Glutathione metabolism is essential for self-renewal and chemoresistance of pancreatic cancer stem cells

WJSC h ps://www.wjgne .com 1410 No embe 26, 2020 Volume 12 Issue 11 Wo ld Jou nal o S em Cells W J S C Submi a Manusc ip : h ps://www. 6publishing.com Wo ld J S em Cells 2020 No embe 26; 12(11): 1410-1428 DOI: 10.4252/wjsc. 12.i11.1410 ISSN 1948-0210 (online) ORIGINAL ARTICLE Basic S udy Glu a hione me abolism is essen ial o sel - enewal and chemo esis ance o panc ea ic cance s em cells Pe a Jagus , Sonia Alcalá, B uno Sainz J , Ch is ophe Heeschen, Pa icia Sancho ORCID numbe : Pe a Jagus 0000- 0001-5291-251X; Sonia Alcalá 0000- 0002-7644-4973; B uno Sainz J 0000- 0003-4829-7651; Ch is ophe Heeschen 0000-0002-1158-8554; Pa icia Sancho 0000-0002-1092- 5395. Au ho con ibu ions: Jagus P and Sancho P pe o med he expe imen s, acqui ed and analyzed da a; Alcalá S and Sainz J B compiled and alida ed he samples o RNAseq analysis; Heeschen C and Sancho P in e p e ed da a, designed he s udy and w o e he manusc ip ; all au ho s app o ed he inal e sion o he manusc ip . Suppo ed by ERC Ad anced In es iga o G an , No. Pa-CSC 233460; Eu opean Communi y's Se en h F amewo k P og amme, No. 602783; Ins i u o de Salud Ca los III and Eu opean Funds (FSE: “el FSE in ie e en u u u o” and FEDER: “una mane a de hace Eu opa”) Miguel Se e Fellowship, No. CP16/00121; and Fondo In es igaciones Sani a ias, No. PI17/00082. Ins i u ional e iew boa d s a emen : The s udy was e iewed and app o ed by he IIS A agon Ins i u ional Re iew Boa d. Pe a Jagus , Molecula Pa hology P og amme, Spanish Na ional Cance Resea ch Cen e (CNIO), Mad id 28029, Spain Sonia Alcalá, B uno Sainz J , Depa men o Biochemis y, Au ónoma Uni e si y o Mad id, Ins i u o de In es igaciones Biomédicas "Albe o Sols" CSIC-UAM, Mad id 28029, Spain Ch is ophe Heeschen, Cen e o Single-Cell Omics & Key Labo a o y o Oncogenes and Rela ed Genes, Shanghai Cance Ins i u e, Shanghai Jiao Tong Uni e si y School o Medicine, Shanghai 200025, China Pa icia Sancho, Hospi al Uni e si a io Miguel Se e , IIS A agon, Za agoza 50009, Spain Co esponding au ho : Pa icia Sancho, PhD, Senio Scien is , Hospi al Uni e si a io Miguel Se e , IIS A agon, Isabel la Ca ólica 1-3, Za agoza 50009, Spain. [email p o ec ed] Abs ac BACKGROUND Cellula me abolism egula es s emness in heal h and disease. A educed edox s a e is essen ial o sel - enewal o no mal and cance s em cells (CSCs). Howe e , while s em cells ely on glycolysis, di e en CSCs, including panc ea ic CSCs, a o mi ochond ial me abolism as hei dominan ene gy-p oducing pa hway. This sugges s ha powe ul an ioxidan ne wo ks mus be in place o de oxi y mi ochond ial eac i e oxygen species (ROS) and main ain s emness in oxida i e CSCs. Since glu a hione me abolism is c i ical o no mal s em cell unc ion and CSCs om b eas , li e and gas ic cance show inc eased glu a hione con en , we hypo hesized ha panc ea ic CSCs also ely on his pa hway o ROS de oxi ica ion. AIM To in es iga e he ole o glu a hione me abolism in panc ea ic CSCs. METHODS P ima y panc ea ic cance cells o pa ien -de i ed xenog a s (PDXs) we e cul u ed in adhe en o CSC-en iching sphe e condi ions o de e mine he ole o glu a hione me abolism in s emness. Real- ime polyme ase chain eac ion (PCR) was used o alida e RNAseq esul s in ol ing glu a hione me abolism genes in adhe en s sphe es, as well as he exp ession o plu ipo ency- ela ed genes ollowing ea men . Public TCGA and GTEx RNAseq da a om panc ea ic cance Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1411 No embe 26, 2020 Volume 12 Issue 11 Con lic -o -in e es s a emen : Au ho s decla e no con lic o in e es . Da a sha ing s a emen : RNAseq da ase E-MTAB-3808 is a ailable a h ps://www.ebi.ac.uk/a ayex p ess/. Open-Access: This a icle is an open-access a icle ha was selec ed by an in-house edi o and ully pee - e iewed by ex e nal e iewe s. I is dis ibu ed in acco dance wi h he C ea i e Commons A ibu ion NonComme cial (CC BY-NC 4.0) license, which pe mi s o he s o dis ibu e, emix, adap , build upon his wo k non-comme cially, and license hei de i a i e wo ks on di e en e ms, p o ided he o iginal wo k is p ope ly ci ed and he use is non-comme cial. See: h p://c ea i ecommons.o g/License s/by-nc/4.0/ Manusc ip sou ce: In i ed manusc ip Special y ype: Cell and issue enginee ing Coun y/Te i o y o o igin: Spain Pee - e iew epo ’s scien i ic quali y classi ica ion G ade A (Excellen ): 0 G ade B (Ve y good): 0 G ade C (Good): C G ade D (Fai ): 0 G ade E (Poo ): 0 Recei ed: July 10, 2020 Pee - e iew s a ed: July 10, 2020 Fi s decision: Augus 9, 2020 Re ised: Augus 19, 2020 Accep ed: Sep embe 25, 2020 A icle in p ess: Sep embe 25, 2020 Published online: No embe 26, 2020 P-Re iewe : Chen Q S-Edi o : Gao CC L-Edi o : Webs e JR P-Edi o : Li JH s no mal issue samples we e analyzed using he webse e GEPIA2. The glu a hione-sensi i e luo escen p obe monochlo obimane was used o de e mine glu a hione con en by luo ime y o low cy ome y. Pha macological inhibi o s o glu a hione syn hesis and ecycling [bu hionine-sul oximine (BSO) and 6- Aminonico inamide (6-AN), espec i ely] we e used o in es iga e he impac o glu a hione deple ion on CSC-en iched cul u es. S aining wi h p opidium iodide (cell cycle), Annexin-V (apop osis) and CD133 (CSC con en ) we e de e mined by low cy ome y. Sel - enewal was assessed by sphe e o ma ion assay and esponse o gemci abine ea men was used as a eadou o chemo esis ance. RESULTS Analysis o ou p e iously published RNAseq da ase E-MTAB-3808 e ealed up- egula ion o genes in ol ed in he KEGG (Kyo o Encyclopedia o Genes and Genomes) Pa hway Glu a hione Me abolism in CSC-en iched cul u es compa ed o hei di e en ia ed coun e pa s. Consis en ly, in panc ea ic cance pa ien samples he exp ession o mos o hese up- egula ed