Isolation and characterization of microsatellite loci in Sorbus aria (Rosaceae)

UNCORRECTED PROOF TECHNICAL NOTE 1 2Isolation and characterization of microsatellite loci 3in Sorbus aria (Rosaceae) 4E. A. Gonza ´lez-Gonza ´lez •M. A. Gonza ´lez-Pe ´rez • 5E. Rivero •P. A. Sosa 6Received: 9 April 2010 / Accepted: 17 April 2010 7ÓSpringer Science+Business Media B.V. 2010 8Abstract Sorbus aria (L) Crantz (Common Whitebeam) 9is native to Europe, east of the Balkans and in North 10 Africa; it is also present in the Canary Islands. To evaluate 11 the genetic diversity in natural populations of this vulner12 able species, nine novel polymorphic microsatellite mark13 ers were isolated from enriched libraries. Microsatellite 14 loci were screened in 97 individuals from La Palma 15 (Canary Islands) and Sierra Nevada (Granada, Spain). 16 Examination of the microsatellite profiles shows that 17 S. aria individuals have up to three alleles per locus. The 18 cloned sequences in microsatellite loci confirmed the 19 polyploidy status of the plants. The number of alleles 20 ranged from 5 to 14 per locus. The phenotype diversities 21 across loci (H0 T ) ranging from 0.653 to 0.847. 22 23 Keywords Sorbus aria Microsatellite Canary Islands  24 Genetic diversity Conservation 25 The genus Sorbus L. (Rosaceae) includes small to medium 26 sized trees from the North Temperate Zone. They are 27 closely related to the commercial genus Malus and Pyrus 28 (Robertson et al. 1991; Campbell et al. 1995). 29 Sorbus aria (L) Crantz (Common Whitebeam) is native 30 to Europe, east of the Balkans and in North Africa. It is 31 distributed in mountain zones throughout almost all of 32 Europe and part of Asia, from the Iberian Peninsula and 33 Ireland to the Himalayas. It is also present in the Canary 34 Islands. The trees are isolated and alone despite their 35 widespread distribution; for this reason UICN has listed it 36 as a ‘‘vulnerable species’’ (Cabezudo et al. 2000; Chester 37 et al. 2007). 38 The European samples of Sorbus aria have been 39 reported as diploids although the subgenus Aria (or S. aria 40 aggregate) contains apomictic triploid and tetraploid spe41 cies (Nelson-Jones et al. 2002). However, little is known 42 about the genetic populations in the Canary Islands which 43 have only been found on La Palma and Tenerife. 44 In this paper, we describe the isolation and character45 ization of 9 microsatellite markers in Sorbus aria and we 46 indicate their effectiveness in identifying patterns of 47 genetic diversity. 48 Genomic DNA for the development of markers and 49 subsequent surveys were extracted from leaf tissue of 97 50 samples from La Palma (45) and Sierra Nevada (52) pop51 ulations using a modified CTAB protocol (Doyle and 52 Doyle 1987). 53 Microsatellite loci were developed by ATG GENETIC INC. 54 using biotin/streptavidin protocol (Khasa et al. 2000). 55 Briefly, genomic DNA was digested with restriction 56 endonucleases (Hae III or Rsa I with PshA I). A synthetic 57 adaptor M28/M29 was added to the ends of the genomic 58 DNA’s by T4 DNA ligase. Two rounds of hybridization 59 with 50biotin-labeled oligonucleotide (TGn and GAn) and 60 capture by streptavidin-coated magnetic beads (Dynabeads, 61 Dynal GmbH) were carried out. The enriched genomic 62 products were amplified using adaptor primer M28 and 63 were cloned into plasmid vectors (pGEM3Z?, Promega). 64 Positive microsatellite clones were identified by dot blot 65 hybridization with appropriate mixes of biotin labelled 66 SSR oligonucleotides. 