In e na ional Jou nal o
Molecula Sciences
A icle
T ansc ip omic S udies Re eal ha he Rhizobium
leguminosa um Se ine/Th eonine P o ein Phospha ase
PssZ has a Role in he Syn hesis o Cell-Su ace
Componen s, Nu ien U iliza ion, and O he
Cellula P ocesses
Paulina Lipa 1, José-Ma ía Vina dell 2and Monika Jancza ek 1,*
1Depa men o Gene ics and Mic obiology, Ins i u e o Mic obiology and Bio echnology, Facul y o Biology
and Bio echnology, Ma ia Cu ie-Skłodowska Uni e si y, Akademicka 19 S ., 20-033 Lublin, Poland;
[email p o ec ed]
2
Depa men o Mic obiology, Facul y o Biology, Uni e si y o Se illa, A da. Reina Me cedes 6, 41012 Se illa,
Spain; [email p o ec ed]
*Co espondence: [email p o ec ed]; Tel.: +48-81-537-5974
Recei ed: 21 May 2019; Accep ed: 11 June 2019; Published: 14 June 2019


Abs ac :
Rhizobium leguminosa um b . i olii is a soil bac e ium capable o es ablishing symbio ic
associa ions wi h clo e plan s (T i olium spp.). Su ace polysaccha ides, anspo sys ems, and
ex acellula componen s syn hesized by his bac e ium a e equi ed o bo h he adap a ion o
changing en i onmen al condi ions and success ul in ec ion o hos plan oo s. The pssZ gene loca ed
in he Pss-I egion, which is in ol ed in he syn hesis o ex acellula polysaccha ide, encodes a
p o ein belonging o he g oup o se ine/ h eonine p o ein phospha ases. In his s udy, a compa a i e
ansc ip omic analysis o R. leguminosa um b . i olii wild- ype s ain R 24.2 and i s de i a i e
R 297 ca ying a pssZ mu a ion was pe o med. RNA-Seq da a iden i ied a la ge numbe o genes
di e en ially exp essed in hese wo backg ounds. T ansc ip ome p o iling o he pssZ mu an
e ealed a ole o he PssZ p o ein in se e al cellula p ocesses, including cell signalling, ansc ip ion
egula ion, syn hesis o cell-su ace polysaccha ides and componen s, and bac e ial me abolism.
In addi ion, we show ha inac i a ion o pssZ a ec s he hizobial abili y o g ow in he p esence
o di e en suga s and a a ious empe a u es, as well as he p oduc ion o di e en su ace
polysaccha ides. In conclusion, ou esul s iden i ied a se o genes whose exp ession was a ec ed by
PssZ and con i med he impo an ole o his p o ein in he hizobial egula o y ne wo k.
Keywo ds:
Rhizobium leguminosa um; se ine/ h eonine p o ein kinases; se ine/ h eonine p o ein
phospha ases; ansc ip omics; gene exp ession; su ace polysaccha ides; exopolysaccha ide;
symbiosis; clo e ; ni ogen ixa ion
1. In oduc ion
The na u al en i onmen is a aluable ese oi o many mic oo ganisms. One o such ese oi s
is soil, which can be inhabi ed by ex emely high numbe s o di e se mic oo ganisms ( om 4,000 o
50,000 di e en mic oo ganisms and up o 10
10
bac e ial cells in 1 g o soil) [
1
]. One o he impo an
g oups o hese soil mic oo ganisms is ni ogen- ixing symbio ic bac e ia belonging o he amily
Rhizobiaceae, which a e collec i ely called hizobia [
2
,
3
]. These he e o ophic mic oo ganisms possess
ex emely la ge genomes (up o 9 Mbp) and show a e y high me abolic plas ici y, hanks o which hey
can exis in wo li es yles, as ee-li ing bac e ia and as endosymbion s o legume plan s [
4
,
5
]. Rhizobia
pa icipa e in he biological ixa ion o a mosphe ic dini ogen in associa ions wi h hei compa ible
In . J. Mol. Sci. 2019,20, 2905; doi:10.3390/ijms20122905 www.mdpi.com/jou nal/ijms
In . J. Mol. Sci. 2019,20, 2905 2 o 27
hos plan s, supplying ~200 million ons o his elemen pe yea o he global ni ogen cycle; ha is,
almos a hal o ni ogen compounds in oduced o he en i onmen as a i icial e ilize s [
6
–
8
]. Thus,
his ype o plan –mic obe in e ac ion plays a c ucial ole in he unc ioning o he biosphe e since i
inc eases soil e ili y and ield c ops.
Ni ogen- ixing symbiosis is a mul i-s ep p ocess which equi es coo dina ion be ween he mac o-
and he mic osymbion and in ol es an exchange o signals be ween he compa ible pa ne s. These
signal molecules include plan la onoids and bac e ial lipochi ooligosaccha ides (Nod ac o s) and
su ace polysaccha ides (PSs); among he la e , exopolysaccha ide (EPS) and lipopolysaccha ide (LPS)
a e he mos impo an [
3
,
9
–
11
]. Recen ly, a signal ole o low-molecula -weigh (LMW) EPS in ea ly
s ages o symbiosis (i.e., hos oo in ec ion) has been con i med, and a plan ecep o esponsible o
he ecogni ion o his PS has been iden i ied [
12
,
13
]. Howe e , be o e hizobia ind compa ible hos
plan s, hey ha e o su i e in soil as ee-li ing bac e ia and a e exposed o a ious en i onmen al
ac o s such as nu ien limi a ions, d ough , salini y, empe a u e changes, he p esence o hea y
me als, and oxida i e s ess [
14
–
20
]. The e o e, hizobia ha e de eloped se e al ea u es and s a egies
ha allow hem o adap o hese condi ions. One o hese adap a ions is a complex composi ion
o hei bac e ial en elope, in which a ious PSs ha e been iden i ied. These hizobial PSs include
LPS, EPS, capsula polysaccha ide (CPS), as well as wo PSs ecen ly cha ac e ized in Rhizobium
leguminosa um: neu al (NP, glucomannan) and gel- o ming (GPS) polysaccha ides [
3
,
9
,
21
]. CPS is
igh ly associa ed wi h he hizobial su ace and i s s uc u e in mos species is e y simila o e en
iden ical o ha o EPS. In con as , EPS is weakly associa ed wi h he bac e ial su ace and is eleased
in la ge amoun s o he en i onmen . Fu he mo e, EPS, which o ms he mos ex e nal laye o he
hizobial cells, plays an impo an p o ec i e ole agains desicca ion, nu ien limi a ion, and o he
s ess condi ions occu ing in he soil. Cyclic
β
-glucans (CGs), which a e loca ed in he pe iplasmic
space, a e in ol ed in bac e ial adap a ion o hypo-osmo ic condi ions. All hese PSs a e equi ed o
di e en s ages o symbiosis, such as a achmen o and bio ilm o ma ion on plan oo s, as well as
o he success ul in ec ion o legumes and adap a ion o condi ions p e ailing inside nodules, i.e.,
speci ic o gans o med by legume oo s, in which hizobia a e hos ed [
22
–
26
]. I has been es ablished
ha EPS is especially impo an in symbioses wi h legumes ha o m inde e mina e- ype nodules (e.g.,
clo e s wi h R. leguminosa um b . i olii, e ch and peas wi h R. leguminosa um b . iciae, and al al a
wi h Sino hizobium melilo i), whe e his PS is in ol ed in he ini ia ion and p opaga ion o ubula
s uc u es inside hos oo s, called in ec ion h eads (IT) [
27
]. Howe e , some excep ions a e known
(e.g., EPS o S. edii HH103 is no equi ed o he nodula ion o Glycy hiza u alensis, which also o ms
inde e mina e- ype nodules) [
28
]. EPS is a majo componen o he IT ma ix and is in ol ed in he
supp ession o plan de ense esponses [
29
,
30
]. The signi ican ole o EPS in he hizobial adap a ion
o bo h soil condi ions and symbiosis wi h legumes has been con i med by pheno ypes o a ious
EPS-de icien mu an s ains (e.g., R. leguminosa um b s. i olii and iciae, and S. melilo i), which we e
ine icien in hos oo in ec ion and ni ogen ixa ion [27,31–33].
Due o he e y impo an ole o EPS, he syn hesis o his polyme had become an objec o
many s udies in se e al hizobial ep esen a i es. Howe e , despi e hese nume ous s udies and
he de e mina ion o he chemical s uc u es o EPS o se e al hizobial species, he biosyn he ic
pa hways and egula ion o he p oduc ion o his PS a e known only agmen a ily [
34
,
35
]. The EPS
o R. leguminosa um is composed o oc asaccha ide subuni s, which con ain D-glucose, D-glucu onic
acid, and D-galac ose esidues in a mola a io 5:2:1 and a e subs i u ed wi h he O-ace yl and py u yl
g oups [
36
–
39
]. This PS is syn hesized by a mul i-enzyma ic complex loca ed in he bac e ial inne
memb ane. To da e, only he unc ion o a ew p o eins in ol ed in EPS syn hesis has been es ablished
expe imen ally in his bac e ium. PssA, PssDE, PssC, and PssS glycosyl ans e ases a e engaged in he
i s ou s eps, whe eas PssJ is p obably in ol ed in he las s ep o he EPS subuni assembly [
40
–
45
].
PssM encodes a ke al py u a e ans e ase esponsible o he py u yla ion o he EPS subuni [
46
],
and p o eins PssT, PssN, PssL, PssP, and PssP2 a e componen s o he EPS polyme iza ion and expo
sys em [
47
–
50
]. A g ea majo i y o hese p o eins (wi h he excep ion o PssA and PssL) a e encoded
In . J. Mol. Sci. 2019,20, 2905 3 o 27
by genes loca ed in a la ge ch omosomal clus e called Pss-I [45,51,52]. Mu a ions in pssA, pssD, pssE,
and pssS genes o ally abolish EPS syn hesis in R. leguminosa um and, in consequence, he e ec i e
symbiosis wi h i s hos plan s [31,41,45,53].
EPS syn hesis in R. leguminosa um is egula ed by se e al p o eins (PsiA, Ps A, ExoR, and RosR)
and en i onmen al ac o s (phospha e and ni ogen limi a ions, ca bon sou ce, la onoids) [
43
,
54
–
58
].
Among hese p o eins, PsiA, Ps A, and ExoR nega i ely a ec EPS syn hesis, whe eas RosR posi i ely
egula es his p ocess.
Fu he mo e, as p e iously epo ed, he pssZ gene, which is loca ed in he Pss-I egion, is
also in ol ed in EPS syn hesis [
59
]. In-silico sequence analysis showed ha his gene encodes a
p o ein belonging o he amily o se ine/ h eonine p o ein phospha ases (STPs), which a e in ol ed in
egula ion o a ious cellula p ocesses in bac e ia, including g ow h and di ision, mo ili y, en elope
biogenesis, bio ilm o ma ion, cell agg ega ion, egula ion o ansc ip ion and ansla ion, and
signaling [60–63]. Un il now, mos STPs ha e been cha ac e ized in G am-posi i e bac e ia, and only
a ew examples o hese enzymes in G am-nega i e bac e ia ha e been epo ed. The PssZ p o ein
is he i s STP desc ibed in Rhizobiaceae ep esen a i es o da e, as well as he i s case o linking
his ype o enzyma ic ac i i y wi h bac e ial EPS syn hesis pa hways. S udies pe o med by ou
esea ch g oup ha e shown ha a mu a ion in his gene had pleio opic e ec s and signi ican ly a ec ed
se e al cellula p ocesses [
59
]. A pssZ mu an o R. leguminosa um b . i olii R 297 exhibi ed se e al
physiological and symbio ic de ec s, among hem, he lack o EPS syn hesis and dec eased g ow h and
cell mo ili y. The inhibi ion o EPS p oduc ion was co ela ed wi h a educed abili y o o m bio ilms
and a d ama ic dec ease in he symbio ic e ec i eness wi h ed clo e (T i olium p a ense), esul ing in
he o ma ion o de o med oo nodules, which we e ine icien in ni ogen ixa ion [
59
]. These da a
indica ed ha he PssZ p o ein is no only indispensable o EPS biosyn hesis, bu also equi ed o he
p ope unc ioning o R. leguminosa um b . i olii cells in symbiosis.
