

Ci a ion: Con e as, L.;
Rod íguez-Gil, A.; Mun ané, J.; de la
C uz, J. B oad T ansc ip omic Impac
o So a enib and I s Rela ion o he
An i umo al P ope ies in Li e
Cance Cells. Cance s 2022,14, 1204.
h ps://doi.o g/10.3390/
cance s14051204
Academic Edi o : Hi oyuki
Tsuchiya
Recei ed: 4 Feb ua y 2022
Accep ed: 21 Feb ua y 2022
Published: 25 Feb ua y 2022
Publishe ’s No e: MDPI s ays neu al
wi h ega d o ju isdic ional claims in
published maps and ins i u ional a il-
ia ions.
Copy igh : © 2022 by he au ho s.
Licensee MDPI, Basel, Swi ze land.
This a icle is an open access a icle
dis ibu ed unde he e ms and
condi ions o he C ea i e Commons
A ibu ion (CC BY) license (h ps://
c ea i ecommons.o g/licenses/by/
4.0/).
cance s
A icle
B oad T ansc ip omic Impac o So a enib and I s Rela ion o
he An i umo al P ope ies in Li e Cance Cells
Lau a Con e as 1,2, Al onso Rod íguez-Gil 1,3,4 , Jo di Mun ané1,4,5,*,† and Jesús de la C uz 1,2,*,†
1Ins i u o de Biomedicina de Se illa, Hospi al Uni e si a io Vi gen del Rocío/CSIC/Uni e sidad de Se illa,
E-41013 Se ille, Spain; [email p o ec ed] (L.C.); a [email p o ec ed] (A.R.-G.)
2Depa amen o de Gené ica, Facul ad de Biología, Uni e sidad de Se illa, E-41012 Se ille, Spain
3Cen o de In es igación Biomédica en Red de Cánce (CIBERONC), E-28029 Mad id, Spain
4Depa amen o de Fisiología Médica y Bio ísica, Uni e sidad de Se illa, E-41009 Se illa, Spain
5Cen o de In es igación Biomédica en Red de En e medades Hepá icas y Diges i as (CIBEREHD),
E-28029 Mad id, Spain
*Co espondence: [email p o ec ed] (J.M.); [email p o ec ed] (J.d.l.C.); Tel.: +34-955-923-122 (J.M.);
+34-923-126 (J.d.l.C.)
† These au ho s con ibu ed equally o his wo k.
Simple Summa y:
Hepa ocellula ca cinoma (HCC) is he ou h mos equen cause o cance -
ela ed mo ali y wo ldwide. While abla ion, esec ion and o ho opic li e ansplan a ion a e
indica ed a an ea ly s age o he disease, So a enib (S b) is he cu en mos adminis a ed i s -line
ea men o ad anced HCC, e en hough i s he apeu ic bene i is limi ed due o he appea ance o
esis ance. Deep knowledge on he molecula consequences o S b- ea men is essen ially equi ed
o op imizing no el he apeu ic s a egies o imp o e he ou comes o pa ien s wi h ad anced
HCC. In his s udy, we analyzed di e en ial gene exp ession changes in wo well cha ac e ized
li e cance cell lines upon a S b- ea men , demons a ing ha bo h lines esponded simila ly o he
ea men . Ou esul s p o ide aluable in o ma ion on he molecula ac ion o S b on di e se cellula
undamen al p ocesses such as DNA epai , ansla ion and p o eos asis and iden i y a ionaliza ion
issues ha could p o ide a di e en he apeu ic pe spec i e o S b.
Abs ac :
Hepa ocellula ca cinoma (HCC) is one o he mos equen and essen ially incu able
cance s in i s ad anced s ages. The y osine kinase inhibi o So a enib (S b) emains he globally
accep ed ea men o ad anced HCC. Howe e , he ex en o i s he apeu ic bene i is limi ed. S b
exe s an i umo ac i i y h ough i s cy o oxic, an i-p oli e a i e and p o-apop o ic oles in HCC cells.
To be e unde s and he molecula mechanisms unde lying hese e ec s, we used RNA sequencing
o gene a e comp ehensi e ansc ip ome p o iles o HepG2 and SNU423, hepa oblas oma- (HB)
and HCC-de i ed cell lines, espec i ely, ollowing a S b ea men a a pha macological dose. This
esul ed in simila al e a ions o gene exp ession in bo h cell lines. Genes unc ionally ela ed
o memb ane a icking, s ess- esponsible and un olded p o ein esponses, ci cadian clock and
ac i a ion o apop osis we e p edominan ly up egula ed, while genes in ol ed in cell g ow h and
cycle, DNA eplica ion and epai , ibosome biogenesis, ansla ion ini ia ion and p o eos asis we e
down egula ed. Ou esul s sugges ha S b causes p ima y e ec s on cellula s ess ha lead o
up egula ion o selec i e esponses o compensa e o i s nega i e e ec and es o e homeos asis. No
signi ican di e ences we e ound speci ically a ec ing each cell line, indica ing he obus ness o he
S b mechanism o ac ion despi e he he e ogenei y o li e cance . We discuss ou esul s on e ms o
p o iding a ionaliza ion o possible s a egies o imp o e S b clinical ou comes.
Keywo ds: hepa ocellula ca cinoma cell line; gene on ology; RNA-Seq; RNA syn hesis; So a enib
Cance s 2022,14, 1204. h ps://doi.o g/10.3390/cance s14051204 h ps://www.mdpi.com/jou nal/cance s
Cance s 2022,14, 1204 2 o 18
1. In oduc ion
Hepa ocellula ca cinoma (HCC) is he mos common ype o p ima y li e cance in
adul s [
1
]. HCC has been desc ibed as he six h mos common neoplasia and he ou h
mos equen cause o cance - ela ed mo ali y in men and women wo ldwide, being he
main cause o dea h in people wi h ci hosis (see [
2
] and e e ences he ein). The p ognosis
o HCC is s ic ly de e mined by he s aging o he umo and he hepa ic unc ion o he
pa ien s. The Ba celona-Clinic Li e Cance Classi ica ion (BCLC) is cu en ly a use ul
me hod o s aging pa ien s and ecommending ea men s depending on he numbe and
size o he umo nodules, li e unc ion, he p esence o ascula in asion, and ex ahepa ic
me as asis [
3
,
4
]. While abla ion, esec ion, and o ho opic li e ansplan a ion a e indica ed
a e y ea ly and ea ly s ages o he disease [
5
,
6
], S b is he cu en mos adminis e ed d ug
o he ea men o pa ien s ad anced HCC [
6
–
8
]. Un o una ely, S b only p o ides e y
limi ed clinical bene i o pa ien s, he i e-yea su i al a e emaining ex emely low [
7
,
8
].
Thus, he e is a need o de elop no el he apies ha alone o in combina ion wi h S b could
imp o e he ou comes o pa ien s wi h ad anced HCC [2,6,9].
S b is a mul iple y osine kinase ecep o inhibi o such as he ascula endo helial
g ow h ac o ecep o s 2 and 3 (VEGFR2 and VEGFR3), he pla ele -de i ed g ow h ac o
ecep o be a (PDGFR-ß), FLT3 and c-KIT, as well as he Ra kinases, which a e in eg al com-
ponen s o he Ras/Ra /mi ogen-ac i a ed p o ein (MAP)/ex acellula signal- egula ed
kinase (ERK) kinase (MEK)/ERK signaling cascade [
10
,
11
]; hus, S b also down egula es
he phosphoinosi ide-3 kinase (PI3K)/Ak /mammalian a ge o apamycin (mTOR) ha
egula es undamen al cellula p ocesses [
12
]. S b exe s a po en an i-p oli e a i e and
p o-apop o ic ac i i y agains HCC cells [
13
,
14
]. We and o he s ha e shown ha his is
likely due o he gene a ion o a po en endoplasmic e iculum (ER) s ess ha leads o he
sequen ial induc ion o au ophagy and apop osis p ocesses in hepa oblas oma (HB) and
HCC cell lines and umo -de i ed xenog a mice models [
13
,
15
]. Howe e , many o he
molecula e en s by which S b exe s i s an i umo ac i i y emain unclea .
P e ious s udies ha e examined he exp ession le el o nume ous ansc ip s in se-
lec ed HB and HCC cell lines, which di e in hei gene ic cha ac e is ics, ea ed wi h S b
using DNA mic oa ay echnology [
10
]. The aim o he p esen s udy was o u he de e -
mine he impac o S b in HB and HCC cells using high- h oughpu RNA-Seq echnology.
