The trophic ecology of Myotis emarginatus unveiled by DNA metabarcoding
Abstract
400 p.
Full text
PhD Thesis by Nerea Vallejo López Leioa, Basque Country, 2025 The trophic ecology of Myotis emarginatus unveiled by DNA metabarcoding REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus unveiled by DNA metabarcoding A thesis submitted by Nerea Vallejo López to the University of the Basque Country for the degree of Doctor of Philosophy, under the supervision of Dr Inazio Garin Atorrasagasti. Leioa, Basque Country, 2025 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258 (cc) 2025 Nerea Vallejo López (cc by-nc-sa 4.0)
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Cover photo by Nerea Vallejo López Back cover photo by Joxerra Aihartza REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Familiari, eta Xabiri We must try to see the world through the eyes of other animals -Mark Bekoff REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
vii Table of contents Table of contents ............................................................................................................vii Esker onak - Acknowledgements ............................................................................... xi Laburpena ........................................................................................................................... 1 Resumen .............................................................................................................................. 3 Summary ............................................................................................................................. 6 CHAPTER 1: General introduction ............................................................................. 9 Foraging ecology of insectivorous bats ................................................................... 11 Foraging ecology ......................................................................................................... 11 Foraging ecology of insectivorous bats: evolution and constraints. ...... 11 Diet composition and variability ................................................................................ 13 Spatio-temporal variations in prey availability .............................................. 13 Prey choice and prey partitioning ........................................................................ 14 Insectivorous bats foraging in the Antropocene ................................................. 16 Studying the diet of insectivorous bats ................................................................... 17 Study species: Myotis emarginatus ............................................................................ 20 General description .................................................................................................... 20 Breeding .......................................................................................................................... 21 Hibernation.................................................................................................................... 22 Foraging ecology ......................................................................................................... 22 Spider consumption by insectivorous bats ........................................................... 24 Thesis backgound ............................................................................................................. 25 Aims and structure of the thesis ................................................................................ 27 References ........................................................................................................................... 28 CHAPTER 2: The diet of the notch-eared bat (Myotis emarginatus) across the Iberian Peninsula analysed by amplicon-metabarcoding ...................... 37 Author’s note ...................................................................................................................... 39 Abstract ................................................................................................................................ 39 Keywords ............................................................................................................................. 39 Introduction ........................................................................................................................ 40 Materials and Methods ................................................................................................... 42 Study area ...................................................................................................................... 42 Sample collection ........................................................................................................ 43 Ethics statement .......................................................................................................... 43 DNA extraction, PCR amplification and sequencing ..................................... 44 Sequence analysis and library building ............................................................. 44 Diet description and analysis ................................................................................. 45 Results ................................................................................................................................... 46 Geographical and seasonal variability of the diet .......................................... 46 Consumption of spiders ........................................................................................... 49 Discussion ............................................................................................................................ 52 Conclusions ......................................................................................................................... 56 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
2 da, batez ere nekazaritzako eta abeltzaintzako jardunbideei dagokiola. Laginak bi alditan jaso ziren (2020ko maiatzean eta uztailean). Armiarmak ziren harrapakin nagusiak, eta atzetik abere-izurriak. Azken hauen presentzia handiagoa zen koloniatik hurbil abeltzaintza-jarduerak zituzten eremuetan; hala ere, beste paisaia-aldagai batzuek, hala nola basoek eta eremu urbanizatuek, eragin handiagoa zuten dietaren osaera orokorrean. Oro har, emaitzek M. emarginatusen profil dietetiko koherente bat erakusten dute eremu geografiko zabal batean zehar, eta hegan egiten ez duten harrapakinak “gleaning” bidez atzemateko bere trebetasuna azpimarratzen dute. Amaraun orbikularrak eraikitzen dituzten armiarmak egitura bertikal konplexua duten habitatetan ugariagoak dira, beraz, ingurune horien kontserbazioa funtsezkoa da M. emarginatus espeziearen bazkaleku egokiak mantentzeko. Horrez gain, behien izurri-eulien kontsumo lokal baina ugariak azpimarratzen du nola lurraren erabilerak eta abeltzaintza-kudeaketak tokiantokiko artropodo-komunitateak aldatzen dituztela, eta, hedaduraz, saguzarraren nitxo trofikoa molda ditzaketela baita ere. Stomoxys calcitrans ikerketa-eremuko abere-izurrite nagusi eta kaltegarrienen artean dago, animalien ongizatean duen eragin negatiboa du eta hainbat gaixotasunen bektore gisa jardun dezake. Espezie honen kontrola oraindik ere zaila bada ere, Izurriteen Kudeaketa Integratuko (IKI) estrategiek haien eragin negatiboak kontrolatzen lagun dezakete. IKI estrategiek izurrien kontrolerako teknika kultural, biologikoak eta kimikoak konbinatzen dituzte, intsektiziden erabilera txikitzeko asmoz. Tesi honetan aurkeztutako emaitzek aukera ematen dute M. emarginatus harraparia IKI estrategietan txertatzeko. Horretarako, M. emarginatus eta beste harrapari batzuen gorotzetan S. calcitransen DNA detektatzeko qPCR proba espezifiko bat garatu nuen. Probak %92ko zehaztasuna lortu du, eta S. calcitransen espezie, populazio eta kolonia kontsumitzaileak topatzeko balia daiteke, bai eta harrapakinen kontsumo-maila erlatiboak balioesteko ere. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
3 Resumen La dieta de los murciélagos insectívoros se caracteriza a menudo por una alta diversidad. Sin embargo, lo que realmente consumen está determinado por limitaciones relacionadas con su morfología y el tipo de ecolocalización, la disponibilidad de presas, las interacciones interespecíficas y la toma de decisiones orientada a optimizar el balance energético. Con la llegada del DNA metabarcoding, estudios detallados sobre la composición y variabilidad de la dieta han proporcionado nuevos conocimientos sobre las preferencias tróficas de varias especies. Esta tesis aplica herramientas moleculares de última generación para investigar la ecología trófica del murciélago ratonero pardo, Myotis emarginatus, en el extremo suroccidental de su distribución europea. El capítulo 2 presenta el primer estudio que utiliza técnicas de DNA metabarcoding para analizar la dieta de M. emarginatus. Se muestrearon 106 individuos en cinco colonias de la Península Ibérica. Los resultados revelaron un consumo frecuente de arañas tejedoras de telas orbiculares, principalmente de las familias Araneidae y Tetragnathidae. Asimismo, se observó una elevada proporción de moscas asociadas al ganado, como Stomoxys calcitrans y Musca sp., especialmente en el norte de la Peninsula. Estas presas, probablemente capturadas en reposo, reflejan la capacidad de M. emarginatus para cazar mediante la técnica de "gleaning", en hábitats densamente vegetados o sobre superficies verticales. El capítulo 3 analiza los cambios estacionales en la composición dietética en cinco colonias de cría situadas en el País Vasco. Las muestras fecales se recogieron de forma pasiva a lo largo de toda la temporada reproductiva de 2020, minimizando el impacto sobre los animales. La dieta general fue similar a la descrita en el capítulo anterior, con abundancia de arañas orbiculares y moscas diurnas como Musca sp. y S. calcitrans. No obstante, la dieta varió a lo largo de la temporada: al inicio, predominaban los Dípteros dentro de una dieta REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
4 más diversa, mientras que, hacia el final, aumentó el consumo de Arácnidos y disminuyó la diversidad dietética. El capítulo 4 examina la relación entre la dieta de M. emarginatus y las características del paisaje, con especial atención a las prácticas agrícolas y ganaderas alrededor de dieciséis colonias de cría en la Península Ibérica y el sur de Francia. Se tomaron muestras en dos periodos (mayo y julio de 2020). Una vez más, las arañas fueron las presas más abundantes, seguidas por moscas de interés veterinario. El consumo de estas últimas fue más común en zonas con presencia de ganado, aunque otras variables del paisaje, como la cobertura forestal o las áreas urbanas, tuvieron mayor influencia en la composición general de la dieta. En conjunto, los resultados muestran una dieta consistente para M. emarginatus a lo largo de un amplio rango geográfico y temporal, con una marcada dependencia del "gleaning" para capturar presas inmóviles. Las arañas orbiculares requieren hábitats de gran complejidad vertical, por lo que su conservación resulta clave para mantener zonas de caza adecuadas para M. emarginatus. Además, la asociación con moscas diurnas, especialmente S. calcitrans, sugiere que la gestión del paisaje y del ganado influye en las comunidades locales de artrópodos, configurando así el nicho trófico de esta especie. Stomoxys calcitrans es una de las plagas ganaderas más comunes y perjudiciales del área de estudio, capaz de afectar al bienestar del ganado y actuar como vector de enfermedades. Su control es actualmente complejo, pero la interacción depredadora con M. emarginatus abre la puerta a su inclusión como enemigo natural en programas de Manejo Integrada de Plagas (MIP), que pretende combinar métodos culturales, biológicos y químicos para el control de plagas, con el objetivo de minimzar el uso de pesticidas. Para ello, se desarrolló un ensayo qPCR específico para la detección de ADN de S. calcitrans en heces de M. emarginatus y otros depredadores. El ensayo mostró una precisión superior al 92 % y se presenta como una herramienta eficaz y económica para identificar REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
5 especies, poblaciones o colonias consumidoras, así como para estimar el consumo relativo de esta mosca, e integrar a vertebrados depredadores en estrategias de MIP. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
6 Summary The diet of insectivorous bats is often characterized by a high diversity of prey. However, what a bat actually eats is ultimately shaped by constraints posed by the wing morphology and echolocation, prey availability, interspecific interactions, and decision-making processes aimed at optimizing energy balance. With the advent of DNA metabarcoding, detailed investigations into dietary composition and variability have provided new insights into prey preferences in many insectivorous bat species. This thesis applies cutting-edge molecular tools to explore the trophic ecology of the notch-eared bat, Myotis emarginatus, at the southwestern edge of its European distribution. Chapter 2 presents the first study to use DNA metabarcoding to investigate the diet of M. emarginatus. A total of 106 individuals were sampled from five colonies across the Iberian Peninsula. The results revealed frequent consumption of orb-weaving spiders, primarily from the families Araneidae and Tetragnathidae. Notably, livestock pests such as Stomoxys calcitrans and Musca sp. were consumed in high proportions in two northern colonies. These prey items, likely captured while motionless, highlight the species’ gleaning behaviour. Chapter 3 provides a detailed analysis of seasonal dietary shifts in five maternity colonies located in the Basque Country. Faecal samples were passively collected throughout the entire 2020 maternity season, with minimal disturbance to the bats. The overall diet mirrored findings from Chapter 2, dominated by orb-web building spiders and diurnal pest flies (Musca sp. and S. calcitrans). However, dietary composition varied over time: early-season diets included a broader range of prey orders (with Diptera being most abundant), whereas later in the season, spider consumption increased, and dietary diversity declined. Chapter 4 examines the relationship between diet and landscape features, particularly agricultural practices and livestock farming, around sixteen REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
7 maternity colonies in the Iberian Peninsula and southern France. Samples were collected during two periods (May and July 2020). Again, spiders were the dominant prey, followed by muscid flies. The presence of livestock pests in the diet was higher in areas with nearby livestock operations; however, other landscape variables, such as forest cover and urbanization, had a stronger influence on prey composition overall. Collectively, the results demonstrate a consistent dietary profile for M. emarginatus across a wide geographic range, emphasizing its reliance on gleaning motionless prey. Because orb-web-building spiders thrive in vertically complex habitats, the conservation of such environments is critical for maintaining suitable foraging grounds. Additionally, the strong dietary link to diurnal flies, especially S. calcitrans, underscores how land use and livestock management practices can shape local arthropod communities and, by extension, the bat’s trophic niche. The stable fly S. calcitrans is among the most prevalent and harmful livestock pests in the study region, known for its negative impact on animal welfare and its role as a disease vector. Although control of this species remains challenging, the specific predation by M. emarginatus offers potential for incorporating natural predators into Integrated Pest Management (IPM) strategies. IPM combines cultural, biological and chemical pest control measures with the aim of reducing pesticide use. To support this, I developed a species-specific qPCR assay for detecting S. calcitrans DNA in the faeces of M. emarginatus and other predators. The assay achieved over 92% accuracy, provides a cost-effective tool to survey potential consumer species, populations or colonies, and it is able to estimate the relative levels of prey consumption. This molecular tool enables the identification of predator populations that significantly rely on S. calcitrans and thus are good candidates as biocontrol agents in future IPM programs. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
CHAPTER 1: General introduction REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Foraging ecology of insectivorous bats Foraging ecology All animals need to obtain energy from the environment, which usually means locating, obtaining and consuming food items that suit their abilities to handle food and satisfy metabolic requirements. Foraging encompasses all the aforementioned aspects of behaviour and is fundamental to all animals, influencing their ability to survive and reproduce (Stephens and Krebs, 1986). For many species, foraging can take up significant amounts of their lifetime, and therefore be responsible for a significant portion of their daily energy expenditure. Thus, while foraging, animals need to balance the energy obtained from food with the energy spent obtaining it (McGuire and Boyles, 2024). Decisions made during foraging, such as what, where and when to forage, or when to stop foraging, can influence energy balance and therefore the individuals’ fitness (Stephens, 2008). Foraging ecology of insectivorous bats: evolution and constraints. Maintaining energy balance is especially important for bats because, as the only mammals capable of powered flight, locomotion incurs great energetic costs (McGuire and Boyles, 2024). However, flight has also enabled bats to travel longer distances while foraging and has opened a wide array of foraging niches. On top of that, all extant bat families except for one (Pteropodidae) use echolocation to navigate and forage in a variety of environments during the night (Simmons, 2005). Flight and echolocation were present in ancestral bats which, being able to exploit nocturnal flying insects, underwent rapid diversification during the Eocene (Teeling et al., 2005), resulting in over 1400 extant species, 70% of which are classified as insectivorous (Kunz et al., 2011). Extant insectivorous bats present diverse wing morphologies and echolocation characteristics, which define the foraging niche of the species in question. On the one hand, wing morphology deeply influences flight style and REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 18 species that have harder chitinous appendages or wing scales, like lepidopterans or coleopterans, while small and soft bodied prey cannot be detected at all (Symondson, 2002). The kind of bats that can be studied by this approach is also limited. The lack of taxonomic finesse of visual identification was hindering our capacity to describe predator-prey interactions in depth. However, with the turn of the new millennium technological advancements related to molecular studies have revolutionized dietary studies of wild animals, the most utilized approach being Metabarcoding (deSousa et al., 2019). This approach consists on amplifying a single or few genes present in an environmental sample (e.g.: soil, water, faeces), with the aim to detect as many species present in it. Traditionally, when the aim of the study is to identify arthropods, a region of the cytochrome c oxydase I (COI) gene is targeted, whose sequence is can be used to identify most arthopod species (Hebert et al., 2003). This region is recognized as the universal marker for the identification of animals by the Consortium for the Barcode of Life and is often the only DNA sequence publicly available from a species (Pentinsaari et al., 2016), making it both robust and convenient to use for dietary identification purposes. Given the volume of sequences to be analysed, high-throughput sequencing (HTS) techniques or Next Generation Sequencing (NGS) are employed to process the biological data and produce the desired DNA sequences. As these technologies have developed, the sequencing depth of each run has increased 400-fold in ten years. Now, it is possible to obtain over 20 billion high quality sequences per sequencing run for a relatively cheap price (Han et al., 2024). This means that detectability of rare species is increased, even in samples that have lower DNA yield because of their degradation (Caporaso et al., 2012). The application of molecular techniques has become widespread for the studies of bats (deSousa et al., 2019), and has brought great advancements in the study of bat diets and foraging ecology. Being able to identify dietary composition to the specific level reliably and cost effectively means better REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 19 understanding of food-web structures and predator-prey interactions, which are fundamental in understanding ecosystem functionality (Symondson, 2002). Also, it has allowed to better understand spatio-temporal variations in dietary composition, and fine mechanisms of prey selection and resource partitioning (Clare et al., 2011; Mata et al., 2016; Novella-Fernandez et al., 2020). This has also popularized trait-based dietary analysis, which focuses on the characteristics of the prey consumed instead of their taxonomy. Prey morphology, size and hardness have been used to understand prey partitioning and ontogenic shifts in the diet of horseshoe bats (Aldasoro et al., 2024). Also, source habitats of consumed prey have been used to infer foraging habitat preferences (Alberdi et al., 2012; Andriollo et al., 2021), and also to highlight the dependencies of predators on the source habitats of prey which may not necessarily match foraging grounds (Arrizabalaga-Escudero et al., 2015; Aihartza et al., 2023). DNA metabarcoding is therefore a great solution to study the dietary composition of generalist species and provides the researcher with the number of DNA reads belonging to each prey species. However, due to differential digestion rates of prey, taxonomic biases related to primer annealing, and technical characteristics of the sequencing process (King et al., 2008; Piñol et al., 2018; Shelton et al., 2022), there is debate on the reliability of whether DNA read counts recovered by metabarcoding accurately quantify the prey species consumed by the predator (Elbrecht and Leese, 2015; Lamb et al., 2018). While this is usually not a big problem for general diet descriptions, it can hinder the power of studies aiming to evaluate the impact bats can on pest species populations by consuming them. In these cases, targeted molecular assays have shown potential to detect and quantify the amount of DNA in each sample, while also significantly reducing costs and processing time compared to NGS (Baroja et al., 2021). During first half of the 2010s, molecular techniques expanded the knowledge about the dietary composition and foraging ecology of many bat species. Their REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 20 trophic position as generalist top predators and their role as bioindicators made them excellent species models for applied studies on anthropogenic effects (Russo et al., 2021), and for methodological studies focusing on the application of molecular techniques for ecological studies (Alberdi et al., 2018). However, within the group there are still broad biases in research, as some species and some areas of the world remain understudied (Tawesuub et al., 2022). Study species: Myotis emarginatus General description Figure 1. Images of M. emarginatus. A: Close-up of the face (Photo: J. Aihartza). B: M. emarginatus in flight (Photo: J. Aihartza). C: Picture of a mixed colony of M. emarginatus, above, and R ferrumequinum, below. (Photo: N. Vallejo). REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 21 The notch eared bat (Myotis emarginatus; Fig. 1) belongs to the family Vespertilionidae. It is a medium sized bat (6-15 g), with low to average wing loading and rouned wingips (Fig. 1B). The hair is bright brown or orange in the dorsal area, and duller beige in the ventral area (Fig. 1C). In adult individuals, the snout, ears and wings are dark. The ears are small, with a distinct notch on the outer edge, a characteristic echoed in the species’ scientific and common names (Dietz and Pir, 2021; Fig. 1A). Distribution M. emarginatus is the only European representative of the African clade of the genus Myotis (Ruedi et al., 2013). It is a medium sized bat whose distribution is centred in around the Mediterranean (Frantz et al., 2022); with isolated populations in the western coast of the Mediterranean, Crimea, Caucasus, Central Asia and Saudi Arabia (Piraccini, 2021). The western European populations are all classified under the nominal sub-species M. emarginatus emarginatus (Uvizl and Benda, 2022), which extends from the north of Africa up to 51°N, so that its northernmost distributional limit goes through countries such as the Netherlands, Germany, Luxemburg or Belgium (Frantz et al., 2022). While it can be rare within its distribution, it seems to live in a variety of habitats (Dietz and Pir, 2021; Augusto, 2023), and its distribution is especially patchy in its northernmost limit (Frantz et al., 2022). Breeding The notch-eared bat forms breeding colonies of variable size (20-7000 individuals, Dietz and Pir, 2021) during the summer. They roost in caves and mines in the southern part of its distribution, but often choose artificial structures such as attics, churches, castles, etc., specially in the north (Dietz and Pir, 2021). Breeding colonies are almost exclusively formed by females, and only half of the animals breed in any given year (Spitzenberger and Weiss, 2020). While in the breeding colonies, animals form tight clusters, often with individuals of other species, especially of the genus Rhinolophus (Dietz and Pir, 2021; Fig. