scieee Science in your language
[en] (orig)

Glutathione metabolism is essential for self-renewal and chemoresistance of pancreatic cancer stem cells

Abstract

BACKGROUND Cellular metabolism regulates stemness in health and disease. A reduced redox state is essential for self-renewal of normal and cancer stem cells (CSCs). However, while stem cells rely on glycolysis, different CSCs, including pancreatic CSCs, favor mitochondrial metabolism as their dominant energy-producing pathway. This suggests that powerful antioxidant networks must be in place to detoxify mitochondrial reactive oxygen species (ROS) and maintain stemness in oxidative CSCs. Since glutathione metabolism is critical for normal stem cell function and CSCs from breast, liver and gastric cancer show increased glutathione content, we hypothesized that pancreatic CSCs also rely on this pathway for ROS detoxification. AIM To investigate the role of glutathione metabolism in pancreatic CSCs. METHODS Primary pancreatic cancer cells of patient-derived xenografts (PDXs) were cultured in adherent or CSC-enriching sphere conditions to determine the role of glutathione metabolism in stemness. Real-time polymerase chain reaction (PCR) was used to validate RNAseq results involving glutathione metabolism genes in adherent vs spheres, as well as the expression of pluripotency-related genes following treatment. Public TCGA and GTEx RNAseq data from pancreatic cancer vs normal tissue samples were analyzed using the webserver GEPIA2. The glutathione-sensitive fluorescent probe monochlorobimane was used to determine glutathione content by fluorimetry or flow cytometry. Pharmacological inhibitors of glutathione synthesis and recycling [buthionine-sulfoximine (BSO) and 6-Aminonicotinamide (6-AN), respectively] were used to investigate the impact of glutathione depletion on CSC-enriched cultures. Staining with propidium iodide (cell cycle), Annexin-V (apoptosis) and CD133 (CSC content) were determined by flow cytometry. Self-renewal was assessed by sphere formation assay and response to gemcitabine treatment was used as a readout for chemoresistance. RESULTS Analysis of our previously published RNAseq dataset E-MTAB-3808 revealed up-regulation of genes involved in the KEGG (Kyoto Encyclopedia of Genes and Genomes) Pathway Glutathione Metabolism in CSC-enriched cultures compared to their differentiated counterparts. Consistently, in pancreatic cancer patient samples the expression of most of these up-regulated genes positively correlated with a stemness signature defined by NANOG, KLF4, SOX2 and OCT4 expression (P < 10-5). Moreover, 3 of the upregulated genes (MGST1, GPX8, GCCT) were associated with reduced disease-free survival in patients [Hazard ratio (HR) 2.2-2.5; P = 0.03-0.0054], suggesting a critical role for this pathway in pancreatic cancer progression. CSC-enriched sphere cultures also showed increased expression of different glutathione metabolism-related genes, as well as enhanced glutathione content in its reduced form (GSH). Glutathione depletion with BSO induced cell cycle arrest and apoptosis in spheres, and diminished the expression of stemness genes. Moreover, treatment with either BSO or the glutathione recycling inhibitor 6-AN inhibited self-renewal and the expression of the CSC marker CD133. GSH content in spheres positively correlated with intrinsic resistance to gemcitabine treatment in different PDXs r = 0.96, P = 5.8 × 1011). Additionally, CD133+ cells accumulated GSH in response to gemcitabine, which was abrogated by BSO treatment (P < 0.05). Combined treatment with BSO and gemcitabine-induced apoptosis in CD133+ cells to levels comparable to CD133- cells and significantly diminished self-renewal (P < 0.05), suggesting that chemoresistance of CSCs is partially dependent on GSH metabolism. CONCLUSION Our data suggest that pancreatic CSCs depend on glutathione metabolism. Pharmacological targeting of this pathway showed that high GSH content is essential to maintain CSC functionality in terms of self-renewal and chemoresistance. Jagust, P.; Alcalá, S.; Jr, B.S.; Heeschen, C.; Sancho, P.

Read accessible full text

Glutathione metabolism is essential for self-renewal and chemoresistance of pancreatic cancer stem cells

Author: Jagust, P.; Heeschen, C.; Alcalá, S.; Sancho, P.; Jr, B.S.
Year: 2020
DOI: 10.4252/wjsc.v12.i11.1410
Source: https://zaguan.unizar.es/record/99089/files/texto_completo.pdf
WJSC h ps://www.wjgne .com 1410 No embe 26, 2020 Volume 12 Issue 11
Wo ld Jou nal o
S em Cells
W J S C
Submi a Manusc ip : h ps://www. 6publishing.com Wo ld J S em Cells 2020 No embe 26; 12(11): 1410-1428
DOI: 10.4252/wjsc. 12.i11.1410 ISSN 1948-0210 (online)
ORIGINAL ARTICLE
Basic S udy
Glu a hione me abolism is essen ial o sel - enewal and
chemo esis ance o panc ea ic cance s em cells
Pe a Jagus , Sonia Alcalá, B uno Sainz J , Ch is ophe Heeschen, Pa icia Sancho
ORCID numbe : Pe a Jagus 0000-
0001-5291-251X; Sonia Alcalá 0000-
0002-7644-4973; B uno Sainz J 0000-
0003-4829-7651; Ch is ophe
Heeschen 0000-0002-1158-8554;
Pa icia Sancho 0000-0002-1092-
5395.
Au ho con ibu ions: Jagus P and
Sancho P pe o med he
expe imen s, acqui ed and
analyzed da a; Alcalá S and Sainz
J B compiled and alida ed he
samples o RNAseq analysis;
Heeschen C and Sancho P
in e p e ed da a, designed he
s udy and w o e he manusc ip ;
all au ho s app o ed he inal
e sion o he manusc ip .
Suppo ed by ERC Ad anced
In es iga o G an , No. Pa-CSC
233460; Eu opean Communi y's
Se en h F amewo k P og amme,
No. 602783; Ins i u o de Salud
Ca los III and Eu opean Funds
(FSE: “el FSE in ie e en u u u o”
and FEDER: “una mane a de hace
Eu opa”) Miguel Se e
Fellowship, No. CP16/00121; and
Fondo In es igaciones Sani a ias,
No. PI17/00082.
Ins i u ional e iew boa d
s a emen : The s udy was
e iewed and app o ed by he IIS
A agon Ins i u ional Re iew
Boa d.
Pe a Jagus , Molecula Pa hology P og amme, Spanish Na ional Cance Resea ch Cen e
(CNIO), Mad id 28029, Spain
Sonia Alcalá, B uno Sainz J , Depa men o Biochemis y, Au ónoma Uni e si y o Mad id,
Ins i u o de In es igaciones Biomédicas "Albe o Sols" CSIC-UAM, Mad id 28029, Spain
Ch is ophe Heeschen, Cen e o Single-Cell Omics & Key Labo a o y o Oncogenes and
Rela ed Genes, Shanghai Cance Ins i u e, Shanghai Jiao Tong Uni e si y School o Medicine,
Shanghai 200025, China
Pa icia Sancho, Hospi al Uni e si a io Miguel Se e , IIS A agon, Za agoza 50009, Spain
Co esponding au ho : Pa icia Sancho, PhD, Senio Scien is , Hospi al Uni e si a io Miguel
Se e , IIS A agon, Isabel la Ca ólica 1-3, Za agoza 50009, Spain. [email p o ec ed]
Abs ac
BACKGROUND
Cellula me abolism egula es s emness in heal h and disease. A educed edox
s a e is essen ial o sel - enewal o no mal and cance s em cells (CSCs).
Howe e , while s em cells ely on glycolysis, di e en CSCs, including panc ea ic
CSCs, a o mi ochond ial me abolism as hei dominan ene gy-p oducing
pa hway. This sugges s ha powe ul an ioxidan ne wo ks mus be in place o
de oxi y mi ochond ial eac i e oxygen species (ROS) and main ain s emness in
oxida i e CSCs. Since glu a hione me abolism is c i ical o no mal s em cell
unc ion and CSCs om b eas , li e and gas ic cance show inc eased
glu a hione con en , we hypo hesized ha panc ea ic CSCs also ely on his
pa hway o ROS de oxi ica ion.