Re e sible phospho yla ion is a key mechanism ha egula es se e al cellula p ocesses in
bo h p oka yo es and euka yo es. Many ecen s udies indica e ha egula o y pa hways con olled
by Hanks- ype se ine/ h eonine kinases (STKs) and se ine/ h eonine phospha ases (STPs) play an
impo an ole in he egula ion o many bac e ial p ocesses, including g ow h and cell di ision, cell wall
biogenesis, spo ula ion, bio ilm o ma ion, s ess esponse, me abolic and de elopmen al p ocesses,
and in e ac ions o bo h pa hogenic and symbio ic bac e ia wi h hei hos s [
60
–
63
]. STKs and STPs a e
no DNA-binding p o eins; he e o e, hey exe a egula o y ole ia pos - ansla ional modi ica ions
o hei p o ein a ge s, among hem, se e al egula o y p o eins o o he signalling cascades.
In his wo k, we pe o med a compa a i e ansc ip omic analysis o R. leguminosa um b . i olii
wild- ype R 24.2 and i s de i a i e, pssZ mu an R 297. This analysis p o ided e idence on he
PssZ-media ed egula ion o gene exp ession in his bac e ium. I was es ablished ha PssZ in luenced
he exp ession o a la ge g oup o genes in ol ed in many p ocesses such as ansc ip ion and
ansla ion, he syn hesis o cell-su ace componen s and polysaccha ides, mo ili y, and di e en
me abolic pa hways. Ou esul s sugges ha PssZ plays an impo an ole in he egula ion o a ious
cellula p ocesses in R. leguminosa um b . i olii.
2. Resul s
2.1. RNA-Seq Analysis o he Wild-Type R 24.2 and pssZ Mu an R 297 S ains
In a p e ious s udy, we showed ha he pssZ mu a ion causes pleio opic e ec s in hizobial
cells, including he lack o EPS p oduc ion, educed g ow h kine ics and mo ili y, and ailu e in
hos oo in ec ion [
59
]. These indings sugges ha pssZ migh play a b oad egula i e unc ion
in R. leguminosa um b . i olii. The e o e, in he p esen s udy, we ha e pe o med a compa a i e
ansc ip omic analysis o he wild- ype R 24.2 and i s de i a i e, pssZ mu an s ain R 297, o es ablish
a se o genes di e en ially exp essed in hese wo s ains. Cul u es o bac e ia g own in he ich 79CA
medium up o he middle exponen ial g ow h phase when bac e ial cells in ensi ely di ide we e used
In . J. Mol. Sci. 2019,20, 2905 4 o 27
o o al RNA isola ion. Fo hese analyses, a d a genome sequence o R 24.2 which was ob ained by
us ea lie was used as a e e ence s ain (181 con igs wi h a o al leng h o 7,653,217 bp, in which 7,374
pu a i e coding egions we e iden i ied) [58,64].
To compa e gene exp ession p o iles in R 24.2 and R 297, h ee cDNA lib a ies o each s ain
we e p epa ed and sequenced as pai -end eads using Illumina MiSeq wi h SBS echnology. A e
il e ing o p ime -adap o sequences and low-quali y eads, he emaining eads we e mapped o
he e e ence R 24.2 genome in o de o iden i y di e en ially exp essed genes (DEGs) in he R 24.2
and R 297 s ains. An analysis o he unc ional composi ion o he wild- ype s ain ansc ip ome
showed ha he mos nume ously ep esen ed ca ego ies we e hose ela ed o me abolic p ocesses,
especially unc ional g oups (COGs) in ol ed in he up ake and me abolism o ca bohyd a es (COG G),
amino acids (E), and ino ganic ions (P), as well as an ene gy p oduc ion and con e sion (C) (Figu e 1,
Supplemen a y Table S1). Fu he mo e, la ge numbe s o genes ela ed wi h ansc ip ion (K) and
ansla ion p ocesses (J), cell en elope biogenesis (M), and poo ly cha ac e ized genes (classes R and
S), we e highly ep esen ed in he R. leguminosa um ansc ip ome. Based on old changes o gene
exp ession in he wild ype and he pssZ mu an (log
2
R 24.2/R 297 alues >1.4), we es ablished ha
996 genes we e ansc ibed a signi ican ly di e en le els in hese wo s ains. These da a indica e ha
PssZ is engaged in he egula ion o he exp ession o a la ge g oup o hizobial genes, sugges ing ha
his p o ein plays an impo an ole in R 24.2 egula o y ne wo ks (Supplemen a y Table S1). Among
hese DEGs, sligh ly mo e genes we e up- egula ed (57.73%), whe eas 42.27% we e down- egula ed in
he pssZ mu an (Figu e 1A). Among he 996 genes analyzed, 83.94% we e success ully classi ied in o
pa icula COGs (Figu e 1B) [
65
]. Mos o hese genes belonged o he ollowing unc ional g oups:
anspo and me abolism o ca bohyd a es (COG G) (9.15%) and amino acids (E) (7.66%), ansc ip ion
(K) (8.80%), signal ansduc ion (T) (7.66%), and cell wall/memb ane/en elope biogenesis (M) (6.34%).
Many DEGs we e also classi ied o COGs encompassing poo ly cha ac e ized p o eins wi h gene al
(R) (5.20%) and unknown unc ions (S) (6.86%) (Figu e 1B). Mo eo e , when indi idual COGs we e
analyzed, we ha e ound ha in he case o COGs in ol ed in signaling and se e al cellula p ocesses,
a high numbe o genes we e down- egula ed in he pssZ mu an in ela ion o he wild ype (i.e., signal
ansduc ion (T), cell wall/memb ane/en elope biogenesis (M), cell mo ili y (N), ex acellula s uc u es
(W) and in acellula a icking, sec e ion and esicula anspo (U)) (Figu e 1C). In con as , a g ea
majo i y o genes belonging o COGs in ol ed in in o ma ion s o age and p ocessing (J, K, L, O), cell
me abolism (C, F, H, I, Q), and hose om he COGs R and S we e up- egula ed in R 297.
Wi h espec o indi idual DEGs, nea ly 12% o he PssZ egulon exhibi ed mo e han 32- old
changed exp ession be ween he wild ype and he pssZ mu an (log
2
old change 24.2/297 >5 o
<
−
5) (Supplemen a y Table S2). This se o genes showing e y high di e en ial exp ession includes
R 659_14 encoding a suga ABC anspo e pe mease (log
2
24.2/297 =
−
10.16), R 659_15 encoding
a suga -binding p o ein (
−
11.12), R 659_20 encoding a glycine/be aine ABC anspo e (
−
11.02),
R 651_2 encoding a cold-shock p o ein (
−
12.65), R 651_33 encoding a LuxR amily ansc ip ional
egula o (
−
12.65), R 659_32 encoding a LysR amily ansc ip ional egula o (
−
10.87), and genes
encoding glycosyl ans e ases in ol ed in EPS syn hesis (R 772_9=13.09, R 772_10 =13.07, and
R 772_14 =12.59).
In . J. Mol. Sci. 2019,20, 2905 5 o 27
In . J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 5 o 27
Figu e 1. The genes di e en ially exp essed in he pssZ mu an R 297 in ela ion o he wild- ype s ain
R. leguminosa um b . i olii R 24.2. (a) Global classi ica ion o he genes in o up- egula ed ones ( ed
colo ), whose exp ession was highe , and down- egula ed ones (blue colo ), whose exp ession was
lowe in he pssZ mu an han in he wild- ype backg ound, espec i ely; (b) Numbe s o genes om
he indi idual unc ional g oups (COGs M-S) di e en ially exp essed in he R 24.2 and R 297 s ains;
(c) he numbe o genes om indi idual COGs di e en ially exp essed in he R 24.2 and R 297 s ains
(up- and down- egula ed genes in he pssZ mu an ); genes encoding hypo he ical p o eins, which
we e no classi ied o COGs, cons i u ed 14.08%. Abb e ia ions o COGs: B = Ch oma in s uc u e and
dynamics, C = Ene gy p oduc ion and con e sion, D = Cell cycle con ol, cell di ision, ch omosome
pa i ioning, E = Amino acid anspo and me abolism, F = Nucleo ide anspo and me abolism, G
= Ca bohyd a e anspo and me abolism, H = Coenzyme anspo and me abolism, I = Lipid
anspo and me abolism, J = T ansla ion, ibosomal s uc u e and biogenesis, K = T ansc ip ion, L =
Replica ion, ecombina ion and epai , M = Cell wall/memb ane/en elope biogenesis, N = Cell
mo ili y, O = Pos - ansla ional modi ica ion, p o ein u no e , and chape ones, P = Ino ganic ion
Figu e 1.
The genes di e en ially exp essed in he pssZ mu an R 297 in ela ion o he wild- ype s ain
R. leguminosa um b . i olii R 24.2. (
a
) Global classi ica ion o he genes in o up- egula ed ones ( ed
colo ), whose exp ession was highe , and down- egula ed ones (blue colo ), whose exp ession was
lowe in he pssZ mu an han in he wild- ype backg ound, espec i ely; (
b
) Numbe s o genes om
he indi idual unc ional g oups (COGs M-S) di e en ially exp essed in he R 24.2 and R 297 s ains;
(
c
) he numbe o genes om indi idual COGs di e en ially exp essed in he R 24.2 and R 297 s ains
(up- and down- egula ed genes in he pssZ mu an ); genes encoding hypo he ical p o eins, which we e
no classi ied o COGs, cons i u ed 14.08%. Abb e ia ions o COGs: B =Ch oma in s uc u e and
dynamics, C =Ene gy p oduc ion and con e sion, D =Cell cycle con ol, cell di ision, ch omosome
pa i ioning, E =Amino acid anspo and me abolism, F =Nucleo ide anspo and me abolism,
G=Ca bohyd a e anspo and me abolism, H =Coenzyme anspo and me abolism, I =Lipid
anspo and me abolism, J =T ansla ion, ibosomal s uc u e and biogenesis, K =T ansc ip ion,
L=Replica ion, ecombina ion and epai , M =Cell wall/memb ane/en elope biogenesis, N =Cell
mo ili y, O =Pos - ansla ional modi ica ion, p o ein u no e , and chape ones, P =Ino ganic ion
anspo and me abolism, Q =Seconda y me aboli es biosyn hesis, anspo , and ca abolism,
R=Gene al unc ion p edic ion only, X =Mobilom, S =Func ion unknown, T =Signal ansduc ion
mechanisms, U =In acellula a icking, sec e ion, and esicula anspo , V =De ense mechanisms,
W=Ex acellula s uc u es.

In . J. Mol. Sci. 2019,20, 2905 6 o 27
2.1.1. T ansc ip ion, T ansla ion, and Signal T ansduc ion Mechanisms
A unc ional ca ego y ha is highly ep esen ed in he PssZ egulon (100 genes) is ansc ip ion
(COG K) (Figu e 1B,C). A majo i y o he genes om his COG we e up- egula ed (61 genes), whe eas
39 genes we e down- egula ed in he pssZ mu an . These DEGs encoded many p o eins belonging o
a ious ansc ip ional egula o y amilies such as LysR, LuxR, C p/Fn , LacI, RpiR, A aC, and Te R
(Table S1, Figu e 2); e.g., R 659_32 and R 713_1 (LysR amily), R 688_7 (C o/Cl amily), R 651_33 (LuxR
amily), R 651_8 (C p/Fn amily), and R 770_14 (Te R amily). A ca abolic p o ein C p/Fn (R 651_8),
a egula o y LacI- ype p o ein (R 651_32), R 619_151 (ROK), and an adenyla e cyclase R 679_8 a e
mos p obably engaged in he egula ion o ca bon me abolism (Figu e 2). Mo eo e , genes R 782_65,
R 766_60, R 627_60, and R 764_21, encoding egula o s om he Gn R amily and p obably engaged in
gene al me abolism, and R 793_203 and R 793_293, encoding OmpR- ype ansc ip ion ac o s, we e
down- egula ed in he pssZ mu an . Genes R 620_47 and R 782_47, encoding RNA polyme ase sigma
subuni s σ32 and σ70, espec i ely, we e o e exp essed in he R 297 mu an .