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 22 1C), and appear to depend greatly on social thermoregulation for the successful rearing of their pups (Spitzenberger and Weiss, 2021). Males are mostly solitary, but bigger congregations have been recorded at swarming sites. Hibernation The notch-eared bat has the shortest reproductive season (Spitzenberger and Weiss, 2020), and the longest hibernation amongst European bats, following a strong circannual rhythm (Spitzenberger et al., 2024). However, little is known about this part of their biology. In northern Europe they have mostly been found hibernating alone or in small groups in mines, tunnels and rock crevices (Dietz and Pir, 2021). Compared to knowledge about the breeding colonies, hibernation sites and dynamics are less known in western Mediterranean countries, and only a few hibernating individuals have been found (Alcalde and Escala, 2000), so the species “seems to vanish” for nine months until breeding colonies are established again (Quetglas, 2007). Foraging ecology At the time of conception of this thesis, many aspects of its biology, including its foraging ecology had been mostly studied in its northernmost limit, where nursery and hibernation colonies were well known and monitored (Dietz and Pir, 2021). Radiotraking studies had found that the bats commuted usually under 5km to their foraging areas (Dietz et al., 2013), whereas maximum reported distance is over 10km (Dietz et a., 2013). Thef same study reported the bat’s mean home range to be between 438.6 and 694.7 ha (Dietz et al., 2013). The bats were reported to have flexible foraging behaviour, with some studies reporting a preference for native forests (Krull et al., 1991; Zahn et al., 2010; Dekker et al., 2013), while others found preference for agricultural areas and riparian areas (Dietz et al., 2013). Females from numerous colonies would also forage frequently inside of cattle sheds (Krull et al., 1991; Steck and Brinkmann, 2006; Dekker et al., 2013; Dietz et al., 2013). REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 23 This behaviour seems to influence the bat’s dietary composition greatly at northern locations, as the visual inspection of dietary remains has identified a large number of brachyceran flies in the diet, constituting between 50% and 73% of the total volume of the diet (Krull et al., 1991; Steck and Brinkmann, 2006). Some studies even managed to identify species such as Stomoxys calcitrans or Musca autumnalis (Kervyn et al., 2012), which are epiparasites linked to cattle (Gerry and Murillo, 2020). As these flies are strictly diurnal, the key to this foraging behaviour was usually attributed to the bat’s ability to glean prey off surfaces, which fits with the echomorphological characteristics of the species (Norberg and Rayner, 1987; Schumm et al., 1991), although other hunting strategies including aerial hawking have been observed (Schumm et al., 1991). Besides diurnal flies, the remainder of the diet in most of these studies is comprised by Arachnida, Lepidoptera, Hemiptera and Coleoptera. These studies identified the importance of cattle sheds as foraging grounds for the notch-eared bat, and even identified a clear preference for traditional, wooden sheds housing bovine cattle (Dekker et al., 2013). As such, preservation of suitable buildings for foraging is often mentioned as an important conservation measure for these populations of M. emarginatus (Dietz and Pir, 2021). However, studies conducted in other areas of its distribution show a different foraging ecology. In the Iberian Peninsula, the notch-eared bat did not visit cattle sheds for foraging, and instead showed preference for areas with dense vegetation such as scrubland, woodlands and conifer plantations (Flaquer et al., 2008; Goiti et al., 2011). These studies reported similar commuting distances to those found in Central Europe, but Goiti et al. (2001) reports smaller home ranges, between 120 and 371 ha. Using morphological methods, Goiti et al. (2011) identified spiders as the most consumed prey items both in quantity and frequency of occurrence, followed by dipterans and neuropterans. Visual identifications of remains is limited, but some of the spiders identified belong to the orb-web building spider guild (Steck and Brinkmann, 2006; Goiti et al., 2011; Kervyn et al., 2012). REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 24 Spider consumption by insectivorous bats Spiders, as predators, are generally expected to be less abundant in the environment than other arthropods (Pimm, 1988). In addition, they exhibit a wide diversity of hunting strategies and web structures. Similar to bats, spiders can be classified into different ecological guilds; however, in their case, guild classification corresponds more closely with taxonomy. According to the guild classification by Uetz et al. (1999), spiders can be hunters or web-builders. The hunting spiders either roam freely in the ground (e.g. Lycosidae) or in the foliage (e.g. Anyphaenidae), or wait and ambush their prey in a variety of microhabitats (e.g. Salticidae, Thomisidae). Web-building spiders, on the other hand, are classified according to the shape of the web they build to trap their prey. This group includes sheet and funnel web-builders (e.g. Agelenidae), tangle weavers (e.g. Linyphiidae), orb-weavers (e.g. Araneidae, Tetragnathidae) and spaceor cob-web builders (e.g. Theridiidae). Given the functional diversity of this order, spider-hunting bats are faced with the same functional constrains presented above. At the time of the conception of this thesis, an arachnivorous diet had seldom been reported as the primary foraging mode of insectivorous bats, but there were some exceptions. Most notably, the Australian species Kerivoula papuensis (Schulz et al., 2000) and the North American species Myotis keenii (Burles et al., 2008) have been described as spider specialists. The status of the latter as an independent species, however, has been doubted by a recent molecular study, which proposes that it should be included in the species Myotis evotis (Lausen et al., 2019). Dietary studies on M. evotis have identified spider remains in Alberta, Canada (Freq. of occurrence 22%; Maucieri and Barklay, 2021), but it was not as abundant as in the studies performed on M. keenii, in Haida Gwaii Archipelago, in western Canada (Freq. of occurrence 80%; Burles et al., 2008). The European Myotis nattereri has shown similar levels of spider consumption. This forest bat shows great ability to detect and glean prey off surfaces (Siemers and Schnitzler, REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 25 2004), and some studies have reported diets rich in diurnal flies and spiders, strikingly similar to that of M. emarginatus (Andreas et al., 2012; Siemers and Swift, 2006). Other studies, however, have reported much more diverse diets, where other insect groups such as nematoceran flies, lepidopterans or coleopterans are of great importance (Hope et al., 2014; Roswag et al., 2018). Spiders have also been reported in the diet of other gleaning bat species, albeit to a lower extent (e.g.: Andreas et al., 2012; Novella-Fernandez et al., 2020), or linked to conditions of lower availability of flying insects (Hope et al., 2014; Kaupas and Barclay, 2018; Vesterinen et al., 2018). Thesis backgound The basic biology of Myotis emarginatus points out a distinct energy management and allocation throughout the year, compared with other members of the same genus in Europe (Spitzenberger and Weiss, 2020; Spitzenberger et al, 2024). Past studies have also highlighted that, despite adaptability in their choice of foraging grounds (Krull et al., 1991; Flaquer et al., 2008; Dietz et al., 2013), it has a particular dietary composition (Goiti et al., 2011; Kervyn et al., 2012). In fact, both of the main prey types described for this species, cattle pest flies and spiders, are not amongst the most popular dietary items of other European bats (Beck, 1995). Most of the knowledge regarding the foraging ecology of the notch-eared bat comes from colonies in the northern area of its distribution, and the few studies performed in Mediterranean countries show a different foraging behaviour. Also, at the time of conception of the thesis, the diet of the notch-eared bat had only been studied using visual identification of faecal remains, which limits the taxonomical information gathered by the studies and can lead to biases against hard-bodied prey (Pompanon et al., 2012). In this thesis we aim to contribute to the knowledge about the dietary composition and variability of the notch-eared bat by studying it in its core area of the western distributional range (Frantz et al., 2022), and using up-to-date molecular techniques. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 26 The studies presented in this thesis have been conducted in several locations in northern and western Iberian Peninsula and southern France. As the study area encompasses a wide geographic region, local climate in each colony varies from temperate oceanic to Mediterranean. On top of that, the whole studied region is highly modified by anthropogenic development, which has developed differently due to geoclimatic, demographic and cultural aspects. Each colony studied is therefore affected by agriculture, forestry, livestock farming or urbanization in a different way. Next generation sequencing techniques are a great tool to expand the knowledge on the dietary composition and dietary variability of the notch-eared bat for many reasons: i) Species level identification of prey remains would allow for precise description of the dietary composition of the notch-eared bat. The functional characteristics of the most consumed prey can be used to infer important aspects of the foraging ecology of the notch-eared bat in the Iberian Peninsula. ii) Using up-to-date molecular techniques, it is possible to analyse hundreds of samples simultaneously, and to carry out extensive spatio-temporal studies. iii) Using generalist primers, it is possible to identify the prey and the predator DNA simultaneously. Thus, it is possible to passively collect bat droppings even from mixed species colonies without the risk of misidentifying the samples. Compared to obtaining faeces after trapping individual animals, passive sample collection allows for colonies to be repeatedly sampled throughout the breeding season with minimal impact on the animal’s well-being. The notch-eared bat is protected by the EU Habitats directive (Council Direcive 92/43/EEC 1992) and was considered to be “Vulnerable” by the IUCN until 2008 because of declines in population numbers (Piraccini, 2016). Even REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 27 though its global status has improved, the species remains classified as “Vulnerable” in Spain (Quetglas, 2007) and its status has receded to “Endangered” in Portugal (Augusto, 2023). Identification of important prey and feeding grounds is paramount for the adequate conservation of this bat species (Frick et al., 2024). Given the apparent variability in its trophic ecology between geographical areas, expanding the basic knowledge about its feeding habits is the first step to design adequate management plans. Aims and structure of the thesis In summary, the main aim of this thesis is to present an in-depth study on the trophic niche, dietary composition and dietary variability of the notch-eared bat (Myotis emarginatus) in south-western Europe using molecular techniques for species level taxonomic identification. The specific objectives of the thesis are: 1To present the first ever fully specific composition of the diet M. emarginatus in the Iberian Peninsula using DNA metabarcoding, to describe the functional characteristics of the most consumed prey species and relate them to the foraging ecology of Myotis emarginatus. Based on the ecomorphological characteristics of the species, I expect non-volant prey such as spiders to be consumed in abundance. 2To analyse the seasonal variability of the diet of the notch-eared bat in a temperate oceanic area throughout a whole maternity season. I expect the dietary composition to change throughout the breeding season, and respond to changes in resource availability, specially regarding the consumption of diurnal flies. 3To study the relationship between dietary composition and prey choice by the notch-eared bat in relation to the land cover and farming pressure around their colonies. I expect the prevalence of flies in the diet to be related to livestock farming around the colony. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 34 Spitzenberger F, Weiss E (2020). Time keeping in female Myotis emarginatus during reproduction (Chiroptera: Vespertilionidae). Lynx New Series, 51(1):131–145. https://doi.org/10.37520/lynx.2020.010 Spitzenberger F, Weiss E (2021). Energy saving in day-roosting female Myotis emarginatus during reproduction (Chiroptera: Vespertilionidae). Lynx New Series, 52(1):105–117. https://doi.org/10.37520/lynx.2021.008 Starik N, Göttert T, Zeller U (2021). Spatial behavior and habitat use of two sympatric bat species. Animals, 11(12): 3460. https://doi.org/10.3390/ani11123460 Steck CE, Brinkmann R (2006). The trophic niche of the Geoffroy’s bat (Myotis emarginatus) in south-western Germany. Acta Chiropterologica, 8(2):445–450. https://doi.org/10.3161/1733-5329(2006)8[445:ttnotg]2.0.co;2 Stephens DW (2008). Decision ecology: Foraging and the ecology of animal decision making. Cognitive, Affective, & Behavioral Neuroscience, 8(4):475–484. https://doi.org/10.3758/cabn.8.4.475 Stephens DW, Krebs JR (1986). Foraging theory (Vol. 1). Princeton University Press. https://doi.org/10.2307/j.ctvs32s6b Stidsholt L, Hubancheva A, Greif S, Goerlitz HR, Johnson M, Yovel Y, Madsen PT (2023). Echolocating bats prefer a high risk-high gain foraging strategy to increase prey profitability. eLife, 12:e84190. https://doi.org/10.7554/elife.84190 Symondson WOC (2002). Molecular identification of prey in predator diets. Molecular Ecology, 11(4):627–641. https://doi.org/10.1046/j.1365-294x.2002.01471.x Taweesub C, Tanalgo KC, Sritongchuay T, Hughes CA (2022). Understanding global patterns of insectivorous bat dietary research. Barbastella, 14(1):134–144. https://doi.org/10.14709/barbj.14.1.2021.12 Teeling EC, Springer MS, Madsen O, Bates P, O’Brien SJ, Murphy WJ (2005). A molecular phylogeny for bats illuminates biogeography and the fossil record. Science, 307(5709):580– 584. https://doi.org/10.1126/science.1105113 Tiede J, Diepenbruck M, Gadau J, Wemheuer B, Daniel R, Scherber C (2020). Seasonal variation in the diet of the serotine bat (Eptesicus serotinus): A high-resolution analysis using DNA metabarcoding. Basic and Applied Ecology, 49:1–12. https://doi.org/10.1016/j.baae.2020.09.004 Tobisch C, Dege S, Panassiti B, Treffler J, Moning C (2025). Metabarcoding the night sky: Monitoring landscape-scale insect diversity through bat diet. Basic and Applied Ecology, 83:128–135. https://doi.org/10.1016/j.baae.2025.01.012 Uetz GW, Halaj J, Cady AB (1999). Guild structure of spiders in major crops. Journal of Arachnology, 27:270–280. Uhler J, Redlich S, Zhang J, Hothorn T, Tobisch C, Ewald J, Thorn S, Seibold S, Mitesser O, Morinière J, Bozicevic V, Benjamin CS, Englmeier J, Fricke U, Ganuza C, Haensel M, Riebl R, Rojas-Botero S, Rummler T, Uphus L, Schmidt S, Steffan-Dewenter I, Müller J (2021). Relationship of insect biomass and richness with land use along a climate gradient. Nature Communications, 12(1):5946. https://doi.org/10.1038/s41467-021-26181-3 Uvizl M, Benda P (2022). Intraspecific variation of Myotis emarginatus (Chiroptera: Vespertilionidae) inferred from mitochondrial and nuclear genetic markers. Acta Chiropterologica, 23(2):285–300. https://doi.org/10.3161/15081109acc2021.23.2.002 Vesterinen EJ, Puisto AIE, Blomberg AS, Lilley TM (2018). Table for five, please: Dietary partitioning in boreal bats. Ecology and Evolution, 8(22):10914–10937. https://doi.org/10.1002/ece3.4559 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 35 Zahn A, Bauer S, Kriner E, Holzhaider J (2010). Foraging habitats of Myotis emarginatus in Central Europe. European Journal of Wildlife Research, 56(3):395–400. https://doi.org/10.1007/s10344-009-0331-y REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
CHAPTER 2: The diet of the notch-eared bat (Myotis emarginatus) across the Iberian Peninsula analysed by ampliconmetabarcoding The contents of this chapter were published in the following paper: Vallejo N, Aihartza J, Goiti U, ArrizabalagaEscudero A, Flaquer C, Puig X, Aldasoro M, Baroja U, Garin I (2019). The diet of the notch-eared bat (Myotis emarginatus) across the Iberian Peninsula analysed by amplicon metabarcoding. Hystrix 30(1):59–64. https://doi.org/10.4404/hystrix00189-2019 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 39 Author’s note This chapter reproduces work originally performed in 2018 and published in 2019. At the time of the study, PERMANOVA was applied without testing for homogeneity of dispersions (e.g., with betadisper). This represents a methodological limitation, so the results of this analysis should be interpreted with caution. In later chapters, this issue is addressed explicitly. The author believes that this methodological shortcoming does not impact the overall significance of the results, nor the main conclusions reached regarding the dietary description of M. emarginatus. Abstract Myotis emarginatus is one of the few bats known to feed mostly on spiders. In order to study the importance of this type of prey, we analysed the species’ diet in five colonies across the Iberian Peninsula using amplicon metabarcoding in order to describe its composition at the species level and analyse its geographic variability within the peninsula. We identified 138 prey species, belonging to 11 different arthropod orders. Among them, 45 species of spiders were identified, mostly of the orb-web building guild, as consumed by 82 out of 106 studied bats, corresponding to every colony and season sampled. Besides, lepidopterans and dipterans were also consumed in every colony. Among the latter, the stable fly Stomoxys calcitrans was especially important in two of the colonies, showing that M. emarginatus can also opportunistically exploit different resources or foraging grounds, such as cattle sheds, which affects the composition of its diet even at the ordinal level of prey. Keywords Araneae, diet, DNA metabarcoding, Myotis emarginatus, geographical variation. