Molecular mechanism of mRNA repression in by a ProQ-dependent small RNA.

Article Molecular mechanism of mRNA repression in trans by a ProQ-dependent small RNA Alexandre Smirnov 1,† , Chuan Wang 1,† , Lisa L Drewry 1 & Jörg Vogel 1,2,* Abstract Research into post-transcriptional control of mRNAs by small noncoding RNAs (sRNAs) in the model bacteria Escherichia coli and Salmonella enterica has mainly focused on sRNAs that associate with the RNA chaperone Hfq. However, the recent discovery of the protein ProQ as a common binding partner that stabilizes a distinct large class of structured sRNAs suggests that additional RNA regulons exist in these organisms. The cellular functions and molecular mechanisms of these new ProQ-dependent sRNAs are largely unknown. Here, we report in Salmonella Typhimurium the mode-of-action of RaiZ, a ProQ-dependent sRNA that is made from the 30end of the mRNA encoding ribosome-inactivating protein RaiA. We show that RaiZ is a base-pairing sRNA that represses in trans the mRNA of histone-like protein HU-a. RaiZ forms an RNA duplex with the ribosome-binding site of hupA mRNA, facilitated by ProQ, to prevent 30S ribosome loading and protein synthesis of HU-a. Similarities and differences between ProQand Hfqmediated regulation will be discussed. Keywords HU-a; ProQ; RaiZ; small RNA; translation inhibition Subject Categories Microbiology, Virology & Host Pathogen Interaction; Protein Biosynthesis & Quality Control; RNA Biology DOI 10.15252/embj.201696127 | Received 20 November 2016 | Revised 5 February 2017 | Accepted 10 February 2017 | Published online 23 March 2017 The EMBO Journal (2017)36:1029–1045 Introduction Many if not all organisms use small base-pairing RNAs to modulate mRNA expression at the post-transcriptional level (Gorski et al, 2017; Kunne et al, 2014). These regulatory pathways often rely upon a conserved RNA-binding protein, primary examples of which are Argonaute family members in the microRNA pathway of eukaryotes (Huntzinger & Izaurralde, 2011; Meister, 2013) and the Sm-like protein Hfq in prokaryotes (Bossi & Figueroa-Bossi, 2016; De Lay et al, 2013; Updegrove et al, 2016; Vogel & Luisi, 2011; Wagner & Romby, 2015). Intense work on these pathways over the past decade has revealed the existence of large post-transcriptional networks that affect almost every cellular aspect and rival the complexity of primary gene expression control at the level of transcription. The Hfq pathway has been particularly well mapped in the Gram-negative model bacteria Escherichia coli (Melamed et al, 2016; Schu et al, 2015; Tree et al, 2014), Salmonella enterica (Holmqvist et al, 2016), Vibrio cholera (Papenfort et al, 2015a) and Pseudomonas (Sonnleitner et al, 2008), in which the protein serves two general functions: protecting the Hfq-associated small noncoding RNAs (sRNAs) from cellular nucleases and helping them to recognize their target mRNAs. Most Hfq-associated sRNAs bind to their targets near the site of translational initiation (Melamed et al, 2016; Waters et al, 2016) and, therefore, this class of riboregulators primarily repress protein synthesis through steric interference with 30S ribosome binding (Balbontı ´net al, 2010; Bouvier et al, 2008; Morita et al, 2006; Udekwu & Wagner, 2007). However, additional mechanisms of repression have been reported which include deposition of Hfq within the mRNA 50untranslated region (50UTR) (Desnoyers & Masse ´, 2012) as well as target destabilization by recruitment of endoribonuclease RNase E to the mRNA coding sequence (CDS) (Bandyra et al, 2012; Pfeiffer et al, 2009). Conversely, Hfq-associated sRNAs also regulate some mRNAs positively by at least two different mechanisms, outcompeting translation-incompetent structures in the mRNA 50-region (Papenfort et al, 2015b; Soper et al, 2010) or increasing mRNA stability by masking RNase E cleavage sites (Fro ¨hlich et al, 2013; Papenfort et al, 2013). The same Hfq-associated sRNA may use multiple seed regions (Coornaert et al, 2013; Lee & Gottesman, 2016; Sharma et al, 2011) and no fewer than four different mechanisms to control its full suite of target mRNAs (Feng et al, 2015). Hfq is important for these sRNA– mRNA interactions which are usually imperfect and cannot be efficiently formed without assistance (Moll et al, 2003; Moller et al, 2002; Sobrero & Valverde, 2012; Updegrove et al, 2015; Zhang et al, 2002). Importantly, Hfq only interacts with single-stranded regions of its ligands and, once the sRNA–mRNA duplex has been formed, it typically dissociates and is available to bind other sRNAs (Fender et al, 2010; Hopkins et al, 2011; Ishikawa et al, 2012). The wealth of molecular insight gained for the Hfq network overshadows the fact that these sRNAs constitute only a third of the ~300 sRNAs that have been annotated in, for example, Salmonella (Colgan et al, 2016; Westermann et al, 2016). Moreover, growing evidence suggests that regulation by Hfq represents only a part of 1RNA Biology Group, Institute of Molecular Infection Biology, University of Würzburg, Würzburg, Germany 2Helmholtz Institute for RNA-based Infection Research (HIRI), Würzburg, Germany *Corresponding author. Tel: +49 931 3182 575; Fax: +49 931 3182 578; E-mail: [email protected]e † These authors contributed equally to this work ª2017 The Authors. Published under the terms of the CC BY 4.0license The EMBO Journal Vol 36 |No8|2017 1029 post-transcriptional regulatory processes in bacteria. Many microbes, such as Helicobacter or Mycobacterium, lack an Hfq homologue altogether (Chao & Vogel, 2010; Sharma et al, 2010; Wagner & Romby, 2015), and in Staphylococcus, Hfq is lowly expressed and dispensable for mRNA regulation (Bohn et al, 2007; Romilly et al, 2012). Even in canonical Hfq-containing E. coli and S. enterica, a number of functional Hfq-independent sRNA species have been described. They include most cis-acting antisense RNAs (asRNAs), which employ extensive perfect base pairing to repress mRNAs encoded on the opposite strand (Georg & Hess, 2011; Thomason & Storz, 2010). Plasmid-encoded asRNAs often use highly specific RNA chaperones (e.g. FinO, Rom) to assist these functions, whereas chromosomally encoded asRNAs are traditionally believed to operate in a protein-independent manner (Wagner & Romby, 2015). There are several additional specialized RNA–protein complexes; for example, CRISPR RNAs rely on dedicated molecular machinery provided by Cas proteins (van der Oost et al, 2014) and Y-like sRNAs associate with Ro proteins and PNPase to assist the degradation of structured RNAs (Chen et al, 2013). Naturally, sRNAs that do not employ base-pairing interactions to perform their functions but sequester certain regulatory proteins are also usually Hfq independent (Babitzke & Romeo, 2007; Go ¨pel et al, 2013; Wassarman & Storz, 2000). However, additional proteins, other than Hfq, that define their own large classes of sRNAs have remained unknown. Recently, we applied Grad-seq (RNA-seq-coupled partitioning of the transcriptome by density gradient centrifugation) to visualize the biochemical structure of Salmonella Typhimurium’s RNA ensemble according to their involvement in ribonucleoproteins (RNPs) (Smirnov et al, 2016). While cosedimentation with Hfq explains the behaviour of ~20% of sRNAs, many additional sRNAs are apparently involved in different RNPs. Using sRNAs of this latter class as baits, we subsequently identified protein ProQ as a common binding partner. ProQ is a conserved abundant RNA-binding protein of the ProQ/ FinO family that is widely spread in a-, band c-proteobacteria (Attaiech et al, 2016; Chaulk et al, 2010, 2011; Glover et al, 2015; Smirnov et al, 2016) and whose solution structure has recently been solved in E. coli (Gonzales et al, 2017). We have demonstrated that ProQ associates with several hundred cellular transcripts, including dozens of sRNAs and that this protein has a profound impact on bacterial gene expression and physiology. On average, ProQassociated sRNAs tend to be more folded than Hfq-dependent sRNAs, suggesting that ProQ preferentially binds transcripts with extensive secondary structure. While some of these sRNAs are part of known and putative type I toxin–antitoxin systems or were implicated in mRNA regulation by earlier studies, most are of unknown function (Smirnov et al, 2016). Here, we report the characterization of a ProQ-dependent sRNA and the associated molecular function of the protein. We show that the RaiZ sRNA (formerly known as STnc2090; Chao et al, 2012) is induced upon entry in stationary phase and that it acts in trans to downregulate the translation of the hupA mRNA, which encodes the a-subunit of the bacterial histone-like protein HU. RaiZ forms a base-pairing interaction with the hupA ribosomebinding site (RBS) to repress translation. ProQ has a double role in this regulation: (i) it is necessary for the intracellular stabilization of RaiZ, and (ii) it together with the RaiZ-hupA duplex prevents 30S ribosome loading. These results lay the foundation for a mechanistic exploration of target regulation by the new large class of ProQ-associated sRNAs. Results Biogenesis of the RaiZ sRNA by 30mRNA processing RaiZ was initially identified as candidate sRNA STnc2090 in a screen for Hfq-associated transcripts in Salmonella Typhimurium (Chao et al, 2012). It originates from the highly conserved raiA gene (encoding a cold shock-inducible ribosome-inactivating protein) of which it covers the last third of the CDS and the entire 30UTR. The RaiZ RNA sequence is conserved in several enterobacteria that are closely related to Salmonella (Fig 1A). Northern blot probing of S. Typhimurium total RNA samples showed that RaiZ is primarily expressed in the stationary phase (OD 600 >2) or in a growth medium that induces the Salmonella pathogenicity island-1 (SPI-1) and less in the exponential phase or under Salmonella pathogenicity island-2 (SPI-2)-inducing conditions (Fig 1B), in accordance with available global RNA-seq profiling data (Kro ¨ger et al, 2013). In both S. enterica and E. coli, we detected two major RaiZ species, a 160-nt form (RaiZ) and a 122-nt processed sRNA (RaiZ-S), with a cumulative abundance of up to 50–60 copies per cell (Fig EV1). However, there are no transcription start sites within the raiA CDS (Kro ¨ger et al, 2012), suggesting that RaiZ is produced