AIM
To in es iga e he ole o glu a hione me abolism in panc ea ic CSCs.
METHODS
P ima y panc ea ic cance cells o pa ien -de i ed xenog a s (PDXs) we e
cul u ed in adhe en o CSC-en iching sphe e condi ions o de e mine he ole o
glu a hione me abolism in s emness. Real- ime polyme ase chain eac ion (PCR)
was used o alida e RNAseq esul s in ol ing glu a hione me abolism genes in
adhe en s sphe es, as well as he exp ession o plu ipo ency- ela ed genes
ollowing ea men . Public TCGA and GTEx RNAseq da a om panc ea ic cance
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1411 No embe 26, 2020 Volume 12 Issue 11
Con lic -o -in e es s a emen :
Au ho s decla e no con lic o
in e es .
Da a sha ing s a emen : RNAseq
da ase E-MTAB-3808 is a ailable
a h ps://www.ebi.ac.uk/a ayex
p ess/.
Open-Access: This a icle is an
open-access a icle ha was
selec ed by an in-house edi o and
ully pee - e iewed by ex e nal
e iewe s. I is dis ibu ed in
acco dance wi h he C ea i e
Commons A ibu ion
NonComme cial (CC BY-NC 4.0)
license, which pe mi s o he s o
dis ibu e, emix, adap , build
upon his wo k non-comme cially,
and license hei de i a i e wo ks
on di e en e ms, p o ided he
o iginal wo k is p ope ly ci ed and
he use is non-comme cial. See: h
p://c ea i ecommons.o g/License
s/by-nc/4.0/
Manusc ip sou ce: In i ed
manusc ip
Special y ype: Cell and issue
enginee ing
Coun y/Te i o y o o igin: Spain
Pee - e iew epo ’s scien i ic
quali y classi ica ion
G ade A (Excellen ): 0
G ade B (Ve y good): 0
G ade C (Good): C
G ade D (Fai ): 0
G ade E (Poo ): 0
Recei ed: July 10, 2020
Pee - e iew s a ed: July 10, 2020
Fi s decision: Augus 9, 2020
Re ised: Augus 19, 2020
Accep ed: Sep embe 25, 2020
A icle in p ess: Sep embe 25, 2020
Published online: No embe 26,
2020
P-Re iewe : Chen Q
S-Edi o : Gao CC
L-Edi o : Webs e JR
P-Edi o : Li JH
s no mal issue samples we e analyzed using he webse e GEPIA2. The
glu a hione-sensi i e luo escen p obe monochlo obimane was used o de e mine
glu a hione con en by luo ime y o low cy ome y. Pha macological inhibi o s
o glu a hione syn hesis and ecycling [bu hionine-sul oximine (BSO) and 6-
Aminonico inamide (6-AN), espec i ely] we e used o in es iga e he impac o
glu a hione deple ion on CSC-en iched cul u es. S aining wi h p opidium iodide
(cell cycle), Annexin-V (apop osis) and CD133 (CSC con en ) we e de e mined by
low cy ome y. Sel - enewal was assessed by sphe e o ma ion assay and
esponse o gemci abine ea men was used as a eadou o chemo esis ance.
RESULTS
Analysis o ou p e iously published RNAseq da ase E-MTAB-3808 e ealed up-
egula ion o genes in ol ed in he KEGG (Kyo o Encyclopedia o Genes and
Genomes) Pa hway Glu a hione Me abolism in CSC-en iched cul u es compa ed
o hei di e en ia ed coun e pa s. Consis en ly, in panc ea ic cance pa ien
samples he exp ession o mos o hese up- egula ed genes posi i ely co ela ed
wi h a s emness signa u e de ined by NANOG, KLF4, SOX2 and OCT4 exp ession
(P < 10-5). Mo eo e , 3 o he up egula ed genes (MGST1, GPX8, GCCT) we e
associa ed wi h educed disease- ee su i al in pa ien s [Haza d a io (HR) 2.2-
2.5; P = 0.03-0.0054], sugges ing a c i ical ole o his pa hway in panc ea ic
cance p og ession. CSC-en iched sphe e cul u es also showed inc eased
exp ession o di e en glu a hione me abolism- ela ed genes, as well as enhanced
glu a hione con en in i s educed o m (GSH). Glu a hione deple ion wi h BSO
induced cell cycle a es and apop osis in sphe es, and diminished he exp ession
o s emness genes. Mo eo e , ea men wi h ei he BSO o he glu a hione
ecycling inhibi o 6-AN inhibi ed sel - enewal and he exp ession o he CSC
ma ke CD133. GSH con en in sphe es posi i ely co ela ed wi h in insic
esis ance o gemci abine ea men in di e en PDXs = 0.96, P = 5.8 × 1011).
Addi ionally, CD133+ cells accumula ed GSH in esponse o gemci abine, which
was ab oga ed by BSO ea men (P < 0.05). Combined ea men wi h BSO and
gemci abine-induced apop osis in CD133+ cells o le els compa able o CD133-
cells and signi ican ly diminished sel - enewal (P < 0.05), sugges ing ha
chemo esis ance o CSCs is pa ially dependen on GSH me abolism.
CONCLUSION
Ou da a sugges ha panc ea ic CSCs depend on glu a hione me abolism.
Pha macological a ge ing o his pa hway showed ha high GSH con en is
essen ial o main ain CSC unc ionali y in e ms o sel - enewal and
chemo esis ance.
Key Wo ds: Panc ea ic cance ; Cance s em cells; Glu a hione; Sel - enewal;
Chemo esis ance; Redox
©The Au ho (s) 2020. Published by Baishideng Publishing G oup Inc. All igh s ese ed.
Co e Tip: Se e al glu a hione me abolism genes a e up egula ed in panc ea ic cance
s em cells (CSCs), and hei exp ession co ela es wi h a s emness signa u e and
p edic s su i al in clinical samples. Inc eased glu a hione concen a ion in CSCs
p omo es iabili y, cell cycle p og ession and plu ipo ency gene exp ession. Inhibi ion
o glu a hione syn hesis o ecycling impai s CSC unc ionali ies such as sel - enewal
and chemo esis ance. Ou da a demons a e a a ge able me abolic ulne abili y o his
agg essi e subpopula ion o cance cells.
Ci a ion: Jagus P, Alcalá S, Sainz J B, Heeschen C, Sancho P. Glu a hione me abolism is
essen ial o sel - enewal and chemo esis ance o panc ea ic cance s em cells. Wo ld J S em
Cells 2020; 12(11): 1410-1428
URL: h ps://www.wjgne .com/1948-0210/ ull/ 12/i11/1410.h m
DOI: h ps://dx.doi.o g/10.4252/wjsc. 12.i11.1410
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1412 No embe 26, 2020 Volume 12 Issue 11
INTRODUCTION
Panc ea ic cance has he wo s ou come o any cance in he wo ld, and is cu en ly
he 3 d mos equen cause o cance - ela ed dea hs[1]. A he same ime, he incidence
o panc ea ic cance keeps inc easing, wi h app oxima ely 448000 new cases in 2019.
This numbe is p edic ed o u he inc ease in he coming yea s and, due o i s
ex eme le hali y and lack o e ec i e ea men s a ailable[2], panc ea ic cance may
e en become he 2nd mos equen cause o cance - ela ed dea hs by 2030[3].
One possible explana ion o he poo ou come associa ed wi h panc ea ic cance is
ha , p e iously, only li le a en ion had been paid o he e icien elimina ion o
cance s em cells (CSCs). Panc ea ic cance con ains s em cell-like cells, which a e he
sole d i e s o umo igenesis, much like no mal s em cells uel p oli e a ion and
di e en ia ion in no mal issue, and he e o e ha e been e med CSCs[4-8]. While CSCs
ep esen only a small ac ion o all he cance cells, hey a e ex emely umo igenic
down o a single cell, and exclusi ely me as a ic[4,6]. Cu en ea men s a egies o
panc ea ic cance spa e CSCs due o hei inhe en chemo esis ance[8-10] and he e o e
likely ep esen he key cellula sou ce d i ing disease elapse. To de elop mo e
e ec i e ea men s a egies o panc ea ic cance , we need o ob ain a ho ough
unde s anding o he egula o y machine y o CSCs, including hei cellula
me abolism.
