The cargo protein MAP17 (PDZK1IP1) regulates the cancer stem cell pool activating the Notch pathway by abducting NUMB

Biology of Human Tumors The Cargo Protein MAP17 (PDZK1IP1) Regulates the Cancer Stem Cell Pool Activating the Notch Pathway by Abducting NUMB Jose Manuel Garcia-Heredia 1,2,3 , Antonio Lucena-Cacace 1,3 , Eva M. Verdugo-Sivianes 1,3 , Marco P erez 1,3 , and Amancio Carnero 1,3 Abstract Purpose: Cancerstemcells (CSC) are self-renewing tumor cells, with the ability to generate diverse differentiated tumor cell subpopulations. They differ from normal stem cells in the deregulation of the mechanisms that normally control stem cell physiology. CSCs are the origin of metastasis and highly resistant to therapy. Therefore, the understanding of the CSC origin and deregulated pathways is important for tumor control. Experimental Design: We have included experiments in vitro, in cell lines and tumors of different origins. We have used patientderived xenografts (PDX) and public transcriptomic databases of human tumors. Results: MAP17 (PDZKIP1), a small cargo protein overexpressedintumors,interactswithNUMB through thePDZ-binding domain activating the Notch pathway, leading to an increase in stem cell factors and cancer-initiating–like cells. Identical behavior was mimicked by inhibiting NUMB. Conversely, MAP17 downregulation in a tumor cell line constitutively expressing this geneled to Notchpathwayinactivationanda marked reduction of stemness. In PDX models, MAP17 levels directly correlated with tumorsphere formation capability. Finally, in human colon, breast, or lung there is a strong correlation of MAP17 expression with a signature of Notch and stem cell genes. Conclusions: MAP17 overexpression activates Notch pathway by sequestering NUMB. High levels of MAP17 correlated with tumorsphere formation and Notch and Stem gene transcription. Its direct modification causes direct alteration of tumorsphere number and Notch and Stem pathway transcription. This defines a new mechanism of Notch pathway activation and Stem cell pool increase that may be active in a large percentage of tumors. Clin Cancer Res; 23(14); 3871–83. 2017 AACR. Introduction MAP17 (DD96, PDZKIP1) is a small (17 kDa), nonglycosylated membrane-associated protein located on the plasma membrane and the Golgi apparatus (1–3) of the proximal tubule cells of the kidney. It contains two transmembrane regions and a hydrophobic C-terminus that encodes a PDZ-binding domain, that allow its interaction with several PDZ domain–containing proteins, like PDZK1 (4–7). MAP17 overexpression enhances tumorigenic properties of tumor cells, with increased proliferation, reduced apoptosis, increased colony formation in soft agar, and increased growth ratios in tumors in nude mice (8, 9). MAP17 is overexpressed in a great variety of human carcinomas (10, 11). In many tumors, including glioblastomas, lymphomas, and cervical, breast, prostate, and ovarian carcinomas, MAP17 overexpression is strongly correlated with tumoral progression (7, 11, 12). While adenomas and benign tumors, as well as normal tissues, rarely express MAP17, a high proportion (50%–90%) of late-stage or metastatic tumors show high levels of MAP17, correlating with a more dedifferentiated phenotype (7, 9, 12). These findings highlight the relevance of this gene in tumorigenic process and tumor development. Increasing evidence has shown that Notch signaling regulates aspects of asymmetric division and stemness (13). Aberrant Notch signaling is found in most types of cancers, either carcinomas or those of mesenchymal origin (14,15). Notch activation depends on the interaction of ligand receptors between neighboring cells, being followed by g-secretase cleavage, releasing the active form of the Notch intracellular domain (NICD). Upon its release, NICD translocates to the nucleus, forming a ternary complex with CSL and Mastermind-Like 1 (MAML1) to transactivate its target genes, including HES and HEY gene families (13, 16). NUMB has an antagonistic influence on Notch pathway, inhibiting Notch signaling by binding directly to the NICD domain, thus preventing its access to the nucleus (17–20). NUMB is also able to directly inhibit Notch by recruiting ITCH to polyubiquitinate Notch (21). The mechanism responsible for the increased tumorigenicity of cells expressing MAP17 is not known yet. To precisely identify the molecular mechanism induced by MAP17 that increases cell tumorigenic properties, we performed a search for MAP17 partners, finding that NUMB physically interacts with MAP17. This 1 Instituto de Biomedicina de Sevilla, IBIS/Hospital Universitario Virgen del Rocio/Universidad de Sevilla/Consejo Superior de Investigaciones Cientificas, Seville, Spain. 