1
1
All4312, an N cA- egula ed wo-componen esponse 2
egula o in Anabaena sp. s ain PCC 7120 3
4
Alicia Ma ía Mu o-Pas o , El i a Olmedo-Ve d, and En ique Flo es 5
6
Ins i u o de Bioquímica Vege al y Fo osín esis, Consejo Supe io de 7
In es igaciones Cien í icas-Uni e sidad de Se illa, E-41092 Se ille, Spain 8
9
10
11
12
13
14
Co espondence: Alicia M. Mu o-Pas o , Ins i u o de Bioquímica Vege al y 15
Fo osín esis, Cen o de In es igaciones Cien í icas Isla de la Ca uja, A da. 16
Amé ico Vespucio 49, E-41092 Se illa, Spain. 17
Tel.: +34 95 448 9523; ax: +34 95 446 0065; e-mail: [email p o ec ed]. 18
19
20
Keywo ds: all4312, n cA, wo-componen , esponse egula o , Anabaena21
2
22
Abs ac 23
24
All4312, encoded by open eading ame all4312 in he genome o he 25
he e ocys - o ming cyanobac e ium Anabaena sp. s ain PCC 7120, exhibi s a 26
CheY-like ecei e domain and an ou pu domain simila o ha o OmpR, 27
cha ac e is ic o wo-componen esponse egula o s. Exp ession o all4312 was 28
di ec ly egula ed by N cA, he global ansc ip ional egula o o ni ogen 29
assimila ion in cyanobac e ia. Fea u es cha ac e is ic o N cA-ac i a ed 30
p omo e s we e also ound ups eam om genes encoding All4312 homologs in 31
se e al o he cyanobac e ial genomes. Exp ession o all4312 was howe e 32
una ec ed in a mu an o he R, which encodes a egula o igge ing he e ocys 33
de elopmen . The unc ion o All4312 may be ela ed o he cellula esponse o 34
ni ogen dep i a ion. 35
36
In oduc ion 37
38
Cyanobac e ia a e a g oup o widely dis ibu ed pho o ophic p oka yo es ha 39
ca y ou oxygenic, plan - ype pho osyn hesis. Cyanobac e ia a e able o use 40
di e en ni ogen sou ces including ni a e and ammonium and many s ains 41
can also ix a mosphe ic ni ogen. Ammonium is assimila ed in p e e ence o e 42
ni a e, which is used in p e e ence o e dini ogen (Flo es & He e o, 1994; 43
He e o e al., 2001). Some ilamen ous cyanobac e ia, including Anabaena 44
spp., a e able o di e en ia e, in esponse o ni ogen de iciency, cells 45
specialized in ni ogen ixa ion called he e ocys s. Assimila ion o di e en 46
3
ni ogen sou ces is globally egula ed in hese o ganisms by N cA, a 47
ansc ip ional egula o belonging o he CAP (o CRP) amily ha , in he 48
absence o ammonium, ac i a es he exp ession o genes equi ed o he 49
assimila ion o al e na i e ni ogen sou ces including a mosphe ic ni ogen 50
(Vega-Palas e al., 1992; F ías e al., 1994; Luque e al., 1994; Wei e al., 1994; 51
He e o e al., 2001). N cA binds o speci ic si es in he p omo e egions o he 52
egula ed genes and ac i a es hei exp ession in esponse o ammonium 53
wi hd awal (Luque e al., 1994). The s uc u e o consensus N cA-binding si es 54
has been de ined (Luque e al., 1994) and se e al N cA-ac i a ed p omo e s 55
ha e been shown o ca y an N cA-binding sequence in he o m GTAN8TAC, 56
which is loca ed abou 22 nucleo ides ups eam om he p omo e –10 hexame 57
(He e o e al., 2001). N cA-binding si es wi h a ep esso , a he han 58
ac i a ing, ole ha e been iden i ied in a ew cases (He e o e al., 2001). The 59
N cA p o ein appea s o ha e as a posi i e e ec o 2-oxoglu a a e (Vázquez-60