genes posi i ely co ela ed wi h a s emness signa u e de ined by NANOG, KLF4, SOX2 and OCT4 exp ession (P < 10-5). Mo eo e , 3 o he up egula ed genes (MGST1, GPX8, GCCT) we e associa ed wi h educed disease- ee su i al in pa ien s [Haza d a io (HR) 2.2- 2.5; P = 0.03-0.0054], sugges ing a c i ical ole o his pa hway in panc ea ic cance p og ession. CSC-en iched sphe e cul u es also showed inc eased exp ession o di e en glu a hione me abolism- ela ed genes, as well as enhanced glu a hione con en in i s educed o m (GSH). Glu a hione deple ion wi h BSO induced cell cycle a es and apop osis in sphe es, and diminished he exp ession o s emness genes. Mo eo e , ea men wi h ei he BSO o he glu a hione ecycling inhibi o 6-AN inhibi ed sel - enewal and he exp ession o he CSC ma ke CD133. GSH con en in sphe es posi i ely co ela ed wi h in insic esis ance o gemci abine ea men in di e en PDXs = 0.96, P = 5.8 × 1011). Addi ionally, CD133+ cells accumula ed GSH in esponse o gemci abine, which was ab oga ed by BSO ea men (P < 0.05). Combined ea men wi h BSO and gemci abine-induced apop osis in CD133+ cells o le els compa able o CD133- cells and signi ican ly diminished sel - enewal (P < 0.05), sugges ing ha chemo esis ance o CSCs is pa ially dependen on GSH me abolism. CONCLUSION Ou da a sugges ha panc ea ic CSCs depend on glu a hione me abolism. Pha macological a ge ing o his pa hway showed ha high GSH con en is essen ial o main ain CSC unc ionali y in e ms o sel - enewal and chemo esis ance. Key Wo ds: Panc ea ic cance ; Cance s em cells; Glu a hione; Sel - enewal; Chemo esis ance; Redox ©The Au ho (s) 2020. Published by Baishideng Publishing G oup Inc. All igh s ese ed. Co e Tip: Se e al glu a hione me abolism genes a e up egula ed in panc ea ic cance s em cells (CSCs), and hei exp ession co ela es wi h a s emness signa u e and p edic s su i al in clinical samples. Inc eased glu a hione concen a ion in CSCs p omo es iabili y, cell cycle p og ession and plu ipo ency gene exp ession. Inhibi ion o glu a hione syn hesis o ecycling impai s CSC unc ionali ies such as sel - enewal and chemo esis ance. Ou da a demons a e a a ge able me abolic ulne abili y o his agg essi e subpopula ion o cance cells. Ci a ion: Jagus P, Alcalá S, Sainz J B, Heeschen C, Sancho P. Glu a hione me abolism is essen ial o sel - enewal and chemo esis ance o panc ea ic cance s em cells. Wo ld J S em Cells 2020; 12(11): 1410-1428 URL: h ps://www.wjgne .com/1948-0210/ ull/ 12/i11/1410.h m DOI: h ps://dx.doi.o g/10.4252/wjsc. 12.i11.1410 Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1412 No embe 26, 2020 Volume 12 Issue 11 INTRODUCTION Panc ea ic cance has he wo s ou come o any cance in he wo ld, and is cu en ly he 3 d mos equen cause o cance - ela ed dea hs[1]. A he same ime, he incidence o panc ea ic cance keeps inc easing, wi h app oxima ely 448000 new cases in 2019. This numbe is p edic ed o u he inc ease in he coming yea s and, due o i s ex eme le hali y and lack o e ec i e ea men s a ailable[2], panc ea ic cance may e en become he 2nd mos equen cause o cance - ela ed dea hs by 2030[3]. One possible explana ion o he poo ou come associa ed wi h panc ea ic cance is ha , p e iously, only li le a en ion had been paid o he e icien elimina ion o cance s em cells (CSCs). Panc ea ic cance con ains s em cell-like cells, which a e he sole d i e s o umo igenesis, much like no mal s em cells uel p oli e a ion and di e en ia ion in no mal issue, and he e o e ha e been e med CSCs[4-8]. While CSCs ep esen only a small ac ion o all he cance cells, hey a e ex emely umo igenic down o a single cell, and exclusi ely me as a ic[4,6]. Cu en ea men s a egies o panc ea ic cance spa e CSCs due o hei inhe en chemo esis ance[8-10] and he e o e likely ep esen he key cellula sou ce d i ing disease elapse. To de elop mo e e ec i e ea men s a egies o panc ea ic cance , we need o ob ain a ho ough unde s anding o he egula o y machine y o CSCs, including hei cellula me abolism. Inc easing e idence sugges s ha , simila o no mal s em cells, cellula me abolism is highly egula ed in CSCs and go e ns essen ial aspec s o hei unc ionali y. Indeed, a educed in acellula edox s a e wi h low eac i e oxygen species (ROS) le els allows o sel - enewal, while ROS accumula ion induces di e en ia ion[11]. Since ela i ely high amoun s o ROS a e o med as by-p oduc s o mi ochond ial oxida i e phospho yla ion, glycolysis was adi ionally conside ed he p e e ed me abolic pa hway o bo h s em cells and CSCs[12]. Howe e , CSCs ac oss a wide ange o cance s main ain low ROS le els[13-15], e en i hey a o mi ochond ial me abolism as hei dominan ene gy-p oducing pa hway[16]. In pa icula , we ha e shown ha panc ea ic CSCs a e dependen on mi ochond ial oxida i e phospho yla ion o ull s emness and umo igenici y, in a p ocess con olled by he balanced exp ession o c- MYC and he mi ochond ial biogenesis ac o PGC-1α[7]. We obse ed ha panc ea ic CSCs bea low le els o mi ochond ial ROS and hey a e especially sensi i e o he mi ochond ial ROS induce menadione, making he edox s a e o his o ganelle a ele an a ge o CSC elimina ion. Glu a hione (L-γ-glu amyl-L-cys einyl-glycine; GSH) is he mos abundan non- p o ein an ioxidan in euka yo ic cells. Al hough i is syn hesized in he cy osol, glu a hione le els a e pa icula ly high in mi ochond ia, whe e i main ains edox balance h ough ROS de oxi ica ion and p o ec s phospholipids in he mi ochond ial memb ane[17]. In e es ingly, glu a hione le els a e s ongly inc eased in mu ine emb yonic s em cells and mesenchymal s em cells, suppo ing de ense agains di e se insul s and main enance o s emness[18]. Simila ly, glu a hione con en and speci ic GSH- ela ed enzymes a e up- egula ed in CSCs om b eas [13], li e [19] and gas ic cance [14]. Addi ionally, di e en componen s o he glu a