scieee AI-readable full text Open interactive document viewer

PLA2G7 associates with hormone receptor negativity in clinical breast cancer samples and regulates epithelial-mesenchymal transition in cultured breast cancer cells

Lehtinen, Laura,Vainio, Paula,Wikman, Harriet,Huhtala, Heini,Mueller, Volkmar,Kallioniemi, Anne,Pantel, Klaus,Krohnqvist, Pauliina,Kallioniemi, Olli,Carpén, Olli,Iljin, Kristiina

Full text

PLA2G7 associates with hormone receptor negativity in clinical breast cancer samples and regulates epithelial-mesenchymal transition in cultured breast cancer cells Laura Lehtinen, 1 * Paula Vainio, 1 Harriet Wikman, 2 Heini Huhtala, 3 Volkmar Mueller, 4 Anne Kallioniemi, 5 Klaus Pantel, 2 Pauliina Kronqvist, 1 Olli Kallioniemi, 6,8 Olli Carpe `n 1,9 and Kristiina Iljin 7 1 Department of Pathology, Turku University and Turku University Hospital, Turku, Finland 2 Institute of Tumour Biology, Centre of Experimental Medicine, University Medical Centre Hamburg-Eppendorf, Germany 3 School of Health Sciences, University of Tampere, Tampere, Finland 4 Department of Gynecology, University Medical Center Hamburg-Eppendorf, Hamburg, Germany 5 BioMediTech, University of Tampere, Tampere, Finland 6 FIMM, Institute for Molecular Medicine Finland, University of Helsinki, Finland 7 VTT Technical Research Centre of Finland, Espoo, Finland 8 Present address: Department of Oncology-Pathology, Science for Life Laboratory, Karolinska Institutet, Solna, Sweden 9 Present address: Department of Pathology, University of Helsinki and Helsinki University Hospital, Helsinki, Finland *Correspondence to:Laura Lehtinen, Department of Pathology,Turku University and Turku University Hospital,Turku, Finland. E-mail: [email protected] Breast cancer is the leading cause of cancer-related deaths in women due to distinct cancer subtypes associated with early recurrence and aggressive metastatic progression. High lipoprotein-associated phospholipase A2 ( PLA2G7 ) expression has previously been associated with aggressive disease and metastasis in prostate cancer. Here, we explore the expression pattern and functional role of PLA2G7 in breast cancer. First, a bioinformatic analysis of genome-wide gene expression data from 970 breast samples was carried out to evaluate the expression pattern of PLA2G7 mRNA in breast cancer. Second, the expression profile of PLA2G7 was studied in 1042 breast cancer samples including 89 matched lymph node metastasis samples using immunohistochemistry. Third, the effect of PLA2G7 silencing on genome-wide gene expression profile was studied and validated in cultured breast cancer cells expressing PLA2G7 at high level. Last, the expression pattern of PLA2G7 mRNA was investigated in 24 nonmalignant tissue samples and 65 primary and 7 metastatic tumour samples derived from various organs using qRT-PCR. The results from clinical breast cancer samples indicated that PLA2G7 is overexpressed in a subset of breast cancer samples compared to its expression in benign breast tissue samples and that high PLA2G7 expression associated with hormone receptor negativity as well as with poor prognosis in a subset of breast cancer samples. In vitro functional studies highlighted the putative role of PLA2G7 in the regulation of epithelial-mesenchymal transition (EMT)-related signalling pathways, vimentin and E-cadherin protein expression as well as cell migration in cultured breast cancer cells. Furthermore, supporting the findings in breast and prostate cancer, high PLA2G7 mRNA expression was associated with metastatic cancer in four additional organs of origin. In conclusion, our results indicate that PLA2G7 is highly expressed in a subset of metastatic and aggressive breast cancers and in metastatic samples of various tissues of origin and promotes EMT and migration in cultured breast cancer cells. Keywords: PLA2G7; epithelial-mesenchymal transition; EMT; vimentin; breast cancer; prognosis; metastasis; invasion Received 2 January 2017; Accepted 10 March 2017 Microarray data: Data can be accessed at ArrayExpress (E-MTAB-5397 and E-MTAB-5398) No conflicts of interest were declared. Original Article V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made. The Journal of Pathology: Clinical Research J Path: Clin Res April 2017; 3: 123–138 Published online 14 March 2017 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/cjp2.69 Introduction