by endonucleolytic cleavage of the raiA mRNA. The cleavage site in the parental raiA mRNA that yields RaiZ is A/U-rich (Fig 1A), suggesting it would be a good substrate for the major mRNA processing enzyme RNase E (Mackie, 2013). Indeed, while in wild-type Salmonella RaiZ is efficiently produced at both 28°C and 44°C, the raiA mRNA accumulates in a thermosensitive rne-3071 mutant (Apirion & Lassar, 1978) upon shifting to the non-permissive temperature, and RaiZ is no longer produced (Fig 1C), which is also confirmed by our recent genomewide analysis of RNase E cleavage sites (Chao et al, 2017). This supports a model whereby RaiZ arises from RNase E-mediated mRNA turnover, similar to the biogenesis of the 30-end-derived sRNAs CpxQ and SroC (Chao & Vogel, 2016; Miyakoshi et al, 2015a). RaiZ is a ProQ-dependent sRNA Although RaiZ was initially identified through its co-purification with Hfq (Chao et al, 2012), it has now emerged as a top ligand of ProQ, showing high enrichment in previous RIP-seq data obtained with a chromosomally FLAG-tagged ProQ protein (Fig 2A) (Smirnov et al, 2016). In addition, ProQ has been shown to bind both the longer and the shorter RaiZ forms in the low nanomolar range, indicating a strong interaction (Smirnov et al, 2016). As shown in Fig 2B, a ProQ-RaiZ complex is formed with high specificity and is even not affected by the presence of a 500-fold excess of tRNA. Using single-strand-specific Pb(II) treatment and the double-strandspecific RNase V1, we probed the native structure and identified the ProQ-protected sites of RaiZ (Fig 2C and Appendix Fig S1). In good agreement with in silico predictions (see Materials and Methods), both RaiZ and RaiZ-S contain several structured regions, including a large domain with an internal loop and a small hairpin next to the The EMBO Journal Vol 36 |No8|2017 ª2017 The Authors The EMBO Journal Mechanism of ProQ-dependent sRNA Alexandre Smirnov et al 1030 intrinsic terminator, separated by a long unstructured central spacer (Fig 2D). ProQ protects primarily the two 30-terminal stem-loops and the base of the large 50-terminal structured domain. These binding preferences resemble those of the protein FinO which is a wellcharacterized plasmid-encoded homologue of ProQ that interacts with the base of a stem-loop and the adjacent single-stranded regions of the FinP sRNA (Arthur et al, 2011). Moreover, a Legionella ProQ homologue, RocC, also appears to recognize the Rhoindependent terminator of its major target, the RocR sRNA (Attaiech et al, 2016). This binding mode is also in agreement with our recent analysis of the ProQ in vivo interactome which shows that ProQ strongly prefers structured RNAs (Smirnov et al, 2016). A BC Figure 1. RaiZ is a processed enterobacterial sRNA. A Multiple alignment of raiA loci from enterobacteria. Highly conserved positions are shown in red; invariant ones are marked with asterisks. B RaiZ expression in WT bacteria grown in LB or in SPI-1and SPI-2-inducing media was visualized by northern blotting. C RNase E inactivation compromises the raiA mRNA processing and RaiZ production. Unlike the WT allele, the thermosensitive rne-3071 variant gives rise to an RNase E protein which is only active at temperatures below 37°C, as can be assessed by the characteristic accumulation of a 5S rRNA precursor, 9S RNA, upon a shift to a non-permissive temperature of 44°C (Apirion & Lassar, 1978). Source data are available online for this figure. ª2017 The Authors The EMBO Journal Vol 36 |No8|2017 Alexandre Smirnov et al Mechanism of ProQ-dependent sRNA The EMBO Journal 1031 B RaiZ RaiZ-ProQ - + + + + + + + + - + + + + + + + +ProQ, 15 nM - - - - 1:1 2:1 5:1 10:1 20:1 50:1 Cold RaiZ excess Cold yeast tRNA excess C RaiZ-S RaiZ-S-ProQ D 5’-UGAUCAACA G G A A AC G G CAAUAAAGUGCAGCACAAA GAAGCAGAAGAAGAGUAGUCCCU CCC A C G U U G C UGC G U A G A A A C UA UCGCC U UCG UUUU -10 1 / / / / / -20 -30 10 20 _ 30 40 50 _ / / // 70 80 100 110 / 120 _90 raiAbamD pheL pheA RaiZ RaiZ-S ProQ-3xFLAG coIP ProQ-3xFLAG lysate WT coIP WT lysate 7000 7000 1000 1000 A * 100:1 1:1 2:1 5:1 10:1 20:1 50:1 100:1 * - + + + + + + + + - + + + + + + + +ProQ, 15 nM - - - - 2:1 5:1 10:1 20:1 50:1 100:1 Cold RaiZ-S excess Cold yeast tRNA excess 500:1 2:1 5:1 10:1 20:1 50:1 100:1 500:1 / Pb(II) cleavage site RNase V1 cleavage site Pb(II) cleavage site protected by ProQ RNase V1 cleavage site protected by ProQ Ctr OH T1 0 250 500 0 250 500 nM ProQ Pb(II) RNase V1 Protected by ProQ 24 21 17 14 12 11 26 32 37 40 44 47 51 56 59 62 65 68 71 73 76 92 97 90 88 Protected by ProQ 38 103 105 111/112/113 Figure 2. The EMBO Journal Vol 36 |No8|2017 ª2017 The Authors The EMBO Journal Mechanism of ProQ-dependent sRNA Alexandre Smirnov et al 1032 In line with earlier observations showing that RaiZ efficiently interacts in vivo with Hfq (Chao et al, 2012; Smirnov et al, 2016), we confirmed the formation of a stable RaiZ-Hfq complex in vitro (Fig EV2). Therefore, RaiZ was found to engage in strong interactions with both ProQ and Hfq in vitro and in vivo (Figs 2 and EV2), which prompted us to evaluate the impact of each RNA chaperone on RaiZ stability. RaiZ was equally well produced in wild-type