Inc easing e idence sugges s ha , simila o no mal s em cells, cellula me abolism
is highly egula ed in CSCs and go e ns essen ial aspec s o hei unc ionali y.
Indeed, a educed in acellula edox s a e wi h low eac i e oxygen species (ROS)
le els allows o sel - enewal, while ROS accumula ion induces di e en ia ion[11]. Since
ela i ely high amoun s o ROS a e o med as by-p oduc s o mi ochond ial oxida i e
phospho yla ion, glycolysis was adi ionally conside ed he p e e ed me abolic
pa hway o bo h s em cells and CSCs[12]. Howe e , CSCs ac oss a wide ange o
cance s main ain low ROS le els[13-15], e en i hey a o mi ochond ial me abolism as
hei dominan ene gy-p oducing pa hway[16]. In pa icula , we ha e shown ha
panc ea ic CSCs a e dependen on mi ochond ial oxida i e phospho yla ion o ull
s emness and umo igenici y, in a p ocess con olled by he balanced exp ession o c-
MYC and he mi ochond ial biogenesis ac o PGC-1α[7]. We obse ed ha panc ea ic
CSCs bea low le els o mi ochond ial ROS and hey a e especially sensi i e o he
mi ochond ial ROS induce menadione, making he edox s a e o his o ganelle a
ele an a ge o CSC elimina ion.
Glu a hione (L-γ-glu amyl-L-cys einyl-glycine; GSH) is he mos abundan non-
p o ein an ioxidan in euka yo ic cells. Al hough i is syn hesized in he cy osol,
glu a hione le els a e pa icula ly high in mi ochond ia, whe e i main ains edox
balance h ough ROS de oxi ica ion and p o ec s phospholipids in he mi ochond ial
memb ane[17]. In e es ingly, glu a hione le els a e s ongly inc eased in mu ine
emb yonic s em cells and mesenchymal s em cells, suppo ing de ense agains di e se
insul s and main enance o s emness[18]. Simila ly, glu a hione con en and speci ic
GSH- ela ed enzymes a e up- egula ed in CSCs om b eas [13], li e [19] and gas ic
cance [14]. Addi ionally, di e en componen s o he glu a hione me abolism pa hway
ha e been shown o p omo e umo ini ia ion[20], me as asis[21,22] and chemo esis -
ance[23]; ea u es equen ly associa ed wi h CSCs.
Howe e , li le is known abou he ole o his pa hway in panc ea ic CSCs. He e we
now show ha panc ea ic CSCs display inc eased GSH con en and exp ession o
di e se genes in ol ed in he glu a hione me abolism pa hway, which co ela ed wi h
s emness and disease- ee su i al in panc ea ic cance pa ien s. Deple ion o GSH
le els in sphe e cul u es wi h pha macological inhibi o s o glu a hione syn hesis o
ecycling induced cell cycle a es and apop osis. This ansla ed in o diminished sel -
enewal capaci y and educed exp ession o he CSC su ace ma ke CD133.
Impo an ly, GSH deple ion sensi ized CSCs o gemci abine, sugges ing an impo an
ole o glu a hione in chemo esis ance in panc ea ic cance .
MATERIALS AND METHODS
P ima y human panc ea ic cance cells
Human panc ea ic cance Pa ien -De i ed Xenog a s [PDXs, ei he panc ea ic duc al
adenoca cinoma (PDAC) o panc ea ic cance o hepa obilia y o igin] we e ob ained
h ough he Biobank o he Spanish Na ional Cance Resea ch Cen e (CNIO), Mad id,
Spain ( e e ence 1204090835CHMH). Fo p ima y cul u es, PDX issue agmen s
p e iously expanded in nude mice (passages 1-13) we e minced, enzyma ically
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1413 No embe 26, 2020 Volume 12 Issue 11
diges ed wi h collagenase (S em Cell Technologies, Vancou e , Canada) o 90 min a
37°C[24], and a e cen i uga ion o 5 min a 1200 pm he pelle s we e esuspended
and cul u ed in RPMI, 10% e al bo ine se um (FBS), and 50 U/mL
penicillin/s ep omycin. Fo he expe imen s, cells we e cul u ed in DMEM:F12
supplemen ed wi h B-27, L-Glu amine (all om Gibco, Li e Technologies, Ca lsbad,
CA, USA), 50 U/mL penicillin–s ep omycin (Sigma-Ald ich, S . Louis, MO, USA) and
β-FGF (Pep oTech, Rocky Hill, NJ, USA).
CSC-en iching cul u e
Panc ea ic cance sphe es we e gene a ed and expanded in supplemen ed DMEM-F12.
A o al o 104 cells/mL was seeded in ul a-low a achmen pla es (Co ning, Co ning,
NY, USA) as desc ibed p e iously[25].
Sphe e o ma ion assay
Cells we e seeded in iplica e in ul a-low a achmen 24-well pla es (Co ning) a 104
cells/well in supplemen ed DMEM-F12 wi h o wi hou he co esponding ea men s,
which we e e eshed e e y o he day. A e 7 d, sphe es we e coun ed using a
mic oscope a 20× magni ica ion.
RNA p epa a ion and eal- ime polyme ase chain eac ion
To al RNAs om human p ima y panc ea ic cance cells and sphe es we e ex ac ed
wi h he TRIzol ki (Li e Technologies) acco ding o he manu ac u e ’s ins uc ions.
One mic og am o o al RNA was used o cDNA syn hesis wi h Supe Sc ip II e e se
ansc ip ase (Li e Technologies) and andom hexame s. Quan i a i e eal- ime
polyme ase chain eac ion (PCR) was pe o med using SYBR G een PCR mas e mix
(Qiagen, Hilden, Ge many), acco ding o he manu ac u e ’s ins uc ions. The lis o
u ilized p ime s is de ailed in Table 1.
GSH con en
The glu a hione-sensi i e luo escen p obe monochlo obimane (mCLB, Sigma-
Ald ich) was used o analyze he educed in acellula glu a hione con en . Cells we e
ypsinized on he day o he expe imen , washed, p o ec ed om ligh and incuba ed
o 1 h a 37°C wi h 2 mmol/L mCLB dilu ed in phospha e bu e ed saline (PBS). Cells
we e hen washed and esuspended in PBS and luo escence (exci a ion: 380 nm,
emission: 461 nm) was measu ed on a FLUOs a OPTIMA Mic opla e Reade . Values
we e co ec ed o cell con en by measu ing he p o ein concen a ion o he sample
wi h he B ad o d assay. Al e na i ely, cells we e incuba ed wi h DAPI and analyzed
by low cy ome y using a FACS Can o II (BD, F anklin Lakes, NJ, USA) and da a we e
analyzed wi h FlowJo 9.2 so wa e (Ashland, OR, USA) o Cy obank (Beckman
Coul e , CA, USA).
CSC con en by low cy ome y
To iden i y panc ea ic CSCs, he an i-CD133/1 (APC o PE, Mil enyi Bio ec, Be gisch
Gladbach, Ge many) o co esponding con ol Immunoglobulin G (IgG) 1 an ibody
we e used. B ie ly, cells we e s ained o 30 min on ice wi h gen le ocking. DAPI was
used o exclusion o dead cells (eBiosciences, San Diego, CA, USA). All samples we e
analyzed by low cy ome y using a FACS Can o II (BD) and da a we e analyzed wi h
FlowJo 9.2 so wa e o Cy obank.
Apop osis assay by low cy ome y
Fi e-day old sphe es o adhe en cul u es we e ea ed o 48 h in he p esence o 100
mmol/L bu hionine-sul oximine (BSO) o BSO and gemci abine (1 μmol/L). A ached
and loa ing cells we e collec ed, esuspended and s ained wi h Annexin V (550474)
dilu ed in Annexin V binding bu e (556454, all om eBiosciences) o 20 min a oom
empe a u e, ollowing he manu ac u e ’s ins uc ions. Cells we e hen incuba ed
wi h DAPI o an addi ional 5 min.