Breast cancer is the most frequent cancer in women worldwide accounting for 25% of all cancer cases among females [1]. Although survival rates of breast cancer patients have improved significantly during the last decade breast cancer is still the leading cause of cancer-related deaths in women due to distinct subtypes of breast cancer that are associated with early recurrence and an aggressive metastatic progression of the disease [1–4]. Identification of biomarkers and development of targeted therapies especially for these malignant tumours is important. Recently, the regulators of metastasis initiating epithelial-mesenchymal transition (EMT) have been suggested as important factors and possible diagnostic markers for aggressive and metastatic breast cancers, including triple negative breast cancers (TNBC) [5–9]. EMT, a vital process during embryogenesis and tissue repair, is characterised by specific gene expression changes, reduced intercellular adhesion, gain of mesenchymal characteristics and increased cell mobility to distant locations. Loss of immotile epithelial phenotype and gain of mesenchymal properties via EMT has recently been shown to be a key metastasis-promoting step in many cancers [10]. In addition to enabling metastasis EMT has been suggested to promote the generation and function of cancer stem cells as well as development of drug resistance [11]. EMT is induced by multiple oncogenic events and signalling pathways and requires the expression of a variety of regulators, including members of the Twist, Snail/Slug and Zeb transcription factor families. In addition, Tiwari et al. recently reported the SOX4-EZH2 pathway as one of the master regulators of EMT in metastatic breast cancer [12]. Two major hallmarks of EMT are the loss of expression of the epithelial cell adhesion molecule Ecadherin (CDH1) and gain of expression of the major mesenchymal cell cytoskeletal component vimentin (VIM). The cytoplasmic intermediate filament protein vimentin is a component of the cytoskeleton normally found in embryonic or mesenchymal cells. However, in cancer vimentin is a marker of EMT and is expressed in neoplastic epithelial cells with metastatic properties [13–15]. The expression of vimentin correlates with invasiveness and poor prognosis in clinical cancer samples [16–18]. PLA2G7, also known as lipoprotein-associated phospholipase A2 or platelet-activating factor (PAF) acetyl hydrolase, is a phospholipase that hydrolyses PAF and truncated phospholipids generated by oxidative attack [19]. PLA2G7 was recently reported as a novel biomarker in 50% of primary and 70% of metastatic prostate cancers and associated with aggressive disease in prostate cancer [20]. Furthermore, PLA2G7 was identified as a potential drug target especially in ERG oncogene positive prostate cancers and the alterations induced by PLA2G7 silencing highlighted the potential of PLA2G7 inhibition as an anti-proliferative, pro-apoptotic and anti-migratory therapeutic approach [20,21]. Interestingly, in addition to ERG oncogene expressing prostate cancers, high PLA2G7 expression has also been proposed to play a causal role in colon tumourigenesis downstream of loss-of-function TP53 mutations and activating RAS mutations [22]. Supporting this finding, deletion of PLA2G7 in Apc Min/1 mice has been shown to decrease both intestinal polyposis as well as colon tumourigenesis [23]. In recent years, PLA2G7 has also been under intensive research in the area of cardiovascular diseases. High PLA2G7 amount and enzyme activity have been associated with an increased risk of cardiovascular disease, and PLA2G7 inhibitor darapladib has been studied in the prevention and treatment of coronary heart disease [24–29]. In this study, we focus on analysing the expression pattern of PLA2G7 in breast cancer and investigate the functional role of PLA2G7 in cultured breast cancer cells using genome-wide gene expression analysis, immunohistochemistry and functional assays. The results indicate a role for PLA2G7 in the regulation of metastasis-enabling EMT and cell migration, associate high PLA2G7 mRNA expression with hormone receptor negative aggressive disease and indicate that high PLA2G7 protein expression in lymph node metastases associates with unfavourable prognosis in breast cancer. Methods Transcriptomics analysis In order to evaluate the in vivo relevance of PLA2G7 in