Be múdez e al., 2002; Vázquez-Be múdez e al., 2003; Luque e al., 2004), 61
which is an indica o o he C o N balance in cyanobac e ial cells (Mu o-Pas o 62
e al., 2001). Fo some p omo e s, he PII p o ein is also needed o ull 63
ac i a ion by N cA unde N de iciency (Aldeni e al., 2003; Paz-Yepes e al., 64
2003). 65
A numbe o cases ha e been desc ibed in which N cA-media ed 66
ni ogen egula ion is no di ec ly ope a ed by N cA (He e o e al., 2001; 67
He e o e al., 2004). In hose cases, one would expec ha N cA ac i a es he 68
exp ession o egula o y p o eins ha would hen be esponsible o di ec 69
egula ion, bu no such e ec o is ye known. He e we desc ibe a p o ein wi h 70
4
homology o wo-componen esponse egula o s whose exp ession is di ec ly 71
ope a ed by N cA in Anabaena sp. s ain PCC 7120. 72
73
Ma e ials and me hods 74
S ains and g ow h condi ions 75
This s udy was ca ied ou wi h he he e ocys - o ming cyanobac e ium 76
Anabaena sp. (also known as Nos oc sp.) s ain PCC 7120 and de i a i e 77
s ains CSE2, an inse ional mu an o he n cA gene (F ías e al., 1994), and 78
216, which bea s a poin mu a ion in he he R gene (Buikema & Haselko n, 79
1991). They we e g own pho oau o ophically a 30ºC in BG110C medium 80
(BG11 medium [Rippka e al., 1979] wi hou NaNO3 and supplemen ed wi h 10 81
mM o NaHCO3) supplemen ed wi h 6 mM NH4Cl plus 12 mM N- is 82
(hyd oxyme hyl) me hyl-2-aminoe hanesul onic acid (TES)-NaOH bu e (pH 83
7.5), bubbled wi h a mix u e o CO2 and ai (1% ol/ ol), and supplemen ed wi h 84
2 µg·ml-1 o s ep omycin and 2 µg·ml-1 o spec inomycin in he case o s ain 85
CSE2 and hose s ains bea ing usions be ween he egion ups eam om 86
all4312 and he g p gene. 87
Fo RNA isola ion, cells g owing exponen ially in BG110C medium 88
supplemen ed wi h NH4Cl we e ha es ed a oom empe a u e and ei he used 89
di ec ly ( ime 0) o washed wi h BG110C medium, esuspended in BG11C 90
(ni a e-con aining) o in BG110C (ni ogen- ee) medium and u he incuba ed 91
unde cul u e condi ions o he numbe o hou s indica ed in each expe imen . 92
Fo he analysis o g p exp ession, cells g owing exponen ially in 93
BG110C medium supplemen ed wi h NH4Cl we e ha es ed a oom 94
5
empe a u e and ei he used di ec ly ( ime 0) o washed wi h BG110C medium, 95
esuspended in BG110C (ni ogen- ee) medium and u he incuba ed unde 96
cul u e condi ions o he numbe o hou s indica ed. 97
E. coli s ains we e g own in Lu ia b o h (LB) supplemen ed, when 98
necessa y, wi h an ibio ics added a s anda d concen a ions (Ausubel e al., 99
2005). 100
101
DNA and RNA isola ion and manipula ion 102
To al RNA om Anabaena sp. s ain PCC 7120 and i s de i a i es was isola ed 103
as p e iously desc ibed (Mu o-Pas o e al., 2002). P ime ex ension analysis o 104
he all4312 ansc ip s was ca ied ou as desc ibed p e iously (Mu o-Pas o e 105
al., 1999). The oligonucleo ide used as p ime was all4312-1 (complemen a y o 106
posi ions +104 o +84 ela i e o he ansla ion s a o all4312). Plasmid 107
pCSAM113 (see below) was used o gene a e dideoxy-sequencing ladde s 108
using he same p ime . Sequencing was ca ied ou by he dideoxy chain-109