The s udy was pe o med in wo di e en li e cance cell lines di e ing in di e en ia ion
s age and he exp ession o p53: HepG2 (well-di e en ia ed HB cell line; wild- ype p53) and
SNU423 (mode a ely di e en ia ed HCC cell line; in- ame p53 gene unca ion o amino
acids 126–132) [
16
]. He ein, we in e , om ou RNA-Seq analysis, he speci ic pa hways ha
seem o be ac i a ed and inhibi ed upon S b ea men and compa e he ob ained esul s
wi h p e iously published ones ob ained using mic oa ay analysis o gene exp ession.
Bo h, simila i ies and di e ences in he ansc ip ome wi h and wi hou S b in he wo cells
lines we e discussed.
2. Ma e ials and Me hods
2.1. Cell Lines, Cul u e Condi ions, and So a enib T ea men
HepG2 and SNU423 cell lines we e ob ained om he Ame ican Type Cul u e Collec ion
(ATCC/LGC S anda ds, S.L.U., Ba celona, Spain). As desc ibed ea lie , cell lines we e selec ed
acco ding o hei o igin, cellula di e en ia ion s age, and p53 gene ic s a us: HepG2 (wild-
ype p53. HB-8065
™
) [
17
] and SNU423 (in- ame p53 gene dele ion. CRL-2238) [
18
]. Bo h cell
lines we e nega i e o mycoplasma con amina ion. Cells we e cul u ed in minimal essen ial
medium (MEM) wi h Ea le’s balanced sal s wi h L-glu amine ( e E15–825, PAA Labo a o ies
Inc., To on o, ON, Canada) supplemen ed wi h 10% e al bo ine se um (FBS, F7524, Sigma
Ald ich, Lo No. 022M3395, endo oxin < 0.2 EU/mL), 1% sodium py u a e ( e . S11–003,
PAA Labo a o ies Inc.), 1% non-essen ial amino acids ( e . M11–003, PAA Labo a o ies Inc.,
To on o, Canada) and penicillin–s ep omycin solu ion (100 U/mL–100
µ
g/mL; e . P11–010,
PAA Labo a o ies Inc., To on o, Canada); cells we e g own in cul u e lasks a 37
◦
C in a
humidi ied incuba o wi h 5% CO
2
un il eaching a densi y o 100,000 cells/cm
2
. S b was
Cance s 2022,14, 1204 3 o 18
added a he concen a ion o 10
µ
M a 24 h a e pla ing, and lysa es we e ob ained a e
12 h
ea men . So a enib (S b, e . FS10808; Ca bosyn h L d., Comp on, UK) was dissol ed in
dime hyl sul oxide (DMSO) as a s ock solu ion (100 mM).
2.2. Cell P oli e a ion
The measu emen o b omodeoxyu idine (B dU) inco po a ion was comple ed as
exac ly desc ibed in [
13
] using a comme cial ki ( e . 11 647229001, Roche Diagnos ics,
Mannheim, Ge many). Cells we e seeded in 96-well pla es a low densi y (15,000 cells/cm
2
).
Two hou s be o e cell ha es ing, 20
µ
L o 10
µ
M B dU was added o he cul u es. DNA
was dena u alized wi h 200
µ
L FixDena solu ion included in he comme cial ki o 30 min
a oom empe a u e. A e emo al, cells we e incuba ed wi h 100
µ
L o monoclonal an i-
B dU an ibody HRP conjuga ed o 90 min a oom empe a u e. A e wa ds, cells we e
washed wi h PBS bu e (137 mM NaCl, 2.7 mM KCl, 10 mM Na
2
HPO
4
, 1.8 mM KH
2
PO
4
,
pH 7.4) and incuba ed wi h 100
µ
L e ealing solu ion o 15 min a oom empe a u e.
Abso bance a 370 nm (A
370
) was measu ed using an In ini e 200 PRO mic opla e eade
(Tecan, Männedo , Swi ze land). Cell cycle p og ession was assessed by low cy ome ic
analysis. Fo his, cells we e seeded 24 h be o e ea men o a inal con luence o 70% in a
6-well pla e. A e wa ds, cells we e ea ed wi h 10
µ
M S b o 12 h and hen ha es ed and
ixed in 70% e hanol in PBS bu e o e nigh a 4
◦
C. A e his, cells we e esuspended in
PBS bu e and incuba ed wi h 0.5 mg/mL RNase A du ing 1 h a 37
◦
C. P opidium Iodine
(PI) was added o a inal concen a ion o 0.05 mg/mL o 20 min a oom empe a u e.
Finally, cells we e il e ed o a oid agg ega ion and cell cycle p og ession was assessed
using a FACSCan oTM Flow Cy ome e and analyzed using he FACSDi a so wa e (BD
Biosciences, Allschwil, Swi ze land).
2.3. RNA Ex ac ion
To al RNA was ex ac ed om each sample using a RNeasy mini ki acco ding o he
manu ac u e ’s ins uc ions (QIAGEN, Hilden, Ge many). RNA om each sample was
hen s o ed a −80 ◦C be o e u he analyses.
2.4. mRNA Lib a y P epa a ion
Lib a ies we e p epa ed using RNA o cells ea ed ei he wi h he ehicle o wi h S b.
To al RNA was p epa ed as desc ibed abo e. Then, concen a ion and quali y o he RNA
we e assessed wi h Qubi (Qubi
™
DNA HS assay, The mo Fishe Scien i ic, Wal ham, MA,
USA) and a 2100 Bioanalyzed Nano Chip (Agilen Technologies Genomics, San a Cla a,
CA, USA), espec i ely. RNA In eg i y Numbe (RIN) alues we e > 9 in all RNA samples.
Polyadenyla ed RNA was isola ed om he o al RNA using NEBNex Oligo d(T)
25
beads
(New England Biolabs, Ipswich, MA, USA) acco ding o he manu ac u e ’s ins uc ions.
Samples we e no malized o an equi alen concen a ion o 67.3 ng/
µ
L and p epa ed o
RNA Ilumina Sequencing. Fo HepG2 cell lines, h ee biological eplica es we e ob ained,
while o SNU423 cells only wo biological eplica es we e collec ed.
2.5. RNA Sequencing and Da a Analyses
RNA sequencing was pe o med wi h he Nex Seq500 Mid-Ou pu and 2
×
75 pb
leng h pa ame e s (pai ed-end). RNA-Seq da a we e i s il e ed using he FASTQ Toolki
1.0.0 p og am and hen analyzed using he BaseSpace Onsi e 3.22.91.158 om Illumina.
Only genes ha we e up egula ed o down egula ed wi h a p- alue < 0.5 and [log
2
( old
changes)]
≥±
0.5 we e selec ed. Da a p esen ed in his s udy has been submi ed o he
Gene Exp ession Omnibus da abase unde he accession numbe GSE186280.
2.6. Gene Se En ichmen Analysis and O e -Rep esen a ion Analysis
To iden i y unc ional ca ego ies signi ican ly a ec ed by he S b ea men , Gene
Se En ichmen Analysis (GSEA) [
19
,
20
] and O e -Rep esen a ion Analysis (ORA) we e
pe o med using he Reac ome da abase (h ps:// eac ome.o g; las accessed 3 Feb ua y
Cance s 2022,14, 1204 4 o 18
2022) [
21
] downloaded om he Molecula Signa u es Da abase . 7.1 (h ps://www.gsea-
msigdb.o g; las accessed 3 Feb ua y 2022). Fo GSEA, genes we e anked acco ding o he
p- alue and he di ec ion o change (up o down egula ed) ob ained om he RNA-Seq
da a. Fo he combined analysis o bo h cell lines, he p oduc o he p- alue o each cell
line was used o he anking. GSEA was pe o med using he GSEA so wa e wi h he
de aul pa ame e s o p e- anked lis s. ORA was pe o med using a Fishe ’s exac es [
22
],
selec ing he genes wi h a p- alue lowe han 0.001 in he RNA-Seq da a, ei he in each cell
line o in bo h cell lines.
2.7. Real-Time Quan i a i e PCR
To con i m mRNA-Seq esul s, eal- ime quan i a i e PCR (RT-qPCR) was pe o med
on a se o selec ed genes. To al RNA was ob ained as p e iously desc ibed and RNA
samples we e ea ed wi h DNase I (P omega, Madison, WI, USA) o emo e all aces
o DNA. A e his ea men , DNase I was inac i a ed by incuba ion o he samples
a 65
◦
C o 10 min. RNA was hen e e se ansc ibed using Supe Sc ip
™
III Fi s
S and Syn hesis o RT-PCR acco ding o he manu ac u e ’s ins uc ion (In i ogen,
Wal hman, MA, USA) and andom hexame p ime s (Roche, Swi ze land). Each eac-
ion con ained 250 ng o RNA in a o al olume o 25
µ
L. RT-qPCR was pe o med us-
ing SYBR
®
G een P emix Ex Taq
™
2X (Taka a, Japan) and p ime speci ics o each an-
sc ip . The ibosomal RNA 28S (28S RNA) was used as an in e nal no maliza ion con ol.