67 Sequences were obtained by amplifying an aliquot of 68 frozen bacterial culture from positive hybridizing colonies A1 E. A. Gonza ´lez-Gonza ´lez M. A. Gonza ´lez-Pe ´rez E. Rivero  A2 P. A. Sosa (&) A3 Departamento de Biologı ´a, Universidad de Las Palmas de Gran A4 Canaria, Campus Universitario de Tafira, 35017 Las Palmas de A5 Gran Canaria, Canary Islands, Spain A6 e-mail: [email protected] 123 Journal : Large 12686 Dispatch : 4-5-2010 Pages : 3 Article No. : 9238 hLE hTYPESET MS Code : COGR371 hCP hDISK 44 Conservation Genet Resour DOI 10.1007/s12686-010-9238-x Author Proof UNCORRECTED PROOF 69 using M13 universal forward and reverse primers, treated 70 with Exonuclease I and Shrimp alkaline phosphatase, and 71 then sequenced from both orientations using ABI3730 72 capillary electrophoresis (NAPS Service, University of 73 British Columbia). For 18 microsatellite loci isolated from 74 these libraries, PCR primers complementary to the flanking 75 regions of loci were designed with c. 40% GC and avoiding 76 palindromic sequence motifs. Ten microsatellites were 77 scored as ‘‘useful’’ based on good amplification of poly78 morphic sized bands from single copy genomic target but 79 only nine have given PCR polymorphic results and were 80 considered robust and predictable enough for further 81 analyses (Table 1). 82 Each 25 ll PCR reaction contained approximately 83 20 ng of DNA, 10 pmol of each primer, as well as PCR 84 Master Mix (Reddy-Mix, ABgene, Surrey, UK) that 85 included 0.625 units of Taq DNA polymerase, 75 mM 86 Tris–HCl, 20 mM (NH4) 2 SO 4 , 0.01% Tween20, 1.5 mM 87 de MgCl 2 , and 0.2 mM of each dNTP. Forward primers 88 were colour-labeled at the 50-end with 6-FAM, PET, NED 89 or VIC. 90 In general, amplifications were carried out using the 91 following thermal cycling conditions: 3 min denaturation 92 at 95°C, 35 cycles of 30 s denaturation at 95°C, 30 s at 93 annealing temperature, and 1.5 min elongation at 72°C; 94 followed by 5 min elongation at 72°C. The products were 95 detected using an ABI 3100 GENETIC ANALYZER and 96 fragment sizes were determined using GENESCAN V. 2.02 97 and GENOTYPER V. 1.1 (Applied Biosystems, Inc.). 98 Examination of the microsatellite profiles shows that 99 S. aria individuals have up to three alleles per locus. The 100 cloned sequences in microsatellite loci confirmed that the 101 polyploidy status of the plants. We are not able to deter102 minate the exact number of copies of each allele because 103 we do not know allele dosage in those individuals with 104 partial heterozygoty. We identified allele peak profiles at 105 each locus and assigned a phenotype to each individual. 106 Analysis of S. aria microsatellites used the phenotype107 based statistics in the FDASH program (Obbard et al. 2006) 108 that can measures diversity in terms of the total number of 109 allelic phenotypes in the population. Because allopolyp110 loids are derived from interspecific hybridization and 111 therefore comprise at least two different genomes, this 112 program assumes the sharing of alleles between isoloci 113 must be owing to common ancestry. So, using a single 114 allelic-phenotype diversity statistic (H0) that measures 115 diversity as the average number of alleles by which pairs of 116 individuals differ plus a population differentiation measure 117 (F0 ST ) which is analogous to F ST; we can capture essential 118 information regarding genetic diversity in polyploids. 119 The nine S. aria microsatellite loci are highly variable 120 with a mean of 9.255 alleles/locus and phenotype diversi121 ties across loci (H0 T ) ranging from 0.653 to 0.847 with a 122 mean value of 0.742; F st mean value was 0.428 (Table 2). Table 1 Primer sequences and characteristics of nine microsatellite loci from natural populations of Sorbus aria Locus Repeat motif PCR primer sequence (50?30)T a (8C) Size of cloned allele (size–range) in bp Fluorescent label GeneBank accession no SA01 a (GA) 13 F: ATGGAGTTGAGCTCCACATC R: GGTGGAGGGACAATTGTGTC 60 229 (212–254) 6-FAM (blue) FN563114 SA02 b (GA) 16 F: CTAGGTATCATCTCCGACCA R: ACGTAGCACTGAATGGTATAG 60 293 (270–325) NED (yellow) FN563115 SA03 a (GA) 12 F: CACTTCTTCCTGCTGTTTGG R: ACTACTGCTACTTCTGTGGG 60 234 (206–249) VIC (green) FN563116 SA06 a (GA) 32 F: ATTTGATCCATGTGCGACTGCA R: TGCAGCGGTTGCAGATTGCA 60 297 (248–297) PET (red) FN563117 SA07 a (GA) 15 F: ACGTTTTCAGTATGATGGCC