e mina ion me hod, using a T7SequencingTM ki (Ame sham Biosciences) and 110
[α-35S]- hio dATP. No he n analysis was ca ied ou as desc ibed (Mu o-Pas o 111
e al., 1999). The all4312 p obe used was a 714-bp NcoI-HincII in e nal 112
agmen ha co e s almos he whole open eading ame, isola ed om 113
pCSAM115. 114
Plasmid isola ion om E. coli, ans o ma ion o E. coli, diges ion o DNA 115
wi h es ic ion endonucleases, liga ion wi h T4 ligase, and PCR we e pe o med 116
by s anda d p ocedu es (Ausubel e al., 2005). 117
118
6
Plasmids 119
Plasmid pCSAM113 con ains a 602-bp DNA agmen PCR-ampli ied using 120
oligonucleo ides all4312-2 (co esponding o posi ions -488 o -467 wi h espec 121
o he ansla ional s a o all4312) and all4312-1 (see abo e) and 122
ch omosomal DNA om Anabaena sp. s ain PCC 7120 as empla e, cloned 123
in o he pGEM-T ec o (P omega). In pCSAM113a he o ien a ion o he inse 124
is such ha sequences co esponding o he all4312-1 oligonucleo ide a e close 125
o he SpeI si e in he polylinke o pGEM-T. In pCSAM113b he inse is cloned 126
in he opposi e o ien a ion. Plasmid pCSAM115 con ains a 1,102-bp DNA 127
agmen PCR-ampli ied wi h oligonucleo ides all4312-Nco (co esponding o 128
posi ions -12 o +10 wi h espec o he ansla ional s a o all4312, in oducing 129
a NcoI si e a he s a codon) and all4312-3 (complemen a y o posi ions +331 130
o +309 wi h espec o he ansla ional s op o all4312) cloned in o he pGEM-T 131
ec o . This agmen con ains he comple e all4312 open eading ame plus 132
331 bp downs eam o all4312. 133
Dis up ion o all4312 134
all4312 in plasmid pCSAM115 was dis up ed by in oducing AccI-ended SmSp-135
esis ance casse e C.S3, excised om pRL463 (pRL138/LHEH1[BamHI]/C.S3, 136
nomencla u e as in [Elhai & Wolk, 1988a]), in o he ClaI si e in e nal o all4312 137
ende ing pCSAM116. The ca. 3.5-kbp P uII agmen om pCSAM116, 138
con aining he dis up ed all4312 plus some downs eam sequences 139
(all4312::C.S3), was cloned in o he Klenow- illed BglII si e o sacB ec o 140
pRL278 (Black e al., 1993). The esul ing plasmid, pCSAM118 was ans e ed 141
o Anabaena sp. s ain PCC 7120 by conjuga ion as desc ibed (Elhai & Wolk, 142
1988b), using he helpe plasmid pRL623 (Elhai e al., 1997), and SmSp 143
7
esis an colonies we e selec ed. Isola ion o double ecombinan s was 144
a emp ed bu , unde ou cul u e condi ions, no suc ose- esis an , Nm-sensi i e 145
colony could be ob ained in se e al ounds o selec ion. 146
147
Fusions o he g een luo escen p o ein 148
Fusions o he p omo e egion o all4312 o he g p gene encoding g een 149
luo escen p o ein we e p epa ed as ollows. SmSp- esis ance casse e C.S3, 150
excised om pRL463 (see abo e) as an XbaI agmen , was inse ed in o he 151
SpeI si e loca ed in he polylinke o pCSAM113b ups eam om he all4312 152
p omo e , ende ing pCSAM114. A SalI-NcoI (Klenow- illed) agmen om 153
pCSAM114, con aining C.S3 ollowed by he p omo e egion o all4312, was 154
placed ups eam om he g p gene in SalI, EcoRV-diges ed pCSEL19, 155
ende ing pCSAM117. (pCSEL19 con ains a p omo e less g p gene PCR-156