P ime s pai used o he RT-qPCR we e as ollows:
β
-ac in mRNA: 5
0
TCCCTGGAGAA
GAGCTACGA3
0
( o wa d) and 5
0
AGGAAGGAAGGCTGGAAGAG3
0
( e e se); BAX mRNA:
5
0
TCCACCAAGAAGCTGAGCGAG3
0
( o wa d) and 5
0
GTCCAGCCCATGATGGTTCT3
0
( e-
e se); BIM mRNA: 5
0
CACCAGCACCATAGAAGAA3
0
( o wa d) and 5
0
ATAAGG
AGCAGGCACAGA3
0
( e e se); BIRC3 mRNA 5
0
ATGCTTCTGTTGTGGCCTGA3
0
( o wa d)
and 5
0
ACTCTGAACGAATCTGCAGCT3
0
( e e se); BOP1 mRNA: 5
0
CTGATTCACC
AGCTGAGCC30( o wa d) and 50GACGCCACCAACAGGAAG30( e e se); CEBPβmRNA:
5
0
AAACTCTCTGCTTCTCCCTCTGC3
0
( o wa d) and 5
0
CTGACAGTTACACGTGGGTTGC3
0
( e e se); CPEB4 mRNA 5
0
CACCAACACCCTCCTCTTCC3
0
( o wa d) and 5
0
TTCAGGGG
CGTTATTCCACC3
0
( e e se); DUSP1 mRNA: 5
0
CCTGAGTACTAGCGTCCCTG3
0
( o wa d)
and 5
0
CAGGTACAGAAAGGGCAGGA3
0
( e e se); EIF4E2 mRNA: 5
0
TGAAAGAT
GATGACAGTGGGGA3
0
( o wa d) and 5
0
CTGATTCTTGTCTCGTTCCGT3
0
( e e se); EPOP
mRNA 5
0
AGTTTTCGGGGTGACAGTCC3
0
( o wa d) and 5
0
AGATGGAAGGAGGCAGG
GAT3
0
( e e se); FEN1 5
0
TGGGGTCAAGAGGCTGAGTA3
0
( o wa d) and 5
0
GTGGATCCC
TTGGGTTCTGG3
0
( e e se); GADD45B 5
0
TGGGAAGGTTTTGGGCTCTC3
0
( o wa d) and
5
0
TCCAGCGTCATGTTGCAATTATA3
0
( e e se); IDI1 5
0
AACCACCTCGACAAGCAACA3
0
( o wa d) and 5
0
TGTTCTCGTTCAGGTGACAA3
0
( e e se); PCNA 5
0
AAAGTCCAAAGTC
AGATCTGGTC3
0
( o wa d) and 5
0
ACTGCATTTAGAGTCAAGACCCT3
0
( e e se); PHB
mRNA: 5
0
TCAACATCACACTGCGCATC3
0
( o wa d) and 5
0
ATAGTCCTCTCCGATGCTG
G3
0
( e e se); SMAD7 mRNA: 5
0
CCCCTCCTCTCCCTCATCAA3
0
( o wa d) and 5
0
GGCTGG
CAGGAAGGGAATAA3
0
( e e se); TPI mRNA: 5
0
GGACTCGGAGTAATCGCCTG3
0
( o -
wa d) and 5
0
TGTTGGGGTGTTGCAGTCTT3
0
( e e se); VEGFA 5
0
CCATCCAATCGAGACC
CTGG3
0
( o wa d) and 5
0
CTCCAGGCCCTCGTCATTG3
0
( e e se); 28S RNA: 5
0
CAAAGCG
GGTGGTAAACTCC30( o wa d) and 50TTCACGCCCTCTTGAACTCT30( e e se).
2.8. Wes e n Blo Analysis
P o ein ex ac s we e ob ained by lysing cell pelle s a 100
◦
C o 10 min in 2
×
Laemmli
bu e (125 mM HCl-T is, pH 6.8, 4% SDS, 0.02% b omophenol blue, 20% glyce ol, 200 mM
DTT). Cellula ex ac s we e hen sonica ed in a Bio up o (Diagenode, Liège, Belgium) o
1 min a high in ensi y. P o ein ex ac s we e subjec ed o 10% SDS-PAGE and ans e ed
o ni ocellulose memb anes (Ame sham
TM
P o an
®
0.45
µ
m, GE Heal hca e Chicago, IL,
USA). The memb anes we e blocked o 1 h wi h 5% skim milk in TTBS (15 mM HCl-T is,
pH 7.5, 200 mM NaCl, 0.2 M NaCl, 0.1% ( / ) Tween-20), ollowed by incuba ion wi h
p ima y an i-NDUFS1 (Abcam, Camb idge, UK, ab169540, 1:10,000 dilu ion), an i-NDUFS2
Cance s 2022,14, 1204 5 o 18
(Abcam, ab103024, 1:2000 dilu ion), an i-NDUFV2 (Abcam, ab183715, 1:2000 dilu ion) and
an i-GAPDH (San a C uz, sc-47724, 1:1000 dilu ion) a 4 ◦C o e nigh .
A e washing wi h TTBS bu e , he memb anes we e incuba ed wi h HRP-conjuga ed
seconda y an ibody (Bio-Rad, He cules, CA, USA) o 1 h a a 1:5000 dilu ion a oom
empe a u e. P o eins we e de ec ed using an enhanced chemiluminescence de ec ion
ki (Pie ce
TM
Supe -Signal Wes Pico, The mo Fishe Scien i ic, Wal ham, MA, USA) in a
ChemiDoc
TM
Touch Imaging Sys em (Bio-Rad) and he ela i e in ensi y alue quan i ied
wi h he Image Lab so wa e p o ided wi h his sys em.
2.9. S a is ical Analyses
S a is ical analyses we e pe o med wi h he P ism 6.01 so wa e (G aphPad, San
Diego, CA, USA). Da a we e gene a ed om se e al epea s (a leas h ee) o di e en
biological eplica es (a leas h ee). Mean
±
S.D. we e ep esen ed in he di e en g aphs.
To de e mine signi icance, S uden ’s es s o unpai ed samples wi h con idence in e als
o 95% we e compu ed. Signi icance be ween condi ions we e indica ed wi h he symbols
*p< 0.05
, ** p< 0.01, *** p< 0.001, and **** p< 0.0001. Reg ession plo s and de e mina ion o
Pea son coe icien s and p- alue we e pe o med using he R so wa e (Ins i u e o S a is ics
and Ma hema ics, Vienna, Aus ia). A Venn diag am was compu ed using Eule APE
so wa e [23].
3. Resul s and Discussion
3.1. T ansc ip ional Changes Caused by So a enib in Hepg2 Hepa oblas oma and SNU423
Hepa ocellula Ca cinoma Cell Lines
S b is an inhibi o o se e al kinases in ol ed in umo cell p oli e a ion and angio-
genesis, including Ra , VEGFR and PDGFR [
10
,
24
]. Nowadays, S b is one o he mos used
molecula a ge ed d ugs o he ea men o ad anced inope able HCC wi h signi ican
bu un o una ely modes an icance esul s [
7
,
8
]. To be e unde s and he biological
consequences o he ea men , wo di e en model li e cance cell lines (HepG2 and
SNU423 cell lines) we e ea ed wi h S b 10
µ
M o 12 h and hei ansc ip omes analyzed
by RNA-Seq and compa ed o hose o un ea ed cells g own in he same condi ions. I has
been p e iously shown ha a his concen a ion, S b induces apop osis and signi ican ly
educes cell p oli e a ion in cul u es o he wo li e cance cell lines [16].
P incipal componen analyses demons a ed s ong consis ency be ween epea s o
each sample and clea ly sepa a ed da a om ea ed s. un ea ed cells in bo h cell lines
(da a no shown). Nume ous changes we e obse ed in bo h cell lines when ea ed
wi h S b (see Table S1). When we ook in o conside a ion changes in gene exp ession
wi h an es ablished p- alue lowe han 0.001, ou RNA-Seq analysis iden i ied 2140 and
1347 di e en ially exp essed genes (DEGs) upon S b ea men in HepG2 and SNU423
cells, espec i ely. F om hese, 1166 and 677 we e up egula ed while 974 and 670 we e
down egula ed, espec i ely, Table S2 displays he lis o DEGs (p- alue < 0.001) and
highligh s hose genes wi h log
2
(FC) ei he highe han 1.5 o lowe han
−
1.5 in S b-
ea ed HepG2 (265 s. 298 genes) and SNU423 (264 s. 175 genes) cells, espec i ely. All
hese esul s a e summa ized in Figu e 1A.