Addi ionally, se e al genes associa ed wi h ansla ion and pos - ansla ional modi ica ions (COGs
J and O) we e exp essed a di e en le els in hese wo s ains. Many genes encoding ibosomal p o eins
o bo h 50S and 30S subuni s we e iden i ied as DEGs, and a majo i y o hem we e up- egula ed in
he pssZ mu an (e.g., R 775_6, R 775_7, R 775_8,R 775_13, and R 775_14). These da a sugges he
occu ence o some dis u bances in ibosome biogenesis and/o in he ansla ion p ocess in his s ain.
Se e al genes classi ied in o he COG O, which encode pu a i e chape ons, a hea shock p o ein,
and p o eases, we e exp essed a highe le els in he pssZ mu an han in he wild ype (e.g., R 785_56
(G oES), R 785_55 (G oEL), R 673_17 (DnaK), R 770_45 and R 770_44 (Hsp20), a hea shock p o ein
R 657_44 (G pE), a se ine p o ease, and pep idases (R 648_49, R 780_51, R 657_208)) (Figu e 2). In
con as , R 792_102 encoding a chape one DnaJ was down- egula ed in he mu an .
Fu he mo e, many genes om he COG T, which is in ol ed in signal ansduc ion mechanisms,
we e also ound o belong o he PssZ egulon. A g ea majo i y o hem (78.16%) we e down- egula ed
in he pssZ mu an (Figu e 1B,C, Table S1). Among DEGs om his unc ional g oup, se e al genes
coding o pu a i e senso his idine kinases (R 657_14 and R 760_35), a di-guanyla e phosphodies e ase
(R 793_45), a PAS senso p o ein (R 622_37), a pu a i e acyl-homose ine lac one syn hase (R 652_22)
in ol ed in quo um sensing, and a CheY- ype chemo axis p o ein (R 784_53) we e ound (Figu e 2).
In e es ingly, se e al genes encoding pu a i e di-guanyla e cyclases (e.g., R 657_264, R 792_10, R 615_41,
R 618_35, R 620_42, R 620_87, and R 623_10) we e down- egula ed in he pssZ mu an (log
2
old
change 24.2/297 om 1.51 o 3.07) (Table S1). These p o eins a e p obably engaged in he syn hesis o a
cyclic di-guanyla e monophospha e (c-di-GMP), which is an impo an signal molecule in ol ed in he
egula ion o many cellula p ocesses in bac e ia [66–71].
2.1.2. Ca bon and Amino Acid T anspo and Me abolism
Besides he COGs K and T, a la ge pa o he PssZ egulon was cons i u ed by DEGs ela ed o
bac e ial me abolism (Figu e 1B,C). Among hese genes, he highes numbe s we e hose g ouped in
COGs G (104 genes), E (87 genes), and P (46 genes). In hese COGs, simila numbe s o genes we e
up- and down- egula ed in he pssZ mu an . These DEGs encoded componen s o a ious anspo
sys ems and enzymes in ol ed in he me abolism o di e en ca bon, ni ogen, and ino ganic sou ces.
Some genes om he COG G, encoding di e en componen s o a pu a i e suga anspo sys em we e
down- egula ed in he pssZ mu an (R 766_15, R 766_16, R 766_17, and R 766_18), whe eas o he genes,
encoding componen s o ano he suga anspo sys em, we e up- egula ed in his s ain (R 659_13,
R 659_14, R 659_15, R 659_16, and R 659_17) (Table S1). In addi ion, se e al o he genes ela ed o
he ca bon me abolism we e exp essed a lowe le els in he pssZ mu an han in he wild ype (e.g.,
R 659_20 and R 659_29) (Figu e 2, Table S1).
In . J. Mol. Sci. 2019,20, 2905 7 o 27
In . J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 7 o 27
Figu e 2. The ep esen a i e genes om he indi idual COGs di e en ially exp essed in he pssZ
mu an R 297 in ela ion o he wild- ype s ain R 24.2. Func ions o pu a i e p o eins encoded by
hese genes a e gi en in b acke s.
Figu e 2.
The ep esen a i e genes om he indi idual COGs di e en ially exp essed in he pssZ
mu an R 297 in ela ion o he wild- ype s ain R 24.2. Func ions o pu a i e p o eins encoded by hese
genes a e gi en in b acke s.
In . J. Mol. Sci. 2019,20, 2905 8 o 27
The COG E ela ed o ni ogen anspo and me abolism encompassed a la ge pa o he PssZ
egulon as well (87 genes). Among hese DEGs, genes encoding an amino acid pe mease (R 763_144),
a b anched-chain amino acid ABC anspo e pe mease (R 787_18), a pu a i e glu amine ABC
anspo e ATP-binding p o ein (R 782_62), and an aminopep idase N (R 648_56) we e exp essed a
lowe le els in he mu an in ela ion o he wild ype backg ound. In con as , genes coding o an
amino acid oxidase (R 651_29), an ATP-binding p o ein o an amino acid ABC- ype anspo sys em
(R 651_30), and componen s o a pu a i e glycine/be aine anspo sys em (R 659_21 and R 659_22)
we e up- egula ed in R 297.
In summa y, he la ge numbe o DEGs ound in he COGs G and E sugges s he occu ence o
some dis u bances in me abolic pa hways in cells o he pssZ mu an .
2.1.3. Syn hesis o Cell-Su ace Componen s
Many DEGs associa ed wi h cell en elope biogenesis and he syn hesis o di e en PSs we e also
iden i ied in he PssZ egulon (COG M) (Figu e 1B,C). A signi ican majo i y o hem (68.06%) we e
down- egula ed in he pssZ mu an . Among hese DEGs, a la ge numbe o genes in ol ed in he
syn hesis o suga p ecu so s (R 679_6, R 772_26) and di e en PSs we e ound (e.g., R 772_1, R 772_4,
R 772_13, R 679_1, R 679_3, R 679_4, R 622_27) (Figu e 2). Some o hese genes a e loca ed in he Pss-I
egion and a e engaged in EPS syn hesis (R 772_4, R 772_9, R 772_10, R 772_11, R 772_12, R 772_13,
and R 772_14, encoding glycosyl ans e ases, R 772_5, R 772_6 and R 772_8 encoding enzymes adding
non-suga modi ica ion o EPS subuni s, and R 772_7 encoding PssL engaged in EPS expo ) (Figu e 2).
These genes we e s ongly down- egula ed in he pssZ mu an (log
2
old change 24.2/297 om 9.79
o 15.10). Some o he genes loca ed in he Pss-I egion, such as R 772_18 and R 772_19, which codes
o polysaccha idase PlyA and au oagg ega ion p o ein RapA1, a e also down- egula ed in R 297.
Simila ly, R 623_91 encoding an UDP-phospha e glucose phospho ans e ase, which is a homolog o
he R. leguminosa um b . iciae 3841 gmsA gene in ol ed in NP syn hesis, was sligh ly down- egula ed
in he pssZ mu an (log2 old change 24.2/297 1.80).
In con as , se e al genes om his COG we e up- egula ed in he mu an . These include
R 772_26(exo5) encoding a UDP-glucose 6-dehyd ogenase, R 623_102 and R 628_53 (acyl ans e ases),
R 780_172 (a pu a i e glycosyl ans e ase), R 620_62 (glucosyl ans e ase PssA in ol ed in he i s
s ep o EPS syn hesis), and R 630_16 (a posi i e egula o o EPS syn hesis, RosR), which showed log
2
old changes om
−
1.46 o
−
2.50 (Figu e 2). The exp ession o R 782_16, encoding an ABC anspo e
o CG (Nd A) was also up- egula ed in he pssZ mu an .
2.1.4. Genes In ol ed in Cell Cycle and Mo ili y
A ew DEGs ela ed o he egula ion o he bac e ial cell cycle we e iden i ied in he PssZ egulon.
Among hese genes, R 626_126 and R 626_127, encoding cell di ision p o eins F sA and F sQ, we e
down- egula ed in he pssZ mu an (log
2
old change 1.54 and 1.43, espec i ely) (Figu e 2). In con as ,
R 780_188, which codes o a cell cycle egula o Gc A, was up- egula ed in his s ain (log
2
old
change
−
4.72). These da a a e in cong uence wi h ou ea lie obse a ion ha he pssZ mu an g ew
signi ican ly slowe and had a longe gene a ion ime han he wild- ype s ain [59].
Mo eo e , se e al DEGs associa ed wi h he o ma ion and/o unc ioning o pilus and lagella
s uc u es equi ed o cell mo ili y we e iden i ied in he PssZ egulon. Fo example, R 629_48,
R 620_56, R 793_203, and R 625_40 we e down- egula ed, whe eas R 628_8, R 780_212, and R 614_107
we e up- egula ed in he mu an s ain. These esul s sugges some dis u bances in he unc ioning o
hese cell-su ace s uc u es and con i m ou p e ious indings ha he mu an cells we e cha ac e ized
by signi ican ly slowe swa ming mo ili y in compa ison o wild- ype cells [59].
2.1.5. Analysis o T ansc ip ional Fusions in R 297 and R 24.2 S ains
To alida e he da a ob ained om he RNA-Seq analyses, se e al genes ep esen a i e o he
PssZ egulon, o which di e en exp ession be ween he wild- ype and he pssZ mu an was obse ed,
In . J. Mol. Sci. 2019,20, 2905 9 o 27
as well as genes no belonging o his egulon, whose exp ession was no a ec ed by PssZ, we e
chosen. The ansc ip ional ac i i y o he genes om hese wo g oups was de e mined using usion
plasmids con aining p omo e egions o hese genes subcloned ups eam o p omo e less lacZ o gusA
epo e genes. These plasmids we e in oduced in o bo h he R 24.2 and R 297 s ains by bi-pa en al
conjuga ion, and
β
-galac osidase/
β
-glucu onidase ac i i y assays we e pe o med. The genes chosen
o he ansc ip ional analysis exhibi ed a wide ange o exp ession le els, as i was de e mined in he
wild- ype backg ound ( alues om 3102 o osR-lacZ o 438 Mille uni s o plyA-lacZ) (Figu e 3).
In . J. Mol. Sci. 2019, 20, x FOR PEER REVIEW 10 o 27
Figu e 3. The ansc ip ional ac i i y o hizobial p omo e s in he wild- ype R 24.2 and he pssZ
mu an s ains de e mined in β-galac osidase o β-glucu onidase ac i i y assays and p esen ed as
Mille uni s. Signi ican di e ences in he ansc ip ional ac i i y o indi idual p omo e s be ween
R 24.2 and R 297 s ains a e ma ked wi h * (p < 0.05, one-way Ano a). The log2 old change 24.2/297
alues o indi idual genes ob ained in RNA-Seq analysis is gi en below he diag am; genes, o
which di e ences in exp ession be ween R 24.2 and R 297 in RNA-Seq we e no ound, a e ma ked
wi h “-“.
When he ansc ip ional ac i i y o he indi idual gene s udied was compa ed be ween he wild
ype and he pssZ mu an backg ounds, signi ican di e ences in he exp ession le els we e ound
o hose genes, in which di e ences in exp ession assessed by he RNA-Seq analysis we e also ound.
Highe exp ession le els in R 24.2 in compa ison o R 297 we e de e mined o he ollowing genes:
R 772_11(pssF), R 772_3(pssW), R 772_8(pssK), R 772_18(plyA), R 772_9(pssI), R 772_1(pssV),
R 772_18( apA1), andR 772_12(pssC), whe eas lowe exp ession was es ablished o R 620_62(pssA),
R 782_16(nd A), and R 630_16( osR). Fu he mo e, based on he β-galac osidase ac i i y assay, he
ansc ip ional ac i i y o genes ha a e no membe s o he PssZ egulon (based on he RNA-Seq
analysis) was on simila le els in bo h s ains R 24.2 and R 297 (e.g., pssO, pssN, pssT, pssP, pssB, mcpC,
and mcpD) (Figu e 3). Thus, hese esul s con i med ha PssZ is in ol ed in he egula ion o he
exp ession o se e al genes associa ed wi h he syn hesis o a ious hizobial PSs and o he su ace
componen s.