2 Department of Vegetal Biochemistry and Molecular Biology, University of Seville, Seville, Spain. 3 CIBER de Cancer, Seville, Spain. Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/). Corresponding Author: Amancio Carnero, Instituto de Biomedicina de Sevilla/ HUVR, CSIC, Hospital Universitario Virgen del Rocio, Avenida Manuel Siurot s/n, Seville 41013, Spain. Phone: 349-5592-3111; Fax: 349-5592-3101; E-mail: [email protected] doi: 10.1158/1078-0432.CCR-16-2358 2017 American Association for Cancer Research. Clinical Cancer Research www.aacrjournals.org 3871 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358 physical interaction leads to a mislocalization of NUMB, which increases nuclear NICD, and consequent Notch pathway activation. As a consequence, MAP17-expressing cells increase the presence of stem-related transcription factors along with the stemness of tumor cells. Materials and Methods All methods were performed in accordance with the relevant guidelines and regulations of the Institute for Biomedical Research of Seville (IBIS, Seville, Spain) and University Hospital Virgen del Rocio (HUVR, Seville, Spain). Bacterial strains, yeast strains, and plasmids MAP17, previously cloned into pBabe-puro (12), was cloned into plasmid pGBKT7 using EcoRI-BamHI sites. To test MAP17 C-terminal deletions, an opal STOP codon was introduced by mutagenic PCR in DNA sequence corresponding to amino acids 71, 102, and 110, obtaining the pGBKT7-MAP17 FL , pGBKT7tMAP17,pGBKT7-MAP17 70 ,and pBKT7-MAP17 110 vectors.Truncated MAP17 (tMAP17) was also obtained by mutagenic PCR in pBabe-puro plasmids. NUMB was amplified from pCMV6-XL5NUMB (SC301023, Origene) and cloned into pGADT7 vector using EcoRI-BamHI sites. As a result, MAP17 was fused to the C-terminus of GAL4-binding domain and NUMB to the C-terminus of GAL4 activation domain. All vectors were amplified using E. coli DH5astrain. Y187 and Y2HGold yeast strains were used for yeast two-hybrid assays. To downregulate NUMB expression, short hairpin RNA (shRNA) against NUMB or scrambled sequence control in pB-RS vectors were obtained from Origene (TR311064). Cells were transfected with shRNA plasmids and selected with 2 mgmL 1 of hygromycin. After selection, two of the four shRNAs against NUMB were selected, shNb2 (TCAGCAGACAGGCATACAGAGGTTCCTAC) and shNb4 (shN in the text; ATCATTCCGTGTCACAACAGCCACTGAAC), after Western blot analysis and qPCR analysis. MAP17 shRNA was previously described (22). Yeast two-hybrid analysis Y2HGold strain was transformed with all MAP17-expressing fusion vectors, while Y187 strain was transformed with NUMBexpressing fusion vector. Briefly, yeast cells were diluted in 150 mL of 35% PEG 5000, 0.2 mol/L lithium acetate, and 0.1 mol/L dithiothreitol (DTT), transformed with 1 mg of each vector by incubating the cells for 45 minutes at 45C and centrifuged at 550 rpm. Y2HGold cells were plated in synthetic defined (SD) medium without Trp, while Y187 cells were plated in SD medium without Leu. Colonies grew for 5 days at 30C. For mating, Y2HGold-MAP17 cells were mixed with Y187-NUMB cells in YPD and cultured for 3 days at 30C. Subsequently, cells were resuspended in sterile water, after measuring OD 600nm . This allowed seeding a similar number of cells in SD plates in four selective conditions: without Trp, Leu nor His; without Trp, Leu, His nor Ade, and the same plates plus X-a-Galactose. Cells grew for other 5 days at 30C. Cell lines and cellular assays T47D, HeLa, Calu3, and 293T cells were obtained from the European Collection of Authenticated Cell Cultures (ECACC) commercial repository at the beginning of this study. No further authenticationwas performedinthese celllines. Commercial cells were maintained in DMEM (Sigma) while AA, AX, and AW cells, derived from sarcoma patients, were maintained in F10 medium (Sigma). All cultures were supplemented with 10% FBS (Life Technologies), penicillin, streptomycin, and fungizone (23). Clonogenicity assays, Holoand paraclone analysis (24), colonies in soft agar, and tumorspheres analysis were performed as described previously (25, 26). Tumor samples Tumor tissues were obtained via surgical resection of sarcomas performed at Virgen del Rocio Hospital (Seville, Spain) after the patient provided written informed consent according to a protocolapproved bythelocal ethicscommittee(CEI2013/PI002). The experiments were performed according to the European guidelines for laboratory animal care. This study was approved by the IBIS Institutional Animal Care and Use Committee. Patient-derived xenograft and the generation of