breast cancer, we analysed PLA2G7 mRNA expression levels in normal (n 513) and malignant (n 5957) breast tissue samples using GeneSapiens database (www.genesapiens.org) [30]. Survival information was available for 395 and recurrence data for 159 breast cancer samples. Clinical material Breast tumour samples were obtained from patients at Hamburg University Medical Centre (Hamburg, Germany) between 1999 and 2007 and Tampere University Hospital (Tampere, Finland) between 1990 and V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 124 L Lehtinen et al 1999. Patient data and tumour characteristics have been described previously [31,32]. Informed consent for the scientific use of tissue materials was obtained from the patients and ethical permission was obtained from the local ethical committees. All procedures were in accordance with the Helsinki Declaration. The patient records contained information on clinicopathological parameters, primary treatments, site and time of tumour recurrences and survival. The maximum follow-up period was 19.8 years. Relapse–free survival was defined as time to any disease recurrence (local, regional or distant). The end point in breast cancer specific survival was death from breast cancer and in overall survival death from any cause. Immunohistochemistry The construction of tissue microarrays (TMA) has been described previously [31,32]. The paraffin embedded breast cancer TMAs containing in total 1042 samples from 897 breast cancer patients, including 89 cases with matched primary and lymph node metastatic samples, were stained with PLA2G7 (1:150, rabbit polyclonal, Cayman Chemical) antibody. Immunostaining was performed with the automated immunostaining device BenchMark XT (Roche Diagnostics/Ventana Medical Systems, Tucson, AZ, USA) using ultraView Universal DAB Detection Kit (Roche Diagnostics/Ventana Medical Systems). PLA2G7 protein expression level in the epithelial breast cancer cells in each sample was evaluated independently in blinded fashion by two pathologists and graded into two groups based on staining intensity: low expression (no staining or weak staining), high expression (moderate or strong staining). After excluding the cases without residual tissue or tumour cells, 618 breast tumours and 65 lymph node metastasis samples remained eligible for evaluation. Cell culture The breast carcinoma cell lines MDA-MB-468, MCF-7, MDA-MB-231 and ZR-75-1 cell lines were from American Type Culture Collection (Manassas, VA, USA). BT-549 and KPL-1 cell lines were from Cell Lines Service (Eppelheim, Germany). All cell lines were maintained according to the distributor’s instructions. Gene silencing For transient knockdown of PLA2G7,siRNA (SI00072177; siPLA2G7, Qiagen, Valencia, CA) was transfected into MDA-MB-468 cells using siLentFect Lipid Reagent (Bio-Rad Laboratories, CA) in OptiMEM (Invitrogen, Carlsbad, CA) at a final concentration of 13 nM. Cells were incubated for 48 hours before further experiments. To generate stable PLA2G7 deficient MDA-MB-468 cells (MDA-468/PLA2G7cells), two lentiviral shRNA constructs (NM_005084.21046s1c1; shPLA2G7_1 and NM_005084.2-684s1c1; shPLA2G7_2, Sigma-Aldrich, St. Louis, MO) were transduced into MDA-MB-468 cells as described [33]. All Stars scrambled siRNA (siScr, Qiagen) and nontargeting construct (SHC002V; shScr: Sigma-Aldrich) were used as negative control. Quantitative RT-PCR The confirmation of effective target gene silencing was performed with Taqman reverse transcriptase PCR (qRT-PCR). Total RNA from 70 000 cells was extracted using RNeasy kit (Qiagen) according to the manufacturer’s protocol and processed to cDNA with Applied Biosystems cDNA synthesis kit. TaqMan gene expression probes and primers from the Universal Probe Library (Roche Diagnostics, Espoo, Finland) were used to study PLA2G7 (forward: tggctctaccttagaaccctga; reverse: ttttgctctttgc cgtacct), and b-actin (ACTB, forward: ccaaccgcgagaagatga; reverse: ccagaggcgtacagggatag) mRNA expression. The quantitative PCR was done using ABI Prism 7900 (Applied Biosystems, Foster City, CA). Quantitation was carried out using the DD CT method with RQ manager 1.2 software (Applied Biosystems). Average expression of the control samples was considered for the calculation of the fold changes and bactin was used as an endogenous control. Three or more replicate samples were studied for detection of mRNA