R: CTTCGCAGTTCATTAAGCAC 60 334 (325–349) 6-FAM (blue) FN563118 SA08 b (CT) 16 F: CAGAGAGAGTGCACTGCCT R: GAATTCTTGGCAGTTTGCCT 60 249 (233–287) 6-FAM (blue) FN563119 SA09 a,c (AG) 17 F: CTTGTTGGACGGATTTCTTC R: CCAATACTTGAGTAGCATAC 60 174 (161–197) NED (yellow) FN563120 SA14 a (TC) 30 F: ATGGATTTAGGTTAACAGTTGTC R: GAGGTAAAACCTACCAGTATAC 57 203 (197–232) PET (red) FN563121 SA19.1 a (GA) 24 F: AAGTTTACAAGAGTGTGTTCAG0 R: GAATTCATGAAAGCAGCTAATG 60 241 (212–250) VIC (green) FN563122 T a =Annealing temperature a PCR Master Mix (AB gene) MgCl 2 1.5 mM, b PCR Master Mix (AB gene) MgCl 2 2.5 mM. c Final elongation: 30 min, 72°C Conservation Genet Resour 123 Journal : Large 12686 Dispatch : 4-5-2010 Pages : 3 Article No. : 9238 hLE hTYPESET MS Code : COGR371 hCP hDISK 44 Author Proof UNCORRECTED PROOF 123 Acknowledgments We thank A ´ngel Ban ˜ares, Manuel Marrero, 124 Eduardo Carque ´, Manuel Izquierdo (Parque Nacional del Teide, 125 Tenerife), A ´ngel Palomares and A ´lvaro Rodrı ´quez Felipe (Parque 126 Nacional Caldera del Taburiente, La Palma), Alicia Escandell and 127 Nancy Cabanillas for assistance in collecting Sorbus samples. Also, 128 we thank Craig Newton for microsatellite library development and 129 Pilar Garcı ´a for instruct us in cloning protocols. This research was 130 funded by the Ministerio de Medio Ambiente y Medio Rural y 131 Organismo Auto ´nomo de Parques Nacionales (2/2005). 132 References 133 Cabezudo B, Herna ´ndez-Bermejo JE, Herrera CM, Mun ˜oz J, Valde ´s 134 B (2000) Libro rojo de la flora silvestre amenazada de Andalucı ´a 135 II: especies vulnerables. Junta de Andalucı ´a, Sevilla, Espan ˜a 136 Campbell CS, Donoughue MJ, Baldwin BG, Wojciechowski MF 137 (1995) Phylogenetic relationship in Maloideae (Rosaceae): 138 evidence from sequences of internal transcribed spacers of 139 nuclear ribosomal DNA and its congruence with morphology. 140 Am J Bot 82:903–918 141 Chester M, Cowan RS, Fay MF, Rich TCG (2007) Parentage of 142 endemic Sorbus L (Rosaceae) species in the British Isles: 143 evidence from plasmid DNA. Bot J Linn Soc 154:291–304 144 Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small 145 quantities of fresh leaf tissue. Phytochem Bull Bot Soc Amer 146 19:11–15 147 Khasa PD, Newton CH, Rahman MH, Jaquish B, Dancik BP (2000) 148 Isolation, characterization and inheritance of microsatellite loci 149 in alpine and western larch. Genome 43:439–448 150 Nelson-Jones EB, Briggs D, Smith AG (2002) The origin of 151 intermediate species of the genus Sorbus. Theor Appl Genet 152 105:953–963 153 Obbard DJ, Harris SA, Pannekk JR (2006) Simple allelic-phenotype 154 diversity and differentiation statistics for allopolyploids. Hered155 ity 97:296–303 156 Robertson KR, Phipps JB, Rohrer JR, Smith PG (1991) A synopsis of 157 genera in Maloideae (Rosaceae). Syst Bot 16:376–394 158 Table 2 Patterns of variability at individual microsatellite and genetic diversity analysis across all populations of Sorbus aria Locus AAVAP AVPH 0 S H0 T F0 ST SA01 5.000 3.033 5.000 2.462 0.295 0.653 0.547 SA02 9.000 5.680 7.000 3.680 0.342 0.681 0.498 SA03 10.000 6.602 7.000 3.269 0.449 0.734 0.388 SA06 9.000 4.897 8.000 3.897 0.473 0.763 0.380 SA07 8.000 5.875 11.000 5.688 0.627 0.847 0.260 SA08 10.000 5.062 12.000 5.639 0.468 0.804 0.418 SA09 10.000 5.680 6.000 3.144 0.358 0.690 0.480 SA14 14.000 7.588 12.000 5.887 0.495 0.808 0.387 SA19,1 8.000 4.211 7.000 2.758 0.350 0.693 0.496 Average across loci 9.255 5.422 8.367 4.065 0.429 0.742 0.428 Atotal number of alleles, AvA average number of different allele per sample, Ptotal number of phenotypes seen, AvP average number phenotypes per sample, H0 S phenotype diversity within sample, H0 T phenotype diversity across all samples, F0 ST =(H0 T –H 0 S )/H0 T measure of genetic differentiation among populations Conservation Genet Resour 123 Journal : Large 12686 Dispatch : 4-5-2010 Pages : 3 Article No. : 9238 hLE hTYPESET MS Code : COGR371 hCP hDISK 44 Author Proof