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 40 Introduction Despite their predominantly insectivorous behaviour, most Palearctic bats show a wide variety of trophic strategies. Wing morphology and echolocation characteristics of bats influence the way they interact with the foraging environment, and therefore, the prey they find and consume (Emrich et al., 2014). On top of that, local or seasonal changes in food availability will inevitably affect the final composition of their diet (Kunz et al., 2011). Finally, coexistence with other bat species and the mechanisms driving the specific allocation of resources can also be important factors that shape the trophic niche of bats (Chesson, 2000; Adler et al., 2007; Salsamendi et al., 2012; Viglino et al., 2016; Arrizabalaga-Escudero et al., 2018; Schoeman and Monadjem, 2018). Amongst the primarily insectivorous European bats, Myotis emarginatus is the only one known to feed mostly on spiders (Goiti et al., 2011; Kervyn et al., 2012). Worldwide, a diet based on spiders has only been described in two more bat species: Myotis keenii in North America (Burles et al., 2008), and Kerivoula papuensis in Australia (Schulz, 2000). Spider consumption on these two species is thought to be linked to foraging in cluttered environments and gleaning over immobile prey. Myotis emarginatus shows a similar foraging strategy, favouring cluttered forests or areas of complex vegetation for hunting (Zahn et al., 2010; Goiti et al., 2011; Dekker et al., 2013), but also gleaning flies off the walls of cattlebarns (Krull et al., 1991). The precise mechanism used to catch spiders, however, remains unknown. Spider consumption by M. emarginatus reaches almost 80% of the diet’s bulk in meridional populations (Goiti et al., 2011) and in Central Europe (Bauerová, 1986). However, in some colonies in Central and North-western Europe, a diet rich in cattle-flies has also been reported, linked to foraging inside cattle-barns (Beck, 1995; Kervyn et al., 2012). Even in these circumstances, spider consumption still reaches 25% of the total diet (Kervyn et al., 2012). Further, Kervyn et al. (2012) visually identified seven species of spiders in the faeces of REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 41 M. emarginatus, and Galan et al. (2018) listed 16 spider species in the faeces of ten M. emarginatus individuals through DNA metabarcoding. Apart from M. emarginatus other European bat species also consume spiders although they are seldom the primary food source. For instance, Plecotus auritus and some populations of boreal bats (Razgour et al., 2011; Vesterinen et al., 2018) consume spiders occasionally. Other European bat species, such as Myotis nattereri or Myotis myotis, prey upon spiders as an alternative food resource in times of lower insect abundance or scarcity of preferred prey (Ramos-Pereira et al., 2002; Hope et al., 2014). Nevertheless, spiders do not represent a single functional prey to bats. A variety of functional groups, or guilds, have been identified according to their own hunting behaviour and web structure (Uetz et al., 1999). Non-web building or wandering spiders, for instance, should be detected on and captured directly from the ground or vegetation by gleaning (Hope et al., 2014). Conversely, webbuilding spiders could be captured from their webs by gleaning (Kervyn et al., 2012) or hawking (Goiti et al., 2011). Finally, small spider species capable of “ballooning” might also be captured by aerial hawking (Hope et al., 2014). Hence, the functional availability of a given spider species to bats will depend largely on the guild the prey belongs to. Difficulties to accurately identify arthropod taxa by external morphological traits hamper the listing of the bat’s prey at the species level, which, if overcome, would allow describing the functional characteristics and lifestyle of the spider prey. The recent application of molecular methods to diet studies (Pompanon et al., 2012) enables a more complete representation of the taxonomical and functional diversity of spiders at the species level (Galan et al., 2018). Orb-web building or aerial-web building spiders have been proposed as prey of spider specialist bats (Schulz, 2000; Burles et al., 2008; Goiti et al., 2011), which fits with the species identified in the faeces of M. emarginatus so far (Kervyn et al., 2012; Galan et al., 2018). REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 42 Our main goals were to assess the importance of spiders in the diet of M. emarginatus, as well as their taxonomical and functional diversity, in a large geographical range. In order to do so, we analysed the variability of the dietary composition across five colonies in the Iberian Peninsula. In addition, we analysed seasonal variability in two of the colonies. Previous studies have shown variability in the dietary composition and type of foraging grounds of M. emarginatus across locations (Bauerová, 1986; Goiti et al., 2011; Kervyn et al., 2012), which is common in bats, especially at a broad geographical scale (Clare et al., 2014a; Aizpurua et al., 2018). Therefore, covering a large geographical range is important to reflect the most complete niche breadth (Aizpurua et al., 2018). Materials and Methods Study area Bats were captured in five different locations along the Northern (Colonies N1, N2 and N3) and Eastern coasts (Colonies E1 and E2) of the Iberian Peninsula (Fig. 1), in order to cover a broad geographical range. All the chosen locations are stable breeding colonies for M. emarginatus alone or with other bat species, and were previously known by the research team, to ensure that all sampling could be made in a single night fieldwork, therefore avoiding excessive stress on individuals of any species occupying the same roost. The climate in colonies N2 and N3 is temperate oceanic, due to the proximity to the Atlantic Ocean (AEMET and IMP, 2011, p. 17). N2 is in an area where open pastures for cattle are abundant; while colony N3 is mainly surrounded by conifer plantations. Colony N1, on the other hand, is further from the coast and therefore has a warmer and drier climate, transitional between temperate oceanic and Mediterranean (AEMET and IMP, 2011, p. 17); the area is covered by conifer forests and scrublands. The eastern colonies, E1 and E2, have Mediterranean climate: warm average temperatures with summer droughts REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 43 (AEMET and IMP, 2011, p. 17), where land use consists mostly of open agricultural areas. Conifer forests are also common near E1. Figure 1. Sampling sites. Sample collection Each location was sampled on a single night in summer of 2012, and colonies N2 and N3 in spring as well. Bats were captured entering the roost after the foraging bout using a harp trap (Tuttle, 1974) and kept in individual cloth bags until they defecated (maximum 40 min). Afterwards, the bats’ sex and age were determined, and the animals were immediately released into the roost. Faeces were frozen within 6 hours. A total of 92 bats were captured during the breeding season of 2012: 12 bats in colony N1, 29 bats in colony N2, 28 bats in colony N3, 17 bats in colony E1 and 6 bats in colony E2. Seven additional individuals from both N2 and N3 were sampled in May of 2012. Ethics statement Capture and manipulation of bats were performed according to the guidelines for treatment of animals in research and teaching (Sherwin, 2012), and were approved by the Ethics Committee at the University of the Basque Country (Ref. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 50 species) and ground runners (one species) (Uetz et al., 1999; Roberts, 1995). Altogether, the species identified belonged to 12 families (Table 1). Table 1. Guild classification of identified spider species according to Uetz et al., 1999 and Roberts, 1995. Family Species Guild classification Agelenidae Agelenatea redii Funnel-web builder Eratigena atrica Funnel-web builder Tegenaria domestica Funnel-web builder Tegenaria parietina Funnel-web builder Anyphaenidae Anyphaena accentuata Foliage runner Araneidae Araneus angulatus Vertical Orb-web builder Araneus diadematus Vertical Orb-web builder Araneus sturmi Vertical Orb-web builder Aranues triguttatus Vertical Orb-web builder Araniella cucurbitina Vertical Orb-web builder Argiope bruennichi Vertical Orb-web builder Argiope lobata Vertical Orb-web builder Cyrtophora citricola Horizontal web builder Gibbaranea gibbosa Vertical Orb-web builder Larinioides cornutus Vertical Orb-web builder Larinioides sclopetarius Vertical Orb-web builder Mangora acalypha Vertical Orb-web builder Neoscona subfusca Vertical Orb-web builder Nuctenea umbratica Vertical Orb-web builder Singa nitidula Vertical Orb-web builder Zilla diodia Vertical Orb-web builder Zygiella sp. Vertical Orb-web builder Clubionidae Clubiona brevipes Foliage runner Clubiona comta Foliage runner Eutichuridae Ceiracanthium elegans Foliage runner Gnaphosidae Scotophaeus blackwallii Ground runner Philodromidae Philodromus collinus Stalker/Ambusher Philodromus praedatus Stalker/Ambusher Tetragnathidae Tetragnatha extensa Vertical Orb-web builder Tetragnatha montana Vertical Orb-web builder Tetragnatha nigrita Vertical Orb-web builder Tetragnatha obtusa Vertical Orb-web builder Theridiidae Enoplognatha sp. Space-web builder Episinus maculipes Space-web builder Parasteatoda tepidariorum Space-web builder Platnickina tincta Space-web builder Rhomphaea cf. rostrata Space-web builder Rhompaea nasica Space-web builder Steatoda grossa Space-web builder Theridion melanurum Space-web builder Theridion varians Space-web builder Thomsidae Xysticus lanio Ambusher Uloboridae Hyptiotes flavidus Vertical Orb-web builder REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 51 The hunting strategy of the spiders occurring in the diet of M. emarginatus varied between colonies during the summer (F = 3.982, df = 4, p = 0.034): posthoc comparisons grouped the composition of spider traits in colonies E1 and N1 from colonies N2 and N3 (for all significant pairwise tests: F > 4.065, df = 1, p < 0.035); any pairwise comparison involving E2 was not significant. Orb-web building spiders of the family Araneidae were the most common spider prey in all colonies (Fig. 4): their consumption was highest in colony E2, where all identified spiders belong to this group; followed by N1 and E1, in which orb-web building spiders reached 90.9% and 80% of occurrences respectively. In summer colonies N2 and N3, the incidence of orb-web building spiders was less prominent than elsewhere (POO < 54%), as other spider guilds such as spaceweb builders were consumed in greater numbers (POO > 15%); and in N2 funnelweb builders are 23% of the spiders consumed. Finally, non-web building spiders were also consumed, albeit occasionally, in every colony except E1 and E2 (Fig. 4). We also found significant differences in the traits of spiders consumed in different seasons (F = 3.072, df = 1, p = 0.004), but none of the pairwise post-hoc tests were significant. Nonetheless, the consumption of orb-web building spiders did increase at the spring colonies, as all bats studied consumed them, as opposed to 48.3% of bats in colony N2, and 57.1% in colony N3 during the summer. Figure 4. Per cent of occurrence (POO) of spider guilds identified in the diet from each colony. (H Orb-webs: Horizontal orb-webs; V Orb-webs: Vertical orb-webs). REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 52 Discussion Spiders were the most commonly consumed prey order, being identified in a total of 82 out of 106 bats’ faeces. The frequency of occurrence of spiders in our localities was in the 62.1-100% range. Worldwide, spider remains have been found in 99% of the faeces of K. papuensis analysed in Australia (Schulz, 2000); while in the case of M. keenii in North America, spider consumption was recorded in 80% of the cases (Burles et al., 2008). Therefore, to our knowledge M. emarginatus is the third bat species of its kind described to date. Spiders have also been identified in the faeces of other bat species in North America (Whitaker et al., 1977; Whitaker, 2004; Kellner and Harestad, 2005), and Europe (RamosPereira et al., 2002; Razgour et al., 2011; Hope et al., 2014); though their FOO does not exceed 25%. Overall, the diet of M. emarginatus varied between locations. The differences of arthropod communities might promote the observed variations in the diet between colonies, mainly at the species level, a likely outcome given the generalist predatory character of bats and the intercolonial differences in landscape and climate (Clare et al., 2014a; Viglino et al., 2016: Aizpurua et al., 2018). Besides, while a few taxa —e.g.: A. diadematus, A. angulatus or S. calcitrans— were commonly consumed by many individuals across colonies, less frequent prey comprised most of the dietary list, with 55% of the species being consumed by a single bat individual (Table S2). Thus, differences in the dietary composition were amplified when the prey species level was considered. Colonies N1, E1 and E2 show similar diet at the ordinal level, as spiders and lepidopterans were the main prey. Goiti et al. (2011) described a comparable diet in Central Iberian Peninsula and proposed it as the foraging archetype closest to the bat’s original situation. In both studies, the colonies studied were in areas of warmer, dryer climate of Mediterranean characteristics. Even though M. emarginatus is a bat mostly found along the Mediterranean (Piraccini, 2016), the majority of studies on its foraging ecology have been conducted in its Northernmost distribution range, where it often adopts an opportunistic REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 53 foraging behaviour (Beck, 1995; Zahn et al., 2010; Kervyn et al, 2012; Dekker et al., 2013). This calls attention to the fact that our current view of M. emarginatus’s trophic niche could be highly biased, and further studies across its entire distribution range would help to describe its typical foraging behaviour and preferred prey types. Despite observed specialization on spiders in the three Mediterranean colonies, summer results in colonies N2 and N3 suggest that M. emarginatus shows a certain degree of flexibility and adaptability, which allows it to opportunistically hunt ocassionally available prey and/or exploit different foraging grounds. Thanks to this opportunist facet, M. emarginatus would not be as susceptible to shifts in prey abundance as other strictly specialist predators would be (Maine and Boyles, 2015), which would allow it to successfully adapt to modified environments and anthropogenic landscapes. We found that the diet composition, and richness in the case of colony N2, changed significantly between seasons in colonies N2 and N3. Overall, from spring to summer, consumption of spiders decreased, while that of dipterans increased. On top of that, in colony N3, half the bats studied consumed A. rusticus during summer, but not during the spring. Its relatively high local frequency was probably linked to a seasonal increase in its density in conifer plantations surrounding the colony. Flaquer et al. (2008) also reported that M. emarginatus foraged in pinewood plantations in Mediterranean Iberian Peninsula, even though it seems to avoid such foraging grounds in Central Europe in favour of native, deciduous woodlands (Zahn et al., 2010; Dekker et al., 2013). Summer diet of colony N2, and partly in N3, resemble those described by Beck (1995) and Kervyn et al. (2012): the primary food source are dipterans, followed by spiders. The abundance of flies such as Musca sp. and S. calcitrans in the diet of M. emarginatus has been linked to the use of cattle sheds as foraging grounds, as reported in colonies of Central Europe (Kervyn et al., 2012; Dekker et al., 2013). Cattle are abundant in colony N2 (108 cows/km2, www.bizkaia.eus), and open grasslands and pastures mostly cover the surrounding area. This REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 54 hypothesis is supported by the fact that traces of bovine DNA were identified in the faeces of 30 out of the 47 bats that consumed S. calcitrans in colonies N2 and N3. In this case, the detection of cow DNA would be a result of secondary predation of flies on cow blood (Sheppard et al., 2005; Patra et al., 2018). The presence of S. calcitrans around livestock can cause several negative effects on the cattle, causing reduction of weight and/or milk production, and acting as a vector of disease (reviewed in Patra et al., 2018). In our study, S. calcitrans was the most frequently consumed prey species, as it was identified in 58% of bats in total, and in 82% of bats specifically in the summer colonies N2 and N3. Due to the huge number of insects consumed by an individual per night and their generalist nature, bats have often been mentioned as potential topdown suppressor of agricultural insect pests (Kunz et al., 2011). The high FOO values of S. calcitrans suggest that M. emarginatus could act as a potential suppressor of cattle flies, as well as other insects which, in high densities, cause harm to cattle. Cow sheds can be a convenient source of prey for many bat species throughout the year (Dekker et al., 2013); they provide a more constant source of insects for bats (Zahn et al., 2010), as they are less affected by local weather and temperature drops. Nevertheless, the higher occurrence of stable flies recorded during the summer does not seem to support this hypothesis; instead, an increase in the densities of flying insects, including cattle related flies like S. calcitrans, Musca autumnalis or Muscina stabulans, linked to warmer summer temperatures (LaBreque et al., 1972) is a more likely explanation. Regarding spiders, most species consumed belong to the vertical orb-web building guild, which were especially prominent in colonies N1, E1 and E2. These have also been proposed as the main guild consumed by other spider specialist bats (Schulz, 2000; Burles et al., 2008). M. emarginatus most likely hunts them directly from their webs and could also feed on insects trapped on them. However, the exact mechanism used to detect and catch spiders while in their webs is not clear, as both gleaning (Schulz, 2000; Kervyn et al., 2012) and REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 55 hawking (Goiti et al., 2011) have been proposed as possible strategies. The consumption of other types of prey suggests that M. emarginatus does have the ability to glean. Diurnal flies such as Musca sp. or S. calcitrans could be hunted from cattle-shed walls by gleaning (Krull et al., 1991), and/or stolen from orbwebs where they got trapped; and non-web building spiders such as Anyphaena accentuata, Clubiona comta or Xysticus lanio were likely caught from the surface of the vegetation. The overall abundance of orband space-web building spiders in all colonies indicates that environments of cluttered vegetation, e.g. inside forests, are the most likely foraging grounds of M. emarginatus (Dekker et al., 2013; Flaquer et al., 2008; Zahn et al., 2010). Abundance and diversity of aerial-web building spiders is higher in such areas, as they provide plenty of anchoring points to build their webs (Balfour and Rypstra, 1998). Funnel-web builders, on the other hand, build their webs closer to the ground, and are commonly found inside buildings (Roberts, 1995); therefore, their consumption may be linked to the use of such foraging grounds, especially in colony N2. Gleaning and foraging in cluttered environments are shared characteristics between the other spider specialist bats, and are thought to be important in the development of such dietary specialization (Schulz, 2000; Burles et al., 2008). However, they are not mutually exclusive, as they are also found amongst other bat species. For example, P. auritus, Myotis bechsteinii, M. myotis or M. nattereri, forest species which are known to glean over prey (Norberg and Rayner, 1987; Anderson and Racey, 1991; Arlettaz, 1996; Napal et al., 2013; Swift and Racey, 2002), although they do not depend on spiders as extensively as M. emarginatus (Beck, 1995; Ramos-Pereira et al., 2002; Razgour et al., 2011; Hope et al., 2014). Spiders, being predators, are less abundant than other arthropod taxa (Pimm, 1988), which may explain why very few bat species consume them in great quantities. While such dietary specialization may allow spider eating bats to reduce competition, it is also advantageous when the abundance of other resources, mainly flying insects, is lower due to adverse weather conditions REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 56 (Burles et al., 2009), or during seasons of lower insect abundance. This emphasizes the uniqueness of M. emarginatus and other spider specialist bats regarding dietary choices, and hints at specific adaptations regarding sensorial ecology and behaviour. Conclusions Using molecular techniques, we studied the diet of five colonies of M. emarginatus at two different seasons, and we were able to identify a total of 138 prey species, 45 of which were spiders. These results assure that these preys play an important role in the diet of M. emarginatus and stress its uniqueness amongst European bats. In fact, M. emarginatus seems to focus a great part of its diet on spiders, principally those belonging to the vertical orb-web building guild, which are presumably caught directly from their webs in cluttered environments. The exact mechanisms involved in the detection and obtaining of such prey are not yet understood. This knowledge could potentially provide insights into why they are so available for M. emarginatus, while rarely recorded in the diet of other European forest species. On the other hand, colonies N2 and N3 also showed that M. emarginatus has a certain degree of geographical and seasonal variability, and can opportunistically exploit different resources, which emphasizes the fact that both landscape use and overall resource availability ultimately shape the foraging niche of a bat population. References Adler PB, HilleRisLambert J, Levine JM (2007). A niche for neutrality. Ecology Letters, 10(2):95– 104. https://doi.org/10.1111/j.1461-0248.2006.00996.x Agencia Estatal de Meteorología de España (AEMET), Instituto de Meteorologia de Portugal (IMP) (2011). Atlas climático Ibérico. Temperatura del aire y precipitación (1971-2000). Madrid, Ministerio de Medio Ambiente, Rural y Marino. https://doi.org/10.31978/784-11-002-5 Aizpurua O, Budinski I, Georgiakakis P, Gopalakrishnan S, Ibañez C, Mata V, Rebelo H, Russo D, Szodoray-Páradi F, Zhalyazkova V, Zrnicic V, Gilbert MTP, Alberdi A (2018). Agriculture shapes the trophic niche of a bat preying on multiple pest arthropods across Europe: Evidence from DNA metabarcoding. Molecular Ecology, 27(3):815–825. https://doi.org/10.1111/mec.14474 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 57 Alberdi A, Aizpurua O, Gilbert MTP, Bohmann K (2017). Scrutinizing key steps for reliable metabarcoding of environmental samples. Methods in Ecology and Evolution, 9(1):134–147. https://doi.org/10.1111/2041-210X.12849 Anderson ME, Racey PA (1991). Feeding behaviour of captive brown long-eared bats, Plecotus auritus. Animal Behaviour, 42(3):489–493. https://doi.org/10.1016/S0003-3472(05)80048X Arlettaz R (1996). Foraging behaviour of the gleaning bat Myotis nattereri (Chiroptera, Vespertilionidae) in the Swiss Alps. Mammalia, 60(2):181–186. https://doi.org/10.1515/mamm.1996.60.2.181 Arrizabalaga-Escudero A, Clare E, Salsamendi E, Alberdi A, Garin I, Aihartza J, Goiti U (2018). Assessing niche partitioning of co-occurring sibling bat species by DNA metabarcoding. Molecular Ecology, 27(5):1273–1238. https://doi.org/10.1111/mec.14508 Balfour RA, Rypstra AL (1998). The influence of habitat structure on spider density in a non-till soybean agroecosystem. The Journal of Arachnology, 26(2):221–226. Bauerová Z (1986). Contribution to the trophic bionomics of Myotis emarginatus. Folia Zoologica, 35(4):305–310. Beck A (1995). Fecal analyses of European bat species. Myotis, 32-33:109–119. Bizkaiko Foru Aldundia – Diputación Foral de Bizkaia. Censos Ganaderos. 30/08/2018. Retrieved from http://www.bizkaia.eus/nekazaritza/ganaderia/censos/ Benjamini Y, Hochberg Y (1995). Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B, 57(1):289–300. Burles DW, Brigham RM, Ring RA, Reimchen TE (2008). Diet of two insectivorous bats, Myotis lucifugus and Myotis keenii, in relation to arthropod abundance in a temperate Pacific Northwest rainforest environment. Canadian Journal of Zoology, 86(12):1367–1375. https://doi.org/10.1139/Z08-125 Burles DW, Brigham RM, Ring RA, Reimchen TE (2009). Influence of weather on two insectivorous bats in a temperate Pacific Northwest rainforest. Canadian Journal of Zoology, 87(2):132–138. https://doi.org/10.1139/Z08-146 Chao A, Jost J (2012). Coverage-based rarefaction and extrapolation: standardizing samples by completeness rather than size. Ecology, 93(12):2533–2347. https://doi.org/10.1890/111952.1 Chesson P (2000). Mechanism of maintenance of species diversity. Annual Review of Ecology, Evolution and Systematics, 31:343–366. https://doi.org/10.1146/annurev.ecolsys.31.1.343 Clare EL, Symondson WOC, Broders H, Fabianek F, Fraser EE, MacKenzie A, Boughen A, Hamilton R, Willis CKR, Martinez-Nuñez F, Menzies AK, Norquay KJO, Brigham M, Poissant J, Rintoul J, Barclay RMR, Reimer JP (2014a). The diet of Myotis lucifugus across Canada: assessing foraging quality and diet variability. Molecular Ecology, 23(15):3618–3632. https://doi.org/10.1111/mec.12542 Clare EL, Symondson WOC, Fenton MB (2014b). An inordinate fondness for beetles? Variation in seasonal dietary preferences of night-roosting big brown bats (Eptesicus fuscus). Molecular Ecology, 23(15):3633–3647. https://doi.org/10.1111/mec.12519 Deagle BE, Thomas AC, McInnes JC, Clarke LJ, Vesterinen EJ, Clare EL, Kartzinel TR, Eveson JP (2018). Counting with DNA in metabarcoding studies: How should we convert sequence reads to dietary data? Molecular Ecology, 28(2):391–406. https://doi.org/10.1111/mec.14734 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 58 Dekker JJA, Regelink JR, Jansen EA, Brinkmann B, Limpens HJGA (2013). Habitat use by female Geoffroy’s bat (Myotis emarginatus) at its two northernmost maternity roosts and the implications for their conservation. Lutra, 56(2):111–120. Edgar RC (2010). Search and clustering orders of magnitude faster than BLAST. Bioinformatics, 16(19):2460–2461. https://doi.org/10.1093/bioinformatics/btq461 Edgar RC, Flyvbjerg H (2014). Error filtering, pair assembly and error correction for nextgeneration sequencing reads. Bioinformatics. 