expression. Gene expression analysis using bead arrays 500 ng of total purified RNA was used for amplification with Illumina RNA TotalPrep Amplification kit (Ambion, Austin, TX), and biotin labelled cRNA was hybridised to Sentrix HumanRef-12 vs.3 Expression Bead Chips (Illumina, San Diego, CA). Analysis was done as described [20]. Microarray data are available in the ArrayExpress database (www.ebi.ac.uk/array express, siRNA treatment: E-MTAB-5397 and shRNA treatments: E-MTAB-5398). Two replicate samples were studied for each treatment and gene expression profiles of the PLA2G7 silenced samples were compared with the scrambled control-treated samples. Ingenuity Pathway Analysis (IPA) Software (Ingenuity Systems Inc., Redwood City, CA, USA), DAVID Bioinformatics Resources [34,35] and PLA2G7 in breast cancer 125 V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 Molecular Signatures Database (MSigDB) Gene Set Enrichment Analysis Software [36,37] were used to assess the enrichment of functional and pathway annotations as well as gene sets for the genes differentially expressed by PLA2G7 siRNA or both PLA2G7 shRNAs. Cell viability and apoptosis assays The effects of PLA2G7 silencing on cancer cell viability and induction of apoptosis were assessed with the CellTitre-Glo cell viability assay and ApoONE apoptosis assay (Promega Inc, Madison, WI, USA) according to the manufacturer’s instructions. The EnVision multilabel plate reader (Perkin-Elmer, Waltham, MA) was used for signal quantification. Scrambled siRNA or shRNA was used as the negative control and KIF11 siRNA as the positive control. Western blotting Western blot analysis was performed using antibodies against vimentin (1:1000, V6630, Sigma-Aldrich), Ecadherin (1:1000, Cell Signalling Technology, Danvers, MA), EGFR (1:100, Cell Signalling Technologies) and b-actin (1:5000, Sigma-Aldrich). The signals obtained were visualised with the enhanced chemiluminescence (ECL) detection system (Amersham) and normalised to b-actin signal. Immunofluorescence staining For the immunofluorescence staining, MDA-468/ PLA2G7cells were fixed with 4% paraformaldehyde (PFA) in PBS, permeabilised with 0.2% Triton X100, and blocked with 3% bovine serum albumin in PBS. Cells were stained with vimentin antibody and Alexa-conjugated secondary antibody was used for secondary staining (1:300 dilution; Molecular Probes, Thermo Fisher Scientific, Waltham, MA, USA). Nuclei were stained with Vectashield mounting medium (Vector Laboratories, Burlingame, CA) containing DAPI. Images were taken with Zeiss Axiovert 200M fluorescence microscope (Carl Zeiss AG, Oberkochen, Germany). Wound healing invasion assay MDA-468/PLA2G7cells were utilized in the wound healing invasion assay using the IncuCyte real-time imaging system (Essen BioScience, Ann Arbor, Michigan, USA). The cells were plated on 96-well plates (ImageLock plate, Essen BioScience, MI) coated with 50 ml 10% Growth Factor Reduced Matrigel (BD Biosciences) after which the cells were allowed to attach overnight at 1378C. A wound was scratched across each well (Wound Maker, Essen BioScience) and the growth medium was removed. The cells were then carefully covered with 50 ml 25% Matrigel in normal growth medium andincubatedin378C for 2–3 hours to allow gelling, after which 100 mlofgrowthmediumwas carefully added to each well. The rate of invasion (wound closure through the matrix) was monitored hourly with Incucyte imaging software (Essen BioScience) for 72 hours. Invasion efficiency was determined as percentage of the relative wound confluence compared to respective negative control (regarded as 100%). cDNA tumour panel TissueScan TM Cancer Survey cDNA Array 96 – I (Origene, Rockville, MD, USA) consisting of 96 samples from 65 primary and 7 metastatic tumour samples as well as 24 non-malignant tissue samples derived from 8 different primary organs and provided with clinical information was utilised according to the manufacturer’s instructions to analyse the expression pattern of PLA2G7 mRNA in multiple malignancies. The expression of PLA2G7 was quantified using qRT-PCR. Statistical analysis Statistical analysis of immunohistochemical samples was carried out using the SPSS program (SPSS Inc., Chicago, IL). Comparisons between categorical variables were performed using the v 2 test. Kaplan-Meier curves were used to estimate survival probability and patient survival