hione me abolism pa hway ha e been shown o p omo e umo ini ia ion[20], me as asis[21,22] and chemo esis - ance[23]; ea u es equen ly associa ed wi h CSCs. Howe e , li le is known abou he ole o his pa hway in panc ea ic CSCs. He e we now show ha panc ea ic CSCs display inc eased GSH con en and exp ession o di e se genes in ol ed in he glu a hione me abolism pa hway, which co ela ed wi h s emness and disease- ee su i al in panc ea ic cance pa ien s. Deple ion o GSH le els in sphe e cul u es wi h pha macological inhibi o s o glu a hione syn hesis o ecycling induced cell cycle a es and apop osis. This ansla ed in o diminished sel - enewal capaci y and educed exp ession o he CSC su ace ma ke CD133. Impo an ly, GSH deple ion sensi ized CSCs o gemci abine, sugges ing an impo an ole o glu a hione in chemo esis ance in panc ea ic cance . MATERIALS AND METHODS P ima y human panc ea ic cance cells Human panc ea ic cance Pa ien -De i ed Xenog a s [PDXs, ei he panc ea ic duc al adenoca cinoma (PDAC) o panc ea ic cance o hepa obilia y o igin] we e ob ained h ough he Biobank o he Spanish Na ional Cance Resea ch Cen e (CNIO), Mad id, Spain ( e e ence 1204090835CHMH). Fo p ima y cul u es, PDX issue agmen s p e iously expanded in nude mice (passages 1-13) we e minced, enzyma ically Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1413 No embe 26, 2020 Volume 12 Issue 11 diges ed wi h collagenase (S em Cell Technologies, Vancou e , Canada) o 90 min a 37°C[24], and a e cen i uga ion o 5 min a 1200 pm he pelle s we e esuspended and cul u ed in RPMI, 10% e al bo ine se um (FBS), and 50 U/mL penicillin/s ep omycin. Fo he expe imen s, cells we e cul u ed in DMEM:F12 supplemen ed wi h B-27, L-Glu amine (all om Gibco, Li e Technologies, Ca lsbad, CA, USA), 50 U/mL penicillin–s ep omycin (Sigma-Ald ich, S . Louis, MO, USA) and β-FGF (Pep oTech, Rocky Hill, NJ, USA). CSC-en iching cul u e Panc ea ic cance sphe es we e gene a ed and expanded in supplemen ed DMEM-F12. A o al o 104 cells/mL was seeded in ul a-low a achmen pla es (Co ning, Co ning, NY, USA) as desc ibed p e iously[25]. Sphe e o ma ion assay Cells we e seeded in iplica e in ul a-low a achmen 24-well pla es (Co ning) a 104 cells/well in supplemen ed DMEM-F12 wi h o wi hou he co esponding ea men s, which we e e eshed e e y o he day. A e 7 d, sphe es we e coun ed using a mic oscope a 20× magni ica ion. RNA p epa a ion and eal- ime polyme ase chain eac ion To al RNAs om human p ima y panc ea ic cance cells and sphe es we e ex ac ed wi h he TRIzol ki (Li e Technologies) acco ding o he manu ac u e ’s ins uc ions. One mic og am o o al RNA was used o cDNA syn hesis wi h Supe Sc ip II e e se ansc ip ase (Li e Technologies) and andom hexame s. Quan i a i e eal- ime polyme ase chain eac ion (PCR) was pe o med using SYBR G een PCR mas e mix (Qiagen, Hilden, Ge many), acco ding o he manu ac u e ’s ins uc ions. The lis o u ilized p ime s is de ailed in Table 1. GSH con en The glu a hione-sensi i e luo escen p obe monochlo obimane (mCLB, Sigma- Ald ich) was used o analyze he educed in acellula glu a hione con en . Cells we e ypsinized on he day o he expe imen , washed, p o ec ed om ligh and incuba ed o 1 h a 37°C wi h 2 mmol/L mCLB dilu ed in phospha e bu e ed saline (PBS). Cells we e hen washed and esuspended in PBS and luo escence (exci a ion: 380 nm, emission: 461 nm) was measu ed on a FLUOs a OPTIMA Mic opla e Reade . Values we e co ec ed o cell con en by measu ing he p o ein concen a ion o he sample wi h he B ad o d assay. Al e na i ely, cells we e incuba ed wi h DAPI and analyzed by low cy ome y using a FACS Can o II (BD, F anklin Lakes, NJ, USA) and da a we e analyzed wi h FlowJo 9.2 so wa e (Ashland, OR, USA) o Cy obank (Beckman Coul e , CA, USA). CSC con en by low cy ome y To iden i y panc ea ic CSCs, he an i-CD133/1 (APC o PE, Mil enyi Bio ec, Be gisch Gladbach, Ge many) o co esponding con ol Immunoglobulin G (IgG) 1 an ibody we e used. B ie ly, cells we e s ained o 30 min on ice wi h gen le ocking. DAPI was used o exclusion o dead cells (eBiosciences, San Diego, CA, USA). All samples we e analyzed by low cy ome y using a FACS Can o II (BD) and da a we e analyzed wi h FlowJo 9.2 so wa e o Cy obank. Apop osis assay by low cy ome y Fi e-day old sphe es o adhe en cul u es we e ea ed o 48 h in he p esence o 100 mmol/L bu hionine-sul oximine (BSO) o BSO and gemci abine (1 μmol/L). A ached and loa ing cells we e collec ed, esuspended and s ained wi h Annexin V (550474) dilu ed in Annexin V binding bu e (556454, all om eBiosciences) o 20 min a oom empe a u e, ollowing he manu ac u e ’s ins uc ions. Cells we e hen incuba ed wi h DAPI o an addi ional 5 min. Cell-cycle analysis by low cy ome y Sphe es we e ypsinized, washed in PBS, cen i uged, and pelle s we e ixed in 200 µL o 70% e hanol and s o ed a -20°C un il use. The cells we e cen i uged and pelle s esuspended in 200 µL o PBS, 10 µg/mL o RNAse A was added and he cells we e incuba ed o 1 h a 37°C. Subsequen ly, he cells we e esuspended in p opidium iodide solu ion (0.1% sodium ci a e, 0.1% T i onX-100, and 50 µg/mL p opidium iodide). Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1414 No embe 26, 2020 Volume 12 Issue 11 Table 1 Lis o u ilized p ime s Gene P ime HPRT Fo wa d TGACCTTGATTTATTTTGCATACC Re e se CGAGCAAGACGTTCAGTCCT GCLC Fo wa d GCCGCTGAGCTGGGAGGAAA Re e se ATTCCACCTCATCGCCCCACT GPX1 Fo wa d TATCGAGAATGTGGCGTCCC Re e se GATGCCCAAACTGGTTGCAC GPX2 Fo wa d GGACATCAGGAGAACTGTCAGA Re e se TCAGGTAGGCGAAGACAGGA GGT1 Fo wa d CAACCTGCCCACAGTGAAGA Re e se TTCTTGGCCTCCATGACTGC GGT2 Fo wa d CCCTTCTTTCAGTGGGAGGG Re e se ATGCTGTCACCTTTGTGGCT GSTM1 Fo wa d AGGAAAAGAAGTACACGATGGG Re e se TTGCTCTGGGTGATCTTGTG GSTA1 Fo wa d CAACCTGCCCACAGTGAAGA Re e se TTCTTGGCCTCCATGACTGC GSTA2 Fo wa d CCCTTCTTTCAGTGGGAGGG Re e se ATGCTGTCACCTTTGTGGCT GSTA Fo wa d TCCGTGAGATGGGTTTTAGC Re e se CTGTACCAACTTCATCCCGTC IDH1 Fo wa d CAAGTGACGGAACCCAAAAG Re e se ACCCTTAGACAGAGCCATTTG IDH2 Fo wa d ACAACACCGACGAGTCCATC Re e se GCCCATCGTAGGCTTTCAGT RNAseq da a o CSC-en iched condi ions Exp ession o he genes con ained in he KEGG (Kyo o Encyclopedia o Genes and Genomes) Pa hway Glu a hione Me abolism was in es iga ed in ou published RNAseq da ase E-MTAB-3808 (A ay Exp ess), which compa es p ima y PDX cells cul u ed ei he by adhe ence o as sphe es[7]. All o iginal bioin o ma ic analyses on his da ase E-MTAB-3808 we e pe o med a he Bioin o ma ics Uni and S uc u al Biology and Biocompu ing P og amme, Spanish Na ional Cance Resea ch Cen e Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1415 No embe 26, 2020 Volume 12 Issue 11 (CNIO), Mad id 28029, Spain. Di e en ial exp ession o genes ac oss he di e en condi ions was calcula ed wi h Cu di [26]. Human da a analysis Exp ession da a om panc ea ic cance and no mal issue om he TCGA and he GTEx p ojec s we e analyzed using he webse e GEPIA2[27]. Pea son co ela ion coe icien was calcula ed o co ela ion analysis o glu a hione- ela ed genes wi h a s emness signa u e de ined by he combined exp ession o he plu ipo ency- ela ed genes NANOG, KLF4, SOX2 and OCT4. Fo disease- ee su i al analysis, he Haza d a io (HR) was calcula ed using he Cox P opo ional Haza ds model o panc ea ic cance pa ien s om uppe and lowe qua iles o exp ession o he indica ed genes. S a is ical analyses Resul s o con inuous a iables a e p esen ed as mean ± SE unless s a ed o he wise. T ea men g oups we e compa ed wi h he independen samples - es . Pai -wise mul iple compa isons we e pe o med wi h he one-way ANOVA ( wo-sided) wi h Bon e oni adjus men . Co ela ion analysis was pe o med by calcula ing he Pea son co ela ion coe icien . P alues < 0.05 we e conside ed s a is ically signi ican . All analyses we e pe o med using P ism G aphPad ( e sion 5.04). RESULTS Connec ion o glu a hione me abolism wi h s emness in human panc ea ic cance samples In o de o de e mine a possible connec ion be ween glu a hione me abolism and s emness in panc ea ic cance , we i s analyzed ou p e iously published RNAseq da ase E-MTAB-3808 compa ing 5 di e en PDAC PDX models cul u ed in di e en ia ing (adhe en ) o CSC-en iching (sphe es) condi ions (Figu e 1A)[7]. We ocused on genes ela ed o he KEGG Pa hway Glu a hione Me abolism, which we ca ego ized in o ou di e en classes: Gamma-glu amyl ans e ases (GGTs), glu a hione-s- ans e ases (GSTs), glu a hione pe oxidases (GPXs), and genes in ol ed in glu a hione syn hesis and ecycling. As summa ized in Table 2, CSC-en iched cul u es gene ally up- egula ed genes om he ou classes, al hough he speci ic genes a ied among he di e en PDXs. We ha e p e iously demons a ed ha panc ea ic CSCs show inc eased exp ession o se e al plu ipo ency- ela ed genes such as NANOG, KLF4, SOX2 and OCT4, which we ha e ou inely used as a s emness signa u e[5-7]. In o de o u he suppo a connec ion be ween glu a hione me abolism and s emness, we used he webse e GEPIA2 o analyze ou a ge genes in human exp ession da a om no mal panc eas and PDAC issues included in he TCGA and GTEx p ojec s. Thus, we pe o med gene exp ession co ela ion s udies be ween he di e en glu a hione- ela ed genes up- egula ed in sphe es and ou de ined s emness signa u e in no mal s PDAC samples. In e es ingly, exp ession o 17 o he 25 genes up- egula ed in CSCs posi i ely co ela ed wi h he s emness signa u e in human samples, wi h P- alues below 10-5 (Figu e 1B). Since disease ecu ence can be mainly a ibu ed o CSCs due o hei abili y o egene a e umo s ollowing ea men , we nex in es iga ed whe he he exp ession o any o he 17 genes co ela ed wi h disease- ee su i al in pa ien s (Figu e 1C). We ound ha high exp ession o MGST1, GPX8 and GGCT p edic ed be ween 2.2-2.5 imes inc eased isk o ecu ence in PDAC pa ien s (P = 0.0054, 0.03 and 0.0054, espec i ely). Toge he , ou esul s sugges a unc ional link be ween glu a hione me abolism, s emness and he agg essi eness o panc ea ic cance . Glu a hione me abolism is enhanced in p ima y sphe e cul u es o panc ea ic cance PDXs Nex , we aimed o u he alida e he abo e RNAseq esul s. The e o e, we analyzed he exp ession o 2-4 genes om each subg oup by eal- ime PCR. We included wo addi ional PDX models [one PDAC (PDX163) and one panc ea ic umo o hepa obilia y o igin (PDX247)] esul ing in a o al o se en PDX models o his alida ion. As shown in Figu e 2, we de ec ed enhanced exp ession o glu a hione me abolism genes in CSC-en iching condi ions o all se en PDX models, anging be ween 2.5 o 600- old. Fo u he unc ional alida ion, we used he hiol-sensi i e p obe monochlo obimane o assess he con en o in acellula glu a hione con en in i s Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1416 No embe 26, 2020 Volume 12 Issue 11 Table 2 RNAseq e eals ha glu a hione me abolism genes a e up- egula ed in cance s em cell-en iched cul u es om panc ea ic cance pa ien -de i ed xenog a s PDX GGTs GSTs GPXs Syn hesis and ecycling PDX185 GGT1, GGT2, GGT3P, GGT6, GGT7 GSTA1, GSTA2, GSTT1, MGST2, MGST3 GPX2, GPX3 GCLC, GSR, PGD, IDH1 PDX215 GGT1, GGT2, GGT7, GGT8P GSTA1, GSTA4, GSTM2, GSTM4, MGST2 OPLAH, IDH1 PDX253 GGT1, GGT2, GGT3P, GGT6 GSTA1, GSTA2, GSTA4, MGST1, MGST2, MGST3 GPX2, GPX8 GSR, IDH1 PDX354 GSTA1, GSTA2, MGST1, GSTM2 GPX3, GPX8 GCLC, GGCT, IDH1 PDX265 GSTA4, GSTM1, GSTM2, GSTM4 GPX2 GGCT, PGD, IDH1, IDH2 PDX: Pa ien -de i ed xenog a ; GGTs: Gamma-glu amyl ans e ases; GSTs: Glu a hione-s- ans e ases; GPXs: Glu a hione pe oxidases. educed o m (GSH). Fi s , we measu ed he GSH con en in p ima y cells cul u ed in adhe en o sphe e condi ions using he same panel o se en PDX models. In e es ingly, excep o PDX247 (o hepa obilia y o igin) GSH con en was 2 