31(21): 3476–3482. https://doi.org/10.1093/bioinformatics/btv401 Emrich MA, Clare EL, Symondson WOC, Keonig SE, Fenton MB (2014). Resource partitioning by insectivorous bats in Jamaica. Molecular Ecology, 23(15):3648–3656. https://doi.org/10.1111/mec.12504 Flaquer C, Puig-Montserrat X, Burgas A, Russo D (2008). Habitat selection by Geoffroy’s bats (Myotis emarginatus) in a rural Mediterranean landscape: implications for conservation. Acta Chiropterologica, 10(1):61–67. https://doi.org/10.3161/150811008X331090 Galan M, Pons JB, Tournayre O, Pierre E, Leuchtmann M, Pontier D, Charbonell N (2018). Metabarcoding for the parallel identification of several hundred predators and their prey: Application to bat species diet analysis. Molecular Ecology Resources, 18(3):474–489. https://doi.org/10.1111/1755-0998.12749 Gillet F, Tiouchichine ML, Galan M, Blanc F, Némoz M, Aulagnier S, Michaux JR (2015). A new method to identify the endangered Pyrenean desman (Galemys pyrenaicus) and to study its diet, using next generation sequencing from faeces. Mammalian Biology, 80(6):505–509. https://doi.org/10.1016/mambio.2015.08.002 Goiti U, Aihartza J, Guiu M, Salsamendi E, Almenar D, Napal M, Garin I (2011). Geoffroy’s bat, Myotis emarginatus, preys preferentially on spiders in multistratified dense habitats: a study of foraging bats in the Mediterranean. Folia Zoologica, 60(1):17–24. https://doi.org/10.25225/fozo.v60.i1.a3.2011 Hill MO (1973). Diversity and evenness: a unifying notation and its consequences. Ecology, 54:427–473. https://doi.org/10.2307/1934352 Hope RP, Bohmann K, Gilbert MTP, Zepeda-Mendoza ML, Razgour O, Jones G (2014). Second generation sequencing and morphological faecal analysis reveal unexpected foraging behaviour by Myotis nattereri (Chiroptera, Vespertilionidae) in winter. Frontiers in Zoology, 11(1):39. https://doi.org/10.1186/1742-9994-11-39 Hsieh TC, Ma KH, Chao A (2016). iNEXT: iNterpolation and EXTrapolation for species diversity. R package version 2.0.12 URL: http://chao.stat.nthu.edu.tw/wordpress/software-download/ Kellner AM, Harestad AS (2005). Diets of bats in coastal rainforest on Vancouver Island, British Columbia. Society for Northwestern Vertebrate Biology, 86(2):45–48. Kervyn T, Godin MC, Jocqué R, Grootaert P, Libois R (2012). Web-building spiders and bloodfeeding flies as prey of the notch eared bat (Myotis emarginatus). Belgian Journal of Zoology, 142(1):59–67. https://doi.org/10.26496/bjz.2012.137 Krull D, Schumm A, Metzner W, Neuweiler G (1991). Foraging areas and foraging behavior in the notch-eared bat, Myotis emarginatus (Vespertilionidae). Behavioral Ecology and Sociobiology, 28:247–253. https://doi.org/10.1007/BF00175097 Kunz TH, Braun de Torrez E, Bauer D, Lobova T, Fleming TH (2011). Ecosystem services provided by bats. Annals of the New York Academy of Sciences, 1223(1):1–38. https://doi.org/10.1111/j.1749-6632.2011.06004.x LaBrecque GC, Meifert DW, Weidhass DE (1972). Dynamics of House Fly and Stable Fly populations. The Florida Entomologist, 55(2):101–106. https://doi.org/10.2307/3493346 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 2: Notch-Eared bat’s diet across the Iberian Peninsula. 59 Legendre P, Legendre L (2012). Numerical Ecology. 3rd edition. Elsevier, Amsterdam. Maine JJ, Boyles JG (2015). Land cover influences dietary specialization of insectivorous bats globally. Mammal Research, 60(4):343–351. https://doi.org/10.1007/s13364-015-0243-z Manly BFJ (1997). Randomization, Bootstrap and Monte Carlo Methods in Biology. 3rd Edition. Chapman and Hall, London. Martin M (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet Journal, 17(1):10–12. https://doi.org/10.14806/ej.17.1.200 Martinez-Arbizu P (2019). pairwiseAdonis: Pairwise multilevel comparison using adonis. R package version 0.3 Mata VA, Amorim F, Corley MFV, McCracken GF, Rebelo H, Beja P (2016). Female dietary bias towards large migratory moths in the European free-tailed bat (Tadarida teniotis). Biology Letters, 12(3):20150988. https://doi.org/10.1098/rsbl.2015.0988 Napal M, Garin I, Goiti U, Salsamendi E, Aihartza J (2013). Past deforestation of Mediterranean Europe explains the present distribution of the strict forest dweller Myotis bechsteinii. Forest Ecology and Management, 293:161–170. https://doi.org/10.1016/j.foreco.2012.12.038 Norberg UM, Rayner JMV (1987). Ecological morphology and flight in bats (Mammalia; Chiroptera): wing adaptations, flight performance, foraging strategy and echolocation. Philosophical Transactions of the Royal Society of London. B, Biological Sciences, 316(1179):335–427. https://doi.org/10.1098/rstb.1987.0030 Oksanen J, Guillaume Blanchet F, Friendly M, Kindt R, Legendre P, McGlinn D, Minchin PR, O'Hara RB, Simpson GL, Solymos P, Henry M, Stevens H, Szoecs E, Wagner H (2018). vegan: Community Ecology Package. R package version 2.5-2. https://CRAN.Rproject.org/package=vegan Patra G, Behera P, Das SK, Saikia B, Ghosh S, Biswas P, Kumar A, Alam SS, Kawlni L, Lalnunpuia C, Lalchhandama C, Bacham M, Debbarma A (2018). Stomoxys calcitrans and its importance in livestock: a review. International Journal of Advance Agricultural Research, 6:30–37. Pimm S (1988). Energy Flow and Trophic Structure. Concepts in ecosystem ecology. SpringerVerlag, New York, New York, USA. Piraccini R (2016). Myotis emarginatus. The IUCN Red List of Threatened Species. e.T14129A22051191. https://doi.org/10.2305/iucn.uk.2016-2.rlts.t14129a22051191.en. Accessed on 13 May 2018. Pompanon F, Deagle BE, Symondson WOC, Brown DS, Jarman SN, Taberlet P (2012). Who is eating what: Diet assessment using next generation sequencing. Molecular Ecology, 21(8):1921–1950. https://doi.org/10.1111/j.1365-294X.2011.05403.x R Core Team (2018). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/ Ramos-Pereira MJ, Rebelo H, Rainho A, Palmeirim JM (2002). Prey selection by Myotis myotis (Vespertilionidae) in a Mediterranean region. Acta Chiropterologica, 4(2):189–193. https://doi.org/10.3161/001.004.0207 Razgour O, Clare EL, Zeale MRK, Hanmer J, Schnell IB, Rasmussen M, Gilbert TP, Jones G (2011). High-throughput sequencing offers insight into mechanisms of resource partitioning in cryptic bat species. Ecology and Evolution, 1(4):556–570. https://doi.org/10.1002/ece3.49 Roberts MJ (1995). Spiders of Britain and Northern Europe. London, Harper Collins. Salsamendi E, Garin I, Arostegui I, Goiti U, Aihartza J (2012). What mechanism of niche segregation allows the coexistence of sympatric sibling rhinolophid bats? Frontiers in Zoology, 9(1):30. https://doi.org/10.1186/1742-9994-9-30 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 66 notch-eared bat has previously been studied in the region by Vallejo et al. (2019) and Goiti (unpublished data) and found that both spiders and stable flies were abundant, the latter, especially during the summer months. Based on these results, we expected the diet composition and diversity to vary seasonally and precisely predict that 1) the diet would be more diverse in spring than in summer, 2) the proportion of spiders consumed will be high overall, and 3) the consumption of diurnal flies would be highest during the summer months. A decrease in the dietary diversity during the summer months, and an increase in the proportion of cattle flies consumed would indicate that cattle flies are an essential food source for M. emarginatus in this area, as it focuses on them in times of higher overall resource abundance, while it maintains a more diverse diet in times of lower resource abundance (Emlen, 1966). Materials and Methods Sample collection The five maternity colonies studied are within a 27 km radius (the Basque Country, Southwestern Europe) and all are roosting in artificial constructions. The climate in the region is temperate oceanic, with mild temperatures throughout the year (mean: 14ºC) and abundant precipitation (1200-2000mm). The landscape around all colonies is highly modified by human activity, as pine and eucalyptus plantations are common in the region. Baranbio (BA) – A farm house, where around 100 M. emarginatus share the roost with 40 Rhinolophus ferrumequinum. The colony is surrounded by coniferous and eucalyptus plantations on a 5 km radius, but further away (up to 10 km) broad-leaved forests, pastures, herbaceous crops and scrubland are available. Ereño (ER) – An empty building in an abandoned quarry gives roost to up to 50 M. emarginatus. Around 15 R. ferrumequinum and occasionally some R. euryale are also present. It is surrounded by a diverse landscape composed of REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 67 broad-leaved forests (including evergreen oak forests), pine and eucalyptus plantations, and wetland. Lauro (LA) – Around 20 M. emarginatus roost in an abandoned unfinished two-storey construction. The area is surrounded by agricultural land of various types and a few patches of broadleaved forests, eucalyptus plantations, pastures and scrublands. Mañaria (MA) – A church vault where up to 200 M. emarginatus share the space with R. ferrumequinum. Mostly broad-leaved forests and pine plantations surround the area. Zestoa (ZE) – The biggest colony of M. emarginatus in the region, with more than 500 individuals, sharing the roost with around 100 R. ferrumequinum and 30 Miniopterus schreibersii in an empty building, right next to a river bed. Pastures, meadows, broad-leaved forests and a few pine plantations surround the area. We sampled these five colonies in the year 2020. Bats at ZE arrived the earliest (May 4th, week 19), and left the latest (September 3rd, week 36). On the other hand, bats from LA spent the shortest time in the roost, arriving the latest (May 29th, week 22) and leaving the earliest (August 5th, week 32). We took special care to reduce disturbance to the colonies. Every fortnight, a collector was placed under the bats and faeces were collected after no more than two days to minimize DNA degradation. We collected up to 20 samples of 4-6 pellets each. In the cases where the risk of contamination from the faeces of nontarget bat species was high, we collected up to 40 samples containing one or two pellets each. Sampling was always conducted in even weeks. Exceptionally, four collections were taken in the next week, although they were analysed as if they were collected in the week before: ZE in week 18, ER in week 20, LA in week 28 and BA in week 30. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 68 The number of samples included for each colony and date varied between 8 and 20. In all cases, we aimed to detect approximately 75% of prey items per colony and day (Chao et al., 2014). Sample completeness was estimated using package iNEXT (Hsieh et al., 2020). Only in seven cases did not the estimates reach the intended 75% coverage (Appendix S3.1). Due to budgetary reasons we were not able to rise the sample size. In total, 595 samples were sequenced. One extraction blank was added every 23 samples, and one library blank was included in every MiSeq Run performed. DNA extraction, PCR amplification and sequencing The faeces were weighted, and the DNA was extracted using DNeasy PowerSoil Kit and DNeasy PowerSoil Pro Kit (Qiagen) following manufacturer’s instructions with some modifications. For the amplification process we used primer set FWH1 (Vamos et al., 2017), which targets a 180 bp region of the COI gene. This primer set was chosen because: first, it amplifies a broad range of prey taxa, and also amplifies bat DNA (Tournayre et al., 2020b) which is helpful to detect contamination from non-target bat species in our samples; and second, it is longer than other popular primer sets used in bat dietary studies (e.g. Zeale et al., 2011; Gillet et al., 2015), which reduces the chance to amplify DNA from unwanted sources. Shorter markers can capture greater diversity (Elbrecht et al., 2019; Tournayre et al., 2020b) but are also prone to amplify very degraded and unwanted DNA coming, for example, from secondary predation (Galan et al., 2018). Usually this is not concerning, but given the fact that spiders are expected to be abundant in the diet of M. emarginatus, the probability of detecting DNA from secondary predation increases, and it would hamper its discrimination from positive data. PCR amplification was performed following Tournayre et al. (2020b), with modifications. Libraries were built using Illumina’s Nextera XT kit, and samples were sequenced in Illumina MiSeq. PCR amplification, DNA library construction and sequencing processes were done at the Genomics and Proteomics General Service (SGIker) of the University of the Basque Country (UPV/EHU). REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 69 Details on all laboratory procedures can be found in Appendix S3.2. Sequence analysis and taxonomic assignment Bioinformatic analyses were done using vsearch (Rognes et al., 2016) and Cutadapt (Martin, 2011), following the steps described in Esnaola et al. (2018) with the necessary modifications. Details are explained in Appendix S3.2. The 595 samples (Appendix S3.3) analysed yielded 7851 OTUs (Appendix S3.4) which were assigned to their appropriate taxonomy using the blastn function in BLAST+ (Camacho et al., 2009) to access the GenBank dataset, and Boldigger-cline (Buchner and Leese, 2020) to access the BOLD dataset. Only matches over 98% similarity were considered. The output of both datasets was curated manually and using a custom script so that each OTU was only assigned to a single taxon. Each assigned taxon was classified into one of the following categories: predator, prey, not-in-study-area, environmental-contamination and unassigned. Selection of samples and OTUs Samples were checked for contamination from potential prey species by studying the sample blanks. We found no clear contamination event from species that could be mistaken for prey. Nonetheless, an abundance threshold was applied to remove taxa with low read abundances, so that OTUs with less than 0.5% of reads were removed in each sample. While far from perfect, this method has proven to be quite effective in limiting contamination risk of multiple sources without eliminating too many rare prey taxa (Drake et al., 2022); therefore, the data was interpreted having this decision in mind. We also checked for contamination from co-occurring bat species. Samples were discarded from the analysis if more than 10% of all the reads identified as bat species belonged to others than M. emarginatus. We obtained at least eight to 12 samples eligible for analysis in most situations. Nevertheless, we removed samples from MA in weeks 20, 32 and 34, and of ZE in week 36 groups entirely from the analysis because we did not manage to obtain more than one viable REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 70 sample for the analyses. More information on the selection of samples is given in Appendix S3.2. Description of dietary metrics All data analysis was performed in R version 4.0.4 (R Core Team, 2021). Only those OTUs classified as potential prey were used for the diet analysis. Due to the lack of proven correlation between relative read abundances (RRA) and biomass of prey consumed (Paula et al., 2022), we converted our data to weighted percentages of occurrences (wPOO), a metric based on presence/absence data that provides a good proxy of consumption (Deagle et al., 2018; Cuff et al., 2021). We calculated wPOO values at the prey species, genus, family and order levels. Multivariate analysis of diet variability and homogeneity We explored diet composition and variability at the species, genus, family and order level of prey items. We calculated Bray-Curtis dissimilarities between all samples using function vegdist in package vegan (Oksanen, 2020). We explored relationships between diet composition and Week, Colony as fixed effects, and their interaction through a Permutational Multivariate Analysis of Variance (PERMANOVA; Anderson, 2001), using function adonis2 in package vegan with 9999 permutations. Even though PERMANOVA is semi-parametric, it does assume that the homogeneity of every group is homogeneously dispersed (Anderson & Walsh, 2013). To test this, we calculated distances of samples to the centroid of their respective group in non-Euclidean space using function betadisper in package vegan, with 9999 permutations. We performed the analysis by defining groups of samples by the combination of Week and Colony. In addition, we used the results of these analyses to explore changes in diet variability, that is, beta diversity (Anderson et al., 2006). To avoid the creation of negative eigenvalues in the process, we calculated square root transformed distances, instead of standard ones. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 71 The distances calculated by betadisper were extracted and modeled against factors Week, Colony and their interaction in a conventional linear regression, to explore differences in diet variability. We visualised the marginal effects of each factor in the model and their interaction using package margins (Leeper, 2021). In addition, we represented each group's centroid position calculated by betadisper in a PCoA to analyse underlying patterns in the overall composition of the sample groups and their relationship with each other. Analysis of seasonal diet composition Finally, the effect of sampling date on the diet composition was analysed at the ordinal level using a Multinomial Logit model, which is used to model discrete choices between mutually exclusive alternatives (Croissant, 2017). They have been recently used to model changes in diet composition in bats (Tiede et al., 2020) and they can theoretically define the probability that an alternative — a prey item in our case— is chosen (see Croissant, 2017). To run the model, we collapsed all orders found in less than 15 samples in a new category called “Others”, resulting in six different prey orders. We chose to use R package brms (Bürkner, 2017), which uses Markov chain Monte Carlo (MCMC) algorithms to fit various multilevel models, including multinomial logit models, under a Bayesian framework. We fit the model using order level wPOO as the response, against variable Week as a continuous fixed effect, and Colony as a random effect to account for variation between different colonies. We chose the category “Others” as a baseline for the model. We calculated the estimated probabilities of consumption for each order every week and the marginal effect of the week on the consumption of each order, without the effect of the baseline category. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 72 Results Selection of samples and OTUs. After removing non-eligible samples, 359 samples were left for the diet analysis (Appendix S3.3), which yielded a total of 6314 OTUs, of which only 664 had an abundance higher than 0.5% in any of the samples (Appendix S3.4). Seven OTUs (accounting for 50% of total reads) belonged to the predator, M. emarginatus; 73 (4% of reads) were classified as environmental contamination; 251 (24% of reads) were identified as potential prey items; four belonged to potential prey species that are not found in the study area (0.5% of reads); and the remaining 329 (21% of reads) did not match with any sequence in the databases at least at the 98% identity level. In total, 155 unique prey species and 21 unique genera were identified (Appendix S3.5). In addition, seven genera also had OTUs identified both at the genus and the species level. In these cases, a genus level occurrence was added to the dietary data. All in all, we analysed 183 prey taxa, identified at the genus or species levels, belonging to 92 families and 14 orders. The most frequent prey species was the orb-weaving spider Araneus diadematus. It was identified in 249 samples (Frequency of occurrence (FOO) 69%) and accounted for 42% RRA and 33.9% wPOO. The next two most frequent prey items were Stomoxys calcitrans and Musca domestica, identified in 81 and 68 samples, with 9.8% and 6.6% RRA and 7.8% and 6.7% wPOO, respectively. Most prey items appeared occasionally in faeces: 108 prey species were only identified in a single sample each, 22 were identified in two samples, and 37 in between three and ten samples. Therefore, only 16 species occurred in more than ten samples out of 359 (Table 1). Half of them were orb-web weaving spiders. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 73 Table 1. Prey species that were identified in more than 10 samples, and their global frequency of occurrence (FOO) and weighted percentage of occurrence (wPOO). Order Family Species FOO wPOO Araneae Araneidae Araneus diadematus 249 33.87 Diptera Muscidae Stomoxys calcitrans 81 7.85 Diptera Muscidae Musca domestica 68 6.78 Araneae Araneidae Nuctenea umbratical 67 5.20 Araneae Tetragnathidae Metellina merianae 58 4.66 Araneae Tetragnathidae Metellina sp. 46 3.42 Diptera Limoniidae Limonia nubeculosa 28 1.82 Araneae Araneidae Zygiella sp. 25 1.91 Ephemeroptera Caenidae Caenis luctuosa 22 2.91 Araneae Araneidae Cyclosa conica 21 1.32 Araneae Araneidae Araneus angulatus 20 1.67 Lepidoptera Hepialidae Pharmacis fusconebulosa 18 1.87 Diptera Tipulidae Tipula fulvipennis 16 0.98 Araneae Tetragnathidae Tetragnatha sp. 16 1.49 Araneae Uloboridae Hyptiotes paradoxus 15 0.95 Araneae Araneidae Araneus triguttatus 14 0.78 0.78 Araneae and Diptera were the two most consumed prey orders, accounting for 67% (Weeks 18-20) to 88% (Weeks 34-36) of the total wPOO. During May, the consumption of other orders is noteworthy: Caenis luctuosa (Ephemeroptera) had the highest wPOO (37%) in ZE Week 18; Pharmacis fusconebulosa (Lepidoptera) was also the highest consumed prey item (wPOO: 27%) in BA Week 20; Melolontha melolontha (Coleoptera) was the third most consumed prey item (wPOO 13%) in ER Week 20. Multivariate analysis of diet composition and variability PERMANOVA showed significant difference in diet composition across Week, Colony and the interaction of both factors at all taxonomical levels (p < 0.05; Appendix S3.6). However, dispersion analysis betadisper also showed significant differences in the diet variability of Colonies, Week, and a combination of both factors at all taxonomical levels (p < 0.05; Appendix S3.7). This means that the results of the PERMANOVA could arise from either community composition or dispersion, and should be interpreted with caution. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 74 Figure 1 shows a PCoA representing the centroid position of every group of samples in a non-Euclidean space, as calculated by betadisper. The first two PCoA axes represent 53% of the total variability at the order level, but a lower percentage at other taxonomic levels. The first axis separates groups of samples similarly regardless of the taxonomic level: it separates samples from early season (Weeks 18-24) and the late season (Weeks 30-36). Mid-season samples appear all along the first PCoA axis, closer to early or late season samples depending on Colony (Fig. 1). The second PCoA axis separates certain colonies more and shows different patterns depending on the taxonomical rank used. Figure 1. PCoA ordination of the position of the centroids of groups of samples collected in the same day and Colony, with prey items classified to the a) Order level, b) Family level, c) Genus level and d) Species level. The percent variability explained by each of the axes is indicated in the axis labels. The distances to centroid calculated by betadisper were negatively correlated to Week at all taxonomical levels (Order: F = 62.161, df = 1, p < 0.001; df = 1, Family: F = 86.5237, df = 1, p < 0.001; Genus: F = 90.024, df = 1, p < 0.001; Species: REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 75 F = 71.262, p < 0.001, Fig. 2a), meaning that diet variability decreased as the season progressed. Distances to centroid were also significantly different between colonies at all taxonomical levels (Order: F = 14.864, df = 4, p < 0.001; Family: F = 25.277, df = 4, p < 0.001; Genus: F = 31.367, df = 4, p < 0.001; Species: F = 31.000, df = 4, p < 0.001). Colonies LA and ER had significantly lower average distances to the centroid (Fig. 2b). An interaction between Week and Colony showed that the temporal pattern might vary in different ways across Colonies (Order: F = 5.647, df = 4, p < 0.001; Family: F = 7.429, df = 4, p < 0.001; Genus: F = 11.335, df = 4, p < 0.001; Species: F = 6.967, df = 4, p < 0.001). ER and BA presented a sharper decrease in diet variability as the season progressed (Fig. 2c & 2d), compared to the rest of the colonies (Fig 2e – 2g). Figure 2. Marginal effects of Predicted Average Distance to Centroid (PADG) and 95 % confidence intervals calculated by the linear model of distances to group centroids (at prey species level) against Week, Colony and their interaction. Plot a) shows the marginal effect of Week PADG without the effect of Colony, plot b) shows PADG per colony, without the effect of seasonality, and plots c) to g) show the colony PADG: c) BA, d) ER, e) LA, f) MA, g) ZE. The effects for the models at different taxonomical levels are similar REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 82 around bovine farms and cattle farms (González, 2022). Stomoxys calcitrans is considered a significant pest for livestock and domestic animals. Both sexes are hematophagous, and their bite causes physical distress and injuries to animals, particularly when their abundance increases, and can act as a vector of severe diseases and pathogens (Steck and Brinkmann, 2006; González, 2022; González et al., 2022). Nowadays, no specific control measures are taken against S. calcitrans by farmers, as the basic knowledge about this species is still scarce (González et al., 2022). Besides, both are diurnal flies and remain active only in the warmest hours of the day (González, 2022), so M. emarginatus should glean them directly from surfaces. In Central Europe, radio tracking data has confirmed that M. emarginatus frequently visits cattle sheds at night to forage (Krull et al., 1991; Zahn et al., 2010; Dekker et al., 2013). These structures are key foraging habitats for M. emarginatus, as they provide a reliable food source, especially on colder nights (Dekker et al., 2013). Krull et al. (1991) did not report such a correlation between weather and the use of cattle sheds as foraging grounds, however. Besides M. emarginatus, other bat species that use forests as their foraging areas have occasionally been reported hunting flies inside cattle sheds (Siemers et al., 2012; Ancilloto et al., 2021). Additionally, the activity of open foragers increases around free-ranging cattle (Ancilloto et al., 2021). DNA metabarcoding has allowed us to confirm that the consumption of S. calcitrans by M. emarginatus is frequent in the Basque Country, especially at the beginning of the summer. Therefore, it is very likely that it also forages in cattle farms in the Basque Country. Nonetheless, specific studies are needed to confirm this fact in the area. More research is needed to explore under what conditions bats exploit diurnal flies in cattle farms, especially in the southern area of the distribution of M. emarginatus, further away from the limit of their distribution, where more examples of a spider-dominated diet have been reported (Goiti et al., 2011; Vallejo et al., 2019). On the other hand, DNA metabarcoding does not offer accurate quantitative data (Deagle et al., 2018), so estimating the potential REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 83 of M. emarginatus colonies for biological control is challenging. Methods targeted to identify a single prey species (e.g. Baroja et al., 2021) are an interesting option to overcome some of the pitfalls of DNA metabarcoding in this regard. References Aizpurua O, Budinski I, Georgiakakis P, Gopalakrishnan S, Ibañez C, Mata V, Rebelo H, Russo D, Szodoray-Parádi F, Zhelyazkova V, Zrncic V, Gilbert MTP, Alberdi A (2018). Agriculture shapes the trophic niche of a bat preying on multiple pest arthropods across Europe: Evidence form DNA metabarcoding. Molecular Ecology, 27(3):815-825. https://doi.org/10.1111/mec.14474 Alberdi A, Garin I, Aizpurua O, Aihartza J (2012). The foraging ecology of the Mountain Longeared bat Plecotus macrobullaris revealed with DNA mini-barcodes. PLoS ONE, 7(4):e35692. https://doi.org/10.1371/journal.pone.0035692 Alberdi A, Aizpurua O, Gilbert MTP, Bohmann K (2017). Scrutinizing key steps for reliable metabarcoding of environmental samples. Methods in Ecology and Evolution, 9(1):134–147. https://doi.org/10.1111/2041-210X.12849 Aldasoro M, Garin I, Vallejo N, Baroja U, Arrizabalaga-Escudero A, Goiti U, Aihartza J (2019). Gaining ecological insight on dietary allocation among horseshoe bats through molecular primer combination. PLoS ONE, 14(7):e0220081. https://doi.org/10.1371/journal.pone.0220081 Ancilloto L, Festa F, De Benedetta F, Cosentino F, Pejic B, Russo D (2021). Free-ranging livestock and a diverse landscape structure increase bat foraging in mountainous landscapes. Agroforestry Systems, 95:407–418. https://doi.org/10.1007/s10457-021-00591-0 Anderson MJ (2001). A new method for non-parametric multivariate analysis of variance. Austral Ecology, 26:32–46. https://doi.org/10.1111/j.1442-9993.2001.01070.pp.x Anderson MJ, Ellingsen KE, McArdle BH (2006). Multivariate dispersion as a measure of beta diversity. Ecology Letters, 9:683–693. https://doi.org/10.1111/j.1461-0248.2006.00926.x Anderson MJ, Walsh DCI (2013). PERMANOVA, ANOSIM, and the Mantel test in the face of heterogeneous dispersion: What null hypothesis are you testing? Ecological Monographs, 83(4):557–574. https://doi.org/10.1890/12-2010.1 Andreas M, Reiter A, Benda P (2012a). Dietary composition, resource partitioning and trophic niche overlap in three forest foliage-gleaning bats in Central Europe. Acta Chiropterologica, 14(2):335–345. https://doi.org/10.3163/150811012X661657 Andreas M, Reiter A, Benda P (2012b). Prey selection and seasonal diet changes in the western barbastelle bat (Barbastella barbastellus). Acta Chiropterologica, 14(1):81–92. https://doi.org/10.3161/150811012X654295 Andriollo T, Michaux JR, Ruedi M (2021). Food for everyone: Differential feeding habits of cryptic bat species inferred from DNA metabarcoding. Molecular Ecology, 30(18):4584–4600. https://doi.org/10.1111/mec.16073 Arrizabalaga-Escudero A, Garin I, García-Mudarra JL, Alberdi A, Aihartza J, Goiti U (2015). Trophic requirements beyond foraging habitats: The importance of prey source habitats in bat conservation. Biological Conservation, 191:512–519. https://doi.org/10.1016/j.biocon.2015.07.043 Arrizabalaga-Escudero A, Merckx T, García-Baquero G, Wahlberg N, Aizpurua O, Garin I, Goiti U, Aihartza J (2019). Trait-based functional dietary analysis provides a better insight into the REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 84 foraging ecology of bats. Journal of Animal Ecology, 88(10):1587–1600. https://doi.org/10.1111/1365-2656.13055 Baroja U, Garin I, Aihartza J, Arrizabalaga-Escudero A, Vallejo N, Aldasoro M, Goiti U (2019). Pest consumption in a vineyard system by the lesser horseshoe bat (Rhinolophus hipposideros). PLoS ONE, 14(7):e0219265. https://doi.org/10.1371/journal.pone.0219265 Baroja U, Garin I, Vallejo N, Aihartza J, Rebelo H, Goiti U (2021). Bats actively track and prey on grape pest populations. Ecological Indicators, 126:107718. https://doi.org/10.1016/j.ecolind.2021.107718 Bauerová Z (1986). Contribution to the trophic bionomics of Myotis emarginatus. Folia Zoologica, 35(4):305–310. Beck A (1995). Fecal analyses of European bat species. Myotis, 32-33:109–119. Buchner D, Leese F (2020). BOLDigger – a Python package to identify and organise sequences with the Barcode of Life Data systems. Metabarcoding and Metagenomics, 4:e53535. https://doi.org/10.3897/mbmg.4.53535 Bürkner PC (2017). brms: an R package for bayesian multilevel models using Stan. Journal of Statistical Software, 80(1):1–28. https://doi.org/10.18637/jss.v080.i01 Burles DW, Brigham RM, Ring RA, Reimchen TE (2008). Diet of two insectivorous bats, Myotis lucifugus and Myotis keenii, in relation to arthropod abundance in a temperate Pacific Northwest rainforest environment. Canadian Journal of Zoology, 86(12):1367–1375. https://doi.org/10.1139/Z08-125 Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL (2009). BLAST+: architecture and applications. BMC Bioinformatics, 10:421. https://doi.org/10.1186/14712105-10-421 Chao A, Gotelli NJ, Hsieh TC, Sander EL, Ma KH, Colwell RK, Ellison AM (2014). Rarefaction and extrapolation with Hill numbers: a framework for sampling and estimation in species diversity studies. Ecological Monographs, 84(1):45–67. https://doi.org/10.1890/13-0133.1 Croissant Y (2017). Estimation of Random Utility Models in R: The mlogit Package. Journal of Statistical Software, 95(11):1–41. https://doi.org/10.18637/jss.v095.i11 Cuff JP, Windsor FM, Tercel MPTG, Kitson JJN, Evans DM (2022). Overcoming the pitfalls of merging dietary metabarcoding into ecological networks. Methods in Ecology and Evolution, 13:545–559. https://doi.org/10.1111/2041-210X.13796 Deagle BE, Thomas AC, McInnes JC, Clarke LJ, Vesterinen EJ, Clare EL, Kartzinel TR, Eveson JP (2018). Counting with DNA in metabarcoding studies: How should we convert sequence reads to dietary data? Molecular Ecology, 28(2):391–406. https://doi.org/10.1111/mec.14734 Dekker JJ, Regelink JR, Jansen EA, Brinkmann R, Limpens HJGA (2013). Habitat use by Myotis emarginatus at its two northernmost maternity roosts and the implications for their conservation. Lutra, 56(2):111–120 Dennis P, Skartveit J, Kunaver A, McCracken DI (2015). The response of spider (Araneae) assemblages to structural heterogeneity and prey abundance in sub-montane vegetation modified by conservation grazing. Global Ecology and Conservation, 3:715–728. http://doi.org/10.1016/j.gecco.2015.03.007 Dietz M, Pir JB, Hillen J (2013). Does the survival of greater horseshoe bats and Geoffroy’s bats in Western Europe depend on traditional cultural landscapes? Biodiversity and Conservation, 22:3007–3025. https://doi.org/10.1007/s10531-013-0567-4 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 85 Dietz M, Pir JB (2021). Geoffroy’s Bat Myotis emarginatus (Geoffroy, 1806). In: Russo D (Ed.) Handbook of the Mammals of Europe. Springer Nature, Cham., Switzerland. https://doi.org/10.1007/978-3-319-65038-8_56-1 Divoll TJ, Brown VA, McCracken GF, O’Keefe JM (2022). Prey size is more representative than prey taxa when measuring dietary overlap in sympatric forest bats. Environmental DNA, 4(6):1407–1419. https://doi.org/10.1002/edn3.354 Drake LE, Cuff JP, Young RE, Marchbank A, Chadwick EA, Symondson WOC (2022). An assessment of minimum sequence copy thresholds for identifying and reducing the prevalence of artefacts in dietary metabarcoding data. Methods in Ecology and Evolution, 13(3):694–710. https://doi.org/10.1111/2041-210X.13780 Elbrecht V, Braukmann TWA, Ivanova NV, Prosser SWJ, Hajibabaei M, Wright M, Evgeny VZ, Hebert PDN, Steinke D (2019). Validation of COI metabarcoding primers for terrestrial arthropods. PeerJ 7:e7745. https://doi.org/10.7717/peerj.7745 Emlen JM (1966). The role of time and energy in food preference. The American Naturalist, 100(916):611–617. Emrich MA, Clare EL, Symondson WOC, Koenig SE, Fenton MB (2014). Resource partitioning by insectivorous bats in Jamaica. Molecular Ecology, 23(15):3648–3656. https://doi.org/10.1111/mec.12504 Esnaola A, Arrizabalaga-Escudero A, González-Esteban J, Elosegi A, Aihartza J (2018). Determining diet from faeces: Selection of metabarcoding primers for the insectivore Pyrenean desman (Galemys pyrenaicus). PLoS ONE, 13(12):e0208986. https://doi.org/10.1371/journal.pone.0208986 Faure PA, Barclay RMR (1994). Substrate-gleaning versus aerial-hawking: plasticity in the foraging and echolocation behaviour of the long-eared bat, Myotis evotis. Journal of Comparative Physiology A, 174(5):651–660. https://doi.org/10.1007/BF00217386 Flaquer C, Puig-Montserrat X, Burgas A, Russo D (2008). Habitat selection by Geoffroy’s bats (Myotis emarginatus) in a rural Mediterranean landscape: implications for conservation. Acta Chiropterologica, 10(1):61–67. https://doi.org/10.3161/150811008X331090 Galan M, Pons JB, Tournayre O, Pierre E, Leuchtmann M, Pontier D, Charbonell N (2018). Metabarcoding for the parallel identification of several hundred predators and their prey: Application to bat species diet analysis. Molecular Ecology Resources, 18(3):474–489. https://doi.org/10.1111/1755-0998.12749 Garin I, Aihartza J, Goiti U, Arrizabalaga-Escudero A, Nogueras J, Ibáñez C (2019). Bats from different foraging guilds prey upon the pine processionary moth. PeerJ, 7:e7169. https://doi.org/10.7717/peerj.7169 Gillet F, Tiouchichine ML, Galan M, Blanc F, Némoz M, Aulagnier S, Michaux JR (2015). A new method to identify the endangered Pyrenean desman (Galemys pyrenaicus) and to study its diet, using next generation sequencing from faeces. Mammalian Biology, 80(6):505–509. https://doi.org/10.1016/j.mambio.2015.08.002 Goiti U, Garin I, Almenar D, Salsamendi E, Aihartza J (2008). Foraging by Mediterranean horseshoe bats (Rhinolophus euryale) in relation to prey distribution and edge habitat. Journal of Mammalogy, 89(2):493–502. https://doi.org/10.1644/07-MAMM-A-054R2.1 Goiti U, Aihartza J, Guiu M, Salsamendi E, Almenar D, Napal M, Garin I (2011). Geoffroy’s bat, Myotis emarginatus, preys preferentially on spiders in multistratified dense habitats: A study of foraging bats in the Mediterranean. Folia Zoologica, 60(1):17–24. https://doi.org/10.25225/fozo.v60.i1.a3.2011 González MA (2022). Insectos de importancia Médico-Veterinaria en el Norte de España, pp. 240. Publicación Independiente. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 86 González MA, Bravo-Barriga D, Barrio-Fernández E, Frontera E, Ruiz-Arrondo I (2022). Severe Skin Lesions Caused by Persistent Bites of the Stable Fly Stomoxys calcitrans (Diptera: Muscidae) in a Donkey Sanctuary of Western Spain. Journal of Equine Veterinary Science, 116:104056. https://doi.org/10.1016/j.jevs.2022.104056 Hails CJ (1982). A comparison of tropical and temperate aerial insect abundance. Biotropica, 14(4):310–313. https://doi.org/10.2307/2388092 Hope PR, Bohmann K, Gilbert MTP, Zepeda-Mendoza ML, Razgour O, Jones G (2014). Second generation sequencing and morphological faecal analysis reveal unexpected foraging behaviour by Myotis nattereri (Chiroptera, Vespertilionidae) in winter. Frontiers in Zoology, 11(1):39. https://doi.org/10.1186/1742-9994-11-39 Hsieh TC, Ma KH, Chao A (2020). iNEXT: iNterpolation and EXTrapolation for species diversity. R package version 2.0.20 URL: http://chao.stat.nthu.edu.tw/wordpress/software-download/ Hsieh YL, Linsenmair KE (2012). Seasonal dynamics of arboreal spider diversity in a temperate forest. Ecology and Evolution, 2(4):768–777. https://doi.org/10.1002/ece3.221 Kervyn T, Godin MC, Jocqué R, Grootaert P, Libois R (2012). Web-building spiders and bloodfeeding flies as prey of the notch-eared bat (Myotis emarginatus). Belgian Journal of Zoology, 142(1):59–67. https://doi.org/10.26496/bjz.2012.137 Krull D, Schumm A, Metzner W, Neuweiler G (1991). Foraging areas and foraging behavior in the notcheared bat, Myotis emarginatus (Vespertilionidae). Behavioral Ecology and Sociobiology, 28(3):247–253. https://doi.org/10.1007/BF00175097 Leeper TJ (2021). margins: Marginal Effects for Model Objects. R package version 0.3.26. Littleford-Colquhoun BL, Freeman PT, Sackett VI, Tulloss CV, McGarvey LM, Geremia C, Kartzinel TR (2022). The precautionary principle and dietary DNA metabarcoding: Commonly used abundance thresholds change ecological interpretation. Molecular Ecology, 31(6): 1615– 1626. https://doi.org/10.1111/mec.16352 Martin M (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet Journal, 17(1):10–12. https://doi.org/10.14806/ej.17.1.200 Mata VA, Amorim F, Corley MFV, McCracken GF, Rebelo H, Beja P (2016). Female dietary bias towards large migratory moths in the European free-tailed bat (Tadarida teniotis). Biology Letters, 12(3):20150988. https://doi.org/10.1098/rsbl.2015.0988 Maucieri DG, Barclay RMR (2021). Consumption of spiders by the little brown bat (Myotis lucifugus) and the long-eared myotis (Myotis evotis) in the Rocky Mountains of Alberta, Canadian Journal of Zoology, 99(3):221–226. https://doi.org/10.1139/cjz-2020-0160 Napal M, Garin I, Goiti U, Salsamendi E, Aihartza J (2013). Past deforestation of Mediterranean Europe explains the present distribution of the strict forest dweller Myotis bechsteinii. Forest Ecology and Management, 293:161–170. https://doi.org/10.1016/j.foreco.2012.12.038 Novella-Fernandez R, Ibañez C, Juste J, Clare EL, Doncaster CP, Razgour O (2020). Trophic resource partitioning drives fine-scale coexistence in cryptic bat species. Ecology and Evolution, 10(24):14122–14136. https://doi.org/10.1002/ece3.7004 O’Rourke DR, Mangan MT, Mangan KE, Bokulich NA, MacManes MD, Foster JT (2021). Lord of the Diptera (and moths and a spider): Molecular diet analyses and foraging ecology of Indiana bats in Illinois. Frontiers in Ecology and Evolution, 9:623655. https://doi.org/10.3389/fevo.2021.623655 Oksanen J, Guillaume B, Friendly M, Kindt R, Legendre P, McGlinn D, Minchin PR, O´Hara RB, Simpson GL, Solymos P, Stevens MHH, Szoecs E, Wagner H (2020). vegan: Community Ecology Package. R package version 2.5-7. https://CRAN.R-project.org/package=vegan REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 87 Olive CW (1981). Optimal phenology and body-size of orb-weaving spiders: Foraging constraints. Oecologia, 49:83–87. https://doi.org/10.1007/BF00376902 Patra G, Behera P, Das SK, Saikia B, Ghosh S, Biswas P, Kumar A, Alam SS, Kawlni L, Lalnunpuia C, Lalchhandama C, Bacham M, Debbarma A (2018). Stomoxys calcitrans and its importance in livestock: a review. International Journal of Advance Agricultural Research, 6:30–37. Paula DP, Barros SKA, Pitta RM, Barreto MR, Togawa RC, Andow DA (2022). Metabarcoding versus mapping unassembled shotgun reads for identification of prey consumed by arthropod epigeal predators. GigaScience, 11(1):1–13. https://doi.org/10.1093/gigascience/giac020 Pompanon F, Deagle BE, Symondson WOC, Brown DS, Jarman SN, Taberlet P (2012). Who is eating what: Diet assessment using next generation sequencing. Molecular Ecology, 21(8):1931–1950. https://doi.org/10.1111/j.1365-294X.2011.05403.x Presetnik P, Aulagnier S (2013). The diet of Schreiber’s bent-winged bat, Miniopterus schreibersii (Chiroptera: Miniopteridae), in northeastern Slovenia (Central Europe). Mammalia, 77(3):297–305. https://doi.org/10.1515/mammalia-2012-0033 R Core Team (2021). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/ Ramos-Pereira MJ, Rebelo H, Rainho A, Palmereim JM (2002). Prey selection by Myotis myotis (Vespertilionidae) in a Mediterranean region. Acta Chiropterologica, 4(2):183–193. https://doi.org/10.3161/001.004.0207 Razgour O, Clare EL, Zeale MRK, Hanmer J, Schnell IB, Rasmussen M, Gilbert TP, Jones G (2011). High-throughput sequencing offers insight into mechanisms of resource partitioning in cryptic bat species. Ecology and Evolution, 1(4):556–570. https://doi.org/10.1002/ece3.49 Rognes T, Flouri T, Nichols B, Quince C, Mahé F (2016). VSEARCH: a versatile open source tool for metagenomics. PeerJ, 4:e2584. https://doi.org/10.7717/peerj.2584 Roswag A, Becker NI, Encarnação JA (2018). Isotopic and dietary niches as indicators for resource partitioning in the gleaner bats Myotis bechsteinii, M. nattereri, and Plecotus auritus. Mammalian Biology, 89:62–70. https://doi.org/10.1016/j.mambio.2017.12.006 Rubio GD, Moreno CE (2010). Orb-weaving spider diversity in the Iberá marshlands, Argentina. Neotropical Entomology, 39(4):496–505. https://doi.org/10.1590/S1519566X2010000400006 Salinas-Ramos VB, Ancillotto L, Bosso L, Sanchez-Cordero V, Russo D (2019). Interspecific competition in bats: state of knowledge and research challenges. Mammal Review, 50(1):68– 81. https://doi.org/10.1111/mam.12180 Salsamendi E, Garin I, Arostegui I, Goiti U, Aihartza J (2012). What mechanism of niche segregation allows the coexistence of sympatric sibling rhinolophid bats? Frontiers in Zoology, 9(1):30. https://doi.org/10.1186/1742-9994-9-30 Schulz M (2000). Diet and foraging behavior of the golden-tipped bat, Kerivoula papuensis: A spider specialist? Journal of Mammalogy, 81(4):948–957. https://doi.org/10.1644/15451542(2000)081<0948:DAFBOT>2.0.CO;2 Siemers BM, Swift S (2006). Differences in sensory ecology contribute to resource partitioning in the bats Myotis bechsteinii and Myotis nattereri (Chiroptera: Vespertilionidae). Behavioural Ecology and Sociobiology, 59:373–380. https://doi.org/10.1007/s00265-005-0060-5 Siemers BM, Kriner E, Kaipf I, Simon M, Greif S (2012). Bats eavesdrop on the sound of copulating flies. Current Biology, 22:563–564. https://doi.org/10.1016/j.cub.2012.06.030 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 88 Spitz J, Ridoux V, Brind’Amour A (2014). Let’s go beyond taxonomy in diet description: testing a trait-based approach to prey-predator relationships. Journal of Animal Ecology, 83:1137– 1148. https://doi.org/10.1111/1365-2656.12218 Starik N, Göttert T, Zeller U (2021). Spatial behavior and habitat use of two sympatric bat species. Animals, 11(12):3460. https://doi.org/10.3390/ani11123460. Steck CE, Brinkmann R (2006). The trophic niche of the Geoffroy’s bat (Myotis emarginatus) in south-western Germany. Acta Chiropterologica, 8(2):445–450. https://doi.org/10.3161/1733-5329(2006)8[445:TTNOTG]2.0.CO;2 Taweesub C, Tanalgo KC, Sritongchuay T, Huges AC (2021). Understanding global patterns of insectivorous bat dietary research. Journal of Bat Research & Conservation, 14(1):134–144. https://doi.org/10.14709/BarbJ.14.1.2021.12 Taylor PJ, Grass I, Alberts AJ, Joubert E, Tscharntke T (2018). Economic value of bat predation services – A review and new estimates from macadamia orchards. Ecosystem services, 30:372–381. https://doi.org/10.1016/j.ecoser.2017.11.015 Tiede J, Diepenbruck M, Gadau J, Wemheuer B, Daniel R, Scherber C (2020). Seasonal variation in the diet of the serotine bat (Eptesicus serotinus): A highresolution analysis using DNA metabacoding. Basic and Applied Ecology, 49:1–12. https://doi.org/10.1016/j.baae.2020.09.004 Tournayre O, Leuchtmann M, Galan M, Trillat M, Piry S, Pinaud D, Filippi-Codaccioni O, Pontier D, Charbonnel N (2020a). eDNA metabarcoding reveals a core and secondary diets of the greater horseshoe bat with strong spatio-temporal plasticity. Environmental DNA, 3(1):277–296. https://doi.org/10.1002/edn3.167 Tournayre O, Leuchtmann M, Filippi-Codaccioni O, Trillat M, Piry S, Pontier D, Charbonnel N, Galan M (2020b). In silico and empirical evaluation of twelve metabarcoding primer sets for insectivorous diet analyses. Ecology and Evolution, 10(13):6310–6332. https://doi.org/10.1002/ece3.6362 Vamos EE, Elbrecht V, Leese F (2017). Short COI markers for freshwater macroinvertebrate metabarcoding. Metabarcoding and Metagenomics, 1:e14625. https://doi.org/10.3897/mbmg.1.14625 Valbuena-Lacarra P, Saloña-Bordas MI (2010). Nuevos datos sobre la presencia de Stomoxys calcitrans (Linnaeus, 1758) (Diptera, Muscidae) en explotaciones ganaderas de Vizcaya (País Vasco, Norte de España). Boletín de la Asociación Española de Entomología, 34(1-2):199-205. Vallejo N, Aihartza J, Goiti U, Arrizabalaga-Escudero A, Flaquer C, Puig X, Aldasoro M, Baroja U, Garin I (2019). The diet of the notch-eared bat (Myotis emarginatus) across the Iberian Peninsula analysed by amplicon metabarcoding. Hystrix, 30(1):59–64. https://doi.org/10.4404/hystrix-00189-2019 Ward D, Lublin Y (1992). Temporal and spatial segregation of web-building in a community of orb-weaving spiders. Journal of Arachnology, 20(2):73–87 Whitaker JO Jr (1988). Food habits analysis of insectivorous bats. In: Ecological and behavioral methods for the study of bats (T. H. Kunz, ed.). Smithsonian Institution Press, Washington, D.C, pp 171-189 Wray AK, Peery MZ, Jusino MA, Kochanski JM, Banik MT, Palmer JM, Lindner DL, Gratton C (2021). Predator preferences shape the diets of arthropodivorous bats more than quantitative local prey abundance. Molecular Ecology, 30(3):855–873. https://doi.org/10.1111/mec.15769 Zahn A, Bauer S, Kriner E, Holzhaider J (2010). Foraging habitats of Myotis emarginatus in Central Europe. European Journal of Wildlife Research, 56(3):395–400. https://doi.org/10.1007/s10344-009-0331-y REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 3: Seasonal shift in the diet of M. emarginatus 89 Zeale MR, Butlin RK, Barker GL, Lees DC, Jones G (2011). Taxon-specific PCR for DNA barcoding arthropod prey in bat faeces. Molecular Ecology Resources, 11(2):236–244. https://doi.org/10.1111/j.1755-0998.2010.02920.x REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
