All4312, an NtcA-regulated two-component response regulator in Anabaena sp. strain PCC 7120

1 1 All4312, an NtcA-regulated two-component response 2 regulator in Anabaena sp. strain PCC 7120 3 4 Alicia María Muro-Pastor, Elvira Olmedo-Verd, and Enrique Flores 5 6 Instituto de Bioquímica Vegetal y Fotosíntesis, Consejo Superior de 7 Investigaciones Científicas-Universidad de Sevilla, E-41092 Seville, Spain 8 9 10 11 12 13 14 Correspondence: Alicia M. Muro-Pastor, Instituto de Bioquímica Vegetal y 15 Fotosíntesis, Centro de Investigaciones Científicas Isla de la Cartuja, Avda. 16 Américo Vespucio 49, E-41092 Sevilla, Spain. 17 Tel.: +34 95 448 9523; fax: +34 95 446 0065; e-mail: [email protected]. 18 19 20 Keywords: all4312, ntcA, two-component, response regulator, Anabaena21 2 22 Abstract 23 24 All4312, encoded by open reading frame all4312 in the genome of the 25 heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, exhibits a 26 CheY-like receiver domain and an output domain similar to that of OmpR, 27 characteristic of two-component response regulators. Expression of all4312 was 28 directly regulated by NtcA, the global transcriptional regulator of nitrogen 29 assimilation in cyanobacteria. Features characteristic of NtcA-activated 30 promoters were also found upstream from genes encoding All4312 homologs in 31 several other cyanobacterial genomes. Expression of all4312 was however 32 unaffected in a mutant of hetR, which encodes a regulator triggering heterocyst 33 development. The function of All4312 may be related to the cellular response to 34 nitrogen deprivation. 35 36 Introduction 37 38 Cyanobacteria are a group of widely distributed phototrophic prokaryotes that 39 carry out oxygenic, plant-type photosynthesis. Cyanobacteria are able to use 40 different nitrogen sources including nitrate and ammonium and many strains 41 can also fix atmospheric nitrogen. Ammonium is assimilated in preference over 42 nitrate, which is used in preference over dinitrogen (Flores & Herrero, 1994; 43 Herrero et al., 2001). Some filamentous cyanobacteria, including Anabaena 44 spp., are able to differentiate, in response to nitrogen deficiency, cells 45 specialized in nitrogen fixation called heterocysts. Assimilation of different 46 3 nitrogen sources is globally regulated in these organisms by NtcA, a 47 transcriptional regulator belonging to the CAP (or CRP) family that, in the 48 absence of ammonium, activates the expression of genes required for the 49 assimilation of alternative nitrogen sources including atmospheric nitrogen 50 (Vega-Palas et al., 1992; Frías et al., 1994; Luque et al., 1994; Wei et al., 1994; 51 Herrero et al., 2001). NtcA binds to specific sites in the promoter regions of the 52 regulated genes and activates their expression in response to ammonium 53 withdrawal (Luque et al., 1994). The structure of consensus NtcA-binding sites 54 has been defined (Luque et al., 1994) and several NtcA-activated promoters 55 have been shown to carry an NtcA-binding sequence in the form GTAN8TAC, 56 which is located about 22 nucleotides upstream from the promoter –10 hexamer 57 (Herrero et al., 2001). NtcA-binding sites with a repressor, rather than 58 activating, role have been identified in a few cases (Herrero et al., 2001). The 59 NtcA protein appears to have as a positive effector 2-oxoglutarate (Vázquez-60 Bermúdez et al., 2002; Vázquez-Bermúdez et al., 2003; Luque et al., 2004), 61 which is an indicator of the C to N balance in cyanobacterial cells (Muro-Pastor 62 et al., 2001). For some promoters, the PII protein is also needed for full 63 activation by NtcA under N deficiency (Aldeni et al., 2003; Paz-Yepes et al., 64 2003). 