To e i y whe he he RNA-Seq esul s we e alid, we i s checked a se o genes
using RT-qPCR, chosen in a andom way. In HepG2 cells, we checked ACTB (
β
-ac in),
BIRC3, which encodes an inhibi o o apop osis, CEBP
β
, which encodes o a leucine-
zippe ansc ip ional ac o egula o o , among o he s, genes in ol ed in he immune
and in lamma o y esponses, CPEB4, a RNA binding p o ein ha egula es ac i a ion o
UPR, DUSP1, which encodes o he Dual Speci ici y P o ein Phospha ase 1, GADD45B,
he g ow h a es and DNA damage-inducible p o ein, SMAD7, which encodes o a
nuclea p o ein in ol ed in he inhibi ion o he TGF-be a ecep o and VEGFA, he ascula
endo helial g ow h ac o A as genes showing a posi i e log
2
(FC), and BAX, a BCL2 amily
membe wi h a ole as a mi ochond ial apop o ic ac i a o , he gene encoding he ansla ion
ini ia ion ac o eIF4E2, EPOP encoding o an sca old p o ein, FEN1 encoding o a DNA

Cance s 2022,14, 1204 6 o 18
nuclease, IDI1 encoding o a pe oxisomal enzyme, PCNA, which encodes o a co ac o
o he eplica i e DNA polyme ase and he gene o he iosephospha e isome ase (TPI)
as genes showing a nega i e log
2
(FC). In all cases, a signi ican and simila end was
ob ained in he le els exp ession o he genes es ed in S b- ea ed e sus non- ea ed cells
by RT-qPCR o RNA-Seq analysis (Figu e S1); hus, ou RT-qPCR analysis was consis en
wi h he ob ained RNA-Seq da a. In SNU423 cells, we checked BIM, which encodes o a
p oapop o ic p o ein, BOP1 encoding o a ac o in ol ed in he assembly o 60S ibosomal
subuni s BIRC3,CPEB4,DUSP1,GADD45B, and SMAD7 as gene showing a posi i e
log
2
(FC), and eIF4E2, EPOP,IDI1,PHB (P ohibi in), which encodes o a p o ein p oposed
o play an an ip oli e a i e ole, PCNA and TPI as genes showing a nega i e log
2
(FC).
Simila ly, gene exp ession le els ob ained using RNA-Seq and RT-qPCR me hods we e
in good ag eemen each o he wi h only small a ia ion in he magni ude o exp ession
(Figu e S2).
Cance s 2022, 14, x 6 o 18
Figu e 1. Di e en ially exp essed genes (mo e han wo- old) in HepG2 and SNU423 cells upon S b
ea men (10 µM, 12 h) de ec ed using RNA-Seq. (A) Venn diag am depic ing he unique and
sha ed up egula ed and down egula ed genes upon ea men . The p- alue cu -o was o 0.001. (B)
A co ela ion analysis showing he ela ion be ween he RNA-Seq da a o he HepG2 e sus SNU423
cells upon he S b ea men . The eg ession lines o all genes, and hose wi h p- alues lowe han
0.001 o HepG2, SNU423 o bo h cell lines a e shown wi h he co esponding linea eg ession
equa ions and Pea son coe icien s.
To e i y whe he he RNA-Seq esul s we e alid, we i s checked a se o genes
using RT-qPCR, chosen in a andom way. In HepG2 cells, we checked ACTB (β-ac in),
BIRC3, which encodes an inhibi o o apop osis, CEBPβ, which encodes o a leucine-zip-
pe ansc ip ional ac o egula o o , among o he s, genes in ol ed in he immune and
in lamma o y esponses, CPEB4, a RNA binding p o ein ha egula es ac i a ion o UPR,
DUSP1, which encodes o he Dual Speci ici y P o ein Phospha ase 1, GADD45B, he
g ow h a es and DNA damage-inducible p o ein, SMAD7, which encodes o a nuclea
p o ein in ol ed in he inhibi ion o he TGF-be a ecep o and VEGFA, he ascula en-
do helial g ow h ac o A as genes showing a posi i e log2(FC), and BAX, a BCL2 amily
membe wi h a ole as a mi ochond ial apop o ic ac i a o , he gene encoding he ansla-
ion ini ia ion ac o eIF4E2, EPOP encoding o an sca old p o ein, FEN1 encoding o a
DNA nuclease, IDI1 encoding o a pe oxisomal enzyme, PCNA, which encodes o a co-
ac o o he eplica i e DNA polyme ase and he gene o he iosephospha e isome ase
(TPI) as genes showing a nega i e log2(FC). In all cases, a signi ican and simila end was
ob ained in he le els exp ession o he genes es ed in S b- ea ed e sus non- ea ed cells
by RT-qPCR o RNA-Seq analysis (Figu e S1); hus, ou RT-qPCR analysis was consis en
wi h he ob ained RNA-Seq da a. In SNU423 cells, we checked BIM, which encodes o a
p oapop o ic p o ein, BOP1 encoding o a ac o in ol ed in he assembly o 60S iboso-
mal subuni s BIRC3, CPEB4, DUSP1, GADD45B, and SMAD7 as gene showing a posi i e
log2(FC), and eIF4E2, EPOP, IDI1, PHB (P ohibi in), which encodes o a p o ein p oposed
o play an an ip oli e a i e ole, PCNA and TPI as genes showing a nega i e log2(FC).
Simila ly, gene exp ession le els ob ained using RNA-Seq and RT-qPCR me hods we e in
good ag eemen each o he wi h only small a ia ion in he magni ude o exp ession (Fig-
u e S2).
In e es ingly, when he RNA-Seq da a we e globally analyzed, a s ong o e lap be-
ween he se o genes mis egula ed by S b in HepG2 and SNU423 cells was obse ed.
Figu e 1.
Di e en ially exp essed genes (mo e han wo- old) in HepG2 and SNU423 cells upon
S b ea men (10
µ
M, 12 h) de ec ed using RNA-Seq. (
A
) Venn diag am depic ing he unique and
sha ed up egula ed and down egula ed genes upon ea men . The p- alue cu -o was o 0.001.
(B) A
co ela ion analysis showing he ela ion be ween he RNA-Seq da a o he HepG2 e sus
SNU423 cells upon he S b ea men . The eg ession lines o all genes, and hose wi h p- alues lowe
han 0.001 o HepG2, SNU423 o bo h cell lines a e shown wi h he co esponding linea eg ession
equa ions and Pea son coe icien s.
In e es ingly, when he RNA-Seq da a we e globally analyzed, a s ong o e lap be-
ween he se o genes mis egula ed by S b in HepG2 and SNU423 cells was obse ed.
Indeed, changes in gene exp ession al e ed by S b ea men we e highly posi i ely co e-
la ed in bo h cell lines (Figu e 1B). The linea eg ession o he common DEG genes shows
a e y high co ela ion (y = 1.055
× −
0.0158), wi h a alue o he Pea son Co ela ion
coe icien as high as = 0.9294. This esul indica es ha despi e di e ences among he
se o DEGs in each li e cance cell line, he o e all esponse o he S b ea men is e y
simila be ween bo h cell lines. Mo eo e , no special ea u es ega ding gene, ORF, 5
0
UTR
o 3
0
UTR leng h, o GC con en we e ound among he DEGs upon a S b ea men (da a
no shown).
Focusing on HepG2 cells, which co espond o he cell line ou inely s udied in ou
labo a o y, when genes a e analyzed indi idually (see Figu e 2A), hose showing he high-
Cance s 2022,14, 1204 7 o 18
es posi i e log
2
(FC) wi h he lowes p- alue we e mainly s ess- esponse genes such as
INHBE,ATF3,NUPR1,PPP1R13B,PPP1R15A (also known as GADD34), DDIT3,DUSP1,
DUSP8, o ERN1, as well as genes such as PDGFA (Pla ele De i ed G ow h Fac o subuni
A) and VEGFA (Vascula Endo helial G ow h Fac o A), which co espond o g ow h ac-
o s ha ac i a e he PDGFR and VEGFR ecep o s, espec i ely, in cha ge o ansducing
hei ex acellula signals in o he cell and desc ibed as di ec a ge s o S b [
10
,
24
]. Thei
up egula ion by S b migh be ela ed o seconda y cell esponse as a consequence o he
inhibi ion o PDGFR and VEGFR ecep o s. Consis en ly, mos abo emen ioned genes
egula e impo an cellula p ocesses leading o inhibi ion o cell g ow h and p oli e a ion
and/o induc ion o apop osis. As examples, INHBE is a membe o he TGF-be a ( ans-
o ming g ow h ac o -be a) supe amily o p o ein genes, which encodes a p ep op o ein
ha equi es p o eoly ical p ocessing o gene a e he inhibin be a E subuni . Inhibins down-
egula e di e en cellula p ocesses, among hem cell p oli e a ion and apop osis [
25
,
26
]. In
ag eemen wi h ou da a, i has been epo ed ha INHBE is up egula ed unde condi ions
o endoplasmic e iculum (ER) s ess, in which i is in ol ed in he S b signaling [
13
,
27
].