differences were analysed by a logrank test. Other statistical analyses were performed using Student’s t-test (*p <0.05; **p <0.01; ***p <0.001) and the Pearson correlation coefficient. The results from cultured cells are presented as the mean 6SD of at least three replicates unless otherwise stated. Results Correlation of PLA2G7 mRNA expression with hormone receptor expression and prognosis in breast cancer To evaluate the expression pattern and possible association of PLA2G7 with poor survival in breast cancer, the GeneSapiens database was utilised to analyse PLA2G7 mRNA expression in 13 normal breast 126 L Lehtinen et al V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 samples and 957 breast cancer samples [30]. Comparison of PLA2G7 expression levels in normal breast tissues and breast cancer samples indicated high PLA2G7 mRNA expression in a subset of breast cancers (Figure 1A). Co-expression analysis indicated PLA2G7 mRNA to be overexpressed especially in breast cancer samples with low oestrogen and progesterone receptor (ESR1 and PGR) expression (p 50 and p 53.4E-10, respectively; Figure 1B) whereas the association between high PLA2G7 mRNA and low HER2/ERBB2 expression was not statistically significant (supplementary material, Figure S1). To investigate whether PLA2G7 may have prognostic significance, Kaplan–Meier analysis was performed. The results revealed a significant association between high PLA2G7 mRNA expression and poor breast cancer survival (p 50.004) as well as increased risk of disease relapse (p 50; Figure 1C). To validate the association between high PLA2G7 expression and hormone receptor negativity as well as poor prognosis in breast cancer, two additional independent sets of clinical breast cancer tissue microarrays were studied with immunohistochemical staining. PLA2G7 expression was analysed in a total of 683 breast cancer samples, including 65 samples derived from lymph node metastases (Figure 2A). High PLA2G7 expression was detected in 21.7% (n 5148) of all breast cancer samples. Association between high PLA2G7 expression and standard clinicopathological parameters is presented in Table 1. In accordance with the results from bioinformatic analysis of PLA2G7 mRNA expression, high PLA2G7 expression showed significant association with hormone receptor negativity in primary the breast cancer samples analysed. Furthermore, even though no significant association with survival or relapse was seen in the samples obtained from primary tumours, high PLA2G7 protein expression was associated with poor Figure 1. Figure 1. High PLA2G7 mRNA expression is associated with hormone receptor negativity and poor prognosis in clinical breast cancer samples. (A) Box plot analysis of normalized PLA2G7 mRNA expression values in normal and malignant tissues. The box refers to quartile distribution (25–75%) range, with the median shown as a vertical line. Data observations which lie more than 1.5*inter-quartile range higher than third quartile are considered as outliers and indicated separately. (B) The mRNA co-expression pattern of PLA2G7 and oestrogen receptor (ESR1) or progesterone receptor (PGR) in breast cancer samples (n 5957). (C) Kaplan-Meier plot of breast cancer specific survival and risk of relapse based on PLA2G7 mRNA expression in breast cancer. A log-rank test was performed between samples with high (50%) and low (50%) expression to evaluate the prognostic significance of PLA2G7 mRNA expression level. PLA2G7 in breast cancer 127 V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 Figure 2. PLA2G7 is expressed in a subset of breast cancers and associates with poor prognosis in breast cancer lymph node metastasis samples. (A) Staining intensity of PLA2G7 in primary breast cancer and breast cancer lymph node metastasis was scored as follows: Low expression (0 or 1), high expression (11 to 111). Representative section of staining intensities is presented. The areas presented at higher magnification have been indicated in the core images. (B) Kaplan-Meier curve presentation of overall survival and risk of relapse in the patient groups with no or weak PLA2G7 staining (n 557) or positive PLA2G7 staining (n 58) in the lymph node metastasis samples. 