65 A number of cases have been described in which NtcA-mediated 66 nitrogen regulation is not directly operated by NtcA (Herrero et al., 2001; 67 Herrero et al., 2004). In those cases, one would expect that NtcA activates the 68 expression of regulatory proteins that would then be responsible for direct 69 regulation, but no such effector is yet known. Here we describe a protein with 70 4 homology to two-component response regulators whose expression is directly 71 operated by NtcA in Anabaena sp. strain PCC 7120. 72 73 Materials and methods 74 Strains and growth conditions 75 This study was carried out with the heterocyst-forming cyanobacterium 76 Anabaena sp. (also known as Nostoc sp.) strain PCC 7120 and derivative 77 strains CSE2, an insertional mutant of the ntcA gene (Frías et al., 1994), and 78 216, which bears a point mutation in the hetR gene (Buikema & Haselkorn, 79 1991). They were grown photoautotrophically at 30ºC in BG110C medium 80 (BG11 medium [Rippka et al., 1979] without NaNO3 and supplemented with 10 81 mM of NaHCO3) supplemented with 6 mM NH4Cl plus 12 mM N-tris 82 (hydroxymethyl) methyl-2-aminoethanesulfonic acid (TES)-NaOH buffer (pH 83 7.5), bubbled with a mixture of CO2 and air (1% vol/vol), and supplemented with 84 2 µg·ml-1 of streptomycin and 2 µg·ml-1 of spectinomycin in the case of strain 85 CSE2 and those strains bearing fusions between the region upstream from 86 all4312 and the gfp gene. 87 For RNA isolation, cells growing exponentially in BG110C medium 88 supplemented with NH4Cl were harvested at room temperature and either used 89 directly (time 0) or washed with BG110C medium, resuspended in BG11C 90 (nitrate-containing) or in BG110C (nitrogen-free) medium and further incubated 91 under culture conditions for the number of hours indicated in each experiment. 92 For the analysis of gfp expression, cells growing exponentially in 93 BG110C medium supplemented with NH4Cl were harvested at room 94 5 temperature and either used directly (time 0) or washed with BG110C medium, 95 resuspended in BG110C (nitrogen-free) medium and further incubated under 96 culture conditions for the number of hours indicated. 97 E. coli strains were grown in Luria broth (LB) supplemented, when 98 necessary, with antibiotics added at standard concentrations (Ausubel et al., 99 2005). 100 101 DNA and RNA isolation and manipulation 102 Total RNA from Anabaena sp. strain PCC 7120 and its derivatives was isolated 103 as previously described (Muro-Pastor et al., 2002). Primer extension analysis of 104 the all4312 transcripts was carried out as described previously (Muro-Pastor et 105 al., 1999). The oligonucleotide used as primer was all4312-1 (complementary to 106 positions +104 to +84 relative to the translation start of all4312). Plasmid 107 pCSAM113 (see below) was used to generate dideoxy-sequencing ladders 108 using the same primer. Sequencing was carried out by the dideoxy chain-109 termination method, using a T7SequencingTM kit (Amersham Biosciences) and 110 [α-35S]-thio dATP. Northern analysis was carried out as described (Muro-Pastor 111 et al., 1999). The all4312 probe used was a 714-bp NcoI-HincII internal 112 fragment that covers almost the whole open reading frame, isolated from 113 pCSAM115. 114 Plasmid isolation from E. coli, transformation of E. coli, digestion of DNA 115 with restriction endonucleases, ligation with T4 ligase, and PCR were performed 116 by standard procedures (Ausubel et al., 2005). 