o 8 imes highe in CSC-en iching condi ions (Figu e 3A; P alues < 0.05-0.01), ein o cing he esul s ob ained by gene exp ession analysis. Nex , we alida ed he inc eased GSH le els obse ed by analyzing CD133– and CD133+ subpopula ions by low cy ome y. As shown in Figu e 3B and 3C, CD133+ CSCs accumula ed mo e in acellula GSH (1.94- old, P = 0.04). In summa y, ou esul s indica e ha exp ession o glu a hione me abolism genes and GSH con en a e up egula ed in CSC-en iched condi ions. Deple ion o GSH con en impai s CSC unc ionali y In o de o e alua e he signi icance o he inc eased GSH con en o CSCs, we pe o med a se ies o GSH deple ion assays using wo dis inc pha macological app oaches. We i s es ed he inhibi o o GSH syn hesis BSO, which i e e sibly blocks he enzyme gamma-glu amylcys eine syn he ase (γ-GCS). Incuba ion o CSC- en iched sphe es wi h inc easing doses o BSO o 48 h esul ed in a dose-dependen decline in GSH con en , and wi h doses > 50 µmol/L deple ed he GSH con en below 50% (Figu e 4A; P alues anging be ween 0.0023 and 0.00032). T ea men o CSC- en iched sphe es wi h BSO a 100 µmol/L o 48 h esul ed in he accumula ion o cells in G1 phase, indica i e o cell cycle a es (Figu e 4B). In addi ion, we obse ed an inc ease in he pe cen age o cells in bo h ea ly and la e apop osis a e BSO ea men , sugges ing ha ull GSH con en is necessa y o p oli e a ion and su i al o CSCs (Figu e 4C). Conside ing hese esul s, we nex ocused on al e na i e ea u es di ec ly linked o CSCs. Fi s , BSO ea men dec eased he exp ession o he a o emen ioned s emness signa u e de ined by NANOG, KLF4, SOX2 and OCT4 (Figu e 5A). Nex , we measu ed he e ec o BSO on CSC sel - enewal. Since we had obse ed an up- egula ion o genes in ol ed in GSH ecycling (Table 2), we also es ed he GSH ecycling inhibi o 6-aminonico inamide (6-AN), which blocks he oxida i e b anch o he pen ose phospha e pa hway ha is necessa y o educ ion o oxidized GSSG in o GSH. Incuba ion wi h ei he BSO o 6-AN consis en ly educed he numbe o sphe es o med by day 7, indica i e o diminished sel - enewal capaci y (Figu e 5B). Consis en ly, he pe cen age o CD133+ cells assessed by low cy ome y was also educed ollowing ea men wi h ei he inhibi o (Figu e 5C). Toge he hese esul s indica e ha deple ion o GSH con en di ec ly impac s CSC iabili y and sel - enewal. Deple ion o GSH con en in CSC-en iched cul u es enhances esponse o gemci abine Apa om he abili y o sel - enew, ano he key ea u e o CSCs is chemo esis ance. No ably, se e al glu a hione- ela ed enzymes such as GSTs a e di ec ly implica ed in de oxi ica ion o xenobio ics, sugges ing ano he po en ial link be ween glu a hione me abolism and CSC ea u es[28]. Indeed, we ound ha he absolu e GSH concen a ion in sphe es, bu no adhe en cul u es, posi i ely co ela ed wi h he pe cen age o su i ing cells a e gemci abine ea men (Figu e 6A; Pea son’s = 0.96, P = 5.89 × 10-11). Gemci abine ea men induced GSH accumula ion exclusi ely in CD133+ cells (Figu e 6B), which was ab oga ed by co- ea men wi h BSO. This ansla ed in sensi iza ion o CD133+ cells o ea men wi h gemci abine, app oxima ing le els o apop osis obse ed in di e en ia ed CD133– cells (Figu e 6C), Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1417 No embe 26, 2020 Volume 12 Issue 11 Figu e 1 Exp ession o glu a hione me abolism genes posi i ely co ela es wi h a s emness signa u e in human panc ea ic cance samples and p edic s poo ou come. A: En ichmen in CD133+ cells in sphe e cul u es s adhe en cul u es, as de e mined by low cy ome y. Rep esen a i e Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1418 No embe 26, 2020 Volume 12 Issue 11 low cy ome y his og ams o he indica ed pa ien -de i ed xenog a models; B: Co ela ion o genes ha we e up- egula ed in cance s em cell-en iched cul u es wi h a s emness signa u e de ined by combined exp ession o he plu ipo ency- ela ed genes NANOG, KLF4, SOX2 and OCT4. Pea son´s and co esponding P alues o indi idual co ela ions a e shown; C: Disease- ee su i al in panc ea ic cance pa ien s om uppe and lowe qua iles o exp ession o he indica ed genes. Haza d a io was calcula ed using he Cox P opo ional Haza ds model. Do ed lines ep esen he 95% con idence in e al. Da a in A and B we e calcula ed using GEPIA2 (h p://gepia2.cance -pku.cn), using public da a compiled in TCGA and GTEx. Sph: Sphe e cul u e; Adh: adhe en cul u e; HR: Haza d a io. Figu e 2 Glu a hione me abolism- ela ed genes a e up- egula ed in cance s em cell-en iched condi ions. P ima y cells om di e en pa ien - de i ed xenog a models as indica ed in he igu e we e cul u ed in adhe en o low-a achmen cance s em cell-en iching condi ions. On day 7 he exp ession o se e al glu a hione (GSH)- ela ed genes was e alua ed by eal- ime polyme ase chain eac ion (PCR). A: Glu a hione-S-T ans e ases A1, A2, A4, M1; B: Gamma- glu amyl ans e ases 1 and 2; C: Glu a hione Pe oxidases 1 and 2; D: Isoci a e Dehyd ogenases 1 and 2. Da a we e no malized o HPRT and a e shown as mean ± SE old change exp ession le els o sphe e s adhe en cul u es in loga i hmic scale. aP < 0.05; bP < 0.01; cP < 0.001. PDX: Pa ien -de i ed xenog a ; GGT: Gamma- glu amyl ans e ase; GST: Glu a hione-s- ans e ase; GPX: Glu a hione pe oxidase. and diminished sphe e o ma ion as compa ed o single ea men s (Figu e 6D; P < 0.05). These esul s demons a e ha chemo esis ance in CSCs is, a leas in pa , dependen on GSH syn hesis. In summa y, ou esul s sugges ha glu a hione me abolism plays an essen ial ole in PDAC agg essi eness, suppo ing CSC su i al, sel - enewal and chemo esis ance. DISCUSSION Any li ing cell p oduces ROS, ei he as a by-p oduc o mi ochond ial espi a ion o in a con olled manne by di e en oxidases o modula e cell signaling. Speci ically, in acellula ROS le els egula e he complex balance be ween symme ic and asymme