ampli ied using oligonucleo ides g p-1 [5’GGAGATATCCATATGAGTAAAGG3’, 157
in oducing a EcoRV si e ups eam om he s a codon o he g p gene] and 158
g p-2 [5’AACAGAAGCTTGCATGCCTG] and plasmid pKEN2-GFPmu 2 [(Ezaz-159
Nikpay e al., 1994; Co mack e al., 1996)] as a empla e, cloned in o he 160
pGEM-T ec o in he same o ien a ion o he be a-lac amase gene). A Ps I 161
agmen om pCSAM117, con aining C.S3 ollowed by a ansc ip ional usion 162
be ween he egion ups eam om all4312 and he g p gene, was cloned in bo h 163
o ien a ions in o he Ps I si e o pCSAV80 (a de i a i e o pCSAM28 [Mu o-164
Pas o e al., 1992] in which he nucA gene has been inac i a ed by diges ion 165
wi h HindIII ollowed by Klenow ea men and eliga ion), designed o 166
in eg a ion o cons uc s in o he nucA egion loca ed in he α megaplasmid o 167
Anabaena sp. s ain PCC 7120. The esul ing plasmids, pCSAM119a and 168
8
pCSAM119b, we e ans e ed o Anabaena by conjuga ion as desc ibed abo e 169
and SmSp esis an colonies we e selec ed. The C.S3 casse e bea s 170
ansc ip ional e mina o s ha a e e ec i e in Anabaena sp. s ain PCC 7120 171
(F ías e al., 1997), ensu ing ha he Pall4312::g p usion is no ansc ibed om 172
an ex e nal p omo e o he han Pall4312. 173
The accumula ion o GFP epo e was analysed by lase con ocal 174
mic oscopy. Samples we e obse ed using a Leica HCX PLAN-APO 63X 1.4 175
NA oil imme sion objec i e a ached o a Leica TCS SP2 con ocal lase -176
scanning mic oscope. GFP was imaged using he 488 nm line supplied by an 177
a gon ion lase . Fluo escen emission was moni o ed by collec ion ac oss 178
windows o 500-570 nm (GFP imaging) and 630-700 nm (cyanobac e ial 179
au o luo escence). All con ocal images we e collec ed using he same se ings, 180
so ha he in ensi ies can be compa ed. 181
182
Band-shi assays 183
A 330-bp D aI-SpeI agmen om pCSAM113a was used in band shi assays 184
wi h pu i ied N cA. This agmen includes sequences -220 o +104 wi h espec 185
o he ansla ion s a o all4312. DNA agmen s we e end-labeled wi h T4 186
polynucleo ide kinase and [γ-32P]dATP. Assays we e ca ied ou as desc ibed 187
p e iously (Luque e al., 1994) in he p esence o absence o 0.6 mM 2-188
oxoglu a a e (Vázquez-Be múdez e al., 2002), and hey con ained abou 0.5 189
mol o labeled agmen and 2.5 o 15 pmol o pu i ied His- agged N cA (Mu o-190
Pas o e al., 1999). 191
192
9
Resul s 193
194
Exp ession o all4312 195
As a esul o a sea ch o N cA boxes ups eam om Anabaena sp. s ain PCC 196
7120 open eading ames and hei co esponding homologs in Nos oc 197
punc i o me, all4312 was iden i ied as a gene exhibi ing a pu a i e egula o y 198
N cA box in simila posi ions in bo h o ganisms (Je Elhai and Alicia M. Mu o-199
Pas o , unpublished esul s). Genes pu a i ely encoding homologs o All4312 200
we e iden i ied in 10 cyanobac e ial genomes. The egions ups eam om he 201
co esponding open eading ames con ained N cA boxes wi h he consensus 202
sequence GTAN8TAC cen e ed a posi ions anging om 66 o 130 nucleo ides 203
ups eam o he p edic ed ansla ional s a (Fig. 1). Fu he mo e, in ou cases, 204
he N cA box con ains he nucleo ides CA in he second and hi d posi ions a e 205