117 118 6 Plasmids 119 Plasmid pCSAM113 contains a 602-bp DNA fragment PCR-amplified using 120 oligonucleotides all4312-2 (corresponding to positions -488 to -467 with respect 121 to the translational start of all4312) and all4312-1 (see above) and 122 chromosomal DNA from Anabaena sp. strain PCC 7120 as template, cloned 123 into the pGEM-T vector (Promega). In pCSAM113a the orientation of the insert 124 is such that sequences corresponding to the all4312-1 oligonucleotide are close 125 to the SpeI site in the polylinker of pGEM-T. In pCSAM113b the insert is cloned 126 in the opposite orientation. Plasmid pCSAM115 contains a 1,102-bp DNA 127 fragment PCR-amplified with oligonucleotides all4312-Nco (corresponding to 128 positions -12 to +10 with respect to the translational start of all4312, introducing 129 a NcoI site at the start codon) and all4312-3 (complementary to positions +331 130 to +309 with respect to the translational stop of all4312) cloned into the pGEM-T 131 vector. This fragment contains the complete all4312 open reading frame plus 132 331 bp downstream of all4312. 133 Disruption of all4312 134 all4312 in plasmid pCSAM115 was disrupted by introducing AccI-ended SmSp-135 resistance cassette C.S3, excised from pRL463 (pRL138/LHEH1[BamHI]/C.S3, 136 nomenclature as in [Elhai & Wolk, 1988a]), into the ClaI site internal to all4312 137 rendering pCSAM116. The ca. 3.5-kbp PvuII fragment from pCSAM116, 138 containing the disrupted all4312 plus some downstream sequences 139 (all4312::C.S3), was cloned into the Klenow-filled BglII site of sacB vector 140 pRL278 (Black et al., 1993). The resulting plasmid, pCSAM118 was transferred 141 to Anabaena sp. strain PCC 7120 by conjugation as described (Elhai & Wolk, 142 1988b), using the helper plasmid pRL623 (Elhai et al., 1997), and SmSp 143 7 resistant colonies were selected. Isolation of double recombinants was 144 attempted but, under our culture conditions, no sucrose-resistant, Nm-sensitive 145 colony could be obtained in several rounds of selection. 146 147 Fusions to the green fluorescent protein 148 Fusions of the promoter region of all4312 to the gfp gene encoding green 149 fluorescent protein were prepared as follows. SmSp-resistance cassette C.S3, 150 excised from pRL463 (see above) as an XbaI fragment, was inserted into the 151 SpeI site located in the polylinker of pCSAM113b upstream from the all4312 152 promoter, rendering pCSAM114. A SalI-NcoI (Klenow-filled) fragment from 153 pCSAM114, containing C.S3 followed by the promoter region of all4312, was 154 placed upstream from the gfp gene in SalI, EcoRV-digested pCSEL19, 155 rendering pCSAM117. (pCSEL19 contains a promoterless gfp gene PCR-156 amplified using oligonucleotides gfp-1 [5’GGAGATATCCATATGAGTAAAGG3’, 157 introducing a EcoRV site upstream from the start codon of the gfp gene] and 158 gfp-2 [5’AACAGAAGCTTGCATGCCTG] and plasmid pKEN2-GFPmut2 [(Ezaz-159 Nikpay et al., 1994; Cormack et al., 1996)] as a template, cloned into the 160 pGEM-T vector in the same orientation of the beta-lactamase gene). A PstI 161 fragment from pCSAM117, containing C.S3 followed by a transcriptional fusion 162 between the region upstream from all4312 and the gfp gene, was cloned in both 163 orientations into the PstI site of pCSAV80 (a derivative of pCSAM28 [Muro-164 Pastor et al., 1992] in which the nucA gene has been inactivated by digestion 165 with HindIII followed by Klenow treatment and religation), designed for 166 integration of constructs into the nucA region located in the α megaplasmid of 167 Anabaena sp. strain PCC 7120. The resulting plasmids, pCSAM119a and 168 8 pCSAM119b, were transferred to Anabaena by conjugation as described above 169 and SmSp resistant colonies were selected. The C.S3 cassette bears 170 transcriptional terminators that are effective in Anabaena sp. strain PCC 7120 171 (Frías et al., 1997), ensuring that the Pall4312::gfp fusion is not transcribed from 172 an external promoter other than Pall4312. 173 The accumulation of GFP reporter was analysed by laser confocal 174 microscopy. Samples were observed using a Leica HCX PLAN-APO 63X 1.4 175 NA oil immersion objective attached to a Leica TCS SP2 confocal laser-176 scanning microscope. GFP was imaged using the 488 nm line supplied by an 177 argon ion laser. Fluorescent emission was monitored by collection across 178 windows of 500-570 nm (GFP imaging) and 630-700 nm (cyanobacterial 179 autofluorescence). All confocal images were collected using the same settings, 180 so that the intensities can be compared. 