In summa y, he esul s ob ained om he β-galac osidase/β-glucu onidase ac i i y assays a e
in cong uence wi h hose ob ained om he RNA-Seq analysis, hus con i ming he eliabili y o he
ansc ip omic analysis o he R. leguminosa um PssZ egulon desc ibed in his wo k.
2.2. Pheno ypic Cha ac e is ics o he Wild-Type S ain R 24.2 and I s De i a i es
In o de o con i m he in ol emen o he pssZ gene in se e al cellula p ocesses, as sugges ed
by he ansc ip omic da a ob ained o he pssZ mu an and he wild ype, we de e mined some
pheno ypic ai s o hese s ains. In addi ion, a complemen ed e sion o he pssZ mu an ,
R 297(pPL1), as well as a pssZ-o e exp essing s ain, R 24.2(pPL1), we e included in hese
expe imen s.
2.2.1. G ow h a a Wide Range o Tempe a u es
The g ow h kine ics o he R 297, R 24.2, R 297(pPL1), and R 24.2(pPL1) s ains a 16, 20, 24, 28,
and 32 °C du ing 72 h was de e mined in 79CA medium con aining 1% glyce ol (w/ ) as a ca bon
Figu e 3.
The ansc ip ional ac i i y o hizobial p omo e s in he wild- ype R 24.2 and he pssZ
mu an s ains de e mined in
β
-galac osidase o
β
-glucu onidase ac i i y assays and p esen ed as
Mille uni s. Signi ican di e ences in he ansc ip ional ac i i y o indi idual p omo e s be ween
R 24.2 and R 297 s ains a e ma ked wi h * (p<0.05, one-way Ano a). The log
2
old change 24.2/297
alues o indi idual genes ob ained in RNA-Seq analysis is gi en below he diag am; genes, o which
di e ences in exp ession be ween R 24.2 and R 297 in RNA-Seq we e no ound, a e ma ked wi h “-“.
When he ansc ip ional ac i i y o he indi idual gene s udied was compa ed be ween he
wild ype and he pssZ mu an backg ounds, signi ican di e ences in he exp ession le els we e
ound o hose genes, in which di e ences in exp ession assessed by he RNA-Seq analysis we e also
ound. Highe exp ession le els in R 24.2 in compa ison o R 297 we e de e mined o he ollowing
genes: R 772_11(pssF), R 772_3(pssW), R 772_8(pssK), R 772_18(plyA), R 772_9(pssI), R 772_1(pssV),
R 772_18( apA1), and R 772_12(pssC), whe eas lowe exp ession was es ablished o R 620_62(pssA),
R 782_16(nd A), and R 630_16( osR). Fu he mo e, based on he
β
-galac osidase ac i i y assay, he
ansc ip ional ac i i y o genes ha a e no membe s o he PssZ egulon (based on he RNA-Seq
analysis) was on simila le els in bo h s ains R 24.2 and R 297 (e.g., pssO, pssN, pssT, pssP, pssB,
mcpC, and mcpD) (Figu e 3). Thus, hese esul s con i med ha PssZ is in ol ed in he egula ion
o he exp ession o se e al genes associa ed wi h he syn hesis o a ious hizobial PSs and o he
su ace componen s.
In summa y, he esul s ob ained om he
β
-galac osidase/
β
-glucu onidase ac i i y assays a e
in cong uence wi h hose ob ained om he RNA-Seq analysis, hus con i ming he eliabili y o he
ansc ip omic analysis o he R. leguminosa um PssZ egulon desc ibed in his wo k.
2.2. Pheno ypic Cha ac e is ics o he Wild-Type S ain R 24.2 and I s De i a i es
In o de o con i m he in ol emen o he pssZ gene in se e al cellula p ocesses, as sugges ed
by he ansc ip omic da a ob ained o he pssZ mu an and he wild ype, we de e mined some
In . J. Mol. Sci. 2019,20, 2905 16 o 27
genomes (up o 9 Mbp), which besides he ch omosome con ain se e al la ge plasmids, ha ensu es
hem high me abolic plas ici y [
97
]. As epo ed ecen ly, hizobial s ains u ilizing a wide ange o
subs a es (including suga subs a es) a e mo e compe i i e han o he s and, as a consequence, a e
mo e success ul in symbiosis [98]. The di e se me abolic capaci ies o hizobial s ains a e impo an
o he adap a ion o soil and su i al in he hizosphe es o hos plan s. Legume oo exuda es con ain
a high numbe o compounds, including suga s, amino acids, amines, alipha ic and a oma ic acids, and
o he s [
99
,
100
]. Ou esul s sugges ha PssZ migh play an impo an ole in he hizobial adap a ion
o bo h soil condi ions and symbiosis wi h hos plan s.
4. Ma e ials and Me hods
4.1. Bac e ial S ains, Plasmids, and Cul u e Condi ions
Bac e ial s ains, plasmids, and oligonucleo ide p ime s used in his wo k a e lis ed in Table 1.
Table 1. The s ains, plasmids and oligonucleo ide p ime s used in his s udy.
S ains, Plasmids,
and P ime s Cha ac e is ics Sou ce o
Re e ence
S ains
R 24.2 wild- ype s ain Rhizobium leguminosa um b . i olii,
clo e mic osymbion , Ri , Nx [101]
R 297 R 24.2 pssZ::mTn5SSgusA40, Sp [59]
R 297(pPL1) R 297 ca ying pssZ on pBBR1MCS-2 ec o , Km [59]
R 24.2(pPL1) R 24.2 ca ying pssZ on pBBR1MCS-2 ec o , Km [59]
R 24.2(pMP220) R 24.2 ca ying pMP220 ec o , Ri , Nx ,Tc This wo k
R 297(pMP220) R 297 ca ying pMP220 ec o , Ri , Nx ,Tc This wo k
Plasmids
pMP220 IncP, mob, p omo e less lacZ, Tc [102]
pFUS1P pFUS1 wi h pa casse e, p omo e less gusA, Tc [103]
pPL1 pBBR1MCS-2 ca ying 1.8-kb SalI-XbaI agmen wi h he pssZ gene, Km [59]
pPSS4 pMP220 ca ying 0.6-kb EcoRI-Ps I agmen o he pssB p omo e egion [58]
pNDV5 pMP220 ca ying 0.3-kb EcoRI-Ps I agmen o he nd A p omo e egion [58]
pCEL9 pMP220 ca ying 0.72-kb EcoRI-Ps I agmen o he celA p omo e egion [58]
pGEL10 pMP220 ca ying 0.8-kbBglII-XbaI agmen o he gelA p omo e egion [58]
pRAP11 pMP220 ca ying 0.9-kb BglII-XbaI agmen o he apA1 p omo e egion [58]
pPRS12
pMP220 ca ying 0.85-kb EcoRI-XbaI agmen o he p sD p omo e egion
[58]
pF65 pMP220 ca ying 0.65-kb BglII-Ps I agmen o he pssF p omo e egion [45]
pW74
pMP220 ca ying 0.74-kb EcoRI-Ps I agmen o he pssW p omo e egion
[45]
pK48 pMP220 ca ying 0.48-kb EcoRI-Ps I agmen o he pssK p omo e egion [45]
pV90 pMP220 ca ying 0.9-kb KpnI-XbaI agmen o he pssV p omo e egion [45]
pC55 pMP220 ca ying 0.55-kb EcoRI-SphI agmen o he pssC p omo e egion [45]
pO66 pMP220 ca ying 0.65-kb BglII-Ps I agmen o he pssO p omo e egion [45]
pN76 pMP220 ca ying 0.75-kb BglII-Ps I agmen o he pssN p omo e egion [45]
pT80 pMP220 ca ying 0.8-kb BglII-Ps I agmen o he pssT p omo e egion [45]
pP85 pMP220 ca ying 0.85-kb EcoRI-XbaI agmen o he pssP p omo e egion [45]
pI90 pMP220 ca ying 0.9-kb EcoRI-SphI agmen o he pssI p omo e egion [45]
pPA2 pMP220 ca ying 0.9-kb EcoRI-XbaI agmen o he pssA p omo e egion [32]
pEP1 pMP220 ca ying 0.65-bp EcoRI-Ps I agmen o he osR p omo e egion [101]
pDGRP pFUS1P ca ying mcpD-gusA usion [103]
pCGR pFUS1P ca ying mcpC-gusA usion [103]
P ime s Sequence (50→30)
pssAG1 CGCACATGCGAAAGATTTGCTGCG [104]
pssA2 CCAGATCGAGGAATTCCCGACGTA [104]
pssY5 GTCGTCGATGACGATGCGGCTGTT [104]
pssY5 GAAACTATGTGCTTCCCATGTCATCG [104]
Ri - i ampicin, Nx - nalidixic acid, Sp - spec inomycin, Tc - e acycline, Km – kanamycin.

In . J. Mol. Sci. 2019,20, 2905 17 o 27
R. leguminosa um s ains we e cul u ed in a 79CA medium wi h 1% glyce ol (w/ ) as a ca bon
sou ce a 28
◦
C on a o a y shake (200 pm) [
105
], whe eas E. coli s ains we e g own in Lu ia-Be ani
(LB) medium a 37
◦
C [
106
]. When equi ed, an ibio ics we e used a he ollowing inal concen a ions:
spec inomycin, 40
µ
g mL
−1
; i ampicin, 40
µ
g mL
−1
; nalidixic acid, 40
µ
g mL
−1
; e acycline, 10
µ
g
mL
−1
; kanamycin, 40
µ
g mL
−1
( o hizobial s ains, 40
µ
g mL
−1
o aga pla es and 20
µ
g mL
−1
o cul u es we e used). To de e mine he g ow h kine ics o R 24.2, he R 297, R 297(pPL1), and
R 24.2(pPL1) s ains a di e en empe a u es, bac e ial cul u es in 79CA o an ini ial op ical densi y
(OD
600
)=0.1 we e p epa ed. In he case o R 297(pPL1) and R 24.2(pPL1) s ains, kanamycin was
added. The cul u es we e incuba ed a 16, 20, 24, 28, and 32
◦
C o 72 h wi h shaking a 200 pm. A e
each 24 h, cul u e OD
600
was measu ed, and hen 100-
µ
L aliquo s we e aken and placed in se ial
dilu ions on o 79CA aga pla es. The bac e ial colonies (colony- o ming uni s, CFU) appea ing a e
3-day incuba ion a 28
◦
C we e coun ed. The expe imen was epea ed wice wi h h ee biological
eplica es o each s ain and condi ion es ed.
G ow h kine ics in he p esence o di e en suga s was s udied using bac e ial cul u es in 79CA
o he ini ial OD
600
=0.1, which we e incuba ed o 48 h a 28
◦
C. A e 24 and 48 h, cul u e OD
600
was
measu ed and hen 100-
µ
L aliquo s we e placed in se ial dilu ions on 79CA aga pla es, and a e 72-h
incuba ion, CFU was coun ed. The expe imen was ca ied ou wice wi h h ee biological eplica es
o each s ain and condi ion es ed.
4.2. Isola ion o To al RNA and Syn hesis o cDNA Lib a ies
The isola ion o o al RNA om R. leguminosa um s ains was pe o med acco ding o a me hod
desc ibed ea lie [
58
]. B ie ly, 25-mL cul u es o R 24.2 and R 297 g own o 24 h in 79CA we e
cen i uged (12,000
×
g, 15 min) and bac e ial pelle s ob ained we e suspended in 15 mL T izol, shaken
igo ously, and incuba ed o 5 min a oom empe a u e. Then, 3 mL o chlo o o m was added o
each mix u e, shaken igo ously (15 s), incuba ed a oom empe a u e (8 min), and subsequen ly
cen i uged (12,000
×
g, 15 min, 4
◦
C). RNA p esen in a wa e phase was p ecipi a ed using isop opanol
(2:1, / ) by incuba ion a oom empe a u e (15 min) and cen i uga ion (12,000
×
g, 15 min, 4
◦
C).