Cell-cycle analysis by low cy ome y
Sphe es we e ypsinized, washed in PBS, cen i uged, and pelle s we e ixed in 200 µL
o 70% e hanol and s o ed a -20°C un il use. The cells we e cen i uged and pelle s
esuspended in 200 µL o PBS, 10 µg/mL o RNAse A was added and he cells we e
incuba ed o 1 h a 37°C. Subsequen ly, he cells we e esuspended in p opidium
iodide solu ion (0.1% sodium ci a e, 0.1% T i onX-100, and 50 µg/mL p opidium
iodide).
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1414 No embe 26, 2020 Volume 12 Issue 11
Table 1 Lis o u ilized p ime s
Gene P ime
HPRT
Fo wa d TGACCTTGATTTATTTTGCATACC
Re e se CGAGCAAGACGTTCAGTCCT
GCLC
Fo wa d GCCGCTGAGCTGGGAGGAAA
Re e se ATTCCACCTCATCGCCCCACT
GPX1
Fo wa d TATCGAGAATGTGGCGTCCC
Re e se GATGCCCAAACTGGTTGCAC
GPX2
Fo wa d GGACATCAGGAGAACTGTCAGA
Re e se TCAGGTAGGCGAAGACAGGA
GGT1
Fo wa d CAACCTGCCCACAGTGAAGA
Re e se TTCTTGGCCTCCATGACTGC
GGT2
Fo wa d CCCTTCTTTCAGTGGGAGGG
Re e se ATGCTGTCACCTTTGTGGCT
GSTM1
Fo wa d AGGAAAAGAAGTACACGATGGG
Re e se TTGCTCTGGGTGATCTTGTG
GSTA1
Fo wa d CAACCTGCCCACAGTGAAGA
Re e se TTCTTGGCCTCCATGACTGC
GSTA2
Fo wa d CCCTTCTTTCAGTGGGAGGG
Re e se ATGCTGTCACCTTTGTGGCT
GSTA
Fo wa d TCCGTGAGATGGGTTTTAGC
Re e se CTGTACCAACTTCATCCCGTC
IDH1
Fo wa d CAAGTGACGGAACCCAAAAG
Re e se ACCCTTAGACAGAGCCATTTG
IDH2
Fo wa d ACAACACCGACGAGTCCATC
Re e se GCCCATCGTAGGCTTTCAGT
RNAseq da a o CSC-en iched condi ions
Exp ession o he genes con ained in he KEGG (Kyo o Encyclopedia o Genes and
Genomes) Pa hway Glu a hione Me abolism was in es iga ed in ou published
RNAseq da ase E-MTAB-3808 (A ay Exp ess), which compa es p ima y PDX cells
cul u ed ei he by adhe ence o as sphe es[7]. All o iginal bioin o ma ic analyses on his
da ase E-MTAB-3808 we e pe o med a he Bioin o ma ics Uni and S uc u al
Biology and Biocompu ing P og amme, Spanish Na ional Cance Resea ch Cen e

Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1415 No embe 26, 2020 Volume 12 Issue 11
(CNIO), Mad id 28029, Spain. Di e en ial exp ession o genes ac oss he di e en
condi ions was calcula ed wi h Cu di [26].
Human da a analysis
Exp ession da a om panc ea ic cance and no mal issue om he TCGA and he
GTEx p ojec s we e analyzed using he webse e GEPIA2[27]. Pea son co ela ion
coe icien was calcula ed o co ela ion analysis o glu a hione- ela ed genes wi h a
s emness signa u e de ined by he combined exp ession o he plu ipo ency- ela ed
genes NANOG, KLF4, SOX2 and OCT4. Fo disease- ee su i al analysis, he Haza d
a io (HR) was calcula ed using he Cox P opo ional Haza ds model o panc ea ic
cance pa ien s om uppe and lowe qua iles o exp ession o he indica ed genes.
S a is ical analyses
Resul s o con inuous a iables a e p esen ed as mean ± SE unless s a ed o he wise.
T ea men g oups we e compa ed wi h he independen samples - es . Pai -wise
mul iple compa isons we e pe o med wi h he one-way ANOVA ( wo-sided) wi h
Bon e oni adjus men . Co ela ion analysis was pe o med by calcula ing he Pea son
co ela ion coe icien . P alues < 0.05 we e conside ed s a is ically signi ican . All
analyses we e pe o med using P ism G aphPad ( e sion 5.04).
RESULTS
Connec ion o glu a hione me abolism wi h s emness in human panc ea ic cance
samples
In o de o de e mine a possible connec ion be ween glu a hione me abolism and
s emness in panc ea ic cance , we i s analyzed ou p e iously published RNAseq
da ase E-MTAB-3808 compa ing 5 di e en PDAC PDX models cul u ed in
di e en ia ing (adhe en ) o CSC-en iching (sphe es) condi ions (Figu e 1A)[7]. We
ocused on genes ela ed o he KEGG Pa hway Glu a hione Me abolism, which we
ca ego ized in o ou di e en classes: Gamma-glu amyl ans e ases (GGTs),
glu a hione-s- ans e ases (GSTs), glu a hione pe oxidases (GPXs), and genes in ol ed
in glu a hione syn hesis and ecycling. As summa ized in Table 2, CSC-en iched
cul u es gene ally up- egula ed genes om he ou classes, al hough he speci ic
genes a ied among he di e en PDXs.
We ha e p e iously demons a ed ha panc ea ic CSCs show inc eased exp ession
o se e al plu ipo ency- ela ed genes such as NANOG, KLF4, SOX2 and OCT4, which
we ha e ou inely used as a s emness signa u e[5-7]. In o de o u he suppo a
connec ion be ween glu a hione me abolism and s emness, we used he webse e
GEPIA2 o analyze ou a ge genes in human exp ession da a om no mal panc eas
and PDAC issues included in he TCGA and GTEx p ojec s. Thus, we pe o med gene
exp ession co ela ion s udies be ween he di e en glu a hione- ela ed genes up-
egula ed in sphe es and ou de ined s emness signa u e in no mal s PDAC samples.
In e es ingly, exp ession o 17 o he 25 genes up- egula ed in CSCs posi i ely
co ela ed wi h he s emness signa u e in human samples, wi h P- alues below 10-5
(Figu e 1B). Since disease ecu ence can be mainly a ibu ed o CSCs due o hei
abili y o egene a e umo s ollowing ea men , we nex in es iga ed whe he he
exp ession o any o he 17 genes co ela ed wi h disease- ee su i al in pa ien s
(Figu e 1C). We ound ha high exp ession o MGST1, GPX8 and GGCT p edic ed
be ween 2.2-2.5 imes inc eased isk o ecu ence in PDAC pa ien s (P = 0.0054, 0.03
and 0.0054, espec i ely). Toge he , ou esul s sugges a unc ional link be ween
glu a hione me abolism, s emness and he agg essi eness o panc ea ic cance .
Glu a hione me abolism is enhanced in p ima y sphe e cul u es o panc ea ic
cance PDXs
Nex , we aimed o u he alida e he abo e RNAseq esul s. The e o e, we analyzed
he exp ession o 2-4 genes om each subg oup by eal- ime PCR. We included wo
addi ional PDX models [one PDAC (PDX163) and one panc ea ic umo o
hepa obilia y o igin (PDX247)] esul ing in a o al o se en PDX models o his
alida ion. As shown in Figu e 2, we de ec ed enhanced exp ession o glu a hione
me abolism genes in CSC-en iching condi ions o all se en PDX models, anging
be ween 2.5 o 600- old.