and Dhfq Salmonella, but failed to accumulate in a DproQ strain (Fig 3A; Smirnov et al, 2016). Analysis of the RaiZ half-life in bacteria treated with rifampicin to arrest transcription clearly indicated that of the two RNA chaperones, only ProQ was required for RaiZ stability, whereas hfq deletion did not significantly affect the half-life of the sRNA (Fig 3B). The RaiZ stability defect in DproQ could not be rescued by over expression of the sRNA even from a high-copy plasmid (Fig EV3), indicating that ProQ primarily affects the half-life of RaiZ and not the transcription of raiA. Therefore, although both RNA chaperones bind RaiZ with high affinity, only ProQ was required for its stability. ◀Figure 2. RaiZ is a ProQ-binding sRNA. A The read distribution around the Salmonella raiAZ locus for a ProQ-3xFLAG RIP-seq experiment performed in the transition phase (Smirnov et al,2016). The upper two lanes show coIP fractions obtained by immunoprecipitation with anti-FLAG antibodies from a proQ-3xFLAG and a control WT strain without a tag; the lower two lanes show the corresponding total cell lysates. The linear scale (number of reads) is shown on the left. All genes are on the same (+) strand. Representative of four independent experiments. B RaiZ/RaiZ-S specifically interacts with ProQ. Competition experiments were carried out in the presence of either specific (cold RaiZ or RaiZ-S) or nonspecific (yeast tRNA) competitors. Asterisks mark RaiZ or RaiZ-S dimers observed under these conditions. Representative of two independent experiments. CIn vitro footprinting assay of the RaiZ-S/ProQ complex. RaiZ-S is 50-labelled. Ctr, uncleaved RNA; OH, alkaline ladder; T1, RNase T1ladder. Nucleotide positions are shown on the left. Representative of two independent experiments. See also Appendix Fig S1for the footprinting assay on the long form of RaiZ. D The secondary structure of RaiZ, based on the RNAfold prediction and the structure probing data shown in (C) and Appendix Fig S1. The first nucleotide of RaiZ-S is “1”. Source data are available online for this figure. A WT ΔraiAΔRaiΖ ΔproQ Δhfq WT + pJV300 ΔproQ + pJV300 ΔproQ + pProQ raiA mRNA RaiZ RaiZ-S B Time after Rif, min 0 1 2 4 8 16 32 0 1 2 4 8 16 32 raiA mRNA proQ+ΔproQ raiA mRNA hfq+ Δhf q RaiZ RaiZ-S RaiZ RaiZ-S 5S rRNA Figure 3. RaiZ is a ProQ-dependent sRNA. A Steady-state levels of RaiZ are compromised by proQ deletion but unaffected by hfq deletion. Total RNA from the corresponding strains was isolated at the transition phase and analysed by northern blotting. DraiADRaiZ lacks the complete raiA-RaiZ locus, pJV300 is an empty control plasmid, and pProQ is a trans-complementing plasmid. B RaiZ stability was assessed in all four possible genetic backgrounds with respect to hfq and proQ genes. Cells were grown to the transition phase, rifampicin was added to arrest transcription, and total RNA samples were collected after the specified time intervals and quantified by densitometry after northern blotting. Source data are available online for this figure. ª2017 The Authors The EMBO Journal Vol 36 |No8|2017 Alexandre Smirnov et al Mechanism of ProQ-dependent sRNA The EMBO Journal 1033 RaiZ post-transcriptionally regulates hupA, encoding a histone-like protein To obtain insight into the function of RaiZ, we performed a pulseexpression analysis (Masse ´et al, 2005; Papenfort et al, 2006) with the RaiZ sequence cloned into a multicopy plasmid under the control of an arabinose-inducible promoter. RaiZ expression was induced for 10 min in the exponential phase (when the chromosomal sRNA is barely expressed; Fig 1B), followed by RNA-seq to determine expression changes on the genomewide level. We observed a reproducible 6.9 2.0-fold (mean SD) downregulation of a single mRNA encoding the a-subunit of the histone-like protein HU, hupA (Fig 4A). Since the short time of induction makes secondary effects on gene expression unlikely (Sharma & Vogel, 2009), we considered hupA a direct target of RaiZ. To validate this regulation, we overexpressed RaiZ under control of a constitutive promoter in a strain carrying a chromosomally FLAG-tagged allele of hupA (Fig 4B). In the control strain, the hupA mRNA accumulated almost exclusively in the exponential phase, whereas the corresponding protein levels remained constant throughout growth. In contrast, RaiZ overexpression affected the target at both the mRNA and protein levels, resulting in an 8.2 2.9-fold (mean SD) decrease in HU-aproduction. These results were corroborated by the use of fluorescent reporter AB C Figure 4. RaiZ negatively regulates hupA expression. A Fold changes of Salmonella RNA levels 10 min after induction of RaiZ overexpression, as measured by RNA-seq of the total RNA. Differentially regulated genes (as compared to the control) are highlighted with colour. Data points correspond to mean genewise fold changes in two independent experiments, and the bars show the range. B Constitutive expression of RaiZ leads to the downregulation of HU-aproduction. Western (upper two panels) and northern blot (lower three panels) analyses were performed on total protein and RNA isolated from a hupA-3xFLAGDraiADRaiZ strain constitutively expressing or not RaiZ. C RaiZ represses expression of a hupA fluorescent reporter construct. Constitutive expression of RaiZ specifically represses a hupA-GFP reporter containing the hupA 50UTR and the first 15 codons of the hupA CDS (constitutively expressed on a pXG10 plasmid), but does not affect a hupB-GFP reporter. Representative image from four independent experiments. See also Fig 6B for quantification of fluorescence in the same strains measured by FACS. Source data are available online for this figure. The EMBO Journal Vol 36 |No8|2017 ª2017 The Authors The EMBO Journal Mechanism of ProQ-dependent sRNA Alexandre Smirnov et al 1034 constructs (Fig 4C). When a gfp CDS was cloned in frame with 15 N-terminal residues of HU-apreceded by the hupA mRNA 50UTR and under control of a constitutive promoter, overexpression of RaiZ resulted in significantly lower fluorescence, compared to a strain carrying the empty pJV300 plasmid. RaiZ overexpression did not affect a gfp reporter preceded by an unrelated 50UTR under the control of the same constitutive promoter (Fig 4C, pXG1) or an analogously constructed hupB reporter (see also Appendix Fig S2). These data indicate that of the two subunits of HU, encoded by hupA and hupB, only HU-ais subject to post-transcriptional regulation by RaiZ, and this regulation depended on its 50UTR and/or the start codon-proximal portion of the hupA CDS. In line with above data (Fig 3), this regulation was not affected by a Dhfq mutation, suggesting that Hfq is not required for RaiZ-mediated hupA repression (Fig EV4). RaiZ is a base-pairing trans-acting sRNA Since RaiZ efficiently repressed translation of a GFP reporter preceded by the hupA 50UTR and a few start codon-proximal codons (Fig 4C), we hypothesized that RaiZ may target the RBS of the hupA mRNA, as seen with many Hfq-dependent sRNAs (De Lay et al, 2013; Vogel & Luisi, 2011). Indeed, extensive though imperfect pairing, involving a total of 23 bases on either side and covering the upstream region of the start codon, was predicted between the two RNAs (Fig 5A and Appendix Fig S2). In agreement with this prediction, the two RNAs interacted efficiently in vitro, forming a duplex with apparent K d of ~80 nM (Fig 5B), which is similar to the affinity of other predicted ProQ-dependent sRNAs for which targets are known (Darfeuille et al, 2007; Ellis et al, 2015; Han et al, 2010; Silva et al, 2013; Smirnov et al, 2016). Structure probing of the RaiZ-hupA mRNA duplex validated this targeting model (Figs 5C and EV5) and revealed several interesting features of the interaction. It showed a high degree of symmetry involving an upstream single-stranded region and a downstream stem-loop in both RNAs (Fig 5A). The stem-loop in each RNA formed base-pairing interactions with the opposite single-stranded stretch and the stem-loop of the partner, resulting in a long imperfect duplex. In RaiZ (both the long and the short forms), the sites concerned included the short hairpin upstream of the terminator and the adjacent portion of the long single-stranded spacer, whereas in the hupA mRNA they covered ~30 nucleotides of the 50UTR immediately adjacent to the start codon (Fig 5A). The perfectly base-paired central region of the duplex underwent a strong site-specific cleavage by RNase III in vitro (Figs 5C and EV5), indicative of an extensive and stable interaction. Interestingly, RaiZ-S conferred more efficient RNase III cleavage than the longer RaiZ (Fig EV5B), suggesting that the processed sRNA is particularly apt for the interaction and represents the active regulatory form of the sRNA. To verify whether the downregulation of the hupA mRNA by RaiZ relies on the same interaction in vivo, we designed mutant versions of both partners by swapping two nucleotides engaged in the strongest stretch of the intermolecular duplex (Fig 5A). The mutant RNAs failed to form stable complexes with their wild-type partners and confer the characteristic strong RNase III cleavage in the correct position in vitro (Fig EV5A and B). As expected, ectopic expression of RaiZ under the control of a constitutive promoter in a Salmonella strain lacking the raiA-RaiZ locus demonstrated that only the wild-type RaiZ and RaiZ-S were able to repress hupA expression. RaiZ and RaiZ-S containing the U81A, U82A mutations in the base-pairing region, failed to achieve a similar level of downregulation, despite accumulating to the same levels (Fig 6A). Interestingly, when using the full-size RaiZ construct, the RaiZ-S species accumulated, indicating that the long RaiZ form contains all structural elements necessary for correct RaiZ maturation. When we used our GFP reporter system to assess the effect of these nucleotide substitutions on the hupA regulation in vivo,weagain observed a significant decrease in fluorescence when both wild-type RaiZ and the hupA 50UTR-controlled gfp construct were co-expressed (Fig 6B). On the contrary, repression was completely relieved by mutations in either RaiZ (U81A, U82A) or the hupA 50UTR (A-11U, A-10U). Importantly, combination of both mutant partners, which restores base pairing, rescued wild-type levels of repression (Fig 