RNA pelle s we e washed wice wi h 1 mL 75% e hanol, d ied, and dissol ed in deionized RNase- and
DNase- ee wa e (10 min, 55
◦
C). The RNA concen a ion and quali y in samples we e de e mined
spec opho ome ically using NanoD op 2000 (The mo Fishe Scien i ic, Wal ham, MA, USA). DNA
aces om RNA we e emo ed using a TURBO DNA- ee Ki (The mo Fishe Scien i ic) acco ding o
a manu ac u e ’s ins uc ion. Possible con amina ion o RNA by DNA was checked using PCR and
p ime s complemen a y o R. leguminosa um pssY (pssY5 and pssY5 ) and pssA (pssAG1 and pssA2 )
genes (Table 1). Fo PCR, a REDTaq Ready PCR Reac ion Mix (Sigma-Ald ich, S . Louis, MO, USA)
was used. RNA om o al RNA was emo ed using a Ribo-Ze o Magne ic Ki o G am-Nega i e
bac e ia (Epicen e, Illumina, San Diego, CA, USA). RNA-deple ed mRNA was p ecipi a ed using
ice-cold e hanol (3:1, / ). Fo his pu pose, he samples we e incuba ed o 60 min a
−
20
◦
C, and
nex cen i uged (12,000
×
g, 30 min, 4
◦
C). Pelle s we e washed wice using ice-cold 75% e hanol,
cen i uged (12,000
×
g, 5 min), and dissol ed in RNase- and DNase- ee wa e . The mRNA ob ained
was quan i ied spec opho ome ically and i s in eg i y was assessed using an RNA 6000 Pico Ki and
Agilen Bioanalyze 2100 (Agilen Technologies, San a Cla a, CA, USA). Th ee independen mRNA
isola ions (i.e., biological epea s) we e done o each s ain. T ansc ip ome lib a ies we e p epa ed
using a NEBNex Ul a Di ec ional RNA Lib a y P ep Ki o Illumina (New England, BioLabs, Hi chin,
UK) ollowing he manu ac u e ’s p o ocol.
4.3. RNA-Seq Da a Analysis
Fo ansc ip omic analyses, cDNA lib a ies ob ained o R 24.2 and R 297 we e sequenced using a
MiSeq Sys em wi h SBS echnology (Illumina), wi h h ee independen biological eplica es pe o med
o each s ain. P elimina y p epa a ion o eads o analysis, including he elimina ion o adap e s and
low-quali y eads, we e done using T immo a ic so wa e (ope a ing mode o pai ed-end) (Illumina,
In . J. Mol. Sci. 2019,20, 2905 18 o 27
Ph ed+33) [
107
]. The emaining eads o bo h R 24.2 and R 297 s ains we e hen mapped using
Bow ie2 (wi hin he Topha package) [
108
] and R 24.2 genome as a e e ence genome [
58
]. The
median ead numbe pe CDS was abo e 1,000 (log alue >3). Nex , numbe s o eads mapped o
indi idual genes we e calcula ed using HTseq p og amme [
109
]. Final esul s we e analyzed in he
R en i onmen using he DEseq2 package [
110
,
111
]. On a e age, 14,885,607 eads o he wild- ype
s ain (K1 =15,927,160; K2 =14,848,310; K3 =13,881,353; SD =835,613.51) and 14,667,946 eads o
he pssZ mu an (J1 =14,835,882; J2 =16,189,714; J3 =12,978,242; SD =1,316,444.701) we e ob ained,
indica ing ha simila amoun s o da a we e mapped o each s ain s udied.
Fo he iden i ica ion o genes o s a is ically signi ican di e ences in exp ession be ween he
R 24.2 and R 297 s ains, he signi icance h eshold alue was se o 0.05 (using he Benjamini-Hochbe g
False Disco e y Ra e (FDR) co ec ion; Wald es ) [
108
,
112
]. CDS wi h FDR-co ec ed p alues o
di e en exp essions be ween he es ed s ains lowe han 0.05 we e conside ed signi ican . A lis o
genes di e en ially exp essed wi h old changes in he wild ype e sus he pssZ mu an was ob ained,
and he no malized exp ession was p esen ed as he numbe o eads o an indi idual gene no malized
pe a o al lib a y size o a pa icula sample. To classi y genes di e en ially exp essed in o unc ional
ca ego ies, Clus e s o O hologous G oups (COG) da abase was used [113].
4.4. Analysis o T ansc ip ional Fusions
T ansc ip ional usion plasmids con aining p omo e egions o hizobial genes cloned ups eam
o epo e lacZ o gusA genes (Table 1) we e ans e ed om E. coli S17-1 o R 24.2 and R 297 s ains
by bi-pa en al conjuga ion. Fo his pu pose, 24-h cul u es o E. coli S17-1 de i a i es ca ying usion
plasmids (dono s ains) and R 24.2 and R 297 ( ecipien s ains) we e mixed in a 1:10 a io ( / ) and
cen i uged (6000
×
g, 10 min). Nex , bac e ial pelle s we e washed wice in 1 mL o s e ilized wa e and
he ob ained mix u es we e cen i uged. Finally, he pelle s we e suspended in 0.2 mL o wa e , placed
on 79CA aga pla es, and incuba ed o 48 h a 28
◦
C. Then, he bac e ia we e collec ed om he pla es o 1
mL o s e ilized wa e and sp ead in 0.1-mL aliquo s on 79CA aga pla es supplemen ed wi h i ampicin
and e acycline. T ansconjugan s ob ained a e a 7-day incuba ion we e used o he de e mina ion o
he ansc ip ional ac i i y o he es ed p omo e s.
β
-galac osidase/
β
-glucu onidase ac i i y assay was
ca ied ou acco ding o Mille ’s p o ocol [
114
] using 2-ni ophenyl-
β
-D-galac opy anoside (ONPG)
o p-ni ophenyl-
β
-D-glucu onide (NPG) as a subs a e o
β
-galac osidase and
β
-glucu onidase,
espec i ely (Sigma-Ald ich). Fo his assay, 24-h cul u es o R 24.2 and R 297 de i a i es con aining
ansc ip ional usions we e used. R 24.2 and R 297 s ains con aining emp y pMP220 and pFUS1P
ec o s we e used as a con ol. To a oid he in luence o EPS on cul u e op ical densi y, he cul u es
we e cen i uged be o e being used o he assay (6000
×
g, 10 min). Bac e ial pelle s we e suspended in
a bu e Z [
114
] and he OD
600
o suspensions we e measu ed. Nex , 20
µ
L chlo o o m and 20
µ
L 0.1%
SDS (w/ ) we e added o 1 mL o bac e ial suspensions ( ). Samples we e shaken o bac e ial lysis and
e apo a ion o chlo o o m (20 min). A o al o 200
µ
L o ONPG o NPG (4 g L
−1
in bu e Z) was added
and he samples we e incuba ed o 5 min ( ) a 37
◦
C. The eac ion was s opped by adding 500
µ
L o
1 M Na
2
CO
3
. Nex , he samples we e cen i uged (10,000
×
g, 7 min) and hei 300-
µ
L aliquo s we e
added o i a ion pla e wells, and he OD
420
was measu ed (Asys UVM 340, Bioch om, Camb idge,
UK). The assay was done in iplica e o each s ain es ed wi h h ee biological epe i ions. The
ac i i y o
β
-galac osidase/
β
-glucu onidase was calcula ed acco ding o he ollowing o mula and
p esen ed as Mille uni s:
β-galac osidase/β-glucu onidase ac i i y (Mille uni s) =(1000×OD420)/( ×ν×OD600)
In . J. Mol. Sci. 2019,20, 2905 19 o 27
4.5. Isola ion o Su ace Polysaccha ides
4.5.1. EPS
Fo EPS isola ion, 5-mL cul u es o he R 24.2, R 297, R 297(pPL1), and R 24.2(pPL1) s ains
we e g own in 79CA o 72 h. A e his ime, OD
600
o each cul u e was measu ed and i s 1.5-mL
aliquo s we e cen i uged (12,000
×
g, 15 min). EPS was p ecipi a ed om he cul u e supe na an
a 4
◦
C o e nigh using cold 95% e hanol (a 1:4 a io o HMW and a 1:10 a io ( / ) o LMW EPS,
espec i ely). Nex , he samples we e cen i uged (12,000
×
g, 20 min), and he EPS ob ained was d ied,
suspended in deionized mili-Q wa e , and analyzed using an indole-sulphu ic acid me hod [
115
]. The
o al suga con en was calcula ed as glucose equi alen s. The expe imen was ca ied ou wice wi h
h ee eplica es o each s ain.
4.5.2. Gel-Fo ming Polysaccha ide
The bac e ial pelle ob ained om 100 mL o a 5-day cul u e was suspended in 20 mL o deionized
wa e . Nex , 20 mL o 2N NaOH was added o he bac e ial suspension and mixed o 1.5 h a oom
empe a u e. Bac e ial cells we e emo ed by cen i uga ion (8000
×
g, 30 min, 4
◦
C) and he supe na an
was acidi ied by addi ion o ace ic acid. P ecipi a ed GPS was collec ed by cen i uga ion, d ied,
dissol ed in deionized mili-Q wa e , and analyzed acco ding o Re e ence [
115
]. The expe imen was
done wice wi h h ee eplica es o each s ain.
4.5.3. Capsula Polysaccha ide
This PS was isola ed om he bac e ial pelle ob ained om 100 mL o 5-day cul u es. The pelle
was suspended in 20 mL o 1N NaOH and he mix u e was agi a ed o 1.5 h a oom empe a u e. CPS
was p ecipi a ed by he addi ion o cold 95% e hanol (1:1, / ), and collec ed by cen i uga ion (8000
×
g, 30 min, 4
◦
C). Nex , CPS was d ied, dissol ed in deionized mili-Q wa e , and analyzed acco ding
o [115]. The expe imen was pe o med wice wi h h ee eplica es o each s ain es ed.
4.5.4. Cyclic β-Glucans
Fo isola ion o cyclic
β
-glucans, supe na an s emaining om CPS isola ion (which con ained
50% e hanol) was used. The glucose concen a ion in he supe na an s was de e mined acco ding o
Re e ence [115]. The expe imen was pe o med wice wi h h ee eplica es o each s ain es ed.
4.5.5. Glucomannan
The isola ion o NP was pe o med acco ding o a me hod desc ibed in Re e ence [
21
]. B ie ly,
he bac e ial pelle ob ained om 1 L o a 5-day cul u e (79CA medium) was ex ac ed by he ho
phenol-wa e me hod wi h se e al modi ica ions [
116
]. The ob ained wa e phase was hen dialyzed
agains wa e using a dialysis ube (12-14 kDa) and lyophilized. The ma e ial was hen suspended in a
binding bu e (100 mM NH
4
HCO
3
, pH 8.0 and 0.9% NaCl) and applied o a polymyxin B column
in a a io o 30 mL o ma e ial pe 10 mL o bed (incuba ion o e nigh o bind LPS). Glucomannan
(NP) was hen elu ed om he column using he binding bu e (a a a e o 5 mL pe h), dialyzed and
lyophilized. The expe imen was pe o med wice wi h wo eplica es o each s ain. The glucose
concen a ion in he supe na an s was de e mined acco ding o Re e ence [115].
4.5.6. De e mina ion o PS Amoun s Syn hesized by Rhizobial S ains
The amoun s o p oduced PSs we e de e mined using an indole-sulphu ic acid me hod [
115
]. Fo
his assay, 20-
µ
L aliquo s o PS solu ions we e added o 500
µ
L o 75% H
2
SO
4
and 20
µ
L o 1% indole
dissol ed in 95% e hanol (w/ ). Samples we e incuba ed o 15 min a 100
◦
C, and 100-
µ
L aliquo s
we e added o i a ion pla e wells, and hei op ical densi y (OD
470
) was measu ed. The assay was
In . J. Mol. Sci. 2019,20, 2905 20 o 27
pe o med in iplica e o each sample analyzed. The esul s o he expe imen we e calcula ed using
a cu e done o glucose, whose unc ion ac o was de e mined on 0.0023.
4.6. S a is ical Analysis
S a is ical da a analyses we e pe o med using one-way analysis o a iance (ANOVA) (S a is ica,
e .12, S a So , C aco , Poland), and signi ican di e ences be ween he analyzed samples we e
es ablished a p<0.05.