Fo u he unc ional alida ion, we used he hiol-sensi i e p obe
monochlo obimane o assess he con en o in acellula glu a hione con en in i s
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1416 No embe 26, 2020 Volume 12 Issue 11
Table 2 RNAseq e eals ha glu a hione me abolism genes a e up- egula ed in cance s em cell-en iched cul u es om panc ea ic
cance pa ien -de i ed xenog a s
PDX GGTs GSTs GPXs Syn hesis and ecycling
PDX185 GGT1, GGT2, GGT3P, GGT6, GGT7 GSTA1, GSTA2, GSTT1, MGST2, MGST3 GPX2, GPX3 GCLC, GSR, PGD, IDH1
PDX215 GGT1, GGT2, GGT7, GGT8P GSTA1, GSTA4, GSTM2, GSTM4, MGST2 OPLAH, IDH1
PDX253 GGT1, GGT2, GGT3P, GGT6 GSTA1, GSTA2, GSTA4, MGST1, MGST2,
MGST3
GPX2, GPX8 GSR, IDH1
PDX354 GSTA1, GSTA2, MGST1, GSTM2 GPX3, GPX8 GCLC, GGCT, IDH1
PDX265 GSTA4, GSTM1, GSTM2, GSTM4 GPX2 GGCT, PGD, IDH1, IDH2
PDX: Pa ien -de i ed xenog a ; GGTs: Gamma-glu amyl ans e ases; GSTs: Glu a hione-s- ans e ases; GPXs: Glu a hione pe oxidases.
educed o m (GSH). Fi s , we measu ed he GSH con en in p ima y cells cul u ed in
adhe en o sphe e condi ions using he same panel o se en PDX models.
In e es ingly, excep o PDX247 (o hepa obilia y o igin) GSH con en was 2 o 8 imes
highe in CSC-en iching condi ions (Figu e 3A; P alues < 0.05-0.01), ein o cing he
esul s ob ained by gene exp ession analysis. Nex , we alida ed he inc eased GSH
le els obse ed by analyzing CD133– and CD133+ subpopula ions by low cy ome y.
As shown in Figu e 3B and 3C, CD133+ CSCs accumula ed mo e in acellula GSH
(1.94- old, P = 0.04). In summa y, ou esul s indica e ha exp ession o glu a hione
me abolism genes and GSH con en a e up egula ed in CSC-en iched condi ions.
Deple ion o GSH con en impai s CSC unc ionali y
In o de o e alua e he signi icance o he inc eased GSH con en o CSCs, we
pe o med a se ies o GSH deple ion assays using wo dis inc pha macological
app oaches. We i s es ed he inhibi o o GSH syn hesis BSO, which i e e sibly
blocks he enzyme gamma-glu amylcys eine syn he ase (γ-GCS). Incuba ion o CSC-
en iched sphe es wi h inc easing doses o BSO o 48 h esul ed in a dose-dependen
decline in GSH con en , and wi h doses > 50 µmol/L deple ed he GSH con en below
50% (Figu e 4A; P alues anging be ween 0.0023 and 0.00032). T ea men o CSC-
en iched sphe es wi h BSO a 100 µmol/L o 48 h esul ed in he accumula ion o cells
in G1 phase, indica i e o cell cycle a es (Figu e 4B). In addi ion, we obse ed an
inc ease in he pe cen age o cells in bo h ea ly and la e apop osis a e BSO ea men ,
sugges ing ha ull GSH con en is necessa y o p oli e a ion and su i al o CSCs
(Figu e 4C).
Conside ing hese esul s, we nex ocused on al e na i e ea u es di ec ly linked o
CSCs. Fi s , BSO ea men dec eased he exp ession o he a o emen ioned s emness
signa u e de ined by NANOG, KLF4, SOX2 and OCT4 (Figu e 5A). Nex , we measu ed
he e ec o BSO on CSC sel - enewal. Since we had obse ed an up- egula ion o
genes in ol ed in GSH ecycling (Table 2), we also es ed he GSH ecycling inhibi o
6-aminonico inamide (6-AN), which blocks he oxida i e b anch o he pen ose
phospha e pa hway ha is necessa y o educ ion o oxidized GSSG in o GSH.
Incuba ion wi h ei he BSO o 6-AN consis en ly educed he numbe o sphe es
o med by day 7, indica i e o diminished sel - enewal capaci y (Figu e 5B).
Consis en ly, he pe cen age o CD133+ cells assessed by low cy ome y was also
educed ollowing ea men wi h ei he inhibi o (Figu e 5C). Toge he hese esul s
indica e ha deple ion o GSH con en di ec ly impac s CSC iabili y and sel - enewal.
Deple ion o GSH con en in CSC-en iched cul u es enhances esponse o
gemci abine
Apa om he abili y o sel - enew, ano he key ea u e o CSCs is chemo esis ance.
No ably, se e al glu a hione- ela ed enzymes such as GSTs a e di ec ly implica ed in
de oxi ica ion o xenobio ics, sugges ing ano he po en ial link be ween glu a hione
me abolism and CSC ea u es[28]. Indeed, we ound ha he absolu e GSH
concen a ion in sphe es, bu no adhe en cul u es, posi i ely co ela ed wi h he
pe cen age o su i ing cells a e gemci abine ea men (Figu e 6A; Pea son’s =
0.96, P = 5.89 × 10-11). Gemci abine ea men induced GSH accumula ion exclusi ely in
CD133+ cells (Figu e 6B), which was ab oga ed by co- ea men wi h BSO. This
ansla ed in sensi iza ion o CD133+ cells o ea men wi h gemci abine,
app oxima ing le els o apop osis obse ed in di e en ia ed CD133– cells (Figu e 6C),
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1417 No embe 26, 2020 Volume 12 Issue 11
Figu e 1 Exp ession o glu a hione me abolism genes posi i ely co ela es wi h a s emness signa u e in human panc ea ic cance
samples and p edic s poo ou come. A: En ichmen in CD133+ cells in sphe e cul u es s adhe en cul u es, as de e mined by low cy ome y. Rep esen a i e
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1418 No embe 26, 2020 Volume 12 Issue 11
low cy ome y his og ams o he indica ed pa ien -de i ed xenog a models; B: Co ela ion o genes ha we e up- egula ed in cance s em cell-en iched cul u es wi h
a s emness signa u e de ined by combined exp ession o he plu ipo ency- ela ed genes NANOG, KLF4, SOX2 and OCT4. Pea son´s and co esponding P alues
o indi idual co ela ions a e shown; C: Disease- ee su i al in panc ea ic cance pa ien s om uppe and lowe qua iles o exp ession o he indica ed genes.
Haza d a io was calcula ed using he Cox P opo ional Haza ds model. Do ed lines ep esen he 95% con idence in e al. Da a in A and B we e calcula ed using
GEPIA2 (h p://gepia2.cance -pku.cn), using public da a compiled in TCGA and GTEx. Sph: Sphe e cul u e; Adh: adhe en cul u e; HR: Haza d a io.
Figu e 2 Glu a hione me abolism- ela ed genes a e up- egula ed in cance s em cell-en iched condi ions. P ima y cells om di e en pa ien -
de i ed xenog a models as indica ed in he igu e we e cul u ed in adhe en o low-a achmen cance s em cell-en iching condi ions. On day 7 he exp ession o
se e al glu a hione (GSH)- ela ed genes was e alua ed by eal- ime polyme ase chain eac ion (PCR). A: Glu a hione-S-T ans e ases A1, A2, A4, M1; B: Gamma-
glu amyl ans e ases 1 and 2; C: Glu a hione Pe oxidases 1 and 2; D: Isoci a e Dehyd ogenases 1 and 2. Da a we e no malized o HPRT and a e shown as mean ±
SE old change exp ession le els o sphe e s adhe en cul u es in loga i hmic scale. aP < 0.05; bP < 0.01; cP < 0.001. PDX: Pa ien -de i ed xenog a ; GGT: Gamma-
glu amyl ans e ase; GST: Glu a hione-s- ans e ase; GPX: Glu a hione pe oxidase.
and diminished sphe e o ma ion as compa ed o single ea men s (Figu e 6D; P <
0.05). These esul s demons a e ha chemo esis ance in CSCs is, a leas in pa ,
dependen on GSH syn hesis.
In summa y, ou esul s sugges ha glu a hione me abolism plays an essen ial ole
in PDAC agg essi eness, suppo ing CSC su i al, sel - enewal and chemo esis ance.
DISCUSSION
Any li ing cell p oduces ROS, ei he as a by-p oduc o mi ochond ial espi a ion o in
a con olled manne by di e en oxidases o modula e cell signaling. Speci ically,
in acellula ROS le els egula e he complex balance be ween symme ic and
asymme ic di ision in s em cells, hus con olling di e en ia ion and sel - enewal[29].