sarcoma cells Sarcoma patient-derived xenografts (PDX) were processed as indicated in ref. 27. Upon reaching a size of 1,500 mm 3 , the mice were euthanized, and the tumors were used to obtain cells to perform tumorsphere experiment. Briefly, tumors were cut in small pieces and cultured in 6-cm 2 plates with 1 mL of F10 for 24 hours, to allow the attachment of cells to the plate. After that, another 2 mL of F10 medium was added to the plate, and the cells grew for a week before performing the tumorsphere experiment, as described before, using 10,000 cells per well. The investigator was blinded to the data from MAP17 levels and therefore to the outcome. Protein isolation and nuclei purification Protein extracts and nuclei purification for Western Blot analysis were obtained as described previously (25). Coimmunoprecipitation and Western blot analysis For coimmunoprecipitation assays and Western blot detection, antibodiesagainstNUMB(ab4147,Abcam)wereusedat1 mg/mL. For Western blot detection, we used MAP17 (MABC522, Merck, 1:500 dilution), Notch (Santa Cruz Biotechnology, s-6014-R, 1:200 dilution), and hnRNP C1/C2 (4F4; Santa Cruz Biotechnology, sc-32308, 1:400 dilution) antibodies. a-Tubulin (T9026, Translational Relevance We report that the increase in MAP17 sequestrates NUMB, leading to Notch pathway activation. As a consequence, MAP17-expressing cells increase the stem-related transcription factors along with the stemness of tumor cells. Therefore, increased MAP17 levels might contribute in a causal form to the progression of cancer by increasing the plasticity of the cancer stem cell (CSC) compartment and by conferring higher rates of conversion from progenitors to CSCs. This is the first time this new mechanism of tumor cell dedifferentiation to CSChasbeenproposed.Ourexperimentscover,invitro,incells, in vivo and in human tumor samples, and confirmed in direct patient-derived xenografts and in many public transcriptomic databases of human tumors. These are truly new findings that explore a new pathway for Notch, and cancer stem cell activation, which may affect more than 50% of all tumors. Garcia-Heredia et al. Clin Cancer Res; 23(14) July 15, 2017 Clinical Cancer Research3872 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358 Sigma) was used as a control. Horseradish peroxidase–labeled rabbit anti-mouse (ab97046, Abcam, diluted 1:5,000) and goat anti-rabbit (ab97051, Abcam, diluted 1:5,000) secondary antibodies were used. To detect MAP17–NUMB interaction, anti-NUMB antibodies were incubated with protein G-Sepharose beads and incubated at 4C for 3 hours. HeLa or T47D cell extract (2 mg; either overexpressing MAP17 or not) were added to the beads in a final volume of 1 mL and incubated at 4C for 16 hours. The beads were washed twice with RIPA buffer and once with cold PBS. Western blot analyses were performed as described previously (28, 29). NICD quantification and proximity ligation assays Cells were cultured onto glass coverslips in 6-well plates, for 36 hours, washed with PBS, and fixed with PBS þ4% paraformaldehyde for 20 minutes, and washed twice with PBS. Cells were permeabilized with PBS þ0.5% Triton X-100 for 5 minutes, washed twice with PBS, and blocked with PBS þ0.1% Triton X-100 þ3% BSA for 30 minutes at room temperature. Then, antiNUMB (ab14140, Abcam) or anti-NICD (ab8925, Abcam) were added to cells, in 1 mL of PBS þ0.1% Triton X-100 þ3% BSA at a final concentration of 1 mg/mL and incubated at 4C for 6 hours with gentle stirring. After that, samples incubated with antiNUMB were washed three times with PBS þ1% Triton X-100 for 5 minutes each, and anti-MAP17 (9, 10), was added to cells in 1 mL of PBS þ1% Triton X-100 at a final concentration of 2 mg/mL, being incubated overnight at 4C with gentle stirring. After that, coverslips were washed four times with PBS þ1% Triton X-100 for 5 minutes each time, with a final wash with PBS for 5 minutes. For NICD quantification immunofluorescence assays, Alexa Fluor goat anti-rabbit IgG (A-11008, Life Technologies) was added at a 1:250 dilution to the cells in 1 mL of PBS þ0.1% Triton X-100 þ3% BSA and incubated in dark at room temperature for 2 hours with gentle stirring. Cells were then washed three times (5 minutes each) with PBS þ0.1% Triton X-100. Finally, coverslips were mounted on a slide with a drop of mounting solution (Prolong Gold Antifade, Life Technologies) and dried. NICD images were acquired with a Leica TCS-SP2-AOBS-UV confocal microscope by sequential scanning of the emission channels. Nuclear NICD was quantified using ImageJ software and expressed as the fluorescence in nuclei relative to the normalized cytoplasm