181 182 Band-shift assays 183 A 330-bp DraI-SpeI fragment from pCSAM113a was used in band shift assays 184 with purified NtcA. This fragment includes sequences -220 to +104 with respect 185 to the translation start of all4312. DNA fragments were end-labeled with T4 186 polynucleotide kinase and [γ-32P]dATP. Assays were carried out as described 187 previously (Luque et al., 1994) in the presence or absence of 0.6 mM 2-188 oxoglutarate (Vázquez-Bermúdez et al., 2002), and they contained about 0.5 189 fmol of labeled fragment and 2.5 to 15 pmol of purified His-tagged NtcA (Muro-190 Pastor et al., 1999). 191 192 9 Results 193 194 Expression of all4312 195 As a result of a search for NtcA boxes upstream from Anabaena sp. strain PCC 196 7120 open reading frames and their corresponding homologs in Nostoc 197 punctiforme, all4312 was identified as a gene exhibiting a putative regulatory 198 NtcA box in similar positions in both organisms (Jeff Elhai and Alicia M. Muro-199 Pastor, unpublished results). Genes putatively encoding homologs of All4312 200 were identified in 10 cyanobacterial genomes. The regions upstream from the 201 corresponding open reading frames contained NtcA boxes with the consensus 202 sequence GTAN8TAC centered at positions ranging from 66 to 130 nucleotides 203 upstream of the predicted translational start (Fig. 1). Furthermore, in four cases, 204 the NtcA box contains the nucleotides CA in the second and third positions after 205 the GTA triplet, a feature conserved in many consensus-type NtcA-binding sites 206 (Herrero et al., 2001). The observation that NtcA boxes are located in such a 207 position in all ten genomes suggests that NtcA might be involved in expression 208 of the corresponding genes. 209 Because NtcA is known to regulate expression of genes in response to 210 the nitrogen status of the cells, expression of all4312 in Anabaena sp. strain 211 PCC 7120 was analysed in ammonium-grown filaments incubated for 4 or 24 h 212 in the presence of nitrate or in the absence of combined nitrogen. Northern blot 213 hybridization (Fig. 2A) showed that expression in the wild-type strain was very 214 low in the presence of ammonium, was slightly induced in the presence of 215 nitrate as sole nitrogen source and was strongly induced after 4 h of nitrogen 216 deficiency. A time-course of induction of all4312 in response to nitrogen 217 16 Luque I, Vázquez-Bermúdez MF, Paz-Yepes J, Flores E & Herrero A (2004) In 366 vivo activity of the nitrogen control transcription factor NtcA is subjected 367 to metabolic regulation in Synechococcus sp. strain PCC 7942. FEMS 368 Microbiol Lett 236: 47-52. 369 Muro-Pastor AM, Flores E, Herrero A & Wolk CP (1992) Identification, genetic 370 analysis and characterization of a sugar-non-specific nuclease from the 371 cyanobacterium Anabaena sp. PCC 7120. Mol Microbiol 6: 3021-3030. 372 Muro-Pastor AM, Valladares A, Flores E & Herrero A (1999) The hetC gene is a 373 direct target of the NtcA transcriptional regulator in cyanobacterial 374 heterocyst development. J Bacteriol 181: 6664-6669. 375 Muro-Pastor AM, Valladares A, Flores E & Herrero A (2002) Mutual 376 dependence of the expression of the cell differentiation regulatory protein 377 HetR and the global nitrogen regulator NtcA during heterocyst 378 development. Mol Microbiol 44: 1377-1385. 379 Muro-Pastor MI, Reyes JC & Florencio FJ (2001) Cyanobacteria perceive 380 nitrogen status by sensing intracellular 2-oxoglutarate levels. J Biol 381 Chem 276: 38320-38328. 