5. Conclusions
Rhizobium leguminosa um b . i olii is a soil bac e ium able o es ablish ni ogen- ixing symbiosis
wi h clo e plan s (T i olium spp.). Compa a i e ansc ip omic analyses o he R. leguminosa um b .
i olii wild- ype s ain R 24.2 and i s de i a i e R 297, ca ying a mu a ion in he pssZ gene, allowed us
o iden i y a la ge g oup o genes di e en ially exp essed in hese wo gene ic backg ounds. Ou da a
con i med he signi icance o PssZ in se e al cellula p ocesses, including he syn hesis o cell-su ace
polysaccha ides, ansc ip ion egula ion, cell signalling, and bac e ial me abolism. This ac indica ed
ha his pu a i e se ine- h eonine phospha ase plays an impo an ole in egula o y ne wo ks o R.
leguminosa um, ha a e impo an o bo h symbio ic and ee-li ing condi ions. To ou knowledge,
his is he i s s udy epo ing he in ol emen o an STP p o ein in he exp ession o genes ela ed o
EPS p oduc ion in a hizobial s ain.
Supplemen a y Ma e ials:
Supplemen a y ma e ials can be ound a h p://www.mdpi.com/1422-0067/20/12/
2905/s1.
Au ho Con ibu ions:
Concep ualiza ion, M.J. and P.L.; me hodology, M.J. and P.L.; so wa e, P.L.; alida ion,
M.J., P.L. and J.-M.V.; o mal analysis, P.L. and M.J.; in es iga ion, P.L. and M.J.; esou ces, M.J. and P.L.; da a
cu a ion, P.L. and M.J.; w i ing—o iginal d a p epa a ion, M.J., P.L. and J.-M.V.; w i ing— e iew and edi ing,
M.J. and J.-M.V.; isualiza ion, P.L.; supe ision, M.J.; p ojec adminis a ion, M.J.; unding acquisi ion, M.J.
Funding: This esea ch ecei ed no ex e nal unding.
Acknowledgmen s:
We hank C. Yos om he Uni e si y o Regina (Canada) o p o iding ansc ip ional
usion plasmids o mo ili y genes. We also hank T. U banik-Sypniewska o me i help in isola ion o he
neu al polysaccha ide.
Con lic s o In e es : The au ho s decla e no con lic o in e es .
Abb e ia ions
EPS exopolysaccha ide
LPS lipopolysaccha ide
PS polysaccha ide
LMW low-molecula -weigh
HMW High-molecula -weigh
CPS capsula polysaccha ide
NP neu al polysaccha ide
GPS gel- o ming polysaccha ide
CG cyclic β-glucan
IT in ec ion h ead
STP se ine/ h eonine p o ein phospha ases
STK Hanks- ype se ine/ h eonine kinase
DEG di e en ially exp essed gene
COG clus e o o hologous g oup
Re e ences
1.
Raynaud, X.; Nunan, N. Spa ial ecology o bac e ia a he mic oscale in soil. PLoS ONE
2014
,9, e8721.
[C ossRe ] [PubMed]
In . J. Mol. Sci. 2019,20, 2905 21 o 27
2.
Jim
é
nez-Gue e o, I.; Acos a-Ju ado, S.; Del Ce o, P.; Na a o-G
ó
mez, P.; L
ó
pez-Baena, F.J.; Olle o, F.J.;
Vina dell, J.M.; P
é
ez-Mon año, F. T ansc ip omic S udies o he E ec o nod Gene-Inducing Molecules in
Rhizobia: Di e en Weapons, One Pu pose. Genes 2018,9, 1. [C ossRe ] [PubMed]
3.
Jancza ek, M.; Rachwał, K.; Ma zec, A.; G z ˛adziel, J.; Palusi´nska-Szysz, M. Signal molecules and cell-su ace
componen s in ol ed in ea ly s ages o he legume- hizobium in e ac ions. Appl. Soil Ecol.
2015
,85, 94–113.
[C ossRe ]
4.
S
á
nchez-Cañiza es, C.; Jo
í
n, B.; Du
á
n, D.; Nadendla, S.; Alba eda, M.; Rubio-Sanz, L.; Lanza, M.;
Gonz
á
lez-Gue e o, M.; P ie o, R.I.; B i o, B.; e al. Genomic Di e si y in he Endosymbio ic Bac e ium
Rhizobium leguminosa um.Genes 2018,9, 60. [C ossRe ] [PubMed]
5.
Young, J.P.; C ossman, L.C.; Johns on, A.W.; Thomson, N.R.; Ghazoui, Z.F.; Hull, K.H.; Wexle , M.;
Cu son, A.R.; Todd, J.D.; Poole, P.S.; e al. The genome o Rhizobium leguminosa um has ecognizable co e and
accesso y componen s. Genome Biol. 2006,7, R34. [C ossRe ] [PubMed]
6.
Zah an, H.H. Rhizobium-legume symbiosis and ni ogen ixa ion unde se e e condi ions and in an a id
clima e. Mic obiol. Mol. Biol. Re . 1999,63, 968–989. [PubMed]
7.
G aham, P.H.; Vance, C.P. Ni ogen ixa ion in pe spec i e: An o e iew o esea ch an ex ension needs.
Field C ops Res. 2000,65, 93–106. [C ossRe ]
8.
San i, C.; Bogusz, D.; F anche, C. Biological ni ogen ixa ion in non-legume plan s. Ann. Bo .
2013
,111,
743–767. [C ossRe ]
9.
Downie, J.A. The oles o ex acellula p o eins, polysaccha ides and signals in he in e ac ions o hizobia
wi h legume oo s. FEMS Mic obiol. Re . 2010,34, 150–170. [C ossRe ]
10.
Wang, Q.; Liu, J.; Zhu, H. Gene ic and Molecula Mechanisms Unde lying Symbio ic Speci ici y in
Legume-Rhizobium In e ac ions. F on . Plan Sci. 2018,9, 313. [C ossRe ]
11.
L
ó
pez-Baena, F.J.; Ruiz-Sainz, J.E.; Rod
í
guez-Ca ajal, M.A.; Vina dell, J.M. Bac e ial molecula signals in
he Sino hizobium edii-soybean symbiosis. In . J. Mol. Sci. 2016,17, 755. [C ossRe ] [PubMed]
12.
Kawaha ada, Y.; Kelly, S.; Nielsen, M.W.; Hjule , C.T.; Gysel, K.; Muszy´nski, A.; Ca lson, R.W.; Thygesen, M.B.;
Sandal, N.; Asmussen, M.H.; e al. Recep o -media ed exopolysaccha ide pe cep ion con ols bac e ial
in ec ion. Na u e 2015,523, 308–312. [C ossRe ] [PubMed]
13.
Muszy´nski, A.; Heiss, C.; Hjule , C.T.; Sulli an, J.T.; Kelly, S.J.; Thygesen, M.B.; S ougaa d, J.; Azadi, P.;
Ca lson, R.W.; Ronson, C.W. S uc u es o Exopolysaccha ides In ol ed in Recep o -media ed Pe cep ion o
Meso hizobium lo i by Lo us japonicus.J. Biol. Chem. 2016,291, 20946–20961. [C ossRe ] [PubMed]
14.
Suzuki, N.; Ri e o, R.M.; Shulae , V.; Blumwald, E.; Mi le , R. Abio ic and bio ic s ess combina ions. New
Phy ol. 2014,203, 32–43. [C ossRe ] [PubMed]
15.
Ba helemy-Delaux, C.; Ma bu ge , D.; Delaux, P.; Conley, S.; An
é
, J. E ec o d ough on B ady hizobium
japonicum popula ions in Midwes soils. Plan Soil 2014,382, 165–173. [C ossRe ]
16.
Jaszek, M.; Jancza ek, M.; Kuczy´nski, K.; Pie siak, T.; G zywnowicz, K. The esponse o he Rhizobium
leguminosa um b . i olii wild- ype and exopolysaccha ide-de icien mu an s o oxida i e s ess. Plan Soil
2014,376, 75–94. [C ossRe ]
17.
L
ó
pez-Leal, G.; Tabche, M.L.; Cas illo-Ram
í
ez, S.; Mendoza-Va gas, A.; Ram
í
ez-Rome o, M.A.; D
á
ila, G.
RNA-Seq analysis o he mul ipa i e genome o Rhizobium e li CE3 shows di e en eplicon con ibu ions
unde hea and saline shock. BMC Genom. 2014,15, 1–15. [C ossRe ]
18.
Jancza ek, M.; Rachwał, K.; Cie´sla, J.; Ginalska, G.; Bieganowski, A. P oduc ion o exopolysaccha ide by
Rhizobium leguminosa um b . i olii and i s ole in bac e ial a achmen and su ace p ope ies. Plan Soil
2015,388, 211–227. [C ossRe ]
19.
Del Ce o, P.; P
é
ez-Mon año, F.; Gil-Se ano, A.; L
ó
pez-Baena, F.J.; Meg
í
as, M.; Hung ia, M.; Olle o, F.J. The
Rhizobium opici CIAT 899 NodD2 p o ein egula es he p oduc ion o Nod ac o s unde sal s ess in a
la onoid-independen manne . Sci. Rep. 2017,7, 46712. [C ossRe ]
20.
Kopyci´nska, M.; Lipa, P.; Cie´sla, J.; Kozieł, M.; Jancza ek, M. Ex acellula polysaccha ide p o ec s Rhizobium
leguminosa um cells agains zinc s ess
in i o
and du ing symbiosis wi h clo e . En i on. Mic obiol. Rep.
2018,10, 355–368. [C ossRe ]
21.
Laus, M.C.; Logman, T.J.; Lame s, G.E.; Van B ussel, A.A.; Ca lson, R.W.; Kijne, J.W. A no el pola su ace
polysaccha ide om Rhizobium leguminosa um binds hos plan lec in. Mol. Mic obiol.
2006
,59, 1704–1713.
[C ossRe ] [PubMed]

In . J. Mol. Sci. 2019,20, 2905 22 o 27
22.
Bogino, P.C.; Oli a, M.D.; So oche, F.G.; Gio dano, W. The ole o bac e ial bio ilms and su ace componen s
in plan -bac e ial associa ions. In . J. Mol. Sci. 2013,14, 15838–15859. [C ossRe ] [PubMed]
23.
Williams, A.; Wilkinson, A.; K ehenb ink, M.; Russo, D.M.; Zo eguie a, A.; Downie, J.A.
Glucomannan-media ed a achmen o Rhizobium leguminosa um o pea oo hai s is equi ed o compe i i e
nodule in ec ion. J. Bac e iol. 2008,190, 4706–4715. [C ossRe ] [PubMed]
24.
Russo, D.M.; Abdian, P.L.; Posadas, D.M.; Williams, A.; Vozza, N.; Gio dano, W.; Kannenbe g, E.; Downie, J.A.;
Zo eguie a, A. Lipopolysaccha ide O-chain co e egion equi ed o cellula cohesion and compac ion
o
in i o
and oo bio ilms de eloped by Rhizobium leguminosa um.Appl. En i on. Mic obiol.
2015
,81,
1013–1023. [C ossRe ] [PubMed]
25.
So oche, F.G.; Spesia, M.B.; Zo eguie a, A.; Gio dano, W. A posi i e co ela ion be ween bac e ial
au oagg ega ion and bio ilm o ma ion in na i e Sino hizobium melilo i isola es om A gen ina. Appl. En i on.
Mic obiol. 2012,78, 4092–4101. [C ossRe ] [PubMed]
26.
Rinaudi, L.V.; Gio dano, W. An in eg a ed iew o bio ilm o ma ion in hizobia. FEMS Mic obiol. Le .
2010
,
304, 1–11. [C ossRe ] [PubMed]
27.
Cheng, H.P.; Walke , G.C. Succinoglycan is equi ed o ini ia ion and elonga ion o in ec ion h eads du ing
nodula ion o al al a by Rhizobium melilo i.J. Bac e iol. 1998,180, 5183–5191.
28.