In hese cells, a oiding ROS accumula ion is pa icula ly impo an , since i p e en s
he accumula ion o he edi a y mu a ions and p ema u e senescence[30]. Fo hese
easons, quiescen s em cells eside in a low oxygen niche a o ing glycolysis o e
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1425 No embe 26, 2020 Volume 12 Issue 11
ARTICLE HIGHLIGHTS
Resea ch backg ound
Redox me abolism modula es s em cell and cance s em cell (CSC) unc ionali y in
di e en model sys ems, ega dless o hei dominan me abolic pheno ype. In ac ,
CSCs om se e al cance ypes show inc eased glu a hione con en and associa ed
enzymes.
Resea ch mo i a ion
Iden i ica ion o me abolic ulne abili ies o highly agg essi e CSCs can lead o he
de elopmen o mo e e ec i e ea men s a egies o panc ea ic cance .
Resea ch objec i es
The p esen s udy aimed o de e mine he impo ance o glu a hione me abolism o
panc ea ic CSCs as compa ed o hei di e en ia ed coun e pa s.
Resea ch me hods
Compa isons be ween CSCs and non-CSCs in p ima y panc ea ic cance cells o
pa ien -de i ed xenog a s we e ca ied ou by cul u ing in adhe en o CSC-en iching
sphe e condi ions and con i med by CD133 s aining by low cy ome y. Gene
exp ession analyses we e pe o med by RNAseq o eal- ime PCR. Public TCGA and
GTEx RNAseq da a om panc ea ic cance s no mal issue samples we e analyzed
using he webse e GEPIA2. S aining o measu emen o glu a hione
(monochlo obimane), cell cycle (p opidium iodide) o apop osis (Annexin-V) we e
de e mined by luo ime y o low cy ome y. Pha macological glu a hione deple ion
was achie ed wi h inhibi o s o glu a hione syn hesis (bu hionine-sul oximine) and
ecycling (6-Aminonico inamide). Sel - enewal was assessed by sphe e o ma ion
assay and esponse o gemci abine ea men was used as a eadou o
chemo esis ance.
Resea ch esul s
Se e al glu a hione me abolism genes we e up egula ed in panc ea ic CSCs, and hei
exp ession co ela es wi h a s emness signa u e and p edic s su i al in clinical
samples. Inc eased glu a hione concen a ion in CSCs p omo es iabili y, cell cycle
p og ession and plu ipo ency gene exp ession. Inhibi ion o glu a hione syn hesis o
ecycling impai s CSC unc ionali ies such as sel - enewal and chemo esis ance.
Resea ch conclusions
Ou da a sugges ha panc ea ic CSCs depend on glu a hione me abolism.
Pha macological a ge ing o his pa hway showed ha high GSH (glu a hione in i s
educed o m) con en is essen ial o main ain CSC unc ionali y in e ms o sel -
enewal and chemo esis ance.
Resea ch pe spec i es
Ou da a demons a e a a ge able me abolic ulne abili y o his agg essi e
subpopula ion o cance cells, which could be exploi ed o he apeu ic pu poses.
ACKNOWLEDGEMENTS
We hank Cou ois S, Espiau P and Pa ejo B o c i ical eading o he manusc ip . The
au ho s would like o acknowledge he use o he Cy ome y Uni s om CNIO and
IACS-Uni e sidad de Za agoza.
REFERENCES
GBD 2017 Risk Fac o Collabo a o s. Global, egional, and na ional compa a i e isk assessmen o 84
beha iou al, en i onmen al and occupa ional, and me abolic isks o clus e s o isks o 195 coun ies and
e i o ies, 1990-2017: a sys ema ic analysis o he Global Bu den o Disease S udy 2017. Lance 2018; 392:
1923-1994 [PMID: 30496105 DOI: 10.1016/S0140-6736(18)32225-6]
1
Siegel RL, Mille KD, Jemal A. Cance S a is ics, 2017. CA Cance J Clin 2017; 67: 7-30 [PMID: 28055103
DOI: 10.3322/caac.21387]
2
Rahib L, Smi h BD, Aizenbe g R, Rosenzweig AB, Fleshman JM, Ma isian LM. P ojec ing cance 3

Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1426 No embe 26, 2020 Volume 12 Issue 11
incidence and dea hs o 2030: he unexpec ed bu den o hy oid, li e , and panc eas cance s in he Uni ed
S a es. Cance Res 2014; 74: 2913-2921 [PMID: 24840647 DOI: 10.1158/0008-5472.CAN-14-0155]
He mann PC, Hube SL, He le T, Aiche A, Ellwa JW, Guba M, B uns CJ, Heeschen C. Dis inc
popula ions o cance s em cells de e mine umo g ow h and me as a ic ac i i y in human panc ea ic cance .
Cell S em Cell 2007; 1: 313-323 [PMID: 18371365 DOI: 10.1016/j.s em.2007.06.002]
4
Lona do E, He mann PC, Muelle MT, Hube S, Balic A, Mi anda-Lo enzo I, Zago ac S, Alcala S,
Rod iguez-A abaolaza I, Rami ez JC, To es-Ruíz R, Ga cia E, Hidalgo M, Ceb ián DÁ, Heuchel R, Löh M,
Be ge F, Ba ens ein P, Aiche A, Heeschen C. Nodal/Ac i in signaling d i es sel - enewal and
umo igenici y o panc ea ic cance s em cells and p o ides a a ge o combined d ug he apy. Cell S em
Cell 2011; 9: 433-446 [PMID: 22056140 DOI: 10.1016/j.s em.2011.10.001]
5
Mi anda-Lo enzo I, Do ado J, Lona do E, Alcala S, Se ano AG, Clausell-To mos J, Cio i M, Megias D,
Zago ac S, Balic A, Hidalgo M, E kan M, Klee J, Sca pa A, Sainz B J , Heeschen C. In acellula
au o luo escence: a bioma ke o epi helial cance s em cells. Na Me hods 2014; 11: 1161-1169 [PMID:
25262208 DOI: 10.1038/nme h.3112]
6
Sancho P, Bu gos-Ramos E, Ta e a A, Bou Khei T, Jagus P, Schoenhals M, Ba neda D, Selle s K,
Campos-Oli as R, G aña O, Vie a CR, Yune a M, Sainz B J , Heeschen C. MYC/PGC-1α Balance
De e mines he Me abolic Pheno ype and Plas ici y o Panc ea ic Cance S em Cells. Cell Me ab 2015; 22:
590-605 [PMID: 26365176 DOI: 10.1016/j.cme .2015.08.015]
7
Sancho P, Alcala S, Usacho V, He mann PC, Sainz B J . The e e -changing landscape o panc ea ic cance
s em cells. Panc ea ology 2016; 16: 489-496 [PMID: 27161173 DOI: 10.1016/j.pan.2016.04.004]
8
Lona do E, He mann PC, Heeschen C. Panc ea ic cance s em cells - upda e and u u e pe spec i es. Mol
Oncol 2010; 4: 431-442 [PMID: 20580623 DOI: 10.1016/j.molonc.2010.06.002]
9
Cio i M, T abulo SM, Sanchez-Ripoll Y, Mi anda-Lo enzo I, Lona do E, Do ado J, Reis Viei a C, Rami ez
JC, Hidalgo M, Aiche A, Hahn S, Sainz B J , Heeschen C. The miR-17-92 clus e coun e ac s quiescence
and chemo esis ance in a dis inc subpopula ion o panc ea ic cance s em cells. Gu 2015; 64: 1936-1948
[PMID: 25887381 DOI: 10.1136/gu jnl-2014-308470]
10
Zhou D, Shao L, Spi z DR. Reac i e oxygen species in no mal and umo s em cells. Ad Cance Res 2014;
122: 1-67 [PMID: 24974178 DOI: 10.1016/B978-0-12-420117-0.00001-3]
11
Sancho P, Ba neda D, Heeschen C. Hallma ks o cance s em cell me abolism. B J Cance 2016; 114:
1305-1312 [PMID: 27219018 DOI: 10.1038/bjc.2016.152]
12
Diehn M, Cho RW, Lobo NA, Kalisky T, Do ie MJ, Kulp AN, Qian D, Lam JS, Ailles LE, Wong M, Joshua
B, Kaplan MJ, Wapni I, Di bas FM, Somlo G, Ga be oglio C, Paz B, Shen J, Lau SK, Quake SR, B own
JM, Weissman IL, Cla ke MF. Associa ion o eac i e oxygen species le els and adio esis ance in cance
s em cells. Na u e 2009; 458: 780-783 [PMID: 19194462 DOI: 10.1038/na u e07733]
13
Ishimo o T, Nagano O, Yae T, Tamada M, Mo oha a T, Oshima H, Oshima M, Ikeda T, Asaba R, Yagi H,
Masuko T, Shimizu T, Ishikawa T, Kai K, Takahashi E, Imamu a Y, Baba Y, Ohmu a M, Suema su M, Baba
H, Saya H. CD44 a ian egula es edox s a us in cance cells by s abilizing he xCT subuni o sys em xc(-)
and he eby p omo es umo g ow h. Cance Cell 2011; 19: 387-400 [PMID: 21397861 DOI:
10.1016/j.cc .2011.01.038]
14
Chang CW, Chen YS, Chou SH, Han CL, Chen YJ, Yang CC, Huang CY, Lo JF. Dis inc subpopula ions o
head and neck cance cells wi h di e en le els o in acellula eac i e oxygen species exhibi di e se
s emness, p oli e a ion, and chemosensi i i y. Cance Res 2014; 74: 6291-6305 [PMID: 25217518 DOI:
10.1158/0008-5472.CAN-14-0626]
15
Jagus P, de Luxán-Delgado B, Pa ejo-Alonso B, Sancho P. Me abolism-Based The apeu ic S a egies
Ta ge ing Cance S em Cells. F on Pha macol 2019; 10: 203 [PMID: 30967773 DOI:
10.3389/ pha .2019.00203]
16
Calab ese G, Mo gan B, Rieme J. Mi ochond ial Glu a hione: Regula ion and Func ions. An ioxid Redox
Signal 2017; 27: 1162-1177 [PMID: 28558477 DOI: 10.1089/a s.2017.7121]
17
Jeong EM, Yoon JH, Lim J, Shin JW, Cho AY, Heo J, Lee KB, Lee JH, Lee WJ, Kim HJ, Son YH, Lee SJ,
Cho SY, Shin DM, Choi K, Kim IG. Real-Time Moni o ing o Glu a hione in Li ing Cells Re eals ha High
Glu a hione Le els A e Requi ed o Main ain S em Cell Func ion. S em Cell Repo s 2018; 10: 600-614
[PMID: 29307581 DOI: 10.1016/j.s emc .2017.12.007]
18
Kim HM, Ha aguchi N, Ishii H, Ohkuma M, Okano M, Mimo i K, Eguchi H, Yamamo o H, Nagano H,
Sekimo o M, Doki Y, Mo i M. Inc eased CD13 exp ession educes eac i e oxygen species, p omo ing
su i al o li e cance s em cells ia an epi helial-mesenchymal ansi ion-like phenomenon. Ann Su g
Oncol 2012; 19 Suppl 3: S539-S548 [PMID: 21879266 DOI: 10.1245/s10434-011-2040-5]
19
Ha is IS, T eloa AE, Inoue S, Sasaki M, Go ini C, Lee KC, Yung KY, B enne D, Knobbe-Thomsen CB,
Cox MA, Elia A, Be ge T, Cescon DW, Adeoye A, B üs le A, Molyneux SD, Mason JM, Li WY,
Yamamo o K, Wakeham A, Be man HK, Khokha R, Done SJ, Ka anagh TJ, Lam CW, Mak TW.
Glu a hione and hio edoxin an ioxidan pa hways syne gize o d i e cance ini ia ion and p og ession.
Cance Cell 2015; 27: 211-222 [PMID: 25620030 DOI: 10.1016/j.ccell.2014.11.019]
20
Ob ado E, Ca e e o J, O ega A, Medina I, Rodilla V, Pellice JA, Es ela JM. gamma-Glu amyl
anspep idase o e exp ession inc eases me as a ic g ow h o B16 melanoma cells in he mouse li e .
Hepa ology 2002; 35: 74-81 [PMID: 11786961 DOI: 10.1053/jhep.2002.30277]
21
Ob ado E, Benlloch M, Pellice JA, Asensi M, Es ela JM. In e issue low o glu a hione (GSH) as a
umo g ow h-p omo ing mechanism: in e leukin 6 induces GSH elease om hepa ocy es in me as a ic B16
melanoma-bea ing mice. J Biol Chem 2011; 286: 15716-15727 [PMID: 21393247 DOI:
10.1074/jbc.M110.196261]
22
Rocha CR, Kaji ani GS, Quine A, Fo una o RS, Menck CF. NRF2 and glu a hione a e key esis ance
media o s o emozolomide in glioma and melanoma cells. Onco a ge 2016; 7: 48081-48092 [PMID:
27344172 DOI: 10.18632/onco a ge .10129]
23
Muelle MT, He mann PC, Wi haue J, Rubio-Viquei a B, Leich SF, Hube S, Ellwa JW, Mus a a M,
Ba ens ein P, D'Haese JG, Schoenbe g MH, Be ge F, Jauch KW, Hidalgo M, Heeschen C. Combined
24
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1427 No embe 26, 2020 Volume 12 Issue 11
a ge ed ea men o elimina e umo igenic cance s em cells in human panc ea ic cance . Gas oen e ology
2009; 137: 1102-1113 [PMID: 19501590 DOI: 10.1053/j.gas o.2009.05.053]
Gallmeie E, He mann PC, Muelle MT, Machado JG, Ziesch A, De Toni EN, Palagyi A, Eisen C, Ellwa
JW, Ri e a J, Rubio-Viquei a B, Hidalgo M, Bunz F, Göke B, Heeschen C. Inhibi ion o a axia
elangiec asia- and Rad3- ela ed unc ion ab oga es he in i o and in i o umo igenici y o human colon
cance cells h ough deple ion o he CD133(+) umo -ini ia ing cell ac ion. S em Cells 2011; 29: 418-429
[PMID: 21308861 DOI: 10.1002/s em.595]
25
T apnell C, Robe s A, Go L, Pe ea G, Kim D, Kelley DR, Pimen el H, Salzbe g SL, Rinn JL, Pach e L.
Di e en ial gene and ansc ip exp ession analysis o RNA-seq expe imen s wi h TopHa and Cu links. Na
P o oc 2012; 7: 562-578 [PMID: 22383036 DOI: 10.1038/np o .2012.016]
26
Tang Z, Kang B, Li C, Chen T, Zhang Z. GEPIA2: an enhanced web se e o la ge-scale exp ession
p o iling and in e ac i e analysis. Nucleic Acids Res 2019; 47: W556-W560 [PMID: 31114875 DOI:
10.1093/na /gkz430]
27
Ribas V, Ga cía-Ruiz C, Fe nández-Checa JC. Glu a hione and mi ochond ia. F on Pha macol 2014; 5: 151
[PMID: 25024695 DOI: 10.3389/ pha .2014.00151]
28
I o K, Hi ao A, A ai F, Ma suoka S, Takubo K, Hamaguchi I, Nomiyama K, Hosokawa K, Saku ada K,
Nakaga a N, Ikeda Y, Mak TW, Suda T. Regula ion o oxida i e s ess by ATM is equi ed o sel - enewal
o haema opoie ic s em cells. Na u e 2004; 431: 997-1002 [PMID: 15496926 DOI: 10.1038/na u e02989]
29
Yaha a T, Takanashi T, Mugu uma Y, Ib ahim AA, Ma suzawa H, Uno T, Sheng Y, Onizuka M, I o M,
Ka o S, Ando K. Accumula ion o oxida i e DNA damage es ic s he sel - enewal capaci y o human
hema opoie ic s em cells. Blood 2011; 118: 2941-2950 [PMID: 21734240 DOI:
10.1182/blood-2011-01-330050]
30
Obu oglu L, Ta di o S, F i z V, de Ba os SC, Me ida P, C a ei o M, Mamede J, C e ene G, Mongellaz C,
An X, Klysz D, Touhami J, Boye -Cla el M, Ba ini JL, Da dalhon V, Zimme mann VS, Mohandas N,
Go lieb E, Si bon M, Kine S, Taylo N. Glucose and glu amine me abolism egula e human hema opoie ic
s em cell lineage speci ica ion. Cell S em Cell 2014; 15: 169-184 [PMID: 24953180 DOI:
10.1016/j.s em.2014.06.002]
31
Zhao H, Duan Q, Zhang Z, Li H, Wu H, Shen Q, Wang C, Yin T. Up- egula ion o glycolysis p omo es he
s emness and EMT pheno ypes in gemci abine- esis an panc ea ic cance cells. J Cell Mol Med 2017; 21:
2055-2067 [PMID: 28244691 DOI: 10.1111/jcmm.13126]
32
Wang L, Li P, Hu W, Xia Y, Hu C, Liu L, Jiang X. CD44+CD24+ subse o PANC-1 cells exhibi s adia ion
esis ance ia dec eased le els o eac i e oxygen species. Oncol Le 2017; 14: 1341-1346 [PMID:
28789349 DOI: 10.3892/ol.2017.6301]
33
Luo M, Shang L, B ooks MD, Jiagge E, Zhu Y, Buschhaus JM, Conley S, Fa h MA, Da is A, Gheo dunescu
E, Wang Y, Ha ouaka R, Lozie A, T ine D, McDe mo S, Me aj e SD, Luke GD, Spi z DR, Wicha MS.