fluorescence. For proximity ligation assay (PLA) labeling, we followed manufacturer's instructions (DUO92101, Sigma). Images were acquired with a Leica TCS-SP2-AOBS confocal microscope. The number of interactions between NUMB and MAP17 was quantified using ImageJ software. Analysis of gene transcription Total RNA was purified as described previously (25). To detect changes in gene expression, we used the following probes, all from Life Technologies: MAP17 (Hs00906696_m1), HES1 (Hs00172878_m1), HES5 (Hs01387463_g1), KLF7 (Hs00748636_s1), ID2 (Hs04187239_m1), GLI1 (Hs01110766_m1), KLF4 (Hs00358836_m1), SOX9 (Hs01001343_g1), NANOG (Hs04260366_g1), OCT4 (Hs00999632_g1), NUMB (Hs01105433_m1), and GAPDH (Hs03929097_g1). Quantitative PCR was performed as described previously (25). FACS analysis LabelingofHeLAandT47Dcellswithantibodies against CD44, CD24, and CD133, and its detection by FACS was performed as described previously (25). Bioinformatics analysis To detect correlations between MAP17 and genes related to Notch pathway or stem cell genes, a total of 28 databases of different tumors (breast, lung, colon, and cervix; Supplementary Table S1) were analyzed using R2 software (Genomics Analysis and Visualization Platform, http://r2.amc.nl). All datasets are freely available in R2 webpage. To perform these correlations, MAP17 (Pdzk1ip1, 219630_at) was used to find correlations with all the genes that appear in each database, fixing a Pvalue lower than 0.05 to find statistically significant correlations. Probe 219630_at, which corresponds to MAP17, was used for all Affymetrix datasets, with the exception of TCGA and Budinska datasets, where we used the unique probe for MAP17 gene. Transcriptomic analysis of MAP17 in human tumors Correlations for MAP17 and associated genes were determined through analysis of the GSE34053, GSE20916, GSE39395, GSE14773, Lung Adenocarcinoma TCGA 515 dataset, and Tumor Breast Carcinoma TCGA 1097 public dataset available at Gene Expression Omnibus. The public array analyses were performed using the R package Bioconductor (http:// bioconductor.org). Our analysis tools incorporated functionalities from several other R packages as follows: Geo Query, AFFY, AFFYPLM, GENEFILTER, and LIMMA. For preprocessing, we used AFFY tool applying rma methods for background correction, quantile method for data normalization, PMonly for PM–MM correction and median-polish for aggregation. Differential gene expression was calculated using Bayesian modeling provided by limma package tool. Adenocarcinoma TCGA 515 dataset and Tumor Breast Carcinoma TCGA 1097 were analyzed by automatized tools provided at Oncomine (Compendia Biosciences, www.oncomine.org), R2: Genomics Analysis and Visualization Platform (http://r2.amc.nl/). Results MAP17 physically interacts with NUMB To precisely identify the molecular mechanism induced by MAP17 that increases the tumorigenic properties of cells, we performed a yeast two-hybrid screening for MAP17 partners, identifying NUMB as MAP17 interactor. To confirm this physical interaction in cells, we overexpressed full-length MAP17 and immunoprecipitated it with NUMB antibodies, finding that MAP17 also binds to NUMB in human cells (Fig. 1A). To characterize MAP17–NUMB interaction, we generated several mutants of MAP17 by cutting different regions of the C-terminus, which contain the PDZ-binding domain (Fig. 1B). Two of these mutants were specific for the PDZ-binding domain. MAP17(1–110) lacked only the last 4 amino acids, and MAP17(1–101) lacked the last 13 amino acids. Furthermore, we generated a MAP17(1–70) mutant lacking the entire intracellular region of MAP17. We then explored their interaction with NUMB in using yeast two-hybrid system interactions (Fig. 1C). We found that MAP17–NUMB interaction was disrupted only for MAP17(1–101) and MAP17(1–70) mutants, MAP17(1–101) being the mutant lacking the smallest region MAP17 Activates Notch www.aacrjournals.org Clin Cancer Res; 23(14) July 15, 2017 3873 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358 unable to bind NUMB, so we referred to it as tMAP17 (truncated MAP17) in the following sections. To confirm the MAP17–NUMB interaction in cell, we used the in situ PLA which allows direct detection of in vivo protein interactions with high specificity and sensitivity. Protein interaction can be readily detected and localized with single molecule resolution and objectively quantified in vivo (30). To this end, we overexpressed the vector only (EV), MAP17, or tMAP17 in HeLa and T47D cells (Fig. 1D; see also Supplementary Fig. S1). After selection, we performed an in situ PLA and found a clear interaction of MAP17 with