382 Ohmori M, Ikeuchi M, Sato N, et al. (2001) Characterization of genes encoding 383 multi-domain proteins in the genome of the filamentous nitrogen-fixing 384 cyanobacterium Anabaena sp. strain PCC 7120. DNA Res 8: 271-284. 385 Olmedo-Verd E, Flores E, Herrero A & Muro-Pastor AM (2005) HetR-dependent 386 and -independent expression of heterocyst-related genes in an 387 Anabaena strain overproducing the NtcA transcription factor. J Bacteriol 388 187: 1985-1991. 389 Paz-Yepes J, Flores E & Herrero A (2003) Transcriptional effects of the signal 390 17 transduction protein P(II) (glnB gene product) on NtcA-dependent genes 391 in Synechococcus sp. PCC 7942. FEBS Lett 543: 42-46. 392 Rippka R, Deruelles J, Waterbury JB, Herdman M & Stanier RY (1979) Generic 393 assignments, strain stories and properties of pure cultures of 394 cyanobacteria. J Gen Microbiol 111: 1-61. 395 Valladares A, Muro-Pastor AM, Herrero A & Flores E (2004) The NtcA-396 dependent P1 promoter is utilized for glnA expression in N2-fixing 397 heterocysts of Anabaena sp. strain PCC 7120. J Bacteriol 186: 7337-398 7343. 399 Vázquez-Bermúdez MF, Herrero A & Flores E (2002) 2-Oxoglutarate increases 400 the binding affinity of the NtcA (nitrogen control) transcription factor for 401 the Synechococcus glnA promoter. FEBS Lett 512: 71-74. 402 Vázquez-Bermúdez MF, Herrero A & Flores E (2003) Carbon supply and 2-403 oxoglutarate effects on expression of nitrate reductase and nitrogen-404 regulated genes in Synechococcus sp. strain PCC 7942. FEMS Microbiol 405 Lett 221: 155-159. 406 Vega-Palas MA, Flores E & Herrero A (1992) NtcA, a global nitrogen regulator 407 from the cyanobacterium Synechococcus that belongs to the Crp family 408 of bacterial regulators. Mol Microbiol 6: 1853-1859. 409 Vioque A (1997) The RNase P RNA from cyanobacteria: short tandemly 410 repeated repetitive (STRR) sequences are present within the RNase P 411 RNA gene in heterocyst-forming cyanobacteria. Nucleic Acids Res 25: 412 3471-3477. 413 Wang L, Sun YP, Chen WL, Li JH & Zhang C-C (2002) Genomic analysis of 414 protein kinases, protein phosphatases and two-component regulatory 415 18 systems of the cyanobacterium Anabaena sp. strain PCC 7120. FEMS 416 Microbiol Lett 217: 155-165. 417 Wei T-F, Ramasubramanian TS & Golden JW (1994) Anabaena sp. strain PCC 418 7120 ntcA gene required for growth on nitrate and heterocyst 419 development. J Bacteriol 176: 4473-4482. 420 421 19 FIGURE LEGENDS 422 Figure 1. Identification of putative NtcA boxes in the regions upstream from 423 genes encoding All4312 and its homologs in several cyanobacterial genomes. 424 Sequences are aligned at the predicted NtcA boxes and distances to the 425 putative translation start (GTG or ATG codon) of the corresponding genes are 426 indicated. The transcription start point determined for all4312 is underlined, and 427 the corresponding putative promoter –10 hexamer is indicated. Sequences 428 aligned correspond to those upstream from all4312 (first line) and genes 429 encoding All4312 homologs from Anabaena variabilis strain ATCC 29413 430 (gi75907486), Nostoc punctiforme strain PCC 73102 (gi53687472), 431 Trichodesmium erythraeum strain IMS101 (gi71676548), Synechocystis sp. 432 strain PCC 6803 (gi16332107), Crocosphaera watsonii strain WH 8501 433 (gi67924898), Synechococcus elongatus strain PCC 7942 (gi45513869), 434 Synechococcus elongatus strain PCC 6301 (gi56751647), Gloeobacter 435 violaceus strain PCC 7421 (gi35212842) and Thermosynechococcus elongatus 436 strain BP-1 (gi22295054). 