In addi ion, DUSPs dephospho yla e many key signaling molecules, including MAPKs,
leading o he educ ion in he du a ion, magni ude, o spa io empo al p o iles o he
ac i i ies o MAPKs [
28
]. ATF3, a gene o a ansc ip ional ac o ha unc ions in gene al
adap i e esponses and whose exp ession is induced by a ious s imuli including ER
s ess [
29
], is also up egula ed upon he S b ea men . NUPR1 is a ansc ip ion egula o
ha induces au ophagy and apop osis h ough up egula ion o ER s ess- ela ed ac o s in-
cluding DDIT3 [
30
]. DDIT3, also known as CHOP o GADD153, is a cen al ansc ip ional
ac o , also induced by ER s ess, ha igge s apop osis h ough inhibi ion o BCL2 and
up egula ion o BIM, which egula e BAX-BAK-media ed mi ochond ial ou e memb ane
pe meabiliza ion [
31
,
32
]. We ha e also p e iously shown ha S b induced a sus ained and
p og essi e inc ease in CHOP exp ession by Wes e n blo analysis [
13
]. Finally, i is wo h
men ioning ano he example o an up egula ed gene ha is ERN1, which encodes he ans-
memb ane kinase IRE1, which unc ions as a gene al senso o un olded p o eins du ing he
ac i a ion o he un olded p o ein esponse (UPR) upon ER s ess [
33
]. Addi ional DEGs
showing up egula ion co esponded o RAB42 and EMMOD2 ela ed o GTP-binding o
GTPase ac i a ion signaling ansduc ion o FBXO9 and TRIM56 ela ed o a ubiqui in
ligase unc ion. On he o he hand, indi idual genes showing bo h lowes nega i e log
2
(FC)
and p- alue co esponded o chape ones, and co-chape one p o eins ha alle ia e he
endency o p e-exis ing p o eins om agg ega ion o help he olding o nascen ones [
34
].
Thus, HSPA1A,HSPA8,DNAJA1 and HSPA1B a e among he genes showing he mos
signi ican down egula ion (Figu e 2A). This esul is, howe e , pa adoxical since he ER
s ess caused by S b leads o he ac i a ion o UPR, hus, equi ing u he cla i ica ion.
Simila esul s o hese ound o HepG2 cells we e also unco e ed o SNU423 cells when
ea ed wi h S b (Figu e 2B), indica ing he obus ness o he cellula esponses o his d ug.
Nex , we pe o med en ichmen analyses o di e en ially exp essed genes using
he REACTOME da abase o iden i y he biological signi icance o he genes a ec ed
by he S b ea men common o bo h li e cance cell lines o his s udy. Figu e 3A
summa izes he 20 o e - ep esen ed REACTOME e ms which a e signi ican ly associa ed
wi h he up egula ed genes. This analysis sugges ed ha he up egula ed DEGs we e
mos signi ican ly ca ego ized in o unc ional g oups ela ed o ci cadian egula ion, g oup
o pa hways ela ed o phospho yla ed eIF2-alpha ansla ion ac o , FOXO-media ed
ansc ip ion, me abolism o di e se lipids, e en s o memb ane a icking, i s egula ion
by RAB GTPases and UPR, anspo o amino acids and ino ganic ca ions, biogenesis
o mi ochond ia, apop osis media ed by BH3-only p o eins; s ikingly, he ac i a ion o
he signaling by ecep o y osine kinases, which is he ou e ha S b mainly inhibi s, is
among he ca ego ies ha a e also up egula ed; his migh be in e p e ed as a cellula
esponse o he S b inhibi ion in o de o egain cellula homeos asis. Figu e 3B shows he
20 o e - ep esen ed REACTOME e ms which a e down egula ed by S b. These mainly
include he ou es o syn hesis o choles e ol and s e oid, DNA eplica ion, me abolism o
Cance s 2022,14, 1204 8 o 18
RNA, and cell cycle. O he p ocesses such as ansla ion and o ma ion o he mi ochond ial
espi a o y complex I we e also down egula ed; again, as a possible adap a ion mechanism,
S b up egula es he ansc ip ional ac i a ion o mi ochond ial biogenesis (Figu e 3A).
Thus, we conclude ha S b bo h induces he ac i a ion o he exp ession o genes belonging
o pa hways in ol ed in signal ansduc ion, ha egula e cell me abolism, belong o he
in eg a ed s ess esponse and igge apop osis and nega i ely a ec s he exp ession o
genes mainly in ol ed in cell g ow h, cell cycle con ol, and p oli e a ion.
Cance s 2022, 14, x 8 o 18
Figu e 2. Di e en ially exp essed genes in HepG2 (A) and SNU423 (B) cells upon So a enib ea -
men (10 µM, 12 h) de ec ed using RNA-seq. The Volcano plo illus a es selec ed ansc ip s ha
show signi ican mis egula ion. The p- alues a e plo ed in a −log10 o ma as y- alues and old
change o he mRNAs a e plo ed in a log2 o ma as x- alues. Rep esen a i e ansc ip s ha
showed signi ican di e en ial exp ession a e indica ed (blue). The es o genes a e shown in g ey;
densi y o genes is ep esen ed by a da ke g ey in ensi y.
Nex , we pe o med en ichmen analyses o di e en ially exp essed genes using he
REACTOME da abase o iden i y he biological signi icance o he genes a ec ed by he
S b ea men common o bo h li e cance cell lines o his s udy. Figu e 3A summa izes
he 20 o e - ep esen ed REACTOME e ms which a e signi ican ly associa ed wi h he
up egula ed genes. This analysis sugges ed ha he up egula ed DEGs we e mos signi -
ican ly ca ego ized in o unc ional g oups ela ed o ci cadian egula ion, g oup o pa h-
ways ela ed o phospho yla ed eIF2-alpha ansla ion ac o , FOXO-media ed ansc ip-
ion, me abolism o di e se lipids, e en s o memb ane a icking, i s egula ion by RAB
GTPases and UPR, anspo o amino acids and ino ganic ca ions, biogenesis o mi o-
chond ia, apop osis media ed by BH3-only p o eins; s ikingly, he ac i a ion o he sig-
naling by ecep o y osine kinases, which is he ou e ha S b mainly inhibi s, is among
he ca ego ies ha a e also up egula ed; his migh be in e p e ed as a cellula esponse o
he S b inhibi ion in o de o egain cellula homeos asis. Figu e 3B shows he 20 o e -
ep esen ed REACTOME e ms which a e down egula ed by S b. These mainly include
he ou es o syn hesis o choles e ol and s e oid, DNA eplica ion, me abolism o RNA,
and cell cycle. O he p ocesses such as ansla ion and o ma ion o he mi ochond ial
espi a o y complex I we e also down egula ed; again, as a possible adap a ion mecha-
nism, S b up egula es he ansc ip ional ac i a ion o mi ochond ial biogenesis (Figu e
3A). Thus, we conclude ha S b bo h induces he ac i a ion o he exp ession o genes
belonging o pa hways in ol ed in signal ansduc ion, ha egula e cell me abolism, be-
long o he in eg a ed s ess esponse and igge apop osis and nega i ely a ec s he ex-
p ession o genes mainly in ol ed in cell g ow h, cell cycle con ol, and p oli e a ion.
Figu e 2.
Di e en ially exp essed genes in HepG2 (
A
) and SNU423 (
B
) cells upon So a enib ea men
(10
µ
M, 12 h) de ec ed using RNA-seq. The Volcano plo illus a es selec ed ansc ip s ha show
signi ican mis egula ion. The p- alues a e plo ed in a
−
log
10
o ma as y- alues and old change
o he mRNAs a e plo ed in a log
2
o ma as x- alues. Rep esen a i e ansc ip s ha showed
signi ican di e en ial exp ession a e indica ed (blue). The es o genes a e shown in g ey; densi y o
genes is ep esen ed by a da ke g ey in ensi y.