NUMB; however, this interaction was not detected with tMAP17 (Fig. 1E and F). MAP17 oncogene overexpression activates the Notch pathway Next, we examined the functional relevance of this interaction. NUMB antagonizes Notch signaling activities by the ubiquitination of the membrane-bound Notch receptor and the subsequent degradation of NICD following receptor activation. Therefore, if MAP17 has a functional role involving NUMB, its overexpression should alter Notch pathway. To determine this, we measured NICD nuclear levels by immunofluorescence in cells overexpressing MAP17, EV, or tMAP17 using NICD antibodies (Fig. 2A). We observed an increased intensity of NICD in the nucleus of cells overexpressing MAP17, showing in EV or tMAP17 cells a similar lower intensity of nuclear NICD, as was confirmed after nuclear signal quantification by ImageJ software (Fig. 2B). To confirm this finding, we performed nuclear fractionation, and levels of nuclear NICD were determined, detecting that nuclei of MAP17-expressing cells contained more nuclear NICD than control cells (Fig. 2C). In addition to the known HES1 gene as target of Notch pathway, other target genes also include HES5, KLF7, and ID2 (31). Furthermore, the Notch target HES1 is a repressive transcription factor that binds the first intron of GLI1 and inhibits its expression (32). We measured the levels of these Notch-dependent transcripts in EV, MAP17, or tMAP17 cells, finding increased transcripts levels of HES1 and HES5 in MAP17-expressing cells compared with expression in EV and tMAP17 cells (Fig. 2D). Furthermore, genes that should be repressed under Notch activation, such as KLF7 and GLI1, showed lower levels of transcription in MAP17-expressing cells (Fig. 2D). These results were identicalin bothcelllines, confirmingthatMAP17overexpression activates Notch pathway. Only ID2 showed a different behavior, showing the expected decrease in transcription only for HeLa cells and an increment in T47D cells, maybe due to cell line–specific reasons. MAP17 oncogene overexpression activates the CSC phenotype Notch target genes have been connected with the maintenance of the cell's potential for self-renewal, suggesting that Notch pathway activation triggers the production of stem transcription factors (33). Cancer stem cells (CSC), or cancer-initiating cells, show an increase in stem cell factors, such as OCT4, NANOG, SOX9, and KLF4 (34, 35). Therefore, we analyzed the effect of MAP17 overexpression on these CSC markers, observing that cells overexpressing MAP17 contained significantly increased mRNA levels of all these stem cell transcripts (Fig. 3A). To confirm the cancer stem–like phenotype of MAP17-expressing cells, we measured cellular subpopulations showing CSC surface markers. T47D is a mammary tumor cell, its CSC Figure 1. NUMB interacts in vivo with the C-terminal domain of MAP17. A, Coimmunoprecipitation of NUMBMAP17 obtained from HeLa or T47D cell extracts transfected with EV or MAP17. B, The four MAP17 genes used for Y2H assays. For MAP17-FL, the last four amino acids (C-terminal PDZ-binding domain) are highlighted. C, Yeast twohybrid analysis (Y2H) results showing positive interaction between NUMB and the C-terminal domain of MAP17. The deletion of 13 amino acids in C-terminal domain breaks the interaction between both proteins (–HWL: plates without histidine, tryptophan, or leucine, -Ade: without adenine). D, Expression of MAP17 measured by qPCR assays. E, Confocal microscopy of PLA of HeLa or T47D cells transfected with EV, MAP17, or tMAP17 vectors. F, Number of PLA events per cell, showing statistically significant differences between cells overexpressing MAP17 relative to EV or tMAP17 cells. All experiments were repeated a minimum of three independent times in triplicate. Student ttest statistical analysis of the data was performed to find statistical differences (,P<0.01; ,P<0.001). EV, empty vector; M17, full-length Map17; tM17, truncated MAP17; Nb, NUMB. Garcia-Heredia et al. Clin Cancer Res; 23(14) July 15, 2017 Clinical Cancer Research3874 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358 Figure 2. MAP17 overexpression increases NICD levels in nuclei. A, Confocal microscopy of HeLa or T47D cells transfected with EV, MAP17, or tMAP17 vectors. Arrowheads indicate individual cells with higher nuclear NICD. B, Relative fluorescence of nuclei normalized to cytoplasm fluorescence of individual cells was determined for a minimum of 180 cells from each condition. Cells overexpressing MAP17 showed significantly higher levels of nuclear NICD (P<0.05). C, NICD nuclear distribution detected by WB in HeLa or T47D cells transfected with