ic di ision in s em cells, hus con olling di e en ia ion and sel - enewal[29]. In hese cells, a oiding ROS accumula ion is pa icula ly impo an , since i p e en s he accumula ion o he edi a y mu a ions and p ema u e senescence[30]. Fo hese easons, quiescen s em cells eside in a low oxygen niche a o ing glycolysis o e Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1425 No embe 26, 2020 Volume 12 Issue 11 ARTICLE HIGHLIGHTS Resea ch backg ound Redox me abolism modula es s em cell and cance s em cell (CSC) unc ionali y in di e en model sys ems, ega dless o hei dominan me abolic pheno ype. In ac , CSCs om se e al cance ypes show inc eased glu a hione con en and associa ed enzymes. Resea ch mo i a ion Iden i ica ion o me abolic ulne abili ies o highly agg essi e CSCs can lead o he de elopmen o mo e e ec i e ea men s a egies o panc ea ic cance . Resea ch objec i es The p esen s udy aimed o de e mine he impo ance o glu a hione me abolism o panc ea ic CSCs as compa ed o hei di e en ia ed coun e pa s. Resea ch me hods Compa isons be ween CSCs and non-CSCs in p ima y panc ea ic cance cells o pa ien -de i ed xenog a s we e ca ied ou by cul u ing in adhe en o CSC-en iching sphe e condi ions and con i med by CD133 s aining by low cy ome y. Gene exp ession analyses we e pe o med by RNAseq o eal- ime PCR. Public TCGA and GTEx RNAseq da a om panc ea ic cance s no mal issue samples we e analyzed using he webse e GEPIA2. S aining o measu emen o glu a hione (monochlo obimane), cell cycle (p opidium iodide) o apop osis (Annexin-V) we e de e mined by luo ime y o low cy ome y. Pha macological glu a hione deple ion was achie ed wi h inhibi o s o glu a hione syn hesis (bu hionine-sul oximine) and ecycling (6-Aminonico inamide). Sel - enewal was assessed by sphe e o ma ion assay and esponse o gemci abine ea men was used as a eadou o chemo esis ance. Resea ch esul s Se e al glu a hione me abolism genes we e up egula ed in panc ea ic CSCs, and hei exp ession co ela es wi h a s emness signa u e and p edic s su i al in clinical samples. Inc eased glu a hione concen a ion in CSCs p omo es iabili y, cell cycle p og ession and plu ipo ency gene exp ession. Inhibi ion o glu a hione syn hesis o ecycling impai s CSC unc ionali ies such as sel - enewal and chemo esis ance. Resea ch conclusions Ou da a sugges ha panc ea ic CSCs depend on glu a hione me abolism. Pha macological a ge ing o his pa hway showed ha high GSH (glu a hione in i s educed o m) con en is essen ial o main ain CSC unc ionali y in e ms o sel - enewal and chemo esis ance. Resea ch pe spec i es Ou da a demons a e a a ge able me abolic ulne abili y o his agg essi e subpopula ion o cance cells, which could be exploi ed o he apeu ic pu poses. ACKNOWLEDGEMENTS We hank Cou ois S, Espiau P and Pa ejo B o c i ical eading o he manusc ip . The au ho s would like o acknowledge he use o he Cy ome y Uni s om CNIO and IACS-Uni e sidad de Za agoza. REFERENCES GBD 2017 Risk Fac o Collabo a o s. Global, egional, and na ional compa a i e isk assessmen o 84 beha iou al, en i onmen al and occupa ional, and me abolic isks o clus e s o isks o 195 coun ies and e i o ies, 1990-2017: a sys ema ic analysis o he Global Bu den o Disease S udy 2017. Lance 2018; 392: 1923-1994 [PMID: 30496105 DOI: 10.1016/S0140-6736(18)32225-6] 1 Siegel RL, Mille KD, Jemal A. Cance S a is ics, 2017. CA Cance J Clin 2017; 67: 7-30 [PMID: 28055103 DOI: 10.3322/caac.21387] 2 Rahib L, Smi h BD, Aizenbe g R, Rosenzweig AB, Fleshman JM, Ma isian LM. P ojec ing cance 3 Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1426 No embe 26, 2020 Volume 12 Issue 11 incidence and dea hs o 2030: he unexpec ed bu den o hy oid, li e , and panc eas cance s in he Uni ed S a es. Cance Res 2014; 74: 2913-2921 [PMID: 24840647 DOI: 10.1158/0008-5472.CAN-14-0155] He mann PC, Hube SL, He le T, Aiche A, Ellwa JW, Guba M, B uns CJ, Heeschen C. Dis inc popula ions o cance s em cells de e mine umo g ow h and me as a ic ac i i y in human panc ea ic cance . Cell S em Cell 2007; 1: 313-323 [PMID: 18371365 DOI: 10.1016/j.s em.2007.06.002] 4 Lona do E, He mann PC, Muelle MT, Hube S, Balic A, Mi anda-Lo enzo I, Zago ac S, Alcala S, Rod iguez-A abaolaza I, Rami ez JC, To es-Ruíz R, Ga cia E, Hidalgo M, Ceb ián DÁ, Heuchel R, Löh M, Be ge F, Ba ens ein P, Aiche A, Heeschen C. Nodal/Ac i in signaling d i es sel - enewal and umo igenici y o panc ea ic cance s em cells and p o ides a a ge o combined d ug he apy. Cell S em Cell 2011; 9: 433-446 [PMID: 22056140 DOI: 10.1016/j.s em.2011.10.001] 5 Mi anda-Lo enzo I, Do ado J, Lona do E, Alcala S, Se ano AG, Clausell-To mos J, Cio i M, Megias D, Zago ac S, Balic A, Hidalgo M, E kan M, Klee J, Sca pa A, Sainz B J , Heeschen C. In acellula au o luo escence: a bioma ke o epi helial cance s em cells. Na Me hods 2014; 11: 1161-1169 [PMID: 25262208 DOI: 10.1038/nme h.3112] 6 Sancho P, Bu gos-Ramos E, Ta e a A, Bou Khei T, Jagus P, Schoenhals M, Ba neda D, Selle s K, Campos-Oli as R, G aña O, Vie a CR, Yune a M, Sainz B J , Heeschen C. MYC/PGC-1α Balance De e mines he Me abolic Pheno ype and Plas ici y o Panc ea ic Cance S em Cells. Cell Me ab 2015; 22: 590-605 [PMID: 26365176 DOI: 10.1016/j.cme .2015.08.015] 7 Sancho P, Alcala S, Usacho V, He mann PC, Sainz B J . The e e -changing landscape o panc ea ic cance s em cells. Panc ea ology 2016; 16: 489-496 [PMID: 27161173 DOI: 10.1016/j.pan.2016.04.004] 8 Lona do E, He mann PC, Heeschen C. Panc ea ic cance s em cells - upda e and u u e pe spec i es. Mol Oncol 2010; 4: 431-442 [PMID: 20580623 DOI: 10.1016/j.molonc.2010.06.002] 9 Cio i M, T abulo SM, Sanchez-Ripoll Y, Mi anda-Lo enzo I, Lona do E, Do ado J, Reis Viei a C, Rami ez JC, Hidalgo M, Aiche A, Hahn S, Sainz B J , Heeschen C. The miR-17-92 clus e coun e ac s quiescence and chemo esis ance in a dis