Ma ga e -Oli e , I.; Lei, W.; Pa ada, M.; Rod
í
guez-Ca ajal, M.A.; C espo-Ri as, J.C.; Hidalgo,
Á
.;
Gil-Se ano, A.; Mo eno, J.; Rod
í
guez-Na a o, D.N.; Buend
í
a-Cla e
í
a, A.; e al. Sino hizobium edii HH103
does no s ic ly equi e KPS and/o EPS o nodula e Glycy hiza u alensis, an inde e mina e nodule- o ming
legume. A ch. Mic obiol. 2012,194, 87–102. [C ossRe ]
29.
D’Haeze, W.; Glushka, J.; De Rycke, R.; Hols e s, M.; Ca lson, R.W. S uc u al cha ac e iza ion o ex acellula
polysaccha ides o Azo hizobium caulinodans and impo ance o nodule ini ia ion on Sesbania os a a.Mol.
Mic obiol. 2004,52, 485–500. [C ossRe ]
30.
Rod
í
guez-Na a o, D.N.; Rod
í
guez-Ca ajal, M.A.; Acos a-Ju ado, S.; So o, M.J.; Ma ga e , I.;
C espo-Ri as, J.C.; Sanjuan, J.; Temp ano, F.; Gil-Se ano, A.; Ruiz-Sainz, J.E.; e al. S uc u e and biological
oles o Sino hizobium edii HH103 exopolysaccha ide. PLoS ONE 2014,18, e115391. [C ossRe ]
31.
I ashina, T.V.; Khmelni sky, M.I.; Shlyapniko , M.G.; Kanapin, A.A.; Ksenzenko, V.N. The pss4 gene om
Rhizobium leguminosa um by iciae VF39: Cloning, sequence and he possible ole in polysaccha ide p oduc ion
and nodule o ma ion. Gene 1994,150, 111–116. [C ossRe ]
32.
Jancza ek, M.; U banik-Sypniewska, T. Exp ession o he Rhizobium leguminosa um b . i olii pssA gene,
in ol ed in exopolysaccha ide syn hesis, is egula ed by RosR, phospha e, and he ca bon sou ce. J. Bac e iol.
2013,195, 3412–3423. [C ossRe ] [PubMed]
33.
Van Wo kum, W.A.T.; an Slage en, S.; an B ussel, A.A.N.; Kijne, J.W. Role o exopolysaccha ides o
Rhizobium leguminosa um b . iciae as hos plan -speci ic molecules equi ed o in ec ion h ead o ma ion
du ing nodula ion o Vicia sa i a.Mol. Plan Mic obe In e ac . 1998,11, 1233–1241. [C ossRe ]
34.
Jancza ek, M. En i onmen al signals and egula o y pa hways ha in luence exopolysaccha ide p oduc ion
in hizobia. In . J. Mol. Sci. 2011,12, 7898–7933. [C ossRe ] [PubMed]
35.
Ma czak, M.; Mazu , A.; Kope , P.; ˙
Zeb acki, K.; Sko upska, A. Syn hesis o hizobial exopolysaccha ides and
hei impo ance o symbiosis wi h legume plan s. Genes 2017,8, 360. [C ossRe ] [PubMed]
36.
Robe sen, B.K.; Aman, P.; Da ill, A.G.; McNeil, M.; Albe sheim, P. Hos -Symbion In e ac ions: V. The
s uc u e o acidic ex acellula polysaccha ides sec e ed by Rhizobium leguminosa um and Rhizobium i olii.
Plan Physiol. 1981,67, 389–400. [C ossRe ] [PubMed]
37.
Can e C eme s, H.C.J.; S e ens, K.; Lug enbe g, B.J.J.; Wij elman, C.A.; Ba ley, M.; Redmond, J.W.;
B eed eld, M.; Ze enhuizen, L.P.T.M. Unusual s uc u e o he exopolysaccha ide o Rhizobium leguminosa um
bio a iciae s ain 248. Ca bohyd . Res. 1991,218, 185–200. [C ossRe ]
38.
O’Neill, M.A.; Da ill, A.G.; Albe sheim, P. The deg ee o es e i ica ion and poin s o subs i u ion by
O-ace yl and O-(3-hyd oxybu anoyl) g oups in he acidic ex acellula polysaccha ides sec e ed by Rhizobium
leguminosa um bio a s iciae, i olii, and phaseoli a e no ela ed o hos ange. J. Biol. Chem.
1991
,266,
9549–9555.
39.
Philip-Hollingswo h, S.; Hollingswo h, R.I.; Dazzo, F.B.; Djo dje ic, M.A.; Rol e, B.G. The e ec o
in e species ans e o Rhizobium hos -speci ic nodula ion genes on acidic polysaccha ide s uc u e and in
si u binding by hos lec in. J. Biol. Chem. 1989,264, 5710–5714.
In . J. Mol. Sci. 2019,20, 2905 23 o 27
40.
B eed eld, M.W.; C eme s, H.C.; Ba ley, M.; Pos humus, M.A.; Ze enhuizen, L.P.; Wij elman, C.A.;
Zehnde , A.J. Polysaccha ide syn hesis in ela ion o nodula ion beha io o Rhizobium leguminosa um.J.
Bac e iol. 1993,175, 750–757. [C ossRe ]
41.
Van Wo kum, W.A.; Can e C eme s, H.C.; Wij jes, A.H.; an de Kolk, C.; Wij elman, C.A.; Kijne, J.W. Cloning
and cha ac e iza ion o ou genes o Rhizobium leguminosa um b . i olii in ol ed in exopolysaccha ide
p oduc ion and nodula ion. Mol. Plan Mic obe In e ac . 1997,10, 290–301. [C ossRe ] [PubMed]
42.
Pollock, T.J.; an Wo kum, W.A.; Tho ne, L.; Mikolajczak, M.J.; Yamazaki, M.; Kijne, J.W.; A men ou , R.W.
Assignmen o biochemical unc ions o glycosyl ans e ase genes which a e essen ial o biosyn hesis o
exopolysaccha ides in Sphingomonas s ain S88 and Rhizobium leguminosa um.J. Bac e iol.
1998
,180, 586–593.
[PubMed]
43.
Jancza ek, M.; Rachwał, K. Mu a ion in he pssA gene in ol ed in exopolysaccha ide syn hesis leads o
se e al physiological and symbio ic de ec s in Rhizobium leguminosa um b . i olii.In . J. Mol. Sci. 2013,14,
23711–23735. [C ossRe ] [PubMed]
44.
I ashina, T.V.; Ksenzenko, V.N. Exopolysaccha ide biosyn hesis in Rhizobium leguminosa um om genes o
unc ions. In The Complex Wo ld o Polysaccha ides; Ka una a ne, D.N., Ed.; InTech: Rijeka, C oa ia, 2012;
pp. 99–127. ISBN 978-953-51-0819-1.
45.
Jancza ek, M.; Rachwał, K.; Kopci´nska, J. Gene ic cha ac e iza ion o he Pss egion and he ole o PssS in
exopolysaccha ide p oduc ion and symbiosis o Rhizobium leguminosa um b . i olii wi h clo e . Plan Soil
2015,396, 257–275. [C ossRe ]
46.
I ashina, T.V.; Fedo o a, E.E.; Ashina, N.P.; Kalinchuk, N.A.; D uzhinina, T.N.; Shashko , A.S.; Shibae , V.N.;
Ksenzenko, V.N. Mu a ion in he pssM gene encoding ke al py u a e ans e ase leads o dis up ion o
Rhizobium leguminosa um b . iciae-Pisum sa i um symbiosis. J. Appl. Mic obiol.
2010
,109, 731–742. [C ossRe ]
[PubMed]
47.
Mazu , A.; Ma czak, M.; K
ó
l, J.E.; Sko upska, A. Topological and ansc ip ional analysis o pssL gene
p oduc : A pu a i e Wzx-like exopolysaccha ide anslocase in Rhizobium leguminosa um b . i olii TA1.
A ch. Mic obiol. 2005,184, 1–10. [C ossRe ] [PubMed]
48.
Mazu , A.; K
ó
l, J.E.; Ma czak, M.; Sko upska, A. Memb ane opology o PssT, he ansmemb ane p o ein
componen o he ype I exopolysaccha ide anspo sys em in Rhizobium leguminosa um b . i olii s ain
TA1. J. Bac e iol. 2003,185, 2503–2511. [C ossRe ]
49.
Ma czak, M.; D´zwie zy´nska, M.; Sko upska, A. Homo- and he e o ypic in e ac ions be ween Pss p o eins
in ol ed in he exopolysaccha ide anspo sys em in Rhizobium leguminosa um b . i olii.Biol. Chem.
2013
,
394, 541–559. [C ossRe ]
50.
Ma czak, M.; Ma ysiak, P.; Ku kowska, J.; Sko upska, A. PssP2 is a polysaccha ide co-polyme ase in ol ed
in exopolysaccha ide chain-leng h de e mina ion in Rhizobium leguminosa um.PLoS ONE
2014
,9, e109106.
[C ossRe ]
51.
Sadyko , M.R.; I ashina, T.V.; Kanapin, A.A.; Shliapniko , M.G.; Ksenzenko, V.N. S uc u e- unc ional
o ganiza ion o exopolysaccha ide biosyn he ic genes in Rhizobium leguminosa um b . iciae VF39. Mol. Biol.
1998,32, 797–804.
52.
K
ó
l, J.E.; Mazu , A.; Ma czak, M.; Sko upska, A. Syn enic a angemen s o he su ace polysaccha ide
biosyn hesis genes in Rhizobium leguminosa um.Genomics 2007,89, 237–247. [C ossRe ] [PubMed]
53.
Jancza ek, M.; Rachwał, K.; Tu ska-Szewczuk, A. A mu a ion in pssE a ec s exopolysaccha ide syn hesis by
Rhizobium leguminosa um b . i olii, i s su ace p ope ies, and symbiosis wi h clo e . Plan Soil
2017
,417,
331–347. [C ossRe ]
54.
Bo haku , D.; Johns on, A.W. Sequence o psi, a gene on he symbio ic plasmid o Rhizobium phaseoli which
inhibi s exopolysaccha ide syn hesis and nodula ion and demons a ion ha i s ansc ip ion is inhibi ed by
ps , ano he gene on he symbio ic plasmid. Mol. Gen. Gene . 1987,207, 149–154. [C ossRe ] [PubMed]
55.
Bo haku , D.; Ba ke , R.F.; La ch o d, J.W.; Rossen, L.; Johns on, A.W. Analysis o pss genes o Rhizobium
leguminosa um equi ed o exopolysaccha ide syn hesis and nodula ion o peas: Thei p ima y s uc u e
and hei in e ac ion wi h psi and o he nodula ion genes. Mol. Gen. Gene .
1988
,213, 155–162. [C ossRe ]
[PubMed]
56.
Ree e, W.G.; Dilwo h, M.J.; Tiwa i, R.P.; Glenn, A.R. Regula ion o exopolysaccha ide p oduc ion in
Rhizobium leguminosa um bio a iciae WSM710 in ol es exoR.Mic obiology
1997
,143, 1951–1958. [C ossRe ]
[PubMed]
In . J. Mol. Sci. 2019,20, 2905 24 o 27
57.
Jancza ek, M.; Sko upska, A. Modula ion o osR exp ession and exopolysaccha ide p oduc ion in Rhizobium
leguminosa um b . i olii by phospha e and clo e oo exuda es. In . J. Mol. Sci.
2011
,12, 4132–4155.
[C ossRe ] [PubMed]
58.
Rachwał, K.; Ma czy´nska, E.; Jancza ek, M. T ansc ip ome p o iling o a Rhizobium leguminosa um b . i olii
osR mu an e eals he ole o he ansc ip ional egula o RosR in mo ili y, syn hesis o cell-su ace
componen s, and o he cellula p ocesses. BMC Genomics 2015,16, 1111. [C ossRe ]
59.
Lipa, P.; Vina dell, J.M.; Kopci´nska, J.; Zdybicka-Ba abas, A.; Jancza ek, M. Mu a ion in he pssZ
Gene Nega i ely Impac s Exopolysaccha ide Syn hesis, Su ace P ope ies, and Symbiosis o Rhizobium
leguminosa um b . i olii wi h Clo e . Genes 2018,9, 369. [C ossRe ]
60.