CHAPTER 4: DNA metabarcoding reveals the influence of land cover and farming on the dietary composition of a spiderspecialist bat The contents of this chapter were published in the following paper: Vallejo N, Aldasoro M, Olasagasti L, Aihartza J, Garin I (2025). DNA metabarcoding reveals the influence of land cover and farming on the dietary composition of a spider-specialist bat. Metabarcoding and Metagenomics, 9:e144371. https://doi.org/10.3897/mbmg.9.144371 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 98 Landscape characterization To include the maximum potential foraging area of M. emarginatus (Flaquer et al., 2008; Goiti et al., 2011; Dietz et al., 2013;), the landscape around the colonies was characterized in a 10 km radius around the colonies. We used 10m raster maps by ESA WorldCover 2020, based on Sentinel-1 and Sentinel-2 data (Zanaga et al., 2021). We reclassified the land uses as (1) forest, (2) non-forested natural areas, (3) pastures and grassland, (4) croplands, (5) urban areas, (6) water bodies and wetlands, and calculated their cover. Additionally, we calculated the minimum distance from the colony to water bodies (6) and urban areas (5). As linear water bodies that could be used as water sources, like rivers and small streams, are underestimated in raster maps, we corrected the value of minimum distance to land class water bodies and wetlands (6) using the EUHydro layers (European Environment Agency, 20219). Finally, we used official cattle census data from Spain and France (INE, 2020; DRAAF Nouvelle Aquitaine, 2020; DRAAF Occitaine, 2020) to estimate the density of total cows within each 10 km radius around roosts, as well as the mean number of cows per livestock farm. Sample collection, laboratory processing and bioinformatic process. Faecal samples were collected on two different days from each colony in 2020; one at the end of May (spring) and another at the beginning of July (summer). The samples were processed with those presented in Vallejo et al. (2023), following identical methodologies and criteria. For each day and colony sampled, hereon sampling event, we passively collected up to 40 samples each consisting of 2-6 pellets (approximate weight 30-60 mg). DNA from each sample was extracted using DNeasy PowerSoil Kit and DNeasy PowerSoil Pro Kit (Qiagen) following manufacturer’s protocol with some modifications (Appendix S3.2) Each extraction round included 23 samples and one negative extraction control. Following DNA extraction, all samples and extraction blanks were amplified using primer set FWH1, as described by Vamos et al. (2017), to amplify DNA from REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 99 both potential prey items and bats. For the amplification process we used 10 µl of Qiagen multiplex PCR kit, 1 µl forward primer (10 µM), 1 µl reverse primer (10 µM), 7 µl H2O and 1 µl of DNA. Cycling conditions started with 15 min at 95 °C for polymerase activation, followed by 40 cycles of 94 °C (30 s) – 45 °C (45 s) – 72 °C (2 m), and finished with 10 minutes at 72 °C. Amplification products were then purified using magnetic beads. Four individual metagenomic libraries were built following official Illumina protocols (Illumina, 2013), and one control was added per library at this stage. In the first library, two controls were added. During this process, index sequences and Illumina adapters were attached using Nextera XT v2. A different combination of forward and reverse markers was used in each sample to allow their differentiation. Amplification success was checked by migrating the product in an agarose gel before purifying again and pooling all the samples at equal molarities for sequencing. Sequencing was performed in Illumina MiSeq (500 cycle v2 kit), in four separate runs. For this study, we used 505 samples, which were processed together with more M. emarginatus samples included in Vallejo et al. (2023), and one sample belonging to Miniopterus schreibersii, which did not belong to any study. In total, we sequenced 940 biological samples, 39 extraction blanks and five library blanks with no DNA template. Bioinformatic analyses were done with VSEARCH (Rognes et al., 2016) and Cutadapt (Martin, 2011) to process raw sequences, merge paired-end reads, trim the primer sequences and cluster them into operational taxonomic units (OTUs) at the 97% similarity threshold. These were compared to online databases using the blastn function in BLAST+ (Camacho et al., 2009) to access the GenBank dataset, and Boldigger-cline (Buchner and Leese, 2020) to access the BOLD database. We accepted all matches above a 98% identity and an e-value lower than 1e-20, when provided. The results were curated using a custom script in R version 4.4.0 (R Core Team, 2024), followed by a manual curation to ensure a single taxon matched per OTU. We classified all identifications as belonging to the predator, environmental contamination, potential prey species absent from REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 100 the study area, or potential prey species present in the study area. Bioinformatic procedures, and the parameters used in the process are detailed in Appendix S3.2. All subsequent analyses were performed in R version 4.4.0 (R Core Team, 2024), and all visualizations were done using ggplot2 (Wickham, 2016). In order to ensure that all samples used in the analysis belonged to the target species, samples were discarded if more than 10% of all the reads identified as a bat belonged to species other than M. emarginatus. We aimed to detect approximately 75% of the prey items per colony and day (Chao et al., 2014). We estimated the diversity of the samples and their coverage using package iNEXT (Hsieh et al., 2020). In general, calculated measures were acceptable (Appendix S4.2), but in some of the colonies they did not reach the intended 75% coverage (five out of 30) as we could not increase the sample size due to budgetary reasons. On the other hand, extraction and library blanks were examined to account for potential pervasive contamination events regarding prey items but no taxa were removed from the analysis at this point. However, under the presumption that OTUs with low abundances are likely sources of mistakes and contamination events, OTUs with less than 0.5% reads were removed in each sample (Drake et al., 2022). Diet description Only those OTUs classified as potential prey items found in the study area were used for the diet analysis. We converted all relative read abundance values to binary data, and built diet tables at the species, family, and order levels. To make a general description of the diet, we calculated the frequency of occurrence (FOO) and weighted percentage of occurrence (wPOO) values of all dietary items at the species, family and order level as described by Deagle et al. (2019). Additionally, we used six dietary variables to explore their relationship with landscape variables: first order Hill numbers at the species, family and order REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 101 levels, and spider species richness per sampling event, which were calculated using R package hilldiv (Alberdi, 2019); and wPOO values of diurnal flies (as family Muscidae) and spiders (as order Araneae) per sampling event. Statistical analyses We first tested the normality of all our dietary variables with the Shapiro-Wilk test. We applied the arcsine square root transformation to dietary proportion variables to improve their fit (Gotelli and Ellison, 2004). We explored differences in the dietary metrics between the two sampling seasons (spring and summer) using paired t-tests. Then, we explored relationships between the dietary metrics and land cover variables, per sampling season. Before the analysis, we used the square root arcsine transformation on all land cover variables, the log transformation on the number of cattle heads, and the mean number of cattle heads per operation. To explore the ordination of the bat colony association with land cover we performed a PCA. All landscape variables were standardized prior to data analysis to ensure that the scales were comparable. Then, we extracted the first three principal components, which were then related to dietary variables in a multiple regression using function glm of package stats in R (R Core Team, 2024). Finally, we modelled diurnal fly consumption using a two-part or hurdle model, which are commonly employed when the response variable is zeroinflated. This approach assumes that two different biological processes are at play; in our case, one would cause the absence of flies in the diet, and the other would influence their frequency of occurrence (Zuur et al., 2009). The choice of this model was guided by the a priori hypothesis that the presence of cow sheds and cattle could be a prerequisite for the availability and therefore the consumption of flies by M. emarginatus. Accordingly, we implemented a hurdle model using function hurdle in package pscl (Zeileis et al., 2008), specifying (i) the probability of flies being consumed by the colony, modelled as a binary response to the landscape variables, and (ii) the relative importance of flies in REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 102 the diet, modelled as the wPOO values ranging from 1 to 100, and rounded to the nearest integer. To account for over-dispersion, we selected a zero truncated negative binomial distribution. As explanatory variables, we included the raw number of cattle surrounding the colony and transformed and standardized values for the proportion of forested and urban areas. We also included collection season as a factor. We built all possible combinations of models and chose the best one based on AICc values using the dredge function from package MuMIn (Bartoń, 2023). Results Landscape variability in the study area The selected colonies were predominantly surrounded by forests, both native and plantations, as well as grasslands and croplands at varying proportions. In some Mediterranean colonies other types of natural areas, mainly shrublands, were also noticeably present (Fig. 2A). The number of cows at a 10 km radius was also highly variable between the selected colonies, and so was the mean number of cows per farm, reflecting the variability in livestock management between colonies (Fig. 2A). The first three axes of the PCA accounted for 80% of the total variation in the data (Fig. 2B). The first axis explained 51% of the total variability and separated the western and northern colonies, characterized by higher proportions of tree cover and grassland, from those colonies with greater cropland cover, larger areas of other natural habitats and higher numbers of cows per farm, mainly located in the south-eastern part of the study area. This axis also correlated with the natural oceanic-Mediterranean climatic gradient present in the study area. The second axis explained 19% of the variation and was correlated with higher levels of urbanization and greater numbers of cows in a 10 km radius. The third axis, which was not portrayed in the PCA plot, explained 9% of the variation and separated colonies according to their proximity to urban and coastal areas. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 103 Figure 2. A: Bar chart depicting the proportion of land cover types in a 10 km radius around the colony, and an estimation of the number of bovine cattle heads and mean number of cattle heads per operation in the same area. B: PCA of the landscape variables calculated for all the maternity colonies. Selection samples and OTUs. The four MiSeq runs generated over 44 million paired-end reads, and a mean of 44876 reads per sample. In colony CR an unexpectedly high number of Miniopterus schreibersii individuals were found in the roost that year, so collection of samples was impossible in spring, and very challenging in summer. As a result, this colony was removed from further analysis. In colony MA bats moved within the roost during the night, resulting in very few samples belonging to M. emarginatus being collected. The roost in LA was empty in the first week of July (summer), so we used samples from mid-July instead. In total, 8941 OTUs from 505 samples were compared against GenBank and BOLD Systems databases, which comprise the full dataset (Appendix S4.3). As expected, some samples from mixed colonies contained DNA of co-occurring bat species, and as a result, we removed 154 samples from further analysis as per the criteria explained in the previous section (Fig. 3). After excluding non-eligible samples due to external contamination, improper amplification, or sequencing error related to prey items, 320 samples were left for the dietary analysis (Appendix S4.4). REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 104 The selected samples contained a total of 15.3 million raw reads, and a mean of 43729 reads per sample. After processing, 14 million reads were assigned to 7366 OTUs, of which only 825 had a frequency of occurrence exceeding 0.5% in any sample. Ten of them (55% of the total sequence reads) belonged to the predator, M. emarginatus, 103 (5% of reads) were classified as environmental contamination, 318 (24% of reads) were identified as potential prey items, and eight belonged to potential prey species that are not found in the study area (0.4% of reads). The remaining 386 OTUs (15.6% of reads) did not match with any sequence in the reference databases at the 98% identity threshold. Figure 3. Frequency of samples processes in each colony and date. Colour refers to sample quality regarding amount of DNA corresponding to Myotis emarginatus: green > 90%; yellow 75-90%, red < 75%. Only Green samples were chosen for the diet analysis. Diet description A total of 253 prey species belonging to 97 families and 16 orders were identified (Appendix S4.5). Most prey species were only identified in a single sample (147 prey species) or in two samples (40 prey species). Spiders (Araneae) were the most consumed prey order (wPOO = 52%, FOO = 83%). Moreover, spiders exhibited the highest wPOO values in 22 sampling events out of 30 (Fig. 4) and were consumed more in July (Fig. 5). The second-most consumed prey order was Diptera (wPOO = 29%, FOO = 62%). The diet was completed by Coleoptera, Lepidoptera, Hemiptera, Ephemeroptera and Odonata, in decreasing order of wPOO. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 105 Figure 4. Weighted percentage of occurrence (wPOO) values of each of the sampling events at the order level. Figure 5. Weighted percentage of occurrence (wPOO) of prey. The eight species with more than 10% frequency of occurrence overall are displayed in the bottom of the graph and with solid colours. Additionally, those species with wPOO higher than 10% at each sampling event are displayed in the top of the graph with dotted colours. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 106 Eight prey species had a FOO value over 10% (n > 32) (Table 1). These include five species and one genus of orb-web building spiders and two diurnal pest flies associated with livestock farming. Collectively, these eight species comprised 27% to 75% of the diet in any sampling event, as measured by wPOO. Among the spiders, Araneus diadematus was the most consumed (wPOO = 20%, FOO = 56%), particularly in July. House flies (Musca domestica) were the most consumed diurnal fly (wPOO = 11%, FOO = 30%), especially by bats from the Mediterranean colonies. Whereas consumption of stable flies (Stomoxys calcitrans) was greater in more oceanic colonies. Beyond these eight taxa, 14 additional ones were locally noteworthy, contributing to more than 10% wPOO in at least one sampling event (Fig. 5). This category includes several large species like, Argiope bruennichi (Araneae), Sympetrum sanguineum (Odonata), Anoxia villosa (Coleoptera) or Cicada orni (Hemiptera). Table 1. Prey species that were identified in more than 32 samples (FOO %10), and their global frequency of occurrence (FOO) and weighted percentage of occurrence (wPOO). Order Family Species FOO wPOO Araneae Araneidae Araneus diadematus 179 20.15 Diptera Muscidae Musca domestica 95 11.23 Araneae Araneidae Nuctenea umbratical 66 4.97 Araneae Tetragnathidae Metellina merianae 54 4.22 Araneae Araneidae Araneus angulatus 50 4.16 Diptera Muscidae Stomoxys calcitrans 48 5.03 Araneae Araneidae Metellina sp. 42 2.82 Araneae Araneidae Neoscona subfusca 32 0.78 2.31 Seasonal variation Dietary diversity was higher in May at all taxonomical levels (Fig. 6), albeit at the order level the difference was only marginally significant (Species: t = 3.073, df = 14, p = 0.0083; Family: t = 2.854, df = 14, p = 0.0127; Order: t = 2.113, df = 14, p = 0.0529). Spider species richness (t = 2.353, df = 14, p = 0.0338) was also significantly higher in May. However, the proportion of spiders in the diet increased significantly from May to July (t = -2.745, df = 14, p = 0.0158). The wPOO of diurnal flies, counted as species belonging to the family Muscidae, did REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 107 not change significantly between sampling seasons (t = 1.379, df = 14, p = 0.1895) and the exclusion of the colonies where no diurnal fly consumption was detected did not alter the results (t = 1.3959, df = 10, p = 0.193). Figure 6. Seasonal differences between dietary metrics. Lines link observations from the same colony. Significance values of the paired t-test are represented (n.s. = nonsignificant, * = 0.01 < p-value < 0.05, ** = p-value < 0.05). Relationship with landscape Spider richness in both seasons was negatively associated with the first axis of the landscape PCA (May: PC1 = -0.8992, t = -3.091, df = 14, p = 0.0103; July: PC1 = -1.2570, t = -4.422, df = 14, p = 0.0010). In May, the wPOO of diurnal flies was significantly related to the second PC (PC2 = -0.12767, t = -2.551, df = 14, p = 0.0269), whereas in July, the relationship was only marginally significant (PC2 = -0.11894, t = -2.060, df = 14, p = 0.0639). No other dietary metric showed significant associations with the PCA axes. The best hurdle model included the raw number of cows, the percentage of forested area and the percentage of urban area in the negative binomial component, while only the raw number of cows was selected in the binomial section. The probability of consuming diurnal flies increased significantly with more cattle heads near the colony (est = 0.0004, z = 3.198, p = 0.0014). However, once fly consumption occurred, the wPOO value was not related to the number of cattle around the colony (est = 8.647 · 10-5, z = 1.338, p = 0.1808). Instead, the importance of diurnal flies in the diet was significantly shaped by the percentage REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 114 handling in the field and in the laboratory, and rigorous data curation mitigate such risks (Ficetola et al., 2016). Additionally, dietary data from DNA metabarcoding may include false positives, especially for predators like M. emarginatus at high trophic levels (Tercel et al., 2021). In our study, distinguishing secondary predation (DNA of the spider’s prey) from true prey was challenging, prompting the use of strict bioinformatic filters and careful dataset interpretation. A significant limitation of DNA metabarcoding, particularly amplicon metabarcoding, is its lack of reliable quantitative accuracy, even when employing generalist primers (Krehenwinkel et al., 2017). As a result, many authors advise against using retrieved sequence count information, or relative read abundances, for the description of diet composition, in favour of presence/absence data (Elbrecht and Leese, 2015). Metrics derived from occurrence data, such as wPOO, can provide a good summary of dietary composition, but it is unlikely that they would represent the ingested biomass accurately (Deagle et al., 2019). This hampers efforts to assess the predation pressure bats like M. emarginatus exert on specific pest species. More specific methods, such as those described by Baroja et al. (2021), are better suited for this purpose, though none have yet been applied to study predation by M. emarginatus on diurnal pest flies. Conclusions Advancements in high-throughput sequencing and a non-invasive sampling methodology allowed us to perform one of the most extensive dietary studies on a European bat species on an intermediate geographical scale. The main prey items of the notch-eared bat remain consistent over a large geographically extensive and climatically diverse range. Orb-web building spiders are the preferred prey type in the southern half of the western distribution (Goiti et al., 2011; Vallejo et al., 2019, 2023). Yet, their consumption does not depend on landscape features such as the presence of forested areas. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 115 Furthermore, the known habitats of some spider species suggest that natural habitats other than deciduous forests are a good source of prey for this bat in the Mediterranean, so conservation efforts should go beyond the conservation of forested areas. Instead, management for the conservation of M. emarginatus should be focused on broad scale preservation of a variety of native habitat types; resulting in the conservation of their associated arthropod communities. This would ensure availability of orb-web building spiders, as well as other insects that might be hunted opportunistically (Frick et al., 2024). The importance of pest flies for the survival of M. emarginatus should not be underestimated either, especially in northern colonies (Pir and Dietz, 2018; Vescera et al., 2024). Our results show that, when available, bats will take advantage of pest flies, therefore restricting the access of bats to cowsheds will negatively impact pest fly profitability (Dietz and Pir, 2021). If suitable sources of pest flies disappear, our results suggest that M. emarginatus colonies will be most vulnerable if the surrounding natural habitats are also degraded. Despite the rising number of studies on the dietary preferences of the notcheared bat, it is seldom noted as a predator of livestock pest flies beyond the restricted realm of bat studies. In-depth interdisciplinary studies on the efficacy of bats to control pest fly populations along human-induced geographical and environmental gradients are required. This way, integrated pest management strategies in Europe could improve the conservation status of wild bat populations and the welfare of farm animals alike. This bat species is a good research subject candidate to address such questions. References Aizpurua O, Budinski I, Georgiakakis P, Gopalakrishnan S, Ibañez C, Mata V, Rebelo H, Russo D, Szodoray-Parádi F, Zhelyazkova V, Zrncic V, Gilbert MTP, Alberdi A (2018). Agriculture shapes the trophic niche of a bat preying on multiple pest arthropods across Europe: Evidence from DNA metabarcoding. Molecular Ecology, 27(3):815–825. https://doi.org/10.1111/mec.14474 Alberdi A (2019). Hilldiv: An R package for the integral analysis of diversity based on Hill numbers. https://doi.org/10.1101/545665 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 116 Alberdi A, Aizpurua O, Gilbert MTP, Bohmann K (2017). Scrutinizing key steps for reliable metabarcoding of environmental samples. Methods in Ecology and Evolution, 9(1):134-147. https://doi.org/10.1111/2041-210X.12849 Alberdi A, Razgour O, Aizpurua O, Novella-Fernandez R, Aihartza J, Budinski I, Garin I, Ibáñez C, Izagirre E, Rebelo H, Russo D, Vlaschenko A, Zhelyazkova V, Zrnčić V, Gilbert MTP (2020). DNA metabarcoding and spatial modelling link diet diversification with distribution homogeneity in European bats. Nature Communications, 11:1154. https://doi.org/10.1038/s41467-020-14961-2 Ancillotto L, Ariano A, Nardone V, Budinski I, Rydell J, Russo D (2017). Effects of free-ranging cattle and landscape complexity on bat foraging: Implications for bat conservation and livestock management. Agriculture, Ecosystems & Environment, 241:54–61. https://doi.org/10.1016/j.agee.2017.03.001 Andreas M, Reiter A, Benda P (2012). Prey selection and seasonal diet changes in the western barbastelle bat (Barbastella barbastellus). Acta Chiropterologica, 14(1):81–92. https://doi.org/10.3161/150811012X654295 Andriollo T, Michaux JR, Ruedi M (2021). Food for everyone: Differential feeding habits of cryptic bat species inferred from DNA metabarcoding. Molecular Ecology, 30(18):4584–4600. https://doi.org/10.1111/mec.16073 Arrizabalaga-Escudero A, Merckx T, García-Baquero G, Wahlberg N, Aizpurua O, Garin I, Goiti U, Aihartza J (2019). Trait-based functional dietary analysis provides a better insight into the foraging ecology of bats. Journal of Animal Ecology, 88(10):1587–1600. https://doi.org/10.1111/1365-2656.13055 Baroja U, Garin I, Vallejo N, Aihartza J, Rebelo H, Goiti U (2021). Bats actively track and prey on grape pest populations. Ecological Indicators, 126:107718. https://doi.org/10.1016/j.ecolind.2021.107718 Bartoń K (2023). MuMIn: Multi-model inference. Available from: https://CRAN.Rproject.org/package=MuMIn Benda P, Lučan R, Obuch J, Reiter A, Andreas M, Bačkor P, Bohnenstengel T, Eid E, Ševčík M, Vallo P, Amr Z (2010). Bats (Mammalia: Chiroptera) of the Eastern Mediterranean and Middle East. Part 8. Bats of Jordan: fauna, ecology, echolocation, ectoparasites. Acta Societatis Zoologicae Bohemicae, 74:185–353. Boyles JG, Storm JJ (2007). The perils of picky eating: dietary breadth is related to extinction risk in insectivorous bats. PLoS ONE, 2(7):e672. https://doi.org/10.1371/journal.pone.0000672 Buchner D, Leese F (2020). BOLDigger – a Python package to identify and organise sequences with the barcode of life data systems. Metabarcoding and Metagenomics, 4:e53535. https://doi.org/10.3897/mbmg.4.53535 Burles DW, Brigham RM, Ring RA, Reimchen TE (2009). Influence of weather on two insectivorous bats in a temperate Pacific Northwest rainforest. Canadian Journal of Zoology, 87(2):132–138. https://doi.org/10.1139/Z08-146 Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL (2009). BLAST+: Architecture and applications. BMC Bioinformatics, 10:421. https://doi.org/10.1186/14712105-10-421 Clare EL, Barber BR, Sweeney BW, Hebert PDN, Fenton MB (2011). Eating local: influences of habitat on the diet of little brown bats (Myotis lucifugus). Molecular Ecology, 20:1772–1780. https://doi.org/10.1111/j.1365-294X.2011.05040.x Deagle BE, Thomas AC, McInnes JC, Clarke LJ, Vesterinen EJ, Clare EL, Kartzinel TR, Eveson JP (2019). Counting with DNA in metabarcoding studies: How should we convert sequence REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 117 reads to dietary data? Molecular Ecology, 28(2):391–406. https://doi.org/10.1111/mec.14734 Dekker JJA, Regelink JR, Jansen EA, Brinkmann R, Limpens HJGA (2013). Habitat use by female Geoffroy’s bats (Myotis emarginatus) at its two northernmost maternity roosts and the implications for their conservation. Lutra, 56(2):111–120. Dennis P, Skartveit J, Kunaver A, McCracken DI (2015). The response of spider (Araneae) assemblages to structural heterogeneity and prey abundance in sub-montane vegetation modified by conservation grazing. Global Ecology and Conservation, 3:715–728. https://doi.org/10.1016/j.gecco.2015.03.007 Dietz M, Pir JB (2021). Geoffroy’s bat Myotis emarginatus (Geoffroy, 1806). In: Russo D (Ed.) Chiroptera, handbook of the mammals of Europe. Springer International Publishing. https://doi.org/10.1007/978-3-030-44029-9_56 Dietz M, Pir JB, Hillen J (2013). Does the survival of greater horseshoe bats and Geoffroy’s bats in Western Europe depend on traditional cultural landscapes? Biodiversity and Conservation, 22:3007–3025. https://doi.org/10.1007/s10531-013-0567-4 Divoll TJ, Brown VA, McCracken GF, O’Keefe JM (2022). Prey size is more representative than prey taxa when measuring dietary overlap in sympatric forest bats. Environmental DNA, 4(6):1407–1419. https://doi.org/10.1002/edn3.354 DRAAF Nouvelle Aquitaine (2020). Le recensement agricole 2020. Available from: https://draaf.nouvelle-aquitaine.agriculture.gouv.fr/donnees-a2479.html [Accessed on 2023/03/31] DRAAF Occitaine (2020). Le recensement agricole 2020. Available from: https://draaf.occitanie.agriculture.gouv.fr/les-donnees-du-ra2020-a8512.html [Accessed on 2023/03/31] Downs NC, Sanderson LJ (2010). Do bats forage over cattle dung or over cattle? Acta Chiropterologica, 12:349–358. https://doi.org/10.3161/150811010X537936 Drake LE, Cuff JP, Young RE, Marchbank A, Chadwick EA, Symondson WOC (2022). An assessment of minimum sequence copy thresholds for identifying and reducing the prevalence of artefacts in dietary metabarcoding data. Methods in Ecology and Evolution, 13(3):694–710. https://doi.org/10.1111/2041-210X.13780 European Environment Agency (2019). EU-hydro: River Network. Eurostat. Available from: https://doi.org/10.2909/393359a7-7ebd-4a52-80ac-1a18d5f3db9c [Accessed on 2023/03/31] Elbrecht V, Leese F (2015). Can DNA-based ecosystem assessments quantify species abundance? Testing primer bias and biomass-sequence relationships with an innovative metabarcoding protocol. PLoS ONE, 10(7):e0130324. https://doi.org/10.1371/journal.pone.0130324 Elbrecht V, Peinert B, Leese F (2017). Sorting things out: Assessing effects of unequal specimen biomass on DNA metabarcoding. Ecology and Evolution, 7:6918–6926. https://doi.org/10.1002/ece3.3192 Emlen JM (1966). The role of time and energy in food preference. The American Naturalist, 100(916):611–617. https://doi.org/10.1086/282455 INE (2020). Censo agrario 2020. Available from: https://www.ine.es/censoagrario2020/presentacion/index.htm [Accessed on 2023/03/29] Fenton MB (1990). The foraging behaviour and ecology of animal-eating bats. Canadian Journal of Zoology, 68:411–422. https://doi.org/10.1139/z90-061 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 118 Ficetola GF, Taberlet P, Coissac E (2016). How to limit false positives in environmental DNA and metabarcoding? Molecular Ecology Resources, 16:604–607. https://doi.org/10.1111/17550998-12508 Fick SE, Hijmans RJ (2017). WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. International Journal of Climatology, 37:4302–4315. https://doi.org/10.1002/joc.5086 Finn C, Grattarola F, Pincheira-Donoso D (2023). More losers than winners: investigating Anthropocene defaunation through the diversity of population trends. Biological Reviews, 98:1732–1748. https://doi.org/10.1111/brv.12974 Flaquer C, Puig-Montserrat X, Burgas A, Russo D (2008). Habitat selection by Geoffroy’s bats (Myotis emarginatus) in a rural Mediterranean landscape: Implications for conservation. Acta Chiropterologica, 10(1):61–67. https://doi.org/10.3161/150811008X331090 Foley JA, DeFries R, Asner GP, Barford C, Bonan G, Carpenter SR, Chapin FS, Coe MT, Daily GC, Gibbs HK, Helkowski JH, Holloway T, Howard EA, Kucharik CJ, Monfreda C, Patz JA, Prentice IC, Ramankutty N, Snyder PK (2005). Global consequences of land use. Science, 309:570–574. https://doi.org/10.1126/science.1111772 Fonderflick J, Azam C, Brochier C, Cosson E, Quékenborn D (2015). Testing the relevance of using spatial modeling to predict foraging habitat suitability around bat maternity: A case study in Mediterranean landscape. Biological Conservation, 192:120–129. https://doi.org/10.1016/j.biocon.2015.09.012 Forister ML, Pelton EM, Black SH (2019). Declines in insect abundance and diversity: We know enough to act now. Conservation Science and Practice, 1(8):e80. https://doi.org/10.1111/csp2.80 Frantz AC, Viglino A, Wilwert E, Cruz A-P, Wittische J, Weigand AM, Buijk J, Nyssen P, Dekeukeleire D, Dekker JJA, Horsburgh GJ, Schneider S, Lang M, Caniglia R, Galaverni M, Schleimer A, Bücs S-L, Pir JB (2022). Conservation by trans-border cooperation: Population genetic structure and diversity of Geoffroy’s bat (Myotis emarginatus) at its north-western european range edge. Biodiversity and Conservation, 31(3):925–948. https://doi.org/10.1007/s10531-022-02371-3 Frick WF, de Wit LA, Ibarra A, Lear K, O’Mara MT (2024). Conserving bats and their foraging habitats. In: Russo D, Fenton B (Eds) A Natural History of Bat Foraging, pp. 305–325. Academic Press. https://doi.org/10.1016/b978-0-323-91820-6.00002-4 Gerry AC, Murillo AC (2019). Promoting biosecurity through insect management at animal facilities. In: Dewulf J, van Immerseel F (Eds.) Biosecurity in animal production and veterinary medicine: from principles to practice, pp. 243–281. CABI. https://doi.org/10.1079/9781789245684.0243 Goiti U, Aihartza J, Guiu M, Salsamendi E, Almenar D, Napal M, Garin I (2011). Geoffroy’s bat, Myotis emarginatus, preys preferentially on spiders in multistratified dense habitats: A study of foraging bats in the Mediterranean. Folia Zoologica, 60(1):17–24. https://doi.org/10.25225/fozo.v60.i1.a3.2011 González MA, Bravo-Barriga D, Barrop-Fernández E, Frontera E, Ruiz-Arrondo I (2022). Severe Skin Lesions Caused by Persistent Bites of the Stable Fly Stomoxys calcitrans (Diptera: Muscidae) in a Donkey Sanctuary of Western Spain. Journal of Equine Veterinary Science, 116:104056. https://doi.org/10.1016/j.jevs.2022.104056 Gotelli NJ, Ellison AM (2004). A primer of ecological statistics. Sinauer Associates Publishers. Hails CJ (1982). A comparison of tropical and temperate aerial insect abundance. Biotropica, 14(4):310–313. https://doi.org/10.2307/2388092 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 119 Hope PR, Bohmann K, Gilbert MTP, Zepeda-Mendoza ML, Razgour O, Jones G (2014). Second generation sequencing and morphological faecal analysis reveal unexpected foraging behavior by Myotis nattereri (Chiroptera, Vespertilionidae) in winter. Frontiers in Zoology, 11(1):39. https://doi.org/10.1186/1742-9994-11-39 Hsieh YL, Linsenmair KE (2012). Seasonal dynamics of arboreal spider diversity in a temperate forest. Ecology and Evolution, 2(4):768–777. https://doi.org/10.1002/ece3.221 Hykel M, Harabiš F, Dolný A (2017). Diel changes in habitat use by dragonflies: Nocturnal roosting site selection by the threatened dragonfly Sympetrum depressiusculum (Odonata: Libellulidae). Entomological Science, 21:154–163. https://doi.org/10.1111/ens.12292 Illumina (2013). 16S Metagenomic Sequencing Library Preparation (Illumina Technical Note 15044223). http://support.illumina.com/documents/documentation/chemistry_documentation/16s/16 s-metagenomic-library-prep-guide-15044223-b.pdf [Accessed on 2025/02/15] Jones G (1990). Prey selection by the greater horseshoe bat (Rhinolophus ferrumequinum): Optimal foraging by echolocation? Journal of Animal Ecology, 59:587–602. https://doi.org/10.2307/4882 Jung K, Kalko EKV (2010). Where forest meets urbanization: Foraging plasticity of aerial insectivorous bats in an anthropogenically altered environment. Journal of Mammalogy, 91:144–153. https://doi.org/10.1644/08-MAMM-A-313R.1. Kervyn T, Godin M-C, Jocqué R, Grootaert P, Libois R (2012). Web-building spiders and bloodfeeding flies as prey of the notch-eared bat (Myotis emarginatus). Belgian Journal of Zoology, 142(1):59–67. https://doi.org/10.26496/bjz.2012.137 Krehenwinkel H, Wolf M, Lim JY, Rominger AJ, Simison WB, Gillespie RG (2017). Estimating and mitigating amplification bias in qualitative and quantitative arthropod metabarcoding. Scientific Reports, 7:17668. https://doi.org/10.1038/s41598-017-17333-x Krull D, Schumm A, Metzner W, Neuweiler G (1991). Foraging areas and foraging behavior in the notch-eared bat, Myotis emarginatus (Vespertilionidae). Behavioral Ecology and Sociobiology, 28:247–253. https://doi.org/10.1007/BF00175097 Lewanzik D, Voigt CC (2016). Transition from conventional to light-emitting diode street lighting changes activity of urban bats. Journal of Applied Ecology 54:264–271. https://doi.org/10.1111/1365-2664.12758 Lindecke O, Currie SE, Fasel NJ, Fritze M, Kravchenko K, Kruszynski C, Lehnert LS, Röleke M, Voigt-Heucke SL, Voigt CC (2021). Common noctule Nyctalus noctula (Schreber, 1774). In: Russo D (Ed.), Chiroptera, handbook of the mammals of Europe, pp. 463–487. Springer International Publishing. https://doi.org/10.1007/978-3-030-44029-9_63 Maine JJ, Boyles JG (2015). Land cover influences dietary specialization of insectivorous bats globally. Mammal Research, 60(4):343–351. https://doi.org/10.1007/s13364-015-0243-z Martin M (2011). Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet Journal, 17(1):10-12. https://doi.org/10.14806/ej.17.1.200 Mata VA, da Silva LP, Veríssimo J, Horta P, Raposeira H, McCracken GF, Rebelo H, Beja P (2021). Combining DNA metabarcoding and ecological networks to inform conservation biocontrol by small vertebrate predators. Ecological Applications, 31(8):e02457. https://doi.org/10.1002/eap.2457 McGuire LP, Boyles JG (2024). Energetics of foraging bats. In: Russo D, Fenton B (Eds) A Natural History of Bat Foraging, pp. 173–198. Academic Press. https://doi.org/10.1016/B978-0-32391820-6.00012-7 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 120 Naef T, Besnard AL, Lehnen L, Petit EJ, van Schaik J, Puechmaille SJ (2023). How to quantify factors degrading DNA in the environment and predict degradation for effective sampling design. Environmental DNA, 5(3):403–416. https://doi.org/10.1002/edn3.414 Novella-Fernandez R, Ibañez C, Juste J, Clare EL, Doncaster CP, Razgour O (2020). Trophic resource partitioning drives fine-scale coexistence in cryptic bat species. Ecology and Evolution, 10(24):14122–14136. https://doi.org/10.1002/ece3.7004 Novella-Fernandez R, Juste J, Ibáñez C, Rebelo H, Russo D, Alberdi A, Kiefer A, Graham L, Paul H, Doncaster CP, Razgour O (2021). Broad-scale patterns of geographic avoidance between species emerge in the absence of fine-scale mechanisms of coexistence. Diversity and Distributions, 27:1606–1618. https://doi.org/10.1111/ddi.13375 Nyffeler M, Bonte D (2020). Where have all the spiders gone? Observations of a dramatic population density decline in the once very abundant garden spider, Araneus diadematus (Araneae: Araneidae), in the Swiss Midland. Insects, 11(4):248. https://doi.org/10.3390/insects11040248 Park KJ (2015). Mitigating the impacts of agriculture on biodiversity: Bats and their potential role as bioindicators. Mammalian Biology, 80:191–204. https://doi.org/10.1016/j.mambio.2014.10.004 Peel MC, Finlayson BL, McMahon TA (2007). Updated world map of the Köppen-Geiger climate classification. Hydrology and Earth System Sciences, 11:1633–1644. https://doi.org/10.5194/hess-11-1633-2007 Pir JB, Dietz M (2018). Populationshdichte und Lebenstaumnutzung det fledermausermaus (Myotis emarginatus Geoffroy, 1806) an ihrer nördlichen Verbreitungsgrenze in Luxemburg. Bulletin de la Sociéte des naturalists luxembourgeois, 12:107-121. Piraccini R (2016). Myotis emarginatus. The IUCN Red List of Threatened Species. e.T14129A22051191. https://doi.org/10.2305/IUCN.UK.2016-2.RLTS.T14129A22051191.en Puig-Montserrat X, Mas M, Flaquer C, Tuneu-Corral C, López-Baucells A (2021). Benefits of organic olive farming for the conservation of gleaning bats. Agriculture, Ecosystems & Environment, 313:107361. https://doi.org/10.1016/j.agee.2021.107361 R Core Team (2024). R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/ Raupp MJ, Shrewsbury PM, Herms DA (2010). Ecology of herbivorous arthropods in urban landscapes. Annual Review of Entomology, 55:19–38. https://doi.org/10.1146/annurev-ento112408-085351 Razgour O, Ibáñez C, Puechmaille SJ, Juste J (2021). Myotis nattereri Species Complex (M. nattereri, M. crypticus, and M. escalerai). In: Russo D (Ed.), Chiroptera, handbook of the mammals of Europe, pp. 257–285. Springer International Publishing. https://doi.org/10.1007/978-3-030-44029-9_57 Rigal S, Dakos V, Alonso H, Auniņš A, Benkő Z, Brotons L, Chodkiewicz T, Chylarecki P, de Carli E, del Moral JC, Domşa C, Escandell V, Fontaine B, Foppen R, Gregory R, Harris S, Herrando S, Husby M, Ieronymidou C, Jiguet F, Kennedy J, Klvaňová A, Kmecl P, Kuczyński L, Kurlavičius P, Kålås JA, Lehikoinen A, Lindström Å, Lorrillière R, Moshøj C, Nellis R, Noble D, Eskildsen DP, Paquet J-Y, Pélissié M, Pladevall C, Portolou D, Reif J, Schmid H, Seaman B, Szabo ZD, Szép T, Florenzano GT, Teufelbauer N, Trautmann S, van Turnhout C, Vermouzek Z, Vikstrøm T, Voříšek P, Weiserbs A, Devictor V (2023). Farmland practices are driving bird population decline across Europe. Proceedings of the National Academy of Sciences, 120(21):e2216573120. https://doi.org/10.1073/pnas.2216573120 Roberts MJ (1995). Spiders of Britain and Northern Europe. London, Harper Collins. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 4: Land cover influences diet of a specialist bat 121 Rognes T, Flouri T, Nichols B, Quince C, Mahé F (2016). VSEARCH: A versatile open source tool for metagenomics. PeerJ, 4:e2584. https://doi.org/10.7717/peerj.2584 Rydell J, Racey PA (1995). Street lamps and the feeding ecology of insectivorous bats. In: Racey and Swift (Eds.) Ecology, Evolution and Behaviour of Bats: The Proceedings of a Symposium held by the Zoological Society of London and the Mammal Society: London, pp. 291–308. Oxford University Press. https://doi.org/10.1093/oso/9780198549451.003.0019 Sala OE, Chapin SF III, Armesto JJ, Berlow E, Bloomfield J, Dirzo R, Huber-Sanwald E, Huenneke LF, Jackson RB, Kinzig A, Leemans R, Lodge DM, Mooney HA, Oesterheld M, Poff NL, Sykes MT, Walker BH, Walker M, Wall DH (2000). Global biodiversity scenarios for the year 2100. Science, 287(5459):1770–1774. https://doi.org/10.1126/science.287.5459.1770 Sanborn AF, Simões PC, Phillips PK, Quartau JA (2011). Thermoregulation and the influence of body temperature on calling song parameters in Cicada orni (Hemiptera: Cicadidae). European Journal of Entomology, 108:365–369. https://doi.org/10.14411/eje.2011.045 Sánchez-Bayo F, Wyckhuys KAG (2019). Worldwide decline of the entomofauna: A review of its drivers. Biological Conservation, 232:8–27. https://doi.org/10.1016/j.biocon.2019.01.020 Siemers BM, Kriner E, Kaipf I, Simon M, Greif S (2012). Bats eavesdrop on the sound of copulating flies. Current Biology, 22:563–564. https://doi.org/10.1016/j.cub.2012.06.030 Spitzenberger F, Weiss E (2020). Time keeping in female Myotis emarginatus during reproduction (Chiroptera: Vespertilionidae). Lynx new series, 51:131–145. https://doi.org/10.37520/lynx.2020.010 Steck CE, Brinkmann R (2006). The trophic niche of the Geoffroy’s bat (Myotis emarginatus) in south-western Germany. Acta Chiropterologica, 8:445–450. https://doi.org/10.3161/17335329(2006)8[445:TTNOTG]2.0.CO;2 Stidsholt L, Scholz C, Hermanns U, Teige T, Post M, Stapelfeldt B, Reusch C, Voigt CC (2023). Low foraging rates drive large insectivorous bats away from urban areas. Global Change Biology, 30:e17063. https://doi.org/10.1111/gcb.17063 Tercel MPTG, Symondson WOC, Cuff JP (2021). The problem of omnivory: A synthesis on omnivory and DNA metabarcoding. Molecular Ecology, 30:2199-2206. https://doi.org/10.1111/mec.15903 Tiede J, Diepenbruck M, Gadau J, Wemheuer B, Daniel R, Scherber C (2020). Seasonal variation in the diet of the serotine bat (Eptesicus serotinus): A high-resolution analysis using DNA metabarcoding. Basic and Applied Ecology, 49:1–12. https://doi.org/10.1016/j.baae.2020.09.004 Tournayre O, Leuchtmann M, Galan M, Trillat M, Piry S, Pinaud D, Filippi-Codaccioni O, Pontier D, Charbonnel N (2020). eDNA metabarcoding reveals a core and secondary diets of the greater horseshoe bat with strong spatio-temporal plasticity. Environmental DNA, 3(1):277–296. https://doi.org/10.1002/edn3.167 Valbuena-Lacarra P, Saloña-Bordas MI (2010). Nuevos datos sobre la presencia de Stomoxys calcitrans (Linnaeus, 1758) (Diptera, Muscidae) en explotaciones ganaderas de Vizcaya (País Vasco, Norte de España). Boletín de la Asociación Española de Entomología, 34(1-2):199–205. Vallejo N, Aihartza J, Goiti U, Arrizabalaga-Escudero A, Flaquer C, Puig X, Aldasoro M, Baroja U, Garin I (2019). The Diet of the Notch-Eared Bat (Myotis emarginatus) across the Iberian Peninsula analysed by Amplicon Metabarcoding. Hystrix, 30(1):59–64. https://doi.org/10.4404/hystrix-00189-2019 Vallejo N, Aihartza J, Olasagasti L, Aldasoro M, Goiti U, Garin I (2023). Seasonal shift in the diet of the notched-eared bat (Myotis emarginatus) in the Basque Country: from flies to spiders. Mammalian Biology, 103:419–431. https://doi.org/10.1007/s42991-023-00353-8 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 122 Vamos EE, Elbrecht V, Leese F (2017). Short COI markers for freshwater macroinvertebrate metabarcoding. Metabarcoding and Metagenomics 1:e14625. https://doi.org/10.3897/mbmg.1.14625 Vescera C, Van Vyve C, Smits Q, Michaux JR (2024). All-you-can-eat buffet: A spider-specialized bat species (Myotis emarginatus) turns into a pest fly eater around cattle. PLoS ONE, 19:e0302028. https://doi.org/10.1371/journal.pone.0302028 Wickham H (2016). ggplot2: Elegant graphics for data analysis. Available from: https://ggplot2.tidyverse.org. Wickramasinghe LP, Harris S, Jones G, Vaughan Jennings N (2004). Abundance and species richness of nocturnal insects on organic and conventional farms: Effects of agricultural intensification on bat foraging. Conservation Biology, 18:1283–1292. https://doi.org/10.1111/j.1523-1739.2004.00152.x Wray AK, Peery MZ, Jusino MA, Kochanski JM, Banik MT, Palmer JM, Lindner DL, Gratton C (2020). Predator preferences shape the diets of arthropodivorous bats more than quantitative local prey abundance. Molecular Ecology, 30(3):855–873. https://doi.org/10.1111/mec.15769 Wong BBM, Candolin U (2015). Behavioral responses to changing environments. Behavioral Ecology, 26:665–673. https://doi.org/10.1093/beheco/aru183 Zahn A, Bauer S, Kriner E, Holzhaider J (2010). Foraging habitats of Myotis emarginatus in Central Europe. European Journal of Wildlife Research, 56(3):395–400. https://doi.org/10.1007/s10344-009-0331-y Zahn A, Rainho A, Kiefer A (2021). Greater mouse-eared bat Myotis myotis (Borkhausen, 1797). In: Russo D (Ed.), Chiroptera, handbook of the mammals of Europe. Springer International Publishing, pp. 287–320. https://doi.org/10.1007/978-3-030-44029-9_59 Zanaga D, Van De Kerchove R, De Keersmaecker W, Souverijns N, Brockmann C, Quast R, Wevers J, Grosu A, Paccini A, Vergnaud S, Cartus O, Santoro M, Fritz S, Georgieva I, Lesiv M, Carter S, Herold M, Li L, Tsendbazar N-E, Ramoino F, Arino O (2021). ESA WorldCover 10 m 2020 v100. https://doi.org/10.5281/ZENODO.5571936 Zeleis A, Kleiber C, Jackman S (2008). Regression models for count data in R. Journal of Statistical Software, 27(8):1–25. https://doi.org/10.18637/jss.v027.i08 Zuur AF, Ieno EN, Walker N, Saveliev AA, Smith GM (2009). Mixed effects models and extensions in ecology with R. Springer, New York. https://doi.org/10.1007/978-0-387-87458-6 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