Ta ge ing B eas Cance S em Cell S a e Equilib ium h ough Modula ion o Redox Signaling. Cell Me ab
2018; 28: 69-86. e6 [PMID: 29972798 DOI: 10.1016/j.cme .2018.06.006]
34
Lu H, Chen I, Shimoda LA, Pa k Y, Zhang C, T an L, Zhang H, Semenza GL. Chemo he apy-Induced Ca2+
Release S imula es B eas Cance S em Cell En ichmen . Cell Rep 2017; 18: 1946-1957 [PMID: 28228260
DOI: 10.1016/j.cel ep.2017.02.001]
35
Liu J, Hinkhouse MM, Sun W, Weyde CJ, Ri chie JM, Obe ley LW, Cullen JJ. Redox egula ion o
panc ea ic cance cell g ow h: ole o glu a hione pe oxidase in he supp ession o he malignan pheno ype.
Hum Gene The 2004; 15: 239-250 [PMID: 15018733 DOI: 10.1089/104303404322886093]
36
Meng Q, Shi S, Liang C, Liang D, Hua J, Zhang B, Xu J, Yu X. Ab oga ion o glu a hione pe oxidase-1
d i es EMT and chemo esis ance in panc ea ic cance by ac i a ing ROS-media ed Ak /GSK3β/Snail
signaling. Oncogene 2018; 37: 5843-5857 [PMID: 29980787 DOI: 10.1038/s41388-018-0392-z]
37
Peng G, Tang Z, Xiang Y, Chen W. Glu a hione pe oxidase 4 main ains a s emness pheno ype, oxida i e
homeos asis and egula es biological p ocesses in Panc-1 cance s em-like cells. Oncol Rep 2019; 41: 1264-
1274 [PMID: 30535490 DOI: 10.3892/o .2018.6905]
38
Cole-Ezea P, Swan D, Shanley D, Heske h J. Glu a hione pe oxidase 4 has a majo ole in p o ec ing
mi ochond ia om oxida i e damage and main aining oxida i e phospho yla ion complexes in gu epi helial
cells. F ee Radic Biol Med 2012; 53: 488-497 [PMID: 22634395 DOI:
10.1016/j. ee adbiomed.2012.05.029]
39
Fuji ani N, Yoneda A, Takahashi M, Takasawa A, Aoyama T, Miyazaki T. Silencing o Glu a hione S-
T ans e ase Pi Inhibi s Cance Cell G ow h ia Oxida i e S ess Induced by Mi ochond ia Dys unc ion. Sci
Rep 2019; 9: 14764 [PMID: 31611630 DOI: 10.1038/s41598-019-51462-9]
40
Aquilano K, Baldelli S, Pagliei B, Canna a SM, Ro ilio G, Ci iolo MR. p53 o ches a es he PGC-1α-
media ed an ioxidan esponse upon mild edox and me abolic imbalance. An ioxid Redox Signal 2013; 18:
386-399 [PMID: 22861165 DOI: 10.1089/a s.2012.4615]
41
Ma molino D, Man o M, Acqua i a F, Ve ga a P, Ra ella A, Mon icelli A, Pandol o M. PGC-1alpha down-
egula ion a ec s he an ioxidan esponse in F ied eich's a axia. PLoS One 2010; 5: e10025 [PMID:
20383327 DOI: 10.1371/jou nal.pone.0010025]
42
Vazquez F, Lim JH, Chim H, Bhalla K, Gi nun G, Pie ce K, Clish CB, G an e SR, Widlund HR,
Spiegelman BM, Puigse e P. PGC1α exp ession de ines a subse o human melanoma umo s wi h
inc eased mi ochond ial capaci y and esis ance o oxida i e s ess. Cance Cell 2013; 23: 287-301 [PMID:
23416000 DOI: 10.1016/j.cc .2012.11.020]
43
Tanaka G, Inoue K, Shimizu T, Akimo o K, Kubo a K. Dual pha macological inhibi ion o glu a hione and
hio edoxin sys ems syne gizes o kill colo ec al ca cinoma s em cells. Cance Med 2016; 5: 2544-2557
[PMID: 27485632 DOI: 10.1002/cam4.844]
44
Mi an T, Vogg ATJ, D ude N, Mo aghy FM, Mo gen o h A. Modula ion o glu a hione p omo es apop osis
in iple-nega i e b eas cance cells. FASEB J 2018; 32: 2803-2813 [PMID: 29301945 DOI:
10.1096/ j.201701157R]
45
Schnelldo e T, Gansauge S, Gansauge F, Schlosse S, Bege HG, Nussle AK. Glu a hione deple ion 46
Jagus P e al. Glu a hione me abolism in panc ea ic CSCs
WJSC h ps://www.wjgne .com 1428 No embe 26, 2020 Volume 12 Issue 11
causes cell g ow h inhibi ion and enhanced apop osis in panc ea ic cance cells. Cance 2000; 89: 1440-1447
[PMID: 11013356]
Ramana han B, Jan KY, Chen CH, Hou TC, Yu HJ, Pu YS. Resis ance o pacli axel is p opo ional o
cellula o al an ioxidan capaci y. Cance Res 2005; 65: 8455-8460 [PMID: 16166325 DOI:
10.1158/0008-5472.CAN-05-1162]
47
Li Q, Yin X, Wang W, Zhan M, Zhao B, Hou Z, Wang J. The e ec s o bu hionine sul oximine on he
p oli e a ion and apop osis o bilia y ac cance cells induced by cispla in and gemci abine. Oncol Le
2016; 11: 474-480 [PMID: 26870236 DOI: 10.3892/ol.2015.3879]
48
Chio IIC, Ja a nejad SM, Ponz-Sa ise M, Pa k Y, Ri e a K, Palm W, Wilson J, Sanga V, Hao Y, Öhlund
D, W igh K, Filippini D, Lee EJ, Da Sil a B, Schoep e C, Wilkinson JE, Buscaglia JM, DeNicola GM,
Ti iac H, Hammell M, C aw o d HC, Schmid EE, Thompson CB, Pappin DJ, Sonenbe g N, Tu eson DA.
NRF2 P omo es Tumo Main enance by Modula ing mRNA T ansla ion in Panc ea ic Cance . Cell 2016;
166: 963-976 [PMID: 27477511 DOI: 10.1016/j.cell.2016.06.056]
49
Lo M, Ling V, Wang YZ, Gou PW. The xc- cys ine/glu ama e an ipo e : a media o o panc ea ic cance
g ow h wi h a ole in d ug esis ance. B J Cance 2008; 99: 464-472 [PMID: 18648370 DOI:
10.1038/sj.bjc.6604485]
50