3.2. So a enib Inhibi s Cell G ow h
Se e al s udies ha e clea ly shown ha ea men wi h S b educed cell iabili y and
p omo ed cell dea h in HCC cell lines (e.g., [
13
] and e e ences he ein). Consis en ly,
Figu e 4A shows a subs an ial dec ease in cell p oli e a ion upon he ea men o S b
in ou g owing condi ions, which is compa ible wi h he cy o oxic ac i i y o his d ug.
In e es ingly, ou RNA-Seq analysis ound, among he di e en unc ional g oups o
down egula ed DEGs, hose ela ed o cell g ow h, ibosome biogenesis, ansla ion, co-
ansla ion p o ein a ge ing o memb ane, cell cycle DNA eplica ion and epai , cell cycle
checkpoin s, and s e ol biosyn hesis. All showed high nega i e alues o no malized
en ichmen sco e (NES) in he GSEA analysis, hus e lec ing a signi ican en ichmen o
hese pa hways in he lis o p edominan ly inhibi ed genes upon S b ea men in HepG2
cells (Table S3 and Figu e 3A).
Cance s 2022,14, 1204 9 o 18
Cance s 2022, 14, x 9 o 18
Figu e 3. O e ep esen a ion analysis (ORA) o commonly up egula ed (A) and down egula ed (B)
genes in bo h HepG2 and SNU423 cells ea ed wi h So a enib (10 µM, 12 h) using he REACTOME
da abase. The 20 ca ego ies wi h be e p- alues as well as a ew selec ed ones (e.g., signaling by
ecep o y osine kinase, ansla ion, complex I biogenesis) a e shown. The ca ego ies o ela ed bi-
ological p ocesses a e labeled in he same colo . The numbe o genes wi h p- alue < 0.001 in he
di e en ca ego ies (n) is depic ed. The p- alues we e −log10 ans o med.
3.2. So a enib Inhibi s Cell G ow h
Se e al s udies ha e clea ly shown ha ea men wi h S b educed cell iabili y and
p omo ed cell dea h in HCC cell lines (e.g., [13] and e e ences he ein). Consis en ly, Fig-
u e 4A shows a subs an ial dec ease in cell p oli e a ion upon he ea men o S b in ou
g owing condi ions, which is compa ible wi h he cy o oxic ac i i y o his d ug. In e es -
ingly, ou RNA-Seq analysis ound, among he di e en unc ional g oups o down egu-
la ed DEGs, hose ela ed o cell g ow h, ibosome biogenesis, ansla ion, co- ansla ion
p o ein a ge ing o memb ane, cell cycle DNA eplica ion and epai , cell cycle check-
poin s, and s e ol biosyn hesis. All showed high nega i e alues o no malized en ich-
men sco e (NES) in he GSEA analysis, hus e lec ing a signi ican en ichmen o hese
pa hways in he lis o p edominan ly inhibi ed genes upon S b ea men in HepG2 cells
(Table S3 and Figu e 3A).
Figu e 4. E ec s o So a enib on cell p oli e a ion and cell cycle. (A) B dU inco po a ion assay on
HepG2 cells ea ed o no wi h 10 µM So a enib. Resul s a e exp essed as he mean ± S.D. o h ee
Figu e 3.
O e ep esen a ion analysis (ORA) o commonly up egula ed (
A
) and down egula ed
(B) genes
in bo h HepG2 and SNU423 cells ea ed wi h So a enib (10
µ
M, 12 h) using he REACTOME
da abase. The 20 ca ego ies wi h be e p- alues as well as a ew selec ed ones (e.g., signaling by
ecep o y osine kinase, ansla ion, complex I biogenesis) a e shown. The ca ego ies o ela ed
biological p ocesses a e labeled in he same colo . The numbe o genes wi h p- alue < 0.001 in he
di e en ca ego ies (n) is depic ed. The p- alues we e −log10 ans o med.
Cance s 2022, 14, x 9 o 18
Figu e 3. O e ep esen a ion analysis (ORA) o commonly up egula ed (A) and down egula ed (B)
genes in bo h HepG2 and SNU423 cells ea ed wi h So a enib (10 µM, 12 h) using he REACTOME
da abase. The 20 ca ego ies wi h be e p- alues as well as a ew selec ed ones (e.g., signaling by
ecep o y osine kinase, ansla ion, complex I biogenesis) a e shown. The ca ego ies o ela ed bi-
ological p ocesses a e labeled in he same colo . The numbe o genes wi h p- alue < 0.001 in he
di e en ca ego ies (n) is depic ed. The p- alues we e −log10 ans o med.
3.2. So a enib Inhibi s Cell G ow h
Se e al s udies ha e clea ly shown ha ea men wi h S b educed cell iabili y and
p omo ed cell dea h in HCC cell lines (e.g., [13] and e e ences he ein). Consis en ly, Fig-
u e 4A shows a subs an ial dec ease in cell p oli e a ion upon he ea men o S b in ou
g owing condi ions, which is compa ible wi h he cy o oxic ac i i y o his d ug. In e es -
ingly, ou RNA-Seq analysis ound, among he di e en unc ional g oups o down egu-
la ed DEGs, hose ela ed o cell g ow h, ibosome biogenesis, ansla ion, co- ansla ion
p o ein a ge ing o memb ane, cell cycle DNA eplica ion and epai , cell cycle check-
poin s, and s e ol biosyn hesis. All showed high nega i e alues o no malized en ich-
men sco e (NES) in he GSEA analysis, hus e lec ing a signi ican en ichmen o hese
pa hways in he lis o p edominan ly inhibi ed genes upon S b ea men in HepG2 cells
(Table S3 and Figu e 3A).
Figu e 4. E ec s o So a enib on cell p oli e a ion and cell cycle. (A) B dU inco po a ion assay on
HepG2 cells ea ed o no wi h 10 µM So a enib. Resul s a e exp essed as he mean ± S.D. o h ee
Figu e 4.
E ec s o So a enib on cell p oli e a ion and cell cycle. (
A
) B dU inco po a ion assay on
HepG2 cells ea ed o no wi h 10
µ
M So a enib. Resul s a e exp essed as he mean
±
S.D. o h ee
independen expe imen s. S a is ical signi icance was analyzed using S uden ’s es (**** p< 0.0001).
(
B
) Cell cycle p o iles ob ained by FACS o HepG2 cells ea ed o no wi h 10
µ
M So a enib. Fo
measu ing DNA con en , cells we e s ained wi h p opidium iodide. G1, S and G2/M phases a e
indica ed. The pe cen age o cells a he di e en phases a e shown in he his og am. Resul s a e
exp essed as he mean
±
S.D. alues o h ee independen expe imen s. S a is ical signi icance was
analyzed using S uden ’s es (* p< 0.05; ** p< 0.01).
Rega ding he cell cycle and DNA eplica ion ca ego ies, we ound ha he le els o
di e en E2F iso o ms and o he kinase CDK4 we e signi ican ly and mildly down egu-
la ed, espec i ely. In ag eemen wi h a educ ion in he unc ion o di e en E2F iso o ms,
he mos se e e one o E2F2, S b causes a clea delay a he S and G2 phases o he cell cycle
in HepG2 cells (Figu e 4B). I should be emphasized ha a selec i e CDK4/6 inhibi o , Pal-
Cance s 2022,14, 1204 16 o 18
13.
Rod íguez-He nández, M.A.; González, R.; de la Rosa, A.J.; Gallego, P.; O doñez, R.; Na a o-Villa án, E.; Con e as, L.;
Rod íguez-A ibas, M.; González-Gallego, J.; Álamo-Ma ínez, J.M.; e al. Molecula cha ac e iza ion o au ophagic and apop o ic
signaling induced by so a enib in li e cance cells. J. Cell. Physiol. 2018,234, 692–708. [C ossRe ] [PubMed]
14.
Fe nando, J.; Sancho, P.; Fe nández-Rod íguez, C.M.; Lledó, J.L.; Caja, L.; Campbell, J.S.; Faus o, N.; Fab ega , I. So a enib
sensi izes hepa ocellula ca cinoma cells o physiological apop o ic s imuli. J. Cell. Physiol. 2012,227, 1319–1325. [C ossRe ]
15.
Gau hie , A.; Ho, M. Role o so a enib in he ea men o ad anced hepa ocellula ca cinoma: An upda e. Hepa ol. Res.
2013
,43,
147–154. [C ossRe ]
16.