Jancza ek, M.; Vina dell, J.M.; Lipa, P.; Ka a´s, M. Hanks-Type Se ine/Th eonine P o ein Kinases and
Phospha ases in Bac e ia: Roles in Signaling and Adap a ion o Va ious En i onmen s. In . J. Mol. Sci.
2018
,
19, 2872. [C ossRe ]
61.
De Vinney, R.; S eele-Mo ime , O.; Finlay, B.B. Phospha ases and kinases deli e ed o he hos cell by
bac e ial pa hogens. T ends Mic obiol. 2000,8, 29–33. [C ossRe ]
62.
Dwo kin, J. Se /Th phospho yla ion as a egula o y mechanism in bac e ia. Cu . Opin. Mic obiol.
2015
,24,
47–52. [C ossRe ] [PubMed]
63.
Mijako ic, I.; G angeasse, C.; Tu gay, K. Explo ing he di e si y o p o ein modi ica ions: Special bac e ial
phospho yla ion sys ems. FEMS Mic obiol. Re . 2016,40, 398–417. [C ossRe ] [PubMed]
64.
Rachwał, K.; Boguszewska, A.; Kopci´nska, J.; Ka as, M.; Tch
ó
zewski, M.; Jancza ek, M. The egula o y
p o ein RosR a ec s Rhizobium leguminosa um b . i olii p o ein p o iles, cell su ace p ope ies, and symbiosis
wi h clo e . F on . Mic obiol. 2016,7, 1302. [C ossRe ]
65.
Ta uso , R.L.; Na ale, D.A.; Ga ka se , I.V.; Ta uso a, T.A.; Shanka a am, U.T.; Rao, B.S.; Ki yu in, B.;
Galpe in, M.Y.; Fedo o a, N.D.; Koonin, E.V. The COG da abase: New de elopmen s in phylogene ic
classi ica ion o p o eins om comple e genomes. Nucl. Acids Res. 2001,29, 22–28. [C ossRe ]
66.
Schäpe , S.; K ol, E.; Sko nicka, D.; Kae e , V.; Hilke , R.; Søgaa d-Ande sen, L.; Becke , A. Cyclic Di-GMP
Regula es Mul iple Cellula Func ions in he Symbio ic Alphap o eobac e ium Sino hizobium melilo i.J.
Bac e iol. 2015,198, 521–535. [C ossRe ] [PubMed]
67.
Lee, V.T.; Ma ewish, J.M.; Kessle , J.L.; Hyodo, M.; Hayakawa, Y.; Lo y, S. A cyclic-di-GMP ecep o equi ed
o bac e ial exopolysaccha ide p oduc ion. Mol. Mic obiol. 2007,65, 1474–1484. [C ossRe ]
68.
Ba aque , C.; Mu akami, K.; Pa sek, M.R.; Ha wood, C.S. The FleQ p o ein om Pseudomonas ae uginosa
unc ions as bo h a ep esso and an ac i a o o con ol gene exp ession om he pel ope on p omo e in
esponse o c-di-GMP. Nucl. Acids Res. 2012,40, 7207–7218. [C ossRe ]
69.
Paul, K.; Nie o, V.; Ca lquis , W.C.; Blai , D.F.; Ha shey, R.M. The c-di-GMP binding p o ein YcgR con ols
lagella mo o di ec ion and speed o a ec chemo axis by a “backs op b ake” mechanism. Mol. Cell
2010
,
38, 128–139. [C ossRe ]
70.
Ross, P.; Weinhouse, H.; Aloni, Y.; Michaeli, D.; Weinbe ge -Ohana, P.; Maye , R.; B aun, S.; de V oom, E.;
an de Ma el, G.A.; an Boom, J.H.; e al. Regula ion o cellulose syn hesis in Ace obac e xylinum by cyclic
diguanylic acid. Na u e 1987,325, 279–281. [C ossRe ]
71.
Ryjenko , D.A.; Simm, R.; Römling, U.; Gomelsky, M. The PilZ domain is a ecep o o he second messenge
c-di-GMP: The PilZ domain p o ein YcgR con ols mo ili y in en e obac e ia. J. Biol. Chem.
2006
,281,
30310–30314. [C ossRe ]
72.
Libby, E.A.; Goss, L.A.; Dwo kin, J. The euka yo ic-like Se /Th kinase P kC egula es he essen ial WalRK
Two-Componen Sys em in Bacillus sub ilis.PLoS Gene . 2015,11, e1005275. [C ossRe ] [PubMed]
73.
B au igan, D.L. P o ein Se /Th phospha ases– he ugly ducklings o cell signalling. FEBS J.
2013
,280, 324–345.
[C ossRe ] [PubMed]
74.
Esse , D.; Ho mann, L.; Pham, T.K.; B äsen, C.; Qiu, W.; W igh , P.C.; Albe s, S.V.; Siebe s, B. P o ein
phospho yla ion and i s ole in a chaeal signal ansduc ion. FEMS Mic obiol. Re .
2016
,40, 625–647.
[C ossRe ] [PubMed]
75.
Muszy´nski, A.; Laus, M.; Kijne, J.W.; Ca lson, R.W. S uc u es o he lipopolysaccha ides om Rhizobium
leguminosa um RBL5523 and i s UDP-glucose dehyd ogenase mu an (exo5). Glycobiology
2011
,21, 55–68.
[C ossRe ] [PubMed]
In . J. Mol. Sci. 2019,20, 2905 25 o 27
76.
Acos a-Ju ado, S.; Na a o-G
ó
mez, P.; C espo-Ri as, J.C.; Medina, C.; Mu doch, P.S.; Cues a-Be io, L.;
Rod
í
guez-Ca ajal, M.A.; Ruiz-Sainz, J.E.; Vina dell, J.M. The Sino hizobium (Ensi e ) edii HH103 kp-2
egion is in ol ed in he biosyn hesis o lipopolysaccha ide and exopolysaccha ide bu no in K-an igen
polysaccha ide p oduc ion. Plan Soil 2017,417, 415–431. [C ossRe ]
77.
Kawaha ada, Y.; Kiyo a, H.; Eda, S.; Minamisawa, K.; Mi sui, H. S uc u al cha ac e iza ion o neu al and
anionic glucans om Meso hizobium lo i.Ca bohyd . Res. 2008,343, 2422–2427. [C ossRe ]
78.
Acos a-Ju ado, S.; Alias-Villegas, C.; Na a o-G
ó
mez, P.; Zehne , S.; Mu doch, P.D.; Rod
í
guez-Ca ajal, M.A.;
So o, M.J.; Olle o, F.J.; Ruiz-Sainz, J.E.; Gö e , M.; e al. The Sino hizobium edii HH103 MucR1 Global
Regula o Is Connec ed wi h he nod Regulon and Is Requi ed o E icien Symbiosis wi h Lo us bu ii and
Glycine max c . Williams. Mol. Plan Mic obe In e ac . 2016,29, 700–712. [C ossRe ]
79.
C espo-Ri as, J.C.; Ma ga e , I.; Hidalgo, A.; Buend
í
a-Cla e
í
a, A.M.; Olle o, F.J.; L
ó
pez-Baena, F.J.; del
Soco o Mu doch, P.; Rod
í
guez-Ca ajal, M.A.; So ia-D
í
az, M.E.; Regue a, M.; e al. Sino hizobium edii
HH103 cgs mu an s a e unable o nodula e de e mina e- and inde e mina e nodule- o ming legumes and
o e p oduce an al e ed EPS. Mol. Plan Mic obe In e ac . 2009,22, 575–588. [C ossRe ]
80.
Vande linde, E.M.; Yos , C.K. Mu a ion o he senso kinase ch G in Rhizobium leguminosa um nega i ely
impac s cellula me abolism, ou e memb ane s abili y, and symbiosis. J. Bac e iol.
2012
,194, 768–777.
[C ossRe ]
81.
P
é
ez-Mendoza, D.; Sanju
á
n, J. Exploi ing he commons: Cyclic diguanyla e egula ion o bac e ial
exopolysaccha ide p oduc ion. Cu . Opin. Mic obiol. 2016,30, 36–43. [C ossRe ]
82.
Tamayo, R.; Tischle , A.D.; Camilli, A. The EAL domain p o ein VieA is a cyclic diguanyla e phosphodies e ase.
J. Biol. Chem. 2005,280, 33324–33330. [C ossRe ] [PubMed]
83.
S i as a a, D.; Wa e s, C.M. A angled web: Regula o y connec ions be ween quo um sensing and cyclic
di-GMP. J. Bac e iol. 2012,194, 4485–4493. [C ossRe ] [PubMed]
84.
P ada-Ram
í
ez, H.A.; P
é
ez-Mendoza, D.; Felipe, A.; Ma
í
nez-G ane o, F.; Ri illa, R.; Sanju
á
n, J.;
Gallegos, M.T. Am Z egula es cellulose p oduc ion in Pseudomonas sy ingae p . oma o DC3000. Mol.
Mic obiol. 2016,99, 960–977. [C ossRe ] [PubMed]
85.
Ma, Q.; Zhang, G.; Wood, T.K. Esche ichia coli BdcA con ols bio ilm dispe sal in Pseudomonas ae uginosa and
Rhizobium melilo i.BMC Res. No es 2011,4, 447. [C ossRe ] [PubMed]
86.
Gao, S.; Romdhane, S.B.; Beullens, S.; Kae e , V.; Lamb ich s, I.; Fau a , M.; Michiels, J. Genomic analysis o
cyclic-di-GMP- ela ed genes in hizobial ype s ains and unc ional analysis in Rhizobium e li.Appl. Mic obiol.
Bio echnol. 2014,98, 4589–4602. [C ossRe ] [PubMed]
87.
P
é
ez-Mendoza, D.; Rod
í
guez-Ca ajal, M.
Á
.; Rome o-Jim
é
nez, L.; Fa ias Gde, A.; Llo e , J.; Gallegos, M.T.;
Sanjuán, J. No el mixed-linkage β-glucan ac i a ed by c-di-GMP in Sino hizobium melilo i.P oc. Na l. Acad.
Sci. USA 2015,112, E757–E765. [C ossRe ]
88.
P
é
ez-Mendoza, D.; Be ine i, D.; Lo enz, R.; Gallegos, M.T.; He be g, F.W.; Sanju
á
n, J. A no el c-di-GMP
binding domain in glycosyl ans e ase BgsA is esponsible o he syn hesis o a mixed-linkage
β
-glucan.
Sci. Rep. 2017,7, 8997. [C ossRe ]
89.
Alexand e, A.; La anjo, M.; Oli ei a, S. Global ansc ip ional esponse o hea shock o he legume symbion
Meso hizobium lo i MAFF303099 comp ises ex ensi e gene down egula ion. DNA Res.
2014
,21, 195–206.
[C ossRe ]
90.
Gomes, D.F.; Ba is a, J.S.; Schia on, A.L.; And ade, D.S.; Hung ia, M. P o eomic p o iling o Rhizobium
opici PRF 81: Iden i ica ion o conse ed and speci ic esponses o hea s ess. BMC Mic obiol.
2012
,12, 84.
[C ossRe ]
91.
Gi an, M.S.; Bullimo e, J.; P e y, J.N.; Osbo n, A.M.; Ball, A.S. Soil ype is he p ima y de e minan o he
composi ion o he o al and ac i e bac e ial communi ies in a able soils. Appl. En i on. Mic obiol.
2003
,69,
1800–1809. [C ossRe ]
92.
Gonz
á
lez, V.; San ama
í
a, R.I.; Bus os, P.; He n
á
ndez-Gonz
á
lez, I.; Med ano-So o, A.; Mo eno-Hagelsieb, G.;
Janga, S.C.; Ram
í
ez, M.A.; Jim
é
nez-Jacin o, V.; Collado-Vides, J.; e al. The pa i ioned Rhizobium e li genome:
Gene ic and me abolic edundancy in se en in e ac ing eplicons. P oc. Na l. Acad. Sci. USA
2006
,103,
3834–3839. [C ossRe ] [PubMed]
93.
P ell, J.; Poole, P. Me abolic changes o hizobia in legume nodules. T ends Mic obiol.
2006
,14, 161–168.
[C ossRe ] [PubMed]