EV, MAP17, or tMAP17 vectors. D, qPCR analysis of Notch pathway genes in HeLa and T47D cells. The results are the average of at least four independent experiments performed in triplicate samples. Student ttest statistical analysis of the data was performed to find statistical differences (,P<0.05; ,P<0.01; ,P<0.001). EV, empty vector; M17, full-length Map17; tM17, truncated Map17. MAP17 Activates Notch www.aacrjournals.org Clin Cancer Res; 23(14) July 15, 2017 3875 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358 subpopulation described as CD44 þ /CD24  (28, 36), while HeLa CSC subpopulation has been described as CD133 þ . Therefore, we measured these subpopulations in EV, MAP17, or tMAP17 cells. Both in HeLaand T47D-overexpressing MAP17 cells, we found an increase in these surface markers compared with EV or tMAP17 cells (Fig. 3B and C). Figure 3. Overexpression of MAP17 increases CSC markers. A, qPCR analysis of stem cell genes in HeLa and T47D cells. The results are the average of at least four independent experiments performed in triplicate samples. B, Analytic FACS to identify the CD133 þ subpopulation for HeLa cells. C, Analytic FACS to identify the CD44 þ /CD24  subpopulation for T47D cells. D, HeLa and T47D cell tumorspheres. E, Percentage and area of the tumorspheres obtained from HeLa or T47D cells, showing that MAP17 overexpression induces a higher percentage of tumorspheres in both cell lines. F, Bright-field microscopy of a typical holoclone, meroclone, or paraclone of HeLa or T47D cells. G, Percentage of each type of clone. At least 150 individual clones, in triplicate, were analyzed. Student ttest statistical analysis of the data was performed to find statistical differences (,P<0.05; ,P<0.01; ,P<0.001). EV, empty vector; M17, full-length Map17; tM17, truncated Map17. H, Effects of MAP17 knockdown by shRNA in Calu3 cells. shRNA directed against MAP17 efficiently downregulates MAP17 expression in Calu3 cells, measured by qPCR. I, qPCR analysis of Notch pathway genes in Calu3 cells expressing scrambled RNA (scr) or shRNA directed against MAP17 mRNA (shMAP17). The results are the average of at least three independent experiments. J, qPCR analysis of stem cell genes in Calu3 cells. K, shRNAs directed against MAP17 increases the number of holoclones. L, Percentage of tumorspheres obtained from Calu3 cells, showing that MAP17 downregulation induces a lower number of tumorspheres. The results are the average of at least three independent experiments. Student t test statistical analysis of the data was performed to find statistical differences (,P<0.05; ,P<0.01; ,P<0.001). Garcia-Heredia et al. Clin Cancer Res; 23(14) July 15, 2017 Clinical Cancer Research3876 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358 To analyze the possible role of increased MAP17 levels on the CSCphenotype,wealso measured the formation of tumorspheres and clonal growth, commonly associated to the cancer-initiating cell phenotype and the ability to generate new colonies. The last experiment allows distinguishing between holoclones, cells considered derived from stem cells; paraclones, differentiated cells incapable to reconstitute a culture; and meroclones, with intermediate properties between holoand paraclones (24, 26, 37). Human tumor cell populations can be maintained in serum-free suspension cultures, growing as clusters of cells called "tumorspheres" (38). These tumorspheres display some self-renewal ability upon disaggregation, being enriched with multi-potent epithelial progenitors (34) and an increase in the expression of CSC markers (35). Therefore, we measured whether MAP17 overexpression alters the ability of tumor cancer cell lines to form tumorspheres. EV, MAP17, or tMAP17 cells were subjected to disaggregation. Theresultingsingle-cellsuspensionwasseededincompletemedia, allowing to grow during 5 days to form tumorspheres (Fig. 3D). In both cell lines, the number of tumorspheres was significantly increased only in MAP17-overexpressing cells (Fig. 3E). Cell lines generated from carcinomas consistently produce in vitro colony patterns similar to those produced by the stem cells of normal epithelia. On the basis of the different types of colony morphologies formed, it is possible to predict some stem cell characteristics (24). Several findings now suggest that malignant cell lines may in fact retain patterns of stem cell behavior (37, 39–41). For example, malignant cell lines derived from holoclones contain subpopulations of cells with putative stem cell characteristics (24, 37). Therefore, we measured whether MAP17 overexpression alters the ability of both cancer cell lines to form