inc subpopula ion o panc ea ic cance s em cells. Gu 2015; 64: 1936-1948 [PMID: 25887381 DOI: 10.1136/gu jnl-2014-308470] 10 Zhou D, Shao L, Spi z DR. Reac i e oxygen species in no mal and umo s em cells. Ad Cance Res 2014; 122: 1-67 [PMID: 24974178 DOI: 10.1016/B978-0-12-420117-0.00001-3] 11 Sancho P, Ba neda D, Heeschen C. Hallma ks o cance s em cell me abolism. B J Cance 2016; 114: 1305-1312 [PMID: 27219018 DOI: 10.1038/bjc.2016.152] 12 Diehn M, Cho RW, Lobo NA, Kalisky T, Do ie MJ, Kulp AN, Qian D, Lam JS, Ailles LE, Wong M, Joshua B, Kaplan MJ, Wapni I, Di bas FM, Somlo G, Ga be oglio C, Paz B, Shen J, Lau SK, Quake SR, B own JM, Weissman IL, Cla ke MF. Associa ion o eac i e oxygen species le els and adio esis ance in cance s em cells. Na u e 2009; 458: 780-783 [PMID: 19194462 DOI: 10.1038/na u e07733] 13 Ishimo o T, Nagano O, Yae T, Tamada M, Mo oha a T, Oshima H, Oshima M, Ikeda T, Asaba R, Yagi H, Masuko T, Shimizu T, Ishikawa T, Kai K, Takahashi E, Imamu a Y, Baba Y, Ohmu a M, Suema su M, Baba H, Saya H. CD44 a ian egula es edox s a us in cance cells by s abilizing he xCT subuni o sys em xc(-) and he eby p omo es umo g ow h. Cance Cell 2011; 19: 387-400 [PMID: 21397861 DOI: 10.1016/j.cc .2011.01.038] 14 Chang CW, Chen YS, Chou SH, Han CL, Chen YJ, Yang CC, Huang CY, Lo JF. Dis inc subpopula ions o head and neck cance cells wi h di e en le els o in acellula eac i e oxygen species exhibi di e se s emness, p oli e a ion, and chemosensi i i y. Cance Res 2014; 74: 6291-6305 [PMID: 25217518 DOI: 10.1158/0008-5472.CAN-14-0626] 15 Jagus P, de Luxán-Delgado B, Pa ejo-Alonso B, Sancho P. Me abolism-Based The apeu ic S a egies Ta ge ing Cance S em Cells. F on Pha macol 2019; 10: 203 [PMID: 30967773 DOI: 10.3389/ pha .2019.00203] 16 Calab ese G, Mo gan B, Rieme J. Mi ochond ial Glu a hione: Regula ion and Func ions. An ioxid Redox Signal 2017; 27: 1162-1177 [PMID: 28558477 DOI: 10.1089/a s.2017.7121] 17 Jeong EM, Yoon JH, Lim J, Shin JW, Cho AY, Heo J, Lee KB, Lee JH, Lee WJ, Kim HJ, Son YH, Lee SJ, Cho SY, Shin DM, Choi K, Kim IG. Real-Time Moni o ing o Glu a hione in Li ing Cells Re eals ha High Glu a hione Le els A e Requi ed o Main ain S em Cell Func ion. S em Cell Repo s 2018; 10: 600-614 [PMID: 29307581 DOI: 10.1016/j.s emc .2017.12.007] 18 Kim HM, Ha aguchi N, Ishii H, Ohkuma M, Okano M, Mimo i K, Eguchi H, Yamamo o H, Nagano H, Sekimo o M, Doki Y, Mo i M. Inc eased CD13 exp ession educes eac i e oxygen species, p omo ing su i al o li e cance s em cells ia an epi helial-mesenchymal ansi ion-like phenomenon. Ann Su g Oncol 2012; 19 Suppl 3: S539-S548 [PMID: 21879266 DOI: 10.1245/s10434-011-2040-5] 19 Ha is IS, T eloa AE, Inoue S, Sasaki M, Go ini C, Lee KC, Yung KY, B enne D, Knobbe-Thomsen CB, Cox MA, Elia A, Be ge T, Cescon DW, Adeoye A, B üs le A, Molyneux SD, Mason JM, Li WY, Yamamo o K, Wakeham A, Be man HK, Khokha R, Done SJ, Ka anagh TJ, Lam CW, Mak TW. Glu a hione and hio edoxin an ioxidan pa hways syne gize o d i e cance ini ia ion and p og ession. Cance Cell 2015; 27: 211-222 [PMID: 25620030 DOI: 10.1016/j.ccell.2014.11.019] 20 Ob ado E, Ca e e o J, O ega A, Medina I, Rodilla V, Pellice JA, Es ela JM. gamma-Glu amyl anspep idase o e exp ession inc eases me as a ic g ow h o B16 melanoma cells in he mouse li e . Hepa ology 2002; 35: 74-81 [PMID: 11786961 DOI: 10.1053/jhep.2002.30277] 21 Ob ado E, Benlloch M, Pellice JA, Asensi M, Es ela JM. In e issue low o glu a hione (GSH) as a umo g ow h-p omo ing mechanism: in e leukin 6 induces GSH elease om hepa ocy es in me as a ic B16 melanoma-bea ing mice. J Biol Chem 2011; 286: 15716-15727 [PMID: 21393247 DOI: 10.1074/jbc.M110.196261] 22 Rocha CR, Kaji ani GS, Quine A, Fo una o RS, Menck CF. NRF2 and glu a hione a e key esis ance media o s o emozolomide in glioma and melanoma cells. Onco a ge 2016; 7: 48081-48092 [PMID: 27344172 DOI: 10.18632/onco a ge .10129] 23 Muelle MT, He mann PC, Wi haue J, Rubio-Viquei a B, Leich SF, Hube S, Ellwa JW, Mus a a M, Ba ens ein P, D'Haese JG, Schoenbe g MH, Be ge F, Jauch KW, Hidalgo M, Heeschen C. Combined 24 Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1427 No embe 26, 2020 Volume 12 Issue 11 a ge ed ea men o elimina e umo igenic cance s em cells in human panc ea ic cance . Gas oen e ology 2009; 137: 1102-1113 [PMID: 19501590 DOI: 10.1053/j.gas o.2009.05.053] Gallmeie E, He mann PC, Muelle MT, Machado JG, Ziesch A, De Toni EN, Palagyi A, Eisen C, Ellwa JW, Ri e a J, Rubio-Viquei a B, Hidalgo M, Bunz F, Göke B, Heeschen C. Inhibi ion o a axia elangiec asia- and Rad3- ela ed unc ion ab oga es he in i o and in i o umo igenici y o human colon cance cells h ough deple ion o he CD133(+) umo -ini ia ing cell ac ion. S em Cells 2011; 29: 418-429 [PMID: 21308861 DOI: 10.1002/s em.595] 25 T apnell C, Robe s A, Go L, Pe ea G, Kim D, Kelley DR, Pimen el H, Salzbe g SL, Rinn JL, Pach e L. Di e en ial gene and ansc ip exp ession analysis o RNA-seq expe imen s wi h TopHa and Cu links. Na P o oc 2012; 7: 562-578 [PMID: 22383036 DOI: 10.1038/np o .2012.016] 26 Tang Z, Kang B, Li C, Chen T, Zhang Z. GEPIA2: an enhanced web se e o la ge-scale exp ession p o iling and in e ac i e analysis. Nucleic Acids Res 2019; 47: W556-W560 [PMID: 31114875 DOI: 10.1093/na /gkz430] 27 Ribas V, Ga cía-Ruiz C, Fe nández-Checa JC. Glu a hione and mi ochond ia. F on Pha macol 2014; 5: 151 [PMID: 25024695 DOI: 10.3389/ pha .2014.00151] 28 I o K, Hi ao A, A ai F, Ma suoka S, Takubo K, Hamaguchi I, Nomiyama K, Hosokawa K, Saku ada K, Nakaga a N, Ikeda Y, Mak TW, Suda T. Regula ion o oxida i e s ess by ATM is equi ed o sel - enewal o haema opoie ic s em cells. Na u e 2004; 431: 997-1002 [PMID: 15496926 DOI: 10.1038/na u e02989] 29 Yaha a T, Takanashi T, Mugu uma Y, Ib ahim AA, Ma suzawa H, Uno T, Sheng Y, Onizuka M, I o M, Ka o S, Ando