Rod íguez-He nández, M.A.; Chap es o-Ga zón, R.; Cadenas, M.; Na a o-Villa Án, E.; Neg e e, M.; Gómez-B a o, M.A.;
Vic o , V.M.; Padillo, F.J.; Mun ané, J. Di e en ial e ec i eness o y osine kinase inhibi o s in 2D/3D cul u e acco ding o cell
di e en ia ion, p53 s a us and mi ochond ial espi a ion in li e cance cells. Cell Dea h Dis. 2020,11, 339. [C ossRe ]
17.
López-Te ada, D.; Guna a ne, P.H.; Adesina, A.M.; Pulliam, J.; Hoang, D.M.; Nguyen, Y.; Mis e a, T.A.; Ma golin, J.; Finegold,
M.J. His ologic sub ypes o hepa oblas oma a e cha ac e ized by di e en ial canonical Wn and No ch pa hway ac i a ion in
DLK+ p ecu so s. Hum. Pa hol. 2009,40, 783–794. [C ossRe ]
18.
Pa k, J.G.; Lee, J.H.; Kang, M.S.; Pa k, K.J.; Jeon, Y.M.; Lee, H.J.; Kwon, H.S.; Pa k, H.S.; Yeo, K.S.; Lee, K.U.; e al. Cha ac e iza ion
o cell lines es ablished om human hepa ocellula ca cinoma. In . J. Cance 1995,62, 276–282. [C ossRe ]
19.
Sub amanian, A.; Tamayo, P.; Moo ha, V.K.; Mukhe jee, S.; Ebe , B.L.; Gille e, M.A.; Paulo ich, A.; Pome oy, S.L.; Golub, T.R.;
Lande , E.S.; e al. Gene se en ichmen analysis: A knowledge-based app oach o in e p e ing genome-wide exp ession p o iles.
P oc. Na l. Acad. Sci. USA 2005,102, 15545–15550. [C ossRe ]
20.
Moo ha, V.K.; Lindg en, C.M.; E iksson, K.F.; Sub amanian, A.; Sihag, S.; Leha , J.; Puigse e , P.; Ca lsson, E.; Ridde s ale, M.;
Lau ila, E.; e al. PGC-1alpha- esponsi e genes in ol ed in oxida i e phospho yla ion a e coo dina ely down egula ed in human
diabe es. Na . Gene . 2003,34, 267–273. [C ossRe ]
21.
Jassal, B.; Ma hews, L.; Vi e i, G.; Gong, C.; Lo en e, P.; Fab ega , A.; Sidi opoulos, K.; Cook, J.; Gillespie, M.; Haw, R.; e al. The
eac ome pa hway knowledgebase. Nucleic Acids Res. 2020,48, D498–D503. [C ossRe ] [PubMed]
22.
Mo ine, M.J.; McMonagle, J.; Toomey, S.; Reynolds, C.M.; Moloney, A.P.; Go mley, I.C.; Gao a, P.O.; Roche, H.M. Bi-di ec ional
gene se en ichmen and canonical co ela ion analysis iden i y key die -sensi i e pa hways and bioma ke s o me abolic
synd ome. BMC Bioin o m. 2010,11, 499. [C ossRe ] [PubMed]
23. Micalle , L.; Rodge s, P. eule APE: D awing a ea-p opo ional 3-Venn diag ams using ellipses. PLoS ONE 2014,9, e101717.
24.
Molina-Ruiz, F.J.; González, R.; Rod íguez-He nández, M.A.; Na a o-Villa án, E.; Padillo, F.J.; Mun ané, J. An i umo al ac i i y
o So a enib in hepa ocellula ca cinoma: E ec s on cell su i al and dea h pa hways, cell me abolism ep og amming, and
ni osa i e and oxida i e s ess. C i . Re . Oncog. 2016,21, 413–432. [C ossRe ]
25.
B üning, A.; Ma singou, C.; B em, G.J.; Rahmeh, M.; Mylonas, I. Inhibin be a E is up egula ed by d ug-induced endoplasmic
e iculum s ess as a ansc ip ional a ge gene o ATF4. Toxicol. Appl. Pha macol. 2012,264, 300–304. [C ossRe ]
26. Phillips, D.J.; Wood u , T.K. Inhibin: Ac ions and signalling. G ow h Fac o s 2004,22, 13–18. [C ossRe ]
27.
Be na d, D.J.; Chapman, S.C.; Wood u , T.K. Mechanisms o inhibin signal ansduc ion. Recen P og. Ho m. Res.
2001
,56,
417–450. [C ossRe ]
28.
Chen, H.F.; Chuang, H.C.; Tan, T.H. Regula ion o Dual-Speci ici y Phospha ase (DUSP) ubiqui ina ion and p o ein s abili y. In . J.
Mol. Sci. 2019,20, 2668. [C ossRe ]
29.
Lu, D.; Chen, J.; Hai, T. The egula ion o ATF3 gene exp ession by mi ogen-ac i a ed p o ein kinases. Biochem. J.
2007
,401,
559–567. [C ossRe ]
30.
Cai, D.; Huang, E.; Luo, B.; Yang, Y.; Zhang, F.; Liu, C.; Lin, Z.; Xie, W.B.; Wang, H. Nup 1/Chop signal axis is in ol ed in
mi ochond ion- ela ed endo helial cell apop osis induced by me hamphe amine. Cell Dea h Dis. 2016,7, e2161. [C ossRe ]
31.
Wol gang, C.D.; Chen, B.P.; Ma indale, J.L.; Holb ook, N.J.; Hai, T. gadd153/Chop10, a po en ial a ge gene o he ansc ip ional
ep esso ATF3. Mol. Cell. Biol. 1997,17, 6700–6707. [C ossRe ]
32.
Ve aillie, T.; Salaza , M.; Velasco, G.; Agos inis, P. Linking ER s ess o su ophagy: Po en ial implica ions o cance he apy. In . J.
Cell Biol. 2010,2010, 930509. [C ossRe ] [PubMed]
33. Chen, Y.; B andizzi, F. IRE1: ER s ess senso and cell a e execu o . T ends Cell Biol. 2013,23, 547–555. [C ossRe ] [PubMed]
34.
Kim, Y.E.; Hipp, M.S.; B ache , A.; Haye -Ha l, M.; Ha l, F.U. Molecula chape one unc ions in p o ein olding and p o eos asis.
Annu. Re . Biochem. 2013,82, 323–355. [C ossRe ] [PubMed]
35.
Bolla d, J.; Miguela, V.; Ruiz de Gala e a, M.; Venka esh, A.; Bian, C.B.; Robe o, M.P.; To a , V.; Sia, D.; Molina-Sánchez, P.;
Nguyen, C.B.; e al. Palbociclib (PD-0332991), a selec i e CDK4/6 inhibi o , es ic s umou g ow h in p eclinical models o
hepa ocellula ca cinoma. Gu 2017,66, 1286–1296. [C ossRe ] [PubMed]
36.
Smi s, V.A.J.; Cab e a, E.; F ei e, R.; Gillespie, D.A. Claspin-checkpoin adap o and DNA eplica ion ac o . FEBS J.
2019
,286,
441–455. [C ossRe ] [PubMed]
37.
Ma échal, A.; Zou, L. DNA damage sensing by he ATM and ATR kinases. Cold Sp ing Ha b. Pe spec . Biol.
2013
,5, a012716.
[C ossRe ]
38. K okan, H.E.; Bjø ås, M. Base excision epai . Cold Sp ing Ha b. Pe spec . Biol. 2013,5, a012583. [C ossRe ]
39.
Richly, H.; Schul heis, B.; Adamie z, I.A.; Kupsch, P.; G ube , M.; Hilge , R.A.; Ludwig, M.; B endel, E.; Ch is ensen, O.;
S umbe g, D. Combina ion o so a enib and doxo ubicin in pa ien s wi h ad anced hepa ocellula ca cinoma: Resul s om a
phase I ex ension ial. Eu . J. Cance 2009,45, 579–587. [C ossRe ]

Cance s 2022,14, 1204 17 o 18
40.
Yang, X.D.; Kong, F.E.; Qi, L.; Lin, J.X.; Yan, Q.; Loong, J.H.C.; Xi, S.Y.; Zhao, Y.; Zhang, Y.; Yuan, Y.F.; e al. PARP inhibi o
Olapa ib o e comes So a enib esis ance h ough eshaping he plu ipo en ansc ip ome in hepa ocellula ca cinoma. Mol.
Cance 2021,20, 20. [C ossRe ]
41.
Yu, W.; Gu, K.; Yu, Z.; Yuan, D.; He, M.; Ma, N.; Lai, S.; Zhao, J.; Ren, Z.; Zhang, X.; e al. So a enib po en ia es i adia ion e ec in
hepa ocellula ca cinoma in i o and in i o. Cance Le . 2013,329, 109–117. [C ossRe ] [PubMed]
42.