he GTA iple , a ea u e conse ed in many consensus- ype N cA-binding si es 206
(He e o e al., 2001). The obse a ion ha N cA boxes a e loca ed in such a 207
posi ion in all en genomes sugges s ha N cA migh be in ol ed in exp ession 208
o he co esponding genes. 209
Because N cA is known o egula e exp ession o genes in esponse o 210
he ni ogen s a us o he cells, exp ession o all4312 in Anabaena sp. s ain 211
PCC 7120 was analysed in ammonium-g own ilamen s incuba ed o 4 o 24 h 212
in he p esence o ni a e o in he absence o combined ni ogen. No he n blo 213
hyb idiza ion (Fig. 2A) showed ha exp ession in he wild- ype s ain was e y 214
low in he p esence o ammonium, was sligh ly induced in he p esence o 215
ni a e as sole ni ogen sou ce and was s ongly induced a e 4 h o ni ogen 216
de iciency. A ime-cou se o induc ion o all4312 in esponse o ni ogen 217
16
Luque I, Vázquez-Be múdez MF, Paz-Yepes J, Flo es E & He e o A (2004) In 366
i o ac i i y o he ni ogen con ol ansc ip ion ac o N cA is subjec ed 367
o me abolic egula ion in Synechococcus sp. s ain PCC 7942. FEMS 368
Mic obiol Le 236: 47-52. 369
Mu o-Pas o AM, Flo es E, He e o A & Wolk CP (1992) Iden i ica ion, gene ic 370
analysis and cha ac e iza ion o a suga -non-speci ic nuclease om he 371
cyanobac e ium Anabaena sp. PCC 7120. Mol Mic obiol 6: 3021-3030. 372
Mu o-Pas o AM, Vallada es A, Flo es E & He e o A (1999) The he C gene is a 373
di ec a ge o he N cA ansc ip ional egula o in cyanobac e ial 374
he e ocys de elopmen . J Bac e iol 181: 6664-6669. 375
Mu o-Pas o AM, Vallada es A, Flo es E & He e o A (2002) Mu ual 376
dependence o he exp ession o he cell di e en ia ion egula o y p o ein 377
He R and he global ni ogen egula o N cA du ing he e ocys 378
de elopmen . Mol Mic obiol 44: 1377-1385. 379
Mu o-Pas o MI, Reyes JC & Flo encio FJ (2001) Cyanobac e ia pe cei e 380
ni ogen s a us by sensing in acellula 2-oxoglu a a e le els. J Biol 381
Chem 276: 38320-38328. 382
Ohmo i M, Ikeuchi M, Sa o N, e al. (2001) Cha ac e iza ion o genes encoding 383
mul i-domain p o eins in he genome o he ilamen ous ni ogen- ixing 384
cyanobac e ium Anabaena sp. s ain PCC 7120. DNA Res 8: 271-284. 385
Olmedo-Ve d E, Flo es E, He e o A & Mu o-Pas o AM (2005) He R-dependen 386
and -independen exp ession o he e ocys - ela ed genes in an 387
Anabaena s ain o e p oducing he N cA ansc ip ion ac o . J Bac e iol 388
187: 1985-1991. 389
Paz-Yepes J, Flo es E & He e o A (2003) T ansc ip ional e ec s o he signal 390
17
ansduc ion p o ein P(II) (glnB gene p oduc ) on N cA-dependen genes 391
in Synechococcus sp. PCC 7942. FEBS Le 543: 42-46. 392
Rippka R, De uelles J, Wa e bu y JB, He dman M & S anie RY (1979) Gene ic 393
assignmen s, s ain s o ies and p ope ies o pu e cul u es o 394
cyanobac e ia. J Gen Mic obiol 111: 1-61. 395
Vallada es A, Mu o-Pas o AM, He e o A & Flo es E (2004) The N cA-396
dependen P1 p omo e is u ilized o glnA exp ession in N2- ixing 397
he e ocys s o Anabaena sp. s ain PCC 7120. J Bac e iol 186: 7337-398
7343. 399
Vázquez-Be múdez MF, He e o A & Flo es E (2002) 2-Oxoglu a a e inc eases 400