K. Accumula ion o oxida i e DNA damage es ic s he sel - enewal capaci y o human hema opoie ic s em cells. Blood 2011; 118: 2941-2950 [PMID: 21734240 DOI: 10.1182/blood-2011-01-330050] 30 Obu oglu L, Ta di o S, F i z V, de Ba os SC, Me ida P, C a ei o M, Mamede J, C e ene G, Mongellaz C, An X, Klysz D, Touhami J, Boye -Cla el M, Ba ini JL, Da dalhon V, Zimme mann VS, Mohandas N, Go lieb E, Si bon M, Kine S, Taylo N. Glucose and glu amine me abolism egula e human hema opoie ic s em cell lineage speci ica ion. Cell S em Cell 2014; 15: 169-184 [PMID: 24953180 DOI: 10.1016/j.s em.2014.06.002] 31 Zhao H, Duan Q, Zhang Z, Li H, Wu H, Shen Q, Wang C, Yin T. Up- egula ion o glycolysis p omo es he s emness and EMT pheno ypes in gemci abine- esis an panc ea ic cance cells. J Cell Mol Med 2017; 21: 2055-2067 [PMID: 28244691 DOI: 10.1111/jcmm.13126] 32 Wang L, Li P, Hu W, Xia Y, Hu C, Liu L, Jiang X. CD44+CD24+ subse o PANC-1 cells exhibi s adia ion esis ance ia dec eased le els o eac i e oxygen species. Oncol Le 2017; 14: 1341-1346 [PMID: 28789349 DOI: 10.3892/ol.2017.6301] 33 Luo M, Shang L, B ooks MD, Jiagge E, Zhu Y, Buschhaus JM, Conley S, Fa h MA, Da is A, Gheo dunescu E, Wang Y, Ha ouaka R, Lozie A, T ine D, McDe mo S, Me aj e SD, Luke GD, Spi z DR, Wicha MS. Ta ge ing B eas Cance S em Cell S a e Equilib ium h ough Modula ion o Redox Signaling. Cell Me ab 2018; 28: 69-86. e6 [PMID: 29972798 DOI: 10.1016/j.cme .2018.06.006] 34 Lu H, Chen I, Shimoda LA, Pa k Y, Zhang C, T an L, Zhang H, Semenza GL. Chemo he apy-Induced Ca2+ Release S imula es B eas Cance S em Cell En ichmen . Cell Rep 2017; 18: 1946-1957 [PMID: 28228260 DOI: 10.1016/j.cel ep.2017.02.001] 35 Liu J, Hinkhouse MM, Sun W, Weyde CJ, Ri chie JM, Obe ley LW, Cullen JJ. Redox egula ion o panc ea ic cance cell g ow h: ole o glu a hione pe oxidase in he supp ession o he malignan pheno ype. Hum Gene The 2004; 15: 239-250 [PMID: 15018733 DOI: 10.1089/104303404322886093] 36 Meng Q, Shi S, Liang C, Liang D, Hua J, Zhang B, Xu J, Yu X. Ab oga ion o glu a hione pe oxidase-1 d i es EMT and chemo esis ance in panc ea ic cance by ac i a ing ROS-media ed Ak /GSK3β/Snail signaling. Oncogene 2018; 37: 5843-5857 [PMID: 29980787 DOI: 10.1038/s41388-018-0392-z] 37 Peng G, Tang Z, Xiang Y, Chen W. Glu a hione pe oxidase 4 main ains a s emness pheno ype, oxida i e homeos asis and egula es biological p ocesses in Panc-1 cance s em-like cells. Oncol Rep 2019; 41: 1264- 1274 [PMID: 30535490 DOI: 10.3892/o .2018.6905] 38 Cole-Ezea P, Swan D, Shanley D, Heske h J. Glu a hione pe oxidase 4 has a majo ole in p o ec ing mi ochond ia om oxida i e damage and main aining oxida i e phospho yla ion complexes in gu epi helial cells. F ee Radic Biol Med 2012; 53: 488-497 [PMID: 22634395 DOI: 10.1016/j. ee adbiomed.2012.05.029] 39 Fuji ani N, Yoneda A, Takahashi M, Takasawa A, Aoyama T, Miyazaki T. Silencing o Glu a hione S- T ans e ase Pi Inhibi s Cance Cell G ow h ia Oxida i e S ess Induced by Mi ochond ia Dys unc ion. Sci Rep 2019; 9: 14764 [PMID: 31611630 DOI: 10.1038/s41598-019-51462-9] 40 Aquilano K, Baldelli S, Pagliei B, Canna a SM, Ro ilio G, Ci iolo MR. p53 o ches a es he PGC-1α- media ed an ioxidan esponse upon mild edox and me abolic imbalance. An ioxid Redox Signal 2013; 18: 386-399 [PMID: 22861165 DOI: 10.1089/a s.2012.4615] 41 Ma molino D, Man o M, Acqua i a F, Ve ga a P, Ra ella A, Mon icelli A, Pandol o M. PGC-1alpha down- egula ion a ec s he an ioxidan esponse in F ied eich's a axia. PLoS One 2010; 5: e10025 [PMID: 20383327 DOI: 10.1371/jou nal.pone.0010025] 42 Vazquez F, Lim JH, Chim H, Bhalla K, Gi nun G, Pie ce K, Clish CB, G an e SR, Widlund HR, Spiegelman BM, Puigse e P. PGC1α exp ession de ines a subse o human melanoma umo s wi h inc eased mi ochond ial capaci y and esis ance o oxida i e s ess. Cance Cell 2013; 23: 287-301 [PMID: 23416000 DOI: 10.1016/j.cc .2012.11.020] 43 Tanaka G, Inoue K, Shimizu T, Akimo o K, Kubo a K. Dual pha macological inhibi ion o glu a hione and hio edoxin sys ems syne gizes o kill colo ec al ca cinoma s em cells. Cance Med 2016; 5: 2544-2557 [PMID: 27485632 DOI: 10.1002/cam4.844] 44 Mi an T, Vogg ATJ, D ude N, Mo aghy FM, Mo gen o h A. Modula ion o glu a hione p omo es apop osis in iple-nega i e b eas cance cells. FASEB J 2018; 32: 2803-2813 [PMID: 29301945 DOI: 10.1096/ j.201701157R] 45 Schnelldo e T, Gansauge S, Gansauge F, Schlosse S, Bege HG, Nussle AK. Glu a hione deple ion 46 Jagus P e al. Glu a hione me abolism in panc ea ic CSCs WJSC h ps://www.wjgne .com 1428 No embe 26, 2020 Volume 12 Issue 11 causes cell g ow h inhibi ion and enhanced apop osis in panc ea ic cance cells. Cance 2000; 89: 1440-1447 [PMID: 11013356] Ramana han B, Jan KY, Chen CH, Hou TC, Yu HJ, Pu YS. Resis ance o pacli axel is p opo ional o cellula o al an ioxidan capaci y. Cance Res 2005; 65: 8455-8460 [PMID: 16166325 DOI: 10.1158/0008-5472.CAN-05-1162] 47 Li Q, Yin X, Wang W, Zhan M, Zhao B, Hou Z, Wang J. The e ec s o bu hionine sul oximine on he p oli e a ion and apop osis o bilia y ac cance cells induced by cispla in and gemci abine. Oncol Le 2016; 11: 474-480 [PMID: 26870236 DOI: 10.3892/ol.2015.3879] 48 Chio IIC, Ja a nejad SM, Ponz-Sa ise M, Pa k Y, Ri e a K, Palm W, Wilson J, Sanga V, Hao Y, Öhlund D, W igh K, Filippini D, Lee EJ, Da Sil a B, Schoep e C, Wilkinson JE, Buscaglia JM, DeNicola GM, Ti iac H, Hammell M, C aw o d HC, Schmid EE, Thompson CB, Pappin DJ, Sonenbe g N, Tu eson DA. NRF2 P omo es Tumo Main enance by Modula ing mRNA T ansla ion in Panc ea ic Cance . Cell 2016; 166: 963-976 [PMID: 27477511 DOI: 10.1016/j.cell.2016.06.056] 49 Lo M, Ling V, Wang YZ, Gou PW. The xc- cys ine/glu ama e an ipo e : a media o o panc ea ic cance g ow h wi h a ole in d ug esis ance. B J Cance 2008; 99: 464-472 [PMID: 18648370 DOI: 10.1038/sj.bjc.6604485] 50