holoclones. Trypsinized cells were seeded at low density and grew for 14–20days.Afterthat,we analyzed the phenotypic characteristics of the individual colonies and the holoclones counted, observing a significant increase holoclone percentage due to MAP17 overexpression (Fig. 3F and G). The increase in CSC properties in cells with high MAP17 should correlate with a higher number of colony-initiating cells. Therefore, we measured the number of colonies formed after seeding of cells at a very low density (Supplementary Fig. S2). As expected, based on previous results, MAP17-expressing cells formed more colonies than EV or tMAP17. This was also true for colony formation in soft agar (Supplementary Fig. S3). In summary, these results show that, in human tumor cells, MAP17 overexpression induces the expression of CSC phenotype, which could be responsible for an increase in the stem cell–like properties. MAP17 downregulation decreases Notch pathway activation and stemness features To further evaluate the role of MAP17 expression, we selected Calu3, a tumor cell line with endogenous high levels of MAP17, and downregulated its expression by shRNA ectopic expression (Fig. 3H). We measured Notch pathway activity and the physiologic behavior associated with MAP17 decrease in Calu3 cells, observing changes in levels of Notch-dependent transcripts (Fig. 3I), confirming the relevance of MAP17 expression in Notch pathway activation. In addition, MAP17 downregulation induced a clear reduction in all CSC transcription markers, confirming the functional relationship between MAP17 and stemness (Fig. 3J). Finally, when MAP17 was downregulated in Calu3 cells, we observed an obvious reduction in the associated stemness phenotype, with a significant decrease both in holoclone and tumorspherenumbers(Fig. 3KandL). Theseresultsalsoconfirmthatthe maintenance of high MAP17 levels is important in maintaining the CSC phenotype. Downregulation of NUMB mimics MAP17 overexpression If MAP17 overexpression is functionally connected to NUMB sequestration, then NUMB downregulation should mimic MAP17 overexpression. We tested the effect of NUMB downregulation both in Notch pathway activation and stem cell–like behavior of tumor cells. To do this, we constitutively overexpressed shRNA against NUMB in the same tumor cell lines, showing a decrease in both mRNA and protein levels (Fig. 4A and B). To avoid off-target effects, we analyzed two different shRNA against NUMB, with similar results (Supplementary Fig. S4). Like in MAP17-overexpressing cells, we observed an increase in Notch pathway activation (Fig. 4C). NUMB downregulation also increased mRNA levels of stem cell factors, correlated with increased colony formation (Fig. 4D and E). In addition, we also observed an increase in holoclone and tumorsphere numbers (Fig. 4F and G). Finally, to confirm the CSC-like phenotype with downregulated NUMB cells, we measured the cellular subpopulations showing CSC surface markers, as was done with the MAP17expressing cells. We found that HeLa and T47D cell expressing NUMB shRNA showed a higher percentage of CD133 þ and CD44 þ /CD24  cells, respectively, confirming that NUMB downregulation is equivalent to MAP17 overexpression in its ability to induce a CSC-like phenotype (Fig. 4H). Taken together, these data indicate that NUMB sequestration is sufficient to activate Notch pathway and increase the stem cell– like properties of tumor cells, pointing a possible role of NUMB as tumor suppressor by reducing Notch pathway activation and the stemness properties of tumor cells. MAP17 expression correlated with high tumorsphere formation in low-passage sarcoma cells and tumors directly from PDX models To approach our findings in a more in vivo situation, we took low passaged sarcoma cell lines generated in our laboratory directly from sarcoma tumors. The lines have been propagated no longer than 20 passages, so the number of genetic alterations should be lower compared with lines such as HeLa, highly propagated during years. AA and AW lines, with very low levels of MAP17, and AX line, with low levels of MAP17, were transfected to force its MAP17 constitutive overexpression. In addition, we overexpressed MAP17 shRNA in AX cell line, with endogenous MAP17 expression. After selection, 5,000 cells were seeded to measure the number and size of tumorspheres. We observed that, in all cases, MAP17 overexpression produced a higher number and increased size of tumorspheres in these low-passage sarcoma cell lines (Fig. 5A). Like for T47D and HeLa cells, mRNA levels from either Notch pathway and stem cell genes were highly activated in cells with high levels of MAP17 (Fig. 5B, black and dark gray bars). Finally, we took 5 models of PDXs of sarcoma growing in mice. After tissue disaggregation, we directly measured MAP17 MAP17 Activates Notch www.aacrjournals.org Clin Cancer Res; 23(14) July 15, 2017 3877 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358 Figure 4. shRNA directed against NUMB (shN) efficiently downregulates NUMB expression, both in HeLa (A) and T47D (B)cells, measured by qPCR and Western blot (WB). C, qPCR analysis of Notch pathway genes in HeLa and T47D EV cells. D, qPCR analysis of stem cell genes in HeLa and T47D EV cells. The results are the average of at least four independent experiments. E, Clonogenicity assays of HeLa and T47D EV cells with scrambled or shN shRNA. One thousand cells were seeded in 10-cm 2 plates in triplicate and cultured for 14–20 days at 37C with 5% CO 2 . Overexpression of shN induces a significantly higher number of clones relative to the number in cell populations overexpressing scrambled shRNA. The results are the average of at least three independent experiments performed in triplicate samples. Student ttest statistical analysis of the data was performed to find statistical differences (,P<0.05; ,P<0.01; ,P<0.001). F, shRNA directed against NUMB increases the number of holoclones, mimicking the effect induced by MAP17 overexpression. G, Percentage and area of the tumorspheres obtained from HeLa or T47D cells, showing that decrease of NUMB induces a higher number of tumorspheres in both cell lines. H, Analytic FACS to identify the CD44 þ /CD24  subpopulation for T47D cells and the CD133 þ subpopulation for HeLa cells. The graph shows the average of three independent experiments performed in triplicate. Student ttest statistical analysis of the data was performed to find statistical differences (,P<0.05; ,P<0.01; ,P<0.001). Garcia-Heredia et al. Clin Cancer Res; 23(14) July 15, 2017 Clinical Cancer Research3878 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358 levels and seeded 10,000 cells to measure the number of tumorspheres (Supplementary Table S2). When plotted to establish one-to-one correlation, we found a strong direct correlation of tumorsphere numbers and MAP17 levels for each tumor (Fig. 5C, R 2 ¼0.8206). In these tumorspheres from primary sarcomas, we also measured the activation of the Notch pathway and the Stem cell–related factors, correlating their levels to the MAP17 levels. We observed a clear correlation between the MAP17 levels and the activation of the Notch pathway and the activation of the Stem cell–related factors (Fig. 5D). All these data strongly suggest that MAP17 drives Notch pathway activation, tumorsphere formation, and activation of the stem cell transcription machinery. Figure 5. MAP17 overexpression activates stem cell–like phenotype and Notch pathway. A, Sarcoma cell lines transfected to overexpress MAP17 (AA, AW, and AX) or to knock down MAP17 expression (AX) were cultured as tumorspheres, measuring both its number and area. Red, number of tumorspheres; blue, area of tumorspheres. B, qPCR analysis of Notch pathway and stem cell genes in sarcoma cell lines. The graphs show the average of three independent experiments performed in triplicate. White bars, EV; black bars, MAP17 overexpression; dark gray bars, scrambled shRNA; light gray bars, shN shRNA overexpression. Student ttest statistical analysis of the data was performed to find statistical differences (,P<0.05; ,P<0.01; ,P<0.001). C, Sarcoma cells, derived from explants grown in mice, were seeded directly and grown as tumorspheres, connecting the number of tumorspheres with MAP17 expression. The graphs show the average of three independent experiments performed in triplicate. D, Sarcoma cells, derived from explants grown in mice, were seeded directly and grown as tumorspheres, and the mRNA levels of MAP17 were analyzed, as well as those of HES1,GLI1,OCT4,KLF4,NANOG, and SOX9. These genes were correlated individually with the levels of MAP17. The graphs show the average of three independent experiments performed in triplicate. E, Expression of Notch pathway–related genes and Stem cell genes in lung, cervix, breast, and colon tumors, extracted from R 2 analysis. Red indicates positive correlation between a specificgeneandMAP17, whereas blue indicates negative correlations. The higher the intensity of the color, the greater number of datasets showing the same correlation. MAP17 Activates Notch www.aacrjournals.org Clin Cancer Res; 23(14) July 15, 2017 3879 on June 18, 2019. © 2017 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from Published OnlineFirst February 2, 2017; DOI: 10.1158/1078-0432.CCR-16-2358