128 L Lehtinen et al V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 survival (p 50.002) as well as increased risk of disease relapse (p 50.005) in the samples obtained from lymph node metastases (Figure 2B). No significant difference was detected in PLA2G7 expression between the paired primary tumour and metastasis samples. A staining result was obtained for 39 paired primary tumours and lymph node metastases and 72% (28) of the pairs showed similar staining intensity in primary and metastatic samples. PLA2G7 mRNA expression in cultured breast cancer cells In order to find a suitable breast cancer cell model for functional experiments the mRNA expression level of PLA2G7 was studied in six breast cancer cell lines with qRT-PCR. Three of the cell lines studied were ER-positive (MCF-7, KPL-1 and ZR-75-1) and three were ER-negative (MDA-MB-231, BT-549 and MDA-MB-468). The results from qRT-PCR analysis are in accordance with the clinical data and show high PLA2G7 expression in two hormone receptor negative cell lines, MDA-MB-468 and BT-549 (Figure 3A). The effect of PLA2G7 silencing on genome-wide gene expression in MDA-MB-468 breast cancer cells To investigate the molecular processes regulated by PLA2G7 in breast cancer cells, the effect of PLA2G7 silencing on genome-wide gene expression profile was studied in MDA-MB-468 cells expressing PLA2G7 at high level. The gene expression analysis was conducted using one siRNA and two different shRNA molecules silencing PLA2G7 efficiently compared to the respective scrambled control (Figure 3B and supplementary material, Figure S2A). For MDA468/PLA2G7cells the genes uniformly differentially regulated by both of the shRNAs were selected for further analysis. DAVID Bioinformatics Resources and Ingenuity Pathway Analysis (IPA) software was used to assess enrichment of functional and pathway annotations for Table 1. PLA2G7 expression and standard clinicopathological parameters in 618 breast cancer samples. TMA 1 TMA 2 (primary tumours) Variable All (n) All (%) High PLA2G7 (n) High PLA2G7 (%) pAll (n) All (%) High PLA2G7 (n) High PLA2G7 (%) p All samples 400 100 84 21.0 218 100 56 25.7 Tumour type 309 218 ILC 135 43.7 21 15.6 0.028 27 12.4 5 18.5 0.048 IDC 174 56.3 45 25.9 165 75.7 43 26.1 Hormone receptor status 328 218 negative 53 16.2 16 30.2 0.041 44 20.2 18 40.9 0.010 positive 275 83.8 51 18.0 174 79.8 38 21.8 HER2 expression 330 187 negative 285 86.4 54 18.9 0.061 160 85.6 41 25.6 0.706 positive 45 13.6 14 31.1 27 14.4 6 22.2 WHO grade 260 213 I 81 31.2 12 14.8 0.244 10 4.7 4 40.0 0.018 II 126 48.5 27 21.4 116 54.5 21 18.1 III 53 20.4 14 26.4 87 40.8 30 34.5 pT stage 342 218 pT1 218 63.7 51 23.4 0.227 109 50.0 29 26.6 0.973 pT2 98 28.7 14 14.3 91 41.7 23 25.3 pT3 12 3.5 1 8.3 10 4.6 2 20.0 pT4 14 4.1 3 21.4 8 3.7 2 25.0 Lymph node metastasis 322 217 pN0 205 63.7 38 18.5 0.538 129 59.4 31 24.0 0.590 pN1 117 36.3 25 21.4 88 40.6 24 27.3 Metastasis 341 214 M0 330 96.8 68 20.6 0.350 205 95.8 50 24.4 0.543 M1 11 3.2 1 9.1 9 4.2 3 33.3 Recurrence 345 208 no 316 91.6 67 21.2 0.065 161 77.4 40 24.8 0.211 yes 29 8.4 2 6.9 47 22.6 16 34.0 ILC, invasive lobular carcinoma; IDC, invasive ductal carcinoma. Numbers in bold indicate statistically significant Pvalues. PLA2G7 in breast cancer 129 V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 the genes differentially expressed by PLA2G7 impairment. In accordance with earlier functional studies in prostate cancer cells [20], in transiently silenced PLA2G7 siRNA transfected breast cancer cells, the gene expression profiling highlighted the effect of PLA2G7 on proliferation (cell cycle) and apoptosis in addition to cell motion and adhesion (supplementary material, Table S1). However, functional cell viability and apoptosis assays with siRNA treated MDA-468 breast cancer cells showed only a minor decrease in cell viability at the 48 hours time point (supplementary material, Figure S2B). Interestingly, the results from genome-wide gene expression profiling using MDA-468/PLA2G7cells indicated that PLA2G7 silencing decreases the expression of genes associated with regulation of cell migration, epithelial cell differentiation and EMT (Table 2). Supporting the role of PLA2G7 in the regulation of EMT as well as migration and invasion, PLA2G7 impairment induced gene expression changes associated with IL-17A (interleukin 17A), Notch and oncostatin M signalling. These processes have all been previously associated with tumour metastasis or EMT [38–42]. Validation of the effect of PLA2G7 impairment on vimentin, E-cadherin