6B). Altogether, these results prove that RaiZ downregulates hupA via a base-pairing interaction with its 50UTR near the RBS. ProQ assists RaiZ in preventing ribosome loading on the hupA mRNA The RaiZ-hupA mRNA interaction occurs very efficiently and does not require assistance of either ProQ or Hfq in vitro (Fig 5B). Nevertheless, ProQ is critically required for RaiZ stability in the cell (Fig 3). To determine whether ProQ has a role in the RaiZdependent hupA repression beyond maintaining sRNA abundance, we overexpressed RaiZ-S in the proQ + and DproQ backgrounds, which resulted in the saturation of the sRNA levels well beyond the apparent K d in both strains (Fig 7A; the estimated resulting RaiZ-S concentrations are >4lM, see Materials and Methods for further detail). Strikingly, while hupA expression was strongly repressed by RaiZ-S in the proQ + strain, the sRNA failed to fully deplete HU-ain the absence of ProQ. Analogously, whereas during the transition phase (OD 600 =2) hupA mRNA level dropped ~4-fold in the proQ + strain compared to the same strain carrying the control plasmid, it remained constant at ~75% of control in the DproQ background (Fig 7A). Therefore, although ProQ has a major impact on RaiZ stability, these results suggest that ProQ may also be required for regulation downstream of RaiZ production and the RaiZ-hupA mRNA interaction. Since RaiZ affects HU-aprotein levels to a greater extent than the mRNA (Figs 6A and 7A), we hypothesized that it primarily interferes with translation, with mRNA destabilization being a secondary consequence of lower ribosome occupancy. Using the toeprint assay, we analysed the effect of RaiZ-S on 30S ribosome loading on the hupA translation initiation region (Fig 7B). In the presence of 30S subunits and formylmethionylated initiator tRNA, a characteristic strong toeprint was observed ~15 nt upstream of the start codon, indicating the correct assembly of the translation initiation complex. Addition of RaiZ-S resulted in a small but dose-dependent decrease of the toeprint signal, demonstrating that the sRNA is capable of interfering with 30S ribosome loading, albeit not efficiently. Strikingly, simultaneous addition of both RaiZ-S and ProQ resulted in the strong suppression of the toeprint, paralleled by the appearance of a new reverse transcriptase stalling site downstream, in front of the region involved in the base pairing with RaiZ (Fig 7B). This new signal did not depend on the presence of 30S subunits or tRNA and could not be produced by ProQ alone, suggesting that it corresponds ª2017 The Authors The EMBO Journal Vol 36 |No8|2017 Alexandre Smirnov et al Mechanism of ProQ-dependent sRNA The EMBO Journal 1035 A B C Figure 5. RaiZ base pairs with the RBS of the hupA mRNA. A The RaiZ/hupA mRNA interaction, based on RNAfold and RNAcofold predictions and structure probing data in (C). The start codon is red, and A is numbered “1”. The base-pairing regions are set in blue and framed. The sites where disruptive point mutations were introduced are highlighted with colour. B EMSA of the RaiZ/hupA mRNA interaction with either RNA labelled and a nonlabelled partner. Apparent K d of the complex is ~80 nM. C Structure probing assay of the RaiZ-S/hupA mRNA duplex. hupA 50UTR and the proximal part of the CDS are 50-labelled. Nucleotide positions on the left correspond to the panel (A). Representative of two independent experiments. Source data are available online for this figure. The EMBO Journal Vol 36 |No8|2017 ª2017 The Authors The EMBO Journal Mechanism of ProQ-dependent sRNA Alexandre Smirnov et al 1036 to a tripartite complex involving the hupA 50UTR, RaiZ-S and ProQ. Indeed, a stable ternary complex was observed in electrophoretic mobility shifts assay (EMSA) in the presence of ProQ (Fig 7C). Therefore, ProQ together with the RaiZ-hupA mRNA duplex may further prevent 30S ribosomes from loading onto and initiating translation of the hupA mRNA. Discussion The vast majority of currently known ProQ-binding sRNAs are of unknown function (Smirnov et al, 2016). We have previously observed that asRNAs are enriched in the ProQ interactome, suggesting that this protein may be involved in gene expression A B Figure 6. RaiZ-hupA mRNA base pairing is necessary for hupA repression. A Constitutive expression of RaiZ leads to the downregulation of HU-aproduction only when the predicted base-pairing interaction is undisrupted. Western (upper two panels) and northern blot (lower three panels) analyses were performed on total protein and RNA isolated from a hupA-3xFLAGDraiADRaiZ strain constitutively expressing or not RaiZ/RaiZ-S. RaiZ AA /RaiZ AA -S stand for the sRNAs carrying the double U81A, U82A substitution within the base-pairing region. Asterisk shows a readthrough band coming from the expression vector. Representative of three independent experiments. B Constitutive expression of RaiZ/RaiZ-S specifically represses a hupA-GFP reporter, containing the hupA 50UTR and the first 15 codons of the hupA CDS (constitutively expressed on a pXG10 plasmid), but does not affect a hupB-GFP reporter. The RaiZ AA mutation or the mirroring hupA UU substitution (A-10U, A-11U) alleviates