437 438 Figure 2. Expression of all4312 in Anabaena sp. strain PCC 7120, the ntcA 439 insertional mutant CSE2, and the hetR strain 216. (A) RNA from wild-type 440 Anabaena sp. strain PCC 7120 was isolated from ammonium-grown filaments 441 (lanes labelled 0) or from ammonium-grown filaments incubated in nitrate-442 containing or nitrogen-free medium for 4 or 24 h and hybridized to an all4312 443 probe. Samples contained 20 µg of RNA. Size standards are indicated on the 444 right. (B) RNA was isolated from ammonium-grown filaments (lanes labelled 0) 445 or from ammonium-grown filaments incubated in nitrogen-free medium for the 446 20 number of hours indicated in each case and hybridized to an all4312 probe. 447 Samples contained 25 µg of RNA. Lower panels correspond in all cases to 448 hybridization to an rnpB probe (Vioque, 1997), which was used as a loading and 449 transfer control. Similar results to those shown in panel B were obtained with 450 RNA samples from an independent induction experiment (not shown). WT, wild-451 type strain PCC 7120. 452 453 Figure 3. Primer extension analysis of expression of all4312 in Anabaena sp. 454 strain PCC 7120, the ntcA insertional mutant CSE2, and the hetR strain 216. 455 Assays were carried out with RNA isolated from ammonium-grown filaments 456 (lanes labelled 0) or from ammonium-grown filaments incubated in nitrogen-free 457 medium for the number of hours indicated in each case. The oligonucleotide 458 used for extension was all4312-1 (see materials and methods). Sequence 459 ladders were generated with the same oligonucleotide and plasmid pCSAM113. 460 Arrowhead points to the putative tsp identified 27 nucleotides upstream from the 461 translation start of the gene. 462 463 Figure 4. Expression of fusions between the promoter region upstream from 464 all4312 and the gfp gene. Fluorescent emission was determined in ammonium-465 grown filaments or in ammonium-grown filaments incubated in nitrogen-free 466 medium for the number of hours indicated. GFP fluorescence (left panels) and 467 cyanobacterial autofluorescence (right panels) is shown. Cells lacking 468 autofluorescence are mature heterocysts. A and B show fluorescent emission of 469 two different clones (see materials and methods for details). Other clones 470 21 analyzed showed similar results. White triangles point to proheterocysts or 471 heterocysts. 472 473 Figure 5. Binding of purified NtcA to the upstream region of all4312. Band-shift 474 assays were carried out with a fragment of the all4312 upstream region (see 475 materials and methods for details) in the absence (lanes 1 to 5) or in the 476 presence of 0.6 mM 2-oxoglutarate (lanes 6 to 9). The amounts of purified NtcA 477 protein used in the assays were: (1) no NtcA protein added; (2,6) 2.5 pmol; (3,7) 478 5 pmol; (4,8) 10 pmol; (5,9) 15 pmol. Solid arrowhead points to the free 479 fragment, white arrowhead points to the retarded NtcA bound fragment. 480 481 Muro-Pastor et al., FIG 1 NtcA binding box -10 box PCC 7120 TAGAGTAACAAAGACTACAAAACCTTGGGCATGGGCTTGTTACTTTGAAATTCATC----22nt-----GTG A. variabilis TAGAGTAACAAAGACTACAAAACCTTGGGCATGGGCTTGTTACTTTGAAATTCATC----22nt-----GTG N. punctiforme TGAAGTAACAAAGGCTACAAAACCTTAGAGATGGGCTTGTTACTTTGAAAGTCATC----23nt-----GTG T. erythraeum TTTAGTAGCTTCTGTTACAAAAGCGCCACAATAATTTATGTTATTTTTATACTTAG----36nt-----GTG PCC 6803 GCAGGTAACTGTTGTTACAAAGCCTTGACATTGACTTTGTTAGATTAACAGGGAAC----22nt-----GTG C. watsonii CCAGGTAACAGATGTTACAAACTCCTGACAATACGTTTGTTAGGCTAATGACTGTC----23nt-----GTG PCC 7942 GCTCGTAAAGGCGAATACAGAAGCCACAATGGACAGCTTGCTAGGTTAAAGTCACA----21nt-----GTG PCC 6301 GCTCGTAAAGGCGAATACAGAAGCCACAATGGACAGCTTGCTAGGTTAAAGTCACA----21nt-----GTG PCC 7421 GTCTGTACGCCGAGGTACTGCGCACAGAGACACAGATGGACAGCGGCCTGCGCCAG----64nt-----GTG T. elongatus TAAAGTATTATTCGTTACGAAATGATAGGTATTAGATTTGCTAGATTAGCATCCAA----85nt-----ATG Muro-Pastor et al., FIG 2 WT CSE2 216 0 3 6 9 12 24 0 3 6 9 12 24 0 3 6 9 12 24 0 4 24 4 24 NO3N2 A B 2.0 1.5 0.5 WT CSE2 216 0 3 6 9 12 24 T C G A 0 3 6 9 12 24 0 3 6 9 12 24 T Muro-Pastor et al., FIG. 3 Muro-Pastor et al., FIG 4 A B NH4+ 9 h N2 24 h N2 NH4+ 9 h N2 24 h N2