he binding a ini y o he N cA (ni ogen con ol) ansc ip ion ac o o 401
he Synechococcus glnA p omo e . FEBS Le 512: 71-74. 402
Vázquez-Be múdez MF, He e o A & Flo es E (2003) Ca bon supply and 2-403
oxoglu a a e e ec s on exp ession o ni a e educ ase and ni ogen-404
egula ed genes in Synechococcus sp. s ain PCC 7942. FEMS Mic obiol 405
Le 221: 155-159. 406
Vega-Palas MA, Flo es E & He e o A (1992) N cA, a global ni ogen egula o 407
om he cyanobac e ium Synechococcus ha belongs o he C p amily 408
o bac e ial egula o s. Mol Mic obiol 6: 1853-1859. 409
Vioque A (1997) The RNase P RNA om cyanobac e ia: sho andemly 410
epea ed epe i i e (STRR) sequences a e p esen wi hin he RNase P 411
RNA gene in he e ocys - o ming cyanobac e ia. Nucleic Acids Res 25: 412
3471-3477. 413
Wang L, Sun YP, Chen WL, Li JH & Zhang C-C (2002) Genomic analysis o 414
p o ein kinases, p o ein phospha ases and wo-componen egula o y 415
18
sys ems o he cyanobac e ium Anabaena sp. s ain PCC 7120. FEMS 416
Mic obiol Le 217: 155-165. 417
Wei T-F, Ramasub amanian TS & Golden JW (1994) Anabaena sp. s ain PCC 418
7120 n cA gene equi ed o g ow h on ni a e and he e ocys 419
de elopmen . J Bac e iol 176: 4473-4482. 420
421
19
FIGURE LEGENDS 422
Figu e 1. Iden i ica ion o pu a i e N cA boxes in he egions ups eam om 423
genes encoding All4312 and i s homologs in se e al cyanobac e ial genomes. 424
Sequences a e aligned a he p edic ed N cA boxes and dis ances o he 425
pu a i e ansla ion s a (GTG o ATG codon) o he co esponding genes a e 426
indica ed. The ansc ip ion s a poin de e mined o all4312 is unde lined, and 427
he co esponding pu a i e p omo e –10 hexame is indica ed. Sequences 428
aligned co espond o hose ups eam om all4312 ( i s line) and genes 429
encoding All4312 homologs om Anabaena a iabilis s ain ATCC 29413 430
(gi75907486), Nos oc punc i o me s ain PCC 73102 (gi53687472), 431
T ichodesmium e y h aeum s ain IMS101 (gi71676548), Synechocys is sp. 432
s ain PCC 6803 (gi16332107), C ocosphae a wa sonii s ain WH 8501 433
(gi67924898), Synechococcus elonga us s ain PCC 7942 (gi45513869), 434
Synechococcus elonga us s ain PCC 6301 (gi56751647), Gloeobac e 435
iolaceus s ain PCC 7421 (gi35212842) and The mosynechococcus elonga us 436
s ain BP-1 (gi22295054). 437
438
Figu e 2. Exp ession o all4312 in Anabaena sp. s ain PCC 7120, he n cA 439
inse ional mu an CSE2, and he he R s ain 216. (A) RNA om wild- ype 440
Anabaena sp. s ain PCC 7120 was isola ed om ammonium-g own ilamen s 441
(lanes labelled 0) o om ammonium-g own ilamen s incuba ed in ni a e-442
con aining o ni ogen- ee medium o 4 o 24 h and hyb idized o an all4312 443
p obe. Samples con ained 20 µg o RNA. Size s anda ds a e indica ed on he 444
igh . (B) RNA was isola ed om ammonium-g own ilamen s (lanes labelled 0) 445
o om ammonium-g own ilamen s incuba ed in ni ogen- ee medium o he 446
20
numbe o hou s indica ed in each case and hyb idized o an all4312 p obe. 447
Samples con ained 25 µg o RNA. Lowe panels co espond in all cases o 448
hyb idiza ion o an npB p obe (Vioque, 1997), which was used as a loading and 449