the repression when combined with WT partners, but they are fully compensated when combined with each other. Lower panel shows FACS quantification for three independent experiments (mean SD), *P<0.009 (two-tailed Student’st-test, FDR-adjusted). Source data are available online for this figure. ª2017 The Authors The EMBO Journal Vol 36 |No8|2017 Alexandre Smirnov et al Mechanism of ProQ-dependent sRNA The EMBO Journal 1037 Mackie GA (2013) RNase E: at the interface of bacterial RNA processing and decay. Nat Rev Microbiol 11:45 –57 Mangan MW, Lucchini S, Ó Cróinín T, Fitzgerald S, Hinton JC, Dorman CJ (2011) Nucleoid-associated protein HU controls three regulons that coordinate virulence, response to stress and general physiology in Salmonella enterica serovar Typhimurium. Microbiology 157:1075 –1087 Massé E, Vanderpool CK, Gottesman S (2005) Effect of RyhB small RNA on global iron use in Escherichia coli.J Bacteriol 187:6962 –6971 Meister G (2013) Argonaute proteins: functional insights and emerging roles. Nat Rev Genet 14:447 –459 Melamed S, Peer A, Faigenbaum-Romm R, Gatt YE, Reiss N, Bar A, Altuvia Y, Argaman L, Margalit H (2016) Global mapping of small RNA-target interactions in bacteria. Mol Cell 63:884 –897 Miyakoshi M, Chao Y, Vogel J (2015a) Cross talk between ABC transporter mRNAs via a target mRNA-derived sponge of the GcvB small RNA. EMBO J 34:1478 –1492 Miyakoshi M, Chao Y, Vogel J (2015b) Regulatory small RNAs from the 30 regions of bacterial mRNAs. Curr Opin Microbiol 24:132 –139 Mok WW, Patel NH, Li Y (2010) Decoding toxicity: deducing the sequence requirements of IbsC, a type I toxin in Escherichia coli.J Biol Chem 285: 41627 –41636 Moll I, Leitsch D, Steinhauser T, Blasi U (2003) RNA chaperone activity of the Sm-like Hfq protein. EMBO Rep 4:284 –289 Moller T, Franch T, Hojrup P, Keene DR, Bachinger HP, Brennan RG, ValentinHansen P (2002) Hfq: a bacterial Sm-like protein that mediates RNA-RNA interaction. Mol Cell 9:23 –30 Morita T, Mochizuki Y, Aiba H (2006) Translational repression is sufficient for gene silencing by bacterial small noncoding RNAs in the absence of mRNA destruction. Proc Natl Acad Sci USA 103:4858 –4863 Motulsky HJ (2014)Intuitive biostatistics. New York: Oxford University Press Naville M, Gautheret D (2010) Premature terminator analysis sheds light on a hidden world of bacterial transcriptional attenuation. Genome Biol 11: R97 Nechooshtan G, Elgrably-Weiss M, Sheaffer A, Westhof E, Altuvia S (2009)A pH-responsive riboregulator. Genes Dev 23:2650 –2662 Nichols RJ, Sen S, Choo YJ, Beltrao P, Zietek M, Chaba R, Lee S, Kazmierczak KM, Lee KJ, Wong A, Shales M, Lovett S, Winkler ME, Krogan NJ, Typas A, Gross CA (2011) Phenotypic landscape of a bacterial cell. Cell 144: 143 –156 Oberto J, Nabti S, Jooste V, Mignot H, Rouviere-Yaniv J (2009) The HU regulon is composed of genes responding to anaerobiosis, acid stress, high osmolarity and SOS induction. PLoS One 4:e4367 van der Oost J, Westra ER, Jackson RN, Wiedenheft B (2014) Unravelling the structural and mechanistic basis of CRISPR-Cas systems. Nat Rev Microbiol 12:479 –492 Padalon-Brauch G, Hershberg R, Elgrably-Weiss M, Baruch K, Rosenshine I, Margalit H, Altuvia S (2008) Small RNAs encoded within genetic islands of Salmonella Typhimurium show host-induced expression and role in virulence. Nucleic Acids Res 36:1913 –1927 Papenfort K, Pfeiffer V, Mika F, Lucchini S, Hinton JC, Vogel J (2006) SigmaEdependent small RNAs of Salmonella respond to membrane stress by accelerating global omp mRNA decay. Mol Microbiol 62:1674 –1688 Papenfort K, Said N, Welsink T, Lucchini S, Hinton JC, Vogel J (2009) Specific and pleiotropic patterns of mRNA regulation by ArcZ, a conserved, Hfqdependent small RNA. Mol Microbiol 74:139 –158 Papenfort K, Sun Y, Miyakoshi M, Vanderpool CK, Vogel J (2013) Small RNAmediated activation of sugar phosphatase mRNA regulates glucose homeostasis. Cell 153:426 –437 Papenfort K, Forstner KU, Cong JP, Sharma CM, Bassler BL (2015a) Differential RNA-seq of Vibrio cholerae identifies the VqmR small RNA as a regulator of biofilm formation. Proc Natl Acad Sci USA 112:E766 –E775 Papenfort K, Espinosa E, Casadesus J, Vogel J (2015b) Small RNA-based feedforward loop with AND-gate logic regulates extrachromosomal DNA transfer in Salmonella.Proc Natl Acad Sci USA 112:E4772 –E4781 Pfeiffer V, Sittka A, Tomer R, Tedin K, Brinkmann V, Vogel J (2007) A small non-coding RNA of the invasion gene island (SPI-1) represses outer membrane protein synthesis from the Salmonella core genome. Mol Microbiol 66:1174 –1191 Pfeiffer V, Papenfort K, Lucchini S, Hinton JC, Vogel J (2009) Coding sequence targeting by MicC RNA reveals bacterial mRNA silencing downstream of translational initiation. Nat Struct Mol Biol 16:840 –846 Plumbridge JA, Dondon J, Nakamura Y, Grunberg-Manago M (1985) Effect of NusA protein on expression of the nusA,infB operon in E. coli.Nucleic Acids Res 13:3371 –3388 Richter AS, Schleberger C, Backofen R, Steglich C (2010) Seed-based INTARNA prediction combined with GFP-reporter system identifies mRNA targets of the small RNA Yfr1.Bioinformatics 26:1–5 Romilly C, Caldelari I, Parmentier D, Lioliou E, Romby