CHAPTER 5: Analysis of a livestock pest fly predation through real-time qPCR: Applications for Integrated Pest Management REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 130 The amplified DNA was migrated in a 1.5% agarose gel to confirm amplification. Amplification products were cleaned with ExoSAP-IT (Applied Biosystems, USA) and sequenced by an ABI3730XL sequencer (ThermoFisher, USA). I processed the resulting sequences with Geneious (version 2022.2). Forward and reverse pairs were checked for errors and assembled, and the sequences were identified by comparing them against the GenBank Nucleotide database using the BLASTn tool. I only regarded identifications as valid if the identity value was over 98%. Primer design for qPCR of environmental samples I retrieved a partial sequence of the full mitochondrial genome of Stomoxys calcitrans from GenBank (accession number DQ533708.1) and used it as a template for our qPCR assay. I designed the specific primers and probes using the Primer-Quest Design Tool (Integrated DNA Technologies, https://eu.idtdna.com/). I set an optimum melting temperature (Tm) of 62 °C and 68 °C for the primers (ScaF and ScaR) and probe (ScaP) respectively, a length of 22 and 24 base pairs for the primers and the probe, and a 50% GC content. I looked for amplicons of around 100 base pairs to ensure their integrity after digestion by predators. I generated 50 primer pair and probe combinations and verified their specificity and that of the predicted amplicon in silico, by comparing them against all sequences available in GenBank. I selected the best assay by ensuring that the resulting amplicon and at least two of the assay elements only matched with Stomoxys calcitrans on GenBank, and that the melting temperature of the probe was at least 6 °C higher than the primers’ (Table 1). qPCR quantification I tested the designed primers using qPCR. I selected one S. calcitrans C+ sample with good extraction quality metrics (DNA concentration = 24 ng/µl; A260/A280 = 2.06; A260/A230 = 2.24) to build a standard curve and created seven aliquots according to a five-fold dilution series from a starting DNA concentration of 5 ng/µl. These seven aliquots were amplified together with REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 5: Livestock pest predation through RT-qPCR 131 samples C- (n = 7), Sc+ (n = 88), Sc- (n = 17), Bl+ (n = 8) and a no template control NTC (n = 1). All samples besides the standard curve and the NTC were diluted to a maximum DNA concentration of 5ng/µl. Table 1: Primers and probes designed and used for the qPCR assay. Name Sequence Len. (bp) GC% Tm (°C) Target gene Product length ScaF 5’ – ATTATAGCCCATGACCTTTAACTG – 3’ 24 37.5 60.8 CO3 147 bp ScaR 5’ – CATCTCGTCATCATTGATAAACTGT – 3’ 25 36.0 61.4 ScaP 5’–/56-FAM/TGGTGCAAT/ZEN/ AACTACAGTTGCAGGA/3IABkFQ/ – 3’ 25 44.4 66.3 Three replicates of each sample were included in a qPCR reaction using 5 µl of Master Mix (NZYSupreme qPCR Probe Master Mix (2x), ROX Plus; NZYtech), 0.4 µl of each primer (10 nM), 0.1 µl of probe (10 nM), 3.1 µl of nuclease-free H2O and 1 µl of template DNA for a total volume of 10 µl per reaction. NTC reactions contained 1 µl of nuclease free H2O instead of DNA. The qPCR reactions were performed in a 7900HT Fast Real-Time PCR System unit (Thermofisher, USA), and conditions were 95 °C for 5 min, followed by 39 cycles of 95 °C for 5 s and 60 °C for 40 s. I pre-processed raw run outputs using Bio-Rad CFX Maestro for indexing the samples, and visually established the threshold to obtain Ct (threshold cycle) values. These values indicate the cycle number at which the fluorescence signal of the qPCR reaches a threshold value that represents the exponential amplification phase of the reaction, and it is related to the starting DNA quantity (Bustin et al., 2009). Statistical analyses I extracted Ct values for all replicates and performed the rest of the analyses in R v4.4.0 (R Core Team, 2024). For the standard curve, I built a linear regression between Ct values and the logarithm of the DNA concentration of the dilution of C+ samples. I recorded the slope of the relationship, and the R2 value REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 132 of the regression. Then, I calculated the efficiency (eff) of the amplification applying equation 1: 𝑒𝑓𝑓 = −1 + 10(− 1 𝑠𝑙𝑜𝑝𝑒) (1) The rest of the samples were first evaluated qualitatively according to whether or not the replicates produced a noticeable change in absorbance (hereafter labelled qPCR+ and qPCR-, respectively), and therefore a measured Ct value. I only regarded a sample as positive if all three of the replicates were positive. Then I calculated the coefficient of variation of Ct values among replicates using equation 2, and if it was higher than 10% I removed the most influential outlier value among the three replicates (Xue et al., 2025). Finally, I calculated the mean Ct values per sample and I validated them based on the standard curve. Samples with mean Ct value outside the range established by the standard curve (21.1 < Ct < 32.9) were disregarded. variation = mean(𝐶𝑡) 𝑠𝑡.𝑑𝑒𝑣 (𝐶𝑡)×100 . (2) Using mean Ct values, and the standard curve method, I predicted the initial DNA concentration for all remaining samples. I evaluated qualitative qPCR results in relation to DNA metabarcoding results for samples Sc+, Scand Bl+. I also evaluated whether qPCR results were related to sample quality and sample characteristics. For that, I separated the samples according to the qualitative result combination in DNA metabarcoding (groups Sc+, Scand Bl+) and qPCR (groups qPCR+, qPCR-), and compared the characteristics of these sample groups in relation to different sample metrics, namely: total read counts in DNA metabarcoding, S. calcitrans reads recovered by DNA metabarcoding, and A280/A260 and A230/A260 ratio of the extraction. Protein or phenol contamination, represented by low values of both ratios measured, can lead to inhibition and negatively affect downstream analyses (Olson and Morrow, 2012). This would impact both the qPCR assay presented in this study and the DNA metabarcoding results. Similarly, low metabarcoding total read counts can also be related to REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 5: Livestock pest predation through RT-qPCR 133 excessive degradation of the DNA (Naef et al., 2023). The differences between groups were evaluated using Kruskall Wallis test from package stats (R Core Team, 2024), followed by a post-hoc Dunn’s test with Holm’s correction from package rstatix (Kassambara, 2023). Finally, I compared the predicted DNA concentration of Sc+/qPCR+ samples with read counts reported by DNA metabarcoding using Spearman’s correlation test (R Core Team, 2024). Results The taxonomic identity of all the C+ samples collected, included the one used to build the standard curve, was confirmed to be S. calcitrans through sequencing of the COI gene. In the qPCR assay, all the replicates from S. calcitrans (C+) were successfully amplified, and the standard curve had an efficiency of 91.92% and R2 = 0.982 (Appendix S5.2). Figure 1. Predicted DNA concentration (ng/µl) achieved in the qPCR assays, except in C+ samples, which indicate measured concentrations. Boxplots indicate the 1st and 3rd quartiles, with the median represented by a thick line. Whiskers extend up to 1.5 times the IQR (interquartile range). Each dot represents a single sample. Data points on top of the dashed line represent failed amplifications. Note that the y axis is represented exponentially. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 134 The qPCR reaction was negative for the NTC, non-target insect DNA (C-), and all the Scfaecal sample replicates. All eight Bl+ samples and eight of the Sc+ samples also failed to amplify, because they either did not produce a noticeable absorption signal, or their mean Ct value fell below the accepted threshold (Appendix S5.1). The qPCR reaction was positive in 80 samples (in all their three replicates), all of them being Sc+. These had Ct values between 22.3 and 32.8, which corresponds to a predicted concentration of S. calcitrans DNA between 2.15 ng/µl and 0.0016 ng/µl (Fig. 1). The four extraction-quality metrics evaluated (the total metabarcoding read counts, S. calcitrans read counts, A260/A280 ratio of the extraction and A260/A230 ratio of the extraction) were significantly different between all classes (Sc+/qPCR+, Sc+/qPCR-, Scand Bl+; Appendix S5.3). Bl+ samples had significantly lower values than Sc+/qPCR+ for all the metrics. On the other hand, Scand Sc+/qPCRsamples were similar to Bl+ samples when comparing the number of S. calcitrans reads and the A260/A230 extraction ratio, and these values were significantly lower than those reported for Sc+/qPCR+ samples. Finally, Scand Sc+/qPCR+ samples contained the highest median of metabarcoding reads, which were also significantly different from Bl+ samples (Fig. 2). Figure 2. Metabarcoding read count results and extraction quality metrics. Significance values of Dunn’s test with Holm’s correction are represented (* = 0.05 < p-value, ** = pvalue < 0.01, *** = p-value < 0.001, **** = p-value < 0.0001). Boxplots indicate the 1st and 3rd quartiles, with the median represented by a thick line. Whiskers extend up to 1.5 times the IQR (interquartile range). See Materials and Methods section for abbreviations. REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 5: Livestock pest predation through RT-qPCR 135 I found significant positive rank correlation between the initial DNA concentration estimated by qPCR and the read counts of Stomoxys calcitrans reported by DNA metabarcoding (rho = 0.65, p = 2.2e-16). Discussion This study presents an effective qPCR methodology to detect traces of Stomoxys calcitrans DNA in the faeces of the vespertilionid bat Myotis emarginatus. The qPCR assay was adequately efficient at amplifying S. calcitrans DNA, based on the standard curve results. Overall, the assay was 100% accurate regarding insect DNA extractions, and 92% for faecal samples belonging to M. emarginatus. The assay presented here easily identifies consumption of S. calcitrans by its natural vertebrate predators like the notch-eared bat, and likely, others as the barn swallow. Livestock pests are usually found in abundance around cattle and inside of cattle sheds, making them an attractive food source for insectivorous predators. While the distribution of these two predators has been explicitly linked to the availability of livestock pests (Dietz et al., 2013; Musitelli et al., 2016), the presence of livestock seems to encourage foraging by other species, whose link with cattle farming are not as clearly set (Ancilloto et al., 2021; Siemers et al., 2012). This assay can help identify populations that have a high dependency for livestock pests and help design adequate management measures for each particular case. Unexpectedly, some of our samples were negative in qPCR while positive by DNA metabarcoding. Some studies have reported a higher sensitivity of qPCR than DNA metabarcoding (Harper et al., 2018; Baroja et al., 2022; Johnson et al., 2024), which contradicts our results. The Sc+/qPCR+ samples had significantly higher S. calcitrans reads recovered by metabarcoding than any other sample class (Sc+/qPCR-, Bl+ and Sc-), which could explain why qPCR results were negative for the metabarcoding-positive samples Bl+ and Sc+/qPCR–. However, extraction quality metrics could also influence qPCR results, due to high protein to DNA ratios (measured by the A260/A280 ratio) and contamination from other REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 136 compounds such as salts or phenols (A260/A230 ratio) than can lower PCR efficiency or inhibit it all together (Olson and Morrow, 2012. Faecal samples had overall lower ratio values than insect samples, Sc+/qPCRsamples had even lower A260/A230 values than Sc+/qPCR+ samples (Fig. 2; Appendix S5.1). Nonetheless, five out of the eight Sc+/qPCRsamples had average Ct values between 33 and 34, were positive in all three replicates and had variation coefficients lower than 10%. They were disregarded as they failed to meet one of the criteria to be considered as qPCR+ (i.e., mean Ct ≤ 32.9). However, these samples could be true positives with very low amounts of S. calcitrans DNA, so the qPCR assay could be able to detect its target beyond the threshold presented here. All Bl+ samples were extraction controls, and even though they were positive in the DNA metabarcoding test, were not expected to contain any template DNA. Out of the 24 individual replicates of Bl+ samples (eight triplicate samples), only three produced a measurable change in absorption that correlated with Ct values over 37, well below the accepted threshold for this study. The observed discrepancy between qPCR and DNA metabarcoding could mean that the latter is more reliable when the quality of the input sample is compromised. Conversely, it could also mean that metabarcoding is more error-prone and I cannot rule out that S. calcitrans reads in Bl+ samples are false positives, resulting from sequencing errors, contamination during library preparation, or tag-jump events (Esling et al., 2015). Stochastic errors such as these can cause false positives in extraction blanks and biological samples alike (e.g. Dick et al., 2023). The design of this study does not allow to assess these alternative explanations. The predicted initial concentrations for Sc+ samples showed a positive correlation with DNA metabarcoding reads for S. calcitrans, consistent with findings from other studies (Dick et al., 2023; Johnson et al., 2024). This correlation would support the use of either method for comparing the relative abundance of single-locus DNA across multiple samples. In fact, DNA REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 5: Livestock pest predation through RT-qPCR 137 metabarcoding remains a powerful tool for community-level analysis of environmental samples. Using generalist primers, it can be applied even with limited prior knowledge of the biological system under investigation (Wangesteen et al., 2018). However, due to the inherently multi-locus nature of DNA metabarcoding, and PCR amplification biases within a single PCR reaction (Krehenwinkel et al., 2017), the resulting read counts do not always correlate with input DNA concentrations (Jusino et al., 2019). On top of that, variable digestion rates of different prey items or tissue types (reviewed in King et al., 2008) adds an additional layer of variability that makes the estimation of the biomass consumed by the predator even more challenging. Carefully evaluating primer selection for each specific application can help mitigate technical biases (Piñol et al., 2018; Jusino et al., 2019), but still, some authors advise against using DNA metabarcoding data for quantitative purposes (Elbrecht and Leese, 2015). Therefore, when the focus is on a single taxon, the reliability and robustness of qPCR makes it a strong option for both qualitative and quantitative studies. This is particularly relevant for evaluating pest consumption by natural enemies (Baroja et al., 2022; Mangan et al., 2018; this study) or for monitoring invasive (Johnson et al., 2024) or elusive species (Ripa et al., 2024). Additionally, qPCR offers logistical advantages over DNA metabarcoding, as it is more cost-effective (Baroja et al., 2022) and requires fewer analytical steps, making it less prone to technical errors or contamination events. Thus, qPCR is a very well-suited technique for large-scale or long-term monitoring programs thanks to its efficiency, reproducibility and reduced costs. The qPCR assay presented in this study is intended to facilitate the evaluation of S. calcitrans consumption by vertebrate natural enemies. It enables to survey species, populations, or colonies consuming S. calcitrans, as well as relatively quantifiying consumption. While variable digestion rates may alter the relationship between ingested biomass and qPCR amplification results, when combined with other techniques, the information obtained from qPCR could provide valuable insights into the direct effect of natural predators on the REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
The trophic ecology of Myotis emarginatus 138 suppression of S. calcitrans. Such data are essential for assessing their effectiveness against livestock pests and protecting native populations of vertebrate predators that may significantly depend on this food source. All in all, the information provided by this qPCR assay could prove to be useful for the implementation of vertebrate natural enemies into IPM programs of livestock pests. References Ambrosini R, Rubolini D, Trovò P, Liberini G, Bandini M, Romano A, Sicurella B, Scandolara C, Romano M, Saino N (2012). Maintenance of livestock farming may buffer population decline of the Barn Swallow Hirundo rustica. Bird Conservation International, 22:411–248. https://doi.org/10.1017/S0959270912000056 Ancilloto L, Festa F, De Benedetta F, Cosentino F, Pejic B, Russo D (2021). Free-ranging livestock and a diverse landscape structure increase bat foraging in mountainous landscapes. Agroforestry Systems, 95:407–418. https://doi.org/10.1007/s10457-021-00591-0 Baroja U, Garin I, Vallejo N, Caro A, Ibáñez C, Basso A, Goiti U (2022). Molecular assays to reliably detect and quantify predation on a forest pest in bat faeces. Scientific Reports, 12:2243. https://doi.org/10.1038/s41598-022-06195-7 Barzman M, Bàrberi P, Birch ANE, Boonekamp P, Dachbrodt-Saaydeh S, Graf B, Hommel B, Jensen JE, Kiss J, Kudsk P, Lamichhane JR, Messéan A, Moonen AC, Ratnadass A, Ricci P, Sarah JL, Sattin M (2015). Eight principles of integrated pest management. Agronomy for Sustainable Development, 35:1199–1215. https://doi.org/10.1007/s13593-015-0327-9 Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT (2009). The MIQE Guidelines: Minimum Information for publication of Quantitative real-time PCR Experiments. Clinical Chemistry, 55(4):611–622. https://doi.org/10.1373/clinchem.2008.112797 Clare E (2014). Molecular detection of trophic interactions: emerging trends, distinct advantages, significant considerations and conservation applications. Evolutionary Applications, 7(9):1144–1157. https://doi.org/10.1111/eva.12225 da Silva LP, Mata VA, Lopes PB, Pinho CJ, Chaves C, Correia E, Pinto J, Heleno RH, Timoteo S, Beja P (2024). Dietary metabarcoding reveals the simplification of bird-pest interaction networks across a gradient of agricultural cover. Molecular Ecology, 33:e17324. https://doi.org/10.1111/mec.17324 Deguine JP, Aubertot JN, Flor RJ, Lescourret F, Wyckhuys, KAG, Ratadass A (2021). Integrated pest management: good intentions, hard realities. A review. Agronomy for Sustainable Development, 41:38. https://doi.org/10.1007/s13593-021-00689-w Dick C, Larson WA, Karpan K, Baetscher DS, Shi Y, Sethi S, Fangue NA, Henderson MJ (2023). Prey ration, temperature and predator species influence digestion rates of prey DNA inferred from qPCR and metabarcoding. Molecular Ecology Resources, 25(5):e13849. https://doi.org/10.1111/1755-0998.13849 Dietz M, Pir JB (2021). Geoffroy’s bat Myotis emarginatus (Geoffroy, 1806). In: Russo D (Ed.) Chiroptera, Handbook of the Mammals of Europe. Springer International Publishing. https://doi.org/10.1007/978-3-030-44029-9_56 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258
Chapter 5: Livestock pest predation through RT-qPCR 139 Dietz M, Pir JB, Hillen J (2013). Does the survival of greater horseshoe bats and Geoffroy’s bats in Western Europe depend on traditional cultural landscapes? Biodiversity and Conservation, 22:3007–3025. https://doi.org/10.1007/s10531-013-0567-4 Dimitrović BA, Gajski D, Kos T, Jelić M, Jelaska LŠ (2023). Insight into trophic interactions of spiders in olive groves with Integrated and Ecological Pest Management using DNA metabarcoding. Diversity, 15(9):976. https://doi.org/10.3390/d15090976 Directive 2009/128/EC of the European Parliament and of the Council of 21 October 2009 establishing a framework for Community action to achieve the sustainable use of pesticides. http://data.europa.eu/eli/dir/2009/128/oj Durel L, Estrada-Peña A, Franc M, Mehlhorn H, Bouyer J (2015). Integrated fly management in European ruminant operations from the perspective of directive 2009/128/EC on sustainable use of pesticides. Parasitology Research, 114:379–389. https://doi.org/10.1007/s00436-0144273-2 Elbrecht V, Leese F (2015). Can DNA-based ecosystem assessments quantify species abundance? Testing primer bias and biomass-sequence relationships with an innovative metabarcoding protocol. PLoS ONE, 10(7):e0130324. https://doi.org/10.1371/journal.pone.0130324 Esling P, Lejzerowicz F, Pawlowski J (2015). Accurate multiplexing and filtering for highthroughput amplicon-sequencing. Nucleic Acids Research, 43(5):2513–2524. https://doir.org/10.1093/nar/gkv107 Garcia K, Olimpi EM, Karp DS, Gonthier DJ (2020). The good, the bad, and the risky: Can birds be incorporated as biological control agents into Integrated Pest Management programs? Journal of Integrated Pest Management, 11(1):11. https://doi.org/10.1093/jipm/pmaa009 Gerry AC, Murillo AC (2019). Promoting biosecurity through insect management at animal facilities. In: Dewulf J, van Immerseel F (Eds.) Biosecurity in animal production and veterinary medicine: from principles to practice, pp. 243–281. CABI. https://doi.org/10.1079/9781789245684.0243 González MA (2022). Insectos de importancia Médico-Veterinaria en el Norte de España, pp. 240 Publicación Independiente. González MA, Duvallet G, Morel D, de Blas, I, Barrio E, Ruiz-Arrondo I (2024). An Integrated Pest Management Strategy Approach for the Management of the Stable Fly Stomoxys calcitrans (Diptera: Muscidae). Insects, 15:222. https://doi.org/10.3390/insects15040222 Gupta N (2019). DNA extraction and Polymerase Chain Reaction. Journal of Cytology, 36(2):116– 117. https://doi.org/10.4103/JOC.JOC_110_18 Harper LR, Handley LL, Hahn C, Boonham N, Rees HC, Gough K, Lewis E, Adams IP, Bretherton P, Phillips S, Hänfling B (2018). Needle in a haystack? A comparison of eDNA metabarcoding and targeted qPCR for detection of the great crested newt (Triturus cristatus). Ecology and Evolution, 8:6330–6341. https://doi.org/10.1002/ece3.4012 Hebert PDN, Cywinska A, Ball SL, de Waard JR (2003). Biological identifications through DNA barcodes. Proceedings of the Royal Society of London. Series B: Biological Sciences, 270(1512):313–321. https://doi.org/10.1098/rspb.2002.2218 Johnson M, Tetzlaff S, Katz A, Jinelle S (2024). Comparison of qPCR and metabarcoding for environmental DNA surveillance of a freshwater parasite. Ecology and Evolution, 14(5):e11382. https://doi.org/10.1002/ece3.11382 Jusino MA, Banik MT, Palmer JM, Wray AK, Xiao L, Pelton E, Barber JR, Kawahara AY, Gratton C, Peery MZ, Lindner DL (2019). An improved method for utilizing high-throughput amplicon sequencing to determine the diets of insectivorous animals. Molecular Ecology Resources, 19:176–190. https://doi.org/10.1111/1755-0998.12951 REGISTRO TELEMÁTICO Sarreren Erregistro Orokorra / Registro General de Entradas 03/10/2025 14:30 EHU2025E047258