and EGFR expression Two major hallmarks of EMT are the loss of expression of the epithelial cell adhesion molecule Ecadherin and gain of expression of the major mesenchymal cell cytoskeletal component vimentin. To validate the role of PLA2G7 in EMT, MDA-468/ PLA2G7cells were analysed for vimentin and Ecadherin protein expression. The results indicated clearly reduced vimentin and increased E-cadherin protein levels (Figure 4A). In addition, immunofluorescence staining of MDA-468/PLA2G7cells showed a clear decrease in vimentin staining intensity in comparison to the corresponding control (Figure 4B). Figure 3. PLA2G7 mRNA is highly expressed in triple negative breast cancer cell lines. (A) PLA2G7 mRNA expression in oestrogen receptor positive and oestrogen receptor negative breast cancer cell lines. (B) Validation of stable PLA2G7 gene silencing in MDA-MB-468 breast cancer cells at the mRNA level. Table 2. The effect of stable PLA2G7 silencing on gene expression profile in MDA-MB-468 breast cancer cells Down (n 519) Biological processes Pvalue Epithelial cell differentiation 6.3E-3 Regulation of cell migration 9.4E-3 Epidermis development 1.1E-2 Regulation of cell motion 1.2E-2 Ectoderm development 1.3E-2 Canonical Pathways Bile Acid Biosynthesis, Neutral Pathway 1.28E-2 Regulation of the Epithelial-Mesenchymal Transition Pathway 1.36E-2 Methylglyoxal Degradation III 1.48E-2 IL-17A Signalling in Gastric Cells 2.45E-2 Notch Signalling 3.7E-2 Up (n 539) Biological processes Immune response 2.5E-3 Canonical Pathways Pvalue Interferon Signalling 1.35E-13 Role of Pattern Recognition Receptors in Recognition of Bacteria and Viruses 2.34E-5 Activation of IRF by Cytosolic Pattern Recognition Receptors 1.83E-4 Oncostatin M Signalling 1.63E-3 Role of IL-17A in Psoriasis 2.26E-2 The functional gene ontology and pathway annotations were analysed for the sets of uniformly differentially expressed genes (FC >1.5 or FC <0.666) in response to two shRNAs. The analysis was conducted using DAVID Bioinformatics Resources and Ingenuity Pathway Analysis software 130 L Lehtinen et al V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 Figure 4. PLA2G7 impairment decreases the protein expression of vimentin and increases the protein expression of E-cadherin. (A) The effect of stable PLA2G7 silencing on vimentin and E-cadherin protein expression in MDA-MB-468 cells. b-actin expression was used as an endogenous control. (B) Immunofluorescence staining of MDA-MB-468 cells without (shScrambled) or with stable PLA2G7 silencing (shPLA2G7) using vimentin antibody (red). DAPI staining (blue) was used to visualize nuclei. 633objective magnification. PLA2G7 in breast cancer 131 V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138 62. Reinartz S, Finkernagel F, Adhikary T, et al. A transcriptomebased global map of signaling pathways in the ovarian cancer microenvironment associated with clinical outcome. Genome Biol 2016; 17: 108. 63. Low HB, Png CW, Li C, et al. Monocyte-derived factors including PLA2G7 induced by macrophage-nasopharyngeal carcinoma cell interaction promote tumour cell invasiveness. Oncotarget 2016; 7: 55473–55490. SUPPLEMENTARY MATERIAL ONLINE Supplementary figure legends Table S1. The effect of transient PLA2G7 silencing on breast cancer cell gene expression profile Figure S1. The mRNA co-expression pattern of PLA2G7 and HER2/neu (ERBB2) in breast cancer samples (n 5957) Figure S2. (A) Validation of transient PLA2G7 gene silencing in MDA-MB-468 breast cancer cells at the mRNA level. (B) The effect of 48 h PLA2G7 and KIF11 silencing on MDA-MB-468 cell viability. (C) The effect of 48 h PLA2G7 and KIF11 silencing on induction of apoptosis in MDA-MB-468 cells Figure S3. The effect of stable PLA2G7 silencing on EGFR protein expression in MDA-MB-468 cells. actin expression was used as an endogenous control Figure S4. The effect of stable PLA2G7 silencing and shScrambled expression on MDA-MB-468 cell viability at 48 h after plating equal numbers of cells Figure S5. Relative PLA2G7 mRNA expression in non-malignant and malignant ovarian, prostate and thyroid tissue samples based on TissueScan TM Cancer Survey cDNA panel 138 L Lehtinen et al V C2017 The Authors The Journal of Pathology: Clinical Research published by The Pathological Society of Great Britain and Ireland and John Wiley & Sons Ltd J Path: Clin Res April 2017; 3: 123–138