P, Fechter P (2012) Current knowledge on regulatory RNAs and their machineries in Staphylococcus aureus.RNA Biol 9:402 –413 Salvail H, Caron MP, Belanger J, Massé E (2013) Antagonistic functions between the RNA chaperone Hfq and an sRNA regulate sensitivity to the antibiotic colicin. EMBO J 32:2764 –2778 Sauer E, Weichenrieder O (2011) Structural basis for RNA 30-end recognition by Hfq. Proc Natl Acad Sci USA 108:13065 –13070 Schu DJ, Zhang A, Gottesman S, Storz G (2015) Alternative Hfq-sRNA interaction modes dictate alternative mRNA recognition. EMBO J 34: 2557 –2573 Sexton JA, Vogel JP (2004) Regulation of hypercompetence in Legionella pneumophila.J Bacteriol 186:3814 –3825 Sharma CM, Darfeuille F, Plantinga TH, Vogel J (2007) A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites. Genes Dev 21:2804 –2817 Sharma CM, Hoffmann S, Darfeuille F, Reignier J, Findeiss S, Sittka A, Chabas S, Reiche K, Hackermuller J, Reinhardt R, Stadler PF, Vogel J (2010) The primary transcriptome of the major human pathogen Helicobacter pylori. Nature 464:250 –255 Sharma CM, Papenfort K, Pernitzsch SR, Mollenkopf HJ, Hinton JC, Vogel J (2011) Pervasive post-transcriptional control of genes involved in amino acid metabolism by the Hfq-dependent GcvB small RNA. Mol Microbiol 81: 1144 –1165 Sharma CM, Vogel J (2009) Experimental approaches for the discovery and characterization of regulatory small RNA. Curr Opin Microbiol 12:536 –546 Silva IJ, Ortega AD, Viegas SC, Garcia-Del Portillo F, Arraiano CM (2013)An RpoS-dependent sRNA regulates the expression of a chaperone involved in protein folding. RNA 19:1253 –1265 Sittka A, Lucchini S, Papenfort K, Sharma CM, Rolle K, Binnewies TT, Hinton JC, Vogel J (2008) Deep sequencing analysis of small noncoding RNA and mRNA targets of the global post-transcriptional regulator, Hfq. PLoS Genet 4:e1000163 Skunca N, Bosnjak M, Krisko A, Panov P, Dzeroski S, Smuc T, Supek F (2013) Phyletic profiling with cliques of orthologs is enhanced by signatures of paralogy relationships. PLoS Comput Biol 9:e1002852 Smirnov A, Forstner KU, Holmqvist E, Otto A, Gunster R, Becher D, Reinhardt R, Vogel J (2016) Grad-seq guides the discovery of ProQ as a major small RNA-binding protein. Proc Natl Acad Sci USA 113:11591 –11596 The EMBO Journal Vol 36 |No8|2017 ª2017 The Authors The EMBO Journal Mechanism of ProQ-dependent sRNA Alexandre Smirnov et al 1044 Sobrero P, Valverde C (2012) The bacterial protein Hfq: much more than a mere RNA-binding factor. Crit Rev Microbiol 38:276 –299 Sonnleitner E, Sorger-Domenigg T, Madej MJ, Findeiss S, Hackermüller J, Hüttenhofer A, Stadler PF, Bläsi U, Moll I (2008) Detection of small RNAs in Pseudomonas aeruginosa by RNomics and structure-based bioinformatic tools. Microbiology 154:3175 –3187 Soper T, Mandin P, Majdalani N, Gottesman S, Woodson SA (2010) Positive regulation by small RNAs and the role of Hfq. Proc Natl Acad Sci USA 107: 9602 –9607 Thomason MK, Storz G (2010) Bacterial antisense RNAs: how many are there, and what are they doing? Annu Rev Genet 44:167 –188 Tree JJ, Granneman S, McAteer SP, Tollervey D, Gally DL (2014) Identification of bacteriophage-encoded anti-sRNAs in pathogenic Escherichia coli.Mol Cell 55:199 –213 Udekwu KI, Wagner EG (2007) Sigma E controls biogenesis of the antisense RNA MicA. Nucleic Acids Res 35:1279 –1288 Updegrove TB, Shabalina SA, Storz G (2015) How do base-pairing small RNAs evolve? FEMS Microbiol Rev 39:379 –391 Updegrove TB, Zhang A, Storz G (2016) Hfq: the flexible RNA matchmaker. Curr Opin Microbiol 30:133 –138 Urban JH, Vogel J (2007) Translational control and target recognition by Escherichia coli small RNAs in vivo.Nucleic Acids Res 35:1018 –1037 Uzzau S, Figueroa-Bossi N, Rubino S, Bossi L (2001) Epitope tagging of chromosomal genes in Salmonella.Proc Natl Acad Sci USA 98: 15264 –15269 Vogel J, Argaman L, Wagner EG, Altuvia S (2004) The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide. Curr Biol 14:2271 –2276 Vogel J, Luisi BF (2011) Hfq and its constellation of RNA. Nat Rev Microbiol 9: 578 –589 Wagner EG, Romby P (2015) Small RNAs in bacteria and archaea: who they are, what they do, and how they do it. Adv Genet 90:133 –208 Wassarman KM, Storz G (2000)6S RNA regulates E. coli RNA polymerase activity. Cell 101:613 –623 Waters SA, McAteer SP, Kudla G, Pang I, Deshpande NP, Amos TG, Wen Leong K, Wilkins MR, Strugnell R, Gally DL, Tollervey D, Tree JJ (2016) Small RNA interactome of pathogenic E. coli revealed through crosslinking of RNase E. EMBO J 36:374 –387 Westermann AJ, Forstner KU, Amman F, Barquist L, Chao Y, Schulte LN, Muller L, Reinhardt R, Stadler PF, Vogel J (2016) Dual RNA-seq unveils noncoding RNA functions in host-pathogen interactions. Nature 529: 496 –501 Zhang A, Wassarman KM, Ortega J, Steven AC, Storz G (2002) The Sm-like Hfq protein increases OxyS RNA interaction with target mRNAs. Mol Cell 9: 11 –22 License: This is an open access article under the terms of the Creative Commons Attribution 4.0 License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. ª2017 The Authors The EMBO Journal Vol 36 |No8|2017 Alexandre Smirnov et al Mechanism of ProQ-dependent sRNA The EMBO Journal 1045