ans e con ol. Simila esul s o hose shown in panel B we e ob ained wi h 450
RNA samples om an independen induc ion expe imen (no shown). WT, wild-451
ype s ain PCC 7120. 452
453
Figu e 3. P ime ex ension analysis o exp ession o all4312 in Anabaena sp. 454
s ain PCC 7120, he n cA inse ional mu an CSE2, and he he R s ain 216. 455
Assays we e ca ied ou wi h RNA isola ed om ammonium-g own ilamen s 456
(lanes labelled 0) o om ammonium-g own ilamen s incuba ed in ni ogen- ee 457
medium o he numbe o hou s indica ed in each case. The oligonucleo ide 458
used o ex ension was all4312-1 (see ma e ials and me hods). Sequence 459
ladde s we e gene a ed wi h he same oligonucleo ide and plasmid pCSAM113. 460
A owhead poin s o he pu a i e sp iden i ied 27 nucleo ides ups eam om he 461
ansla ion s a o he gene. 462
463
Figu e 4. Exp ession o usions be ween he p omo e egion ups eam om 464
all4312 and he g p gene. Fluo escen emission was de e mined in ammonium-465
g own ilamen s o in ammonium-g own ilamen s incuba ed in ni ogen- ee 466
medium o he numbe o hou s indica ed. GFP luo escence (le panels) and 467
cyanobac e ial au o luo escence ( igh panels) is shown. Cells lacking 468
au o luo escence a e ma u e he e ocys s. A and B show luo escen emission o 469
wo di e en clones (see ma e ials and me hods o de ails). O he clones 470
21
analyzed showed simila esul s. Whi e iangles poin o p ohe e ocys s o 471
he e ocys s. 472
473
Figu e 5. Binding o pu i ied N cA o he ups eam egion o all4312. Band-shi 474
assays we e ca ied ou wi h a agmen o he all4312 ups eam egion (see 475
ma e ials and me hods o de ails) in he absence (lanes 1 o 5) o in he 476
p esence o 0.6 mM 2-oxoglu a a e (lanes 6 o 9). The amoun s o pu i ied N cA 477
p o ein used in he assays we e: (1) no N cA p o ein added; (2,6) 2.5 pmol; (3,7) 478
5 pmol; (4,8) 10 pmol; (5,9) 15 pmol. Solid a owhead poin s o he ee 479
agmen , whi e a owhead poin s o he e a ded N cA bound agmen . 480
481
Mu o-Pas o e al., FIG 1
N cA binding box -10 box
PCC 7120 TAGAGTAACAAAGACTACAAAACCTTGGGCATGGGCTTGTTACTTTGAAATTCATC----22n -----GTG
A. a iabilis TAGAGTAACAAAGACTACAAAACCTTGGGCATGGGCTTGTTACTTTGAAATTCATC----22n -----GTG
N. punc i o me TGAAGTAACAAAGGCTACAAAACCTTAGAGATGGGCTTGTTACTTTGAAAGTCATC----23n -----GTG
T. e y h aeum TTTAGTAGCTTCTGTTACAAAAGCGCCACAATAATTTATGTTATTTTTATACTTAG----36n -----GTG
PCC 6803 GCAGGTAACTGTTGTTACAAAGCCTTGACATTGACTTTGTTAGATTAACAGGGAAC----22n -----GTG
C. wa sonii CCAGGTAACAGATGTTACAAACTCCTGACAATACGTTTGTTAGGCTAATGACTGTC----23n -----GTG
PCC 7942 GCTCGTAAAGGCGAATACAGAAGCCACAATGGACAGCTTGCTAGGTTAAAGTCACA----21n -----GTG
PCC 6301 GCTCGTAAAGGCGAATACAGAAGCCACAATGGACAGCTTGCTAGGTTAAAGTCACA----21n -----GTG
PCC 7421 GTCTGTACGCCGAGGTACTGCGCACAGAGACACAGATGGACAGCGGCCTGCGCCAG----64n -----GTG
T. elonga us TAAAGTATTATTCGTTACGAAATGATAGGTATTAGATTTGCTAGATTAGCATCCAA----85n -----ATG
Mu o-Pas o e al., FIG 2
WT CSE2 216
0 3 6 9 12 24 0 3 6 9 12 24 0 3 6 9 12 24
0 4 24 4 24
NO3- N2
A B
2.0
1.5
0.5
WT CSE2 216
0 3 6 9 12 24 T C G A 0 3 6 9 12 24 0 3 6 9 12 24 T
Mu o-Pas o e al., FIG. 3
Mu o-Pas o e al., FIG 4
A
B
NH4+
9 h N2
24 h N2
NH4+
9 h N2
24 h N2