Wang, C.; Wang, H.; Lie ink, C.; du Cha inie , A.; Gao, D.; Jin, G.; Jin, H.; Beije sbe gen, R.L.; Qin, W.; Be na ds, R. CDK12
inhibi ion media es DNA damage and is syne gis ic wi h so a enib ea men in hepa ocellula ca cinoma. Gu
2020
,69, 727–736.
[C ossRe ] [PubMed]
43.
In de S o h, L.; Tha ehalli, U.; Günes, C.; Lechel, A. Telome es and Telome ase in he De elopmen o Li e Cance . Cance s
2020,12, 2048. [C ossRe ]
44.
Zhou, T.; L , X.; Guo, X.; Ruan, B.; Liu, D.; Ding, R.; Gao, Y.; Ding, J.; Dou, K.; Chen, Y. RACK1 modula es apop osis induced by
so a enib in HCC cells by in e e ing wi h he IRE1/XBP1 axis. Oncol. Rep. 2015,33, 3006–3014. [C ossRe ] [PubMed]
45.
Shi, Y.H.; Ding, Z.B.; Zhou, J.; Hui, B.; Shi, G.M.; Ke, A.W.; Wang, X.Y.; Dai, Z.; Peng, Y.F.; Gu, C.Y.; e al. Ta ge ing au ophagy
enhances so a enib le hali y o hepa ocellula ca cinoma ia ER s ess- ela ed apop osis. Au ophagy
2011
,7, 1159–1172. [C ossRe ]
[PubMed]
46.
Fang, C.; Xie, H.; Zhao, J.; Wang, W.; Hou, H.; Zhang, B.; Zhou, D.; Geng, X. eIF4E-eIF4G complex inhibi ion syne gis ically
enhances he e ec o so a enib in hepa ocellula ca cinoma. An icance . D ugs 2021,32, 822–828. [C ossRe ]
47.
Honma, Y.; Shimizu, S.; Takeha a, T.; Ha ada, M. So a enib enhances p o easome inhibi o -induced cell dea h ia inac i a ion o
Ak and s ess-ac i a ed p o ein kinases. J. Gas oen e ol. 2014,49, 517–526. [C ossRe ]
48.
Jiang, C.; Xu, R.; Li, X.X.; Zhou, Y.F.; Xu, X.Y.; Yang, Y.; Wang, H.Y.; Zheng, X.F.S. So a enib and Ca ilzomib syne gis ically inhibi
he p oli e a ion, su i al, and me as asis o hepa ocellula ca cinoma. Mol. Cance The . 2018,17, 2610–2621. [C ossRe ]
49.
Chen, K.F.; Yu, H.C.; Liu, T.H.; Lee, S.S.; Chen, P.J.; Cheng, A.L. Syne gis ic in e ac ions be ween so a enib and bo ezomib in
hepa ocellula ca cinoma in ol e PP2A-dependen Ak inac i a ion. J. Hepa ol. 2010,52, 88–95. [C ossRe ]
50.
Rod íguez-He nández, M.A.; de la C uz-Ojeda, P.; López-G ueso, M.J.; Na a o-Villa án, E.; Requejo-Aguila , R.; Cas ejón-
Vega, B.; Neg e e, M.; Gallego, P.; Vega-Ochoa, A.; Vic o , V.M.; e al. In eg a ed molecula signaling in ol ing mi ochond ial
dys unc ion and al e a ion o cell me abolism induced by y osine kinase inhibi o s in cance . Redox Biol.
2020
,36, 101510.
[C ossRe ]
51.
Fiume, L.; Mane ba, M.; Ve aino, M.; Di S e ano, G. E ec o so a enib on he ene gy me abolism o hepa ocellula ca cinoma
cells. Eu . J. Pha macol. 2011,670, 39–43. [C ossRe ]
52.
Teso i, V.; Piscaglia, A.C.; Samengo, D.; Ba ba, M.; Be na dini, C.; Sca ena, R.; Pon oglio, A.; Cas ellini, L.; Spelb ink, J.N.;
Maulucci, G.; e al. The mul ikinase inhibi o So a enib enhances glycolysis and syne gizes wi h glycolysis blockade o cance
cell killing. Sci. Rep. 2015,5, 9149. [C ossRe ] [PubMed]
53.
Zhang, C.; Liu, Z.; Bunke , E.; Ramí ez, A.; Lee, S.; Peng, Y.; Tan, A.C.; Eckha d , S.G.; Chapnick, D.A.; Liu, X. So a enib a ge s
he mi ochond ial elec on anspo chain complexes and ATP syn hase o ac i a e he PINK1-Pa kin pa hway and modula e
cellula d ug esponse. J. Biol. Chem. 2017,292, 15105–15120. [C ossRe ] [PubMed]
54.
Rod íguez-He nández, M.A.; de la C uz-Ojeda, P.; Gallego, P.; Na a o-Villa án, E.; S anko a, P.; del Campo, J.A.; Kuce a, O.;
Elkala , M.; Maseko, T.E.; Ce inko a, Z.; e al. Dose-dependen egula ion o mi ochond ial unc ion and cell dea h pa hway by
so a enib in li e cance cells. Biochem. Pha macol. 2020,176, 113902. [C ossRe ]
55.
Paech, F.; Minga d, C.; G unig, D.; Abegg, V.F.; Boui bi , J.; K ähenbühl, S. Mechanisms o mi ochond ial oxici y o he kinase
inhibi o s pona inib, ego a enib and so a enib in human hepa ic HepG2 cells. Toxicology 2018,395, 34–44. [C ossRe ]
56.
Li, Y.; Xia, J.; Shao, F.; Zhou, Y.; Yu, J.; Wu, H.; Du, J.; Ren, X. So a enib induces mi ochond ial dys unc ion and exhibi s syne gis ic
e ec wi h cys eine deple ion by p omo ing HCC cells e op osis. Biochem. Biophys. Res. Commun.
2021
,534, 877–884. [C ossRe ]
57.
Fan, G.; Wei, X.; Xu, X. Is he e a o so a enib o e ? A e iew o he li e a u e. The . Ad . Med. Oncol.
2020
,12, 1758835920927602.
[C ossRe ]
58.
Liu, G.; Kuang, S.; Cao, R.; Wang, J.; Peng, Q.; Sun, C. So a enib kills li e cance cells by dis up ing SCD1-media ed syn hesis o
monounsa u a ed a y acids ia he ATP-AMPK-mTOR-SREBP1 signaling pa hway. FASEB J.
2019
,33, 10089–10103. [C ossRe ]
[PubMed]
59.
Yin, F.; Feng, F.; Wang, L.; Wang, X.; Li, Z.; Cao, Y. SREBP-1 inhibi o Be ulin enhances he an i umo e ec o So a enib on
hepa ocellula ca cinoma ia es ic ing cellula glycoly ic ac i i y. Cell Dea h Dis. 2019,10, 672. [C ossRe ]
60.
Eun, H.S.; Cho, S.Y.; Lee, B.S.; Seong, I.O.; Kim, K.H. P o iling cy och ome P450 amily 4 gene exp ession in human hepa ocellula
ca cinoma. Mol. Med. Rep. 2018,18, 4865–4876. [C ossRe ]
61.
Dong, X.C.; Chowdhu y, K.; Huang, M.; Kim, H.G. Signal ansduc ion and molecula egula ion in a y li e disease. An ioxid.
Redox Signal. 2021,35, 689–717. [C ossRe ] [PubMed]
62.
Che, L.; Chi, W.; Qiao, Y.; Zhang, J.; Song, X.; Liu, Y.; Li, L.; Jia, J.; Pilo, M.G.; Wang, J.; e al. Choles e ol biosyn hesis suppo s he
g ow h o hepa oca cinoma lesions deple ed o a y acid syn hase in mice and humans. Gu 2020,69, 177–186. [C ossRe ]
63.
Di Paolo, G.; De Camilli, P. Phosphoinosi ides in cell egula ion and memb ane dynamics. Na u e
2006
,443, 651–657. [C ossRe ]
[PubMed]
64. Reppe , S.M.; Wea e , D.R. Coo dina ion o ci cadian iming in mammals. Na u e 2002,418, 935–941. [C ossRe ]
65. Bass, J.; Takahashi, J.S. Ci cadian in eg a ion o me abolism and ene ge ics. Science 2010,330, 1349–1354. [C ossRe ] [PubMed]
Cance s 2022,14, 1204 18 o 18
66.
Reinke, H.; Ashe , G. Ci cadian clock con ol o li e me abolic unc ions. Gas oen e ology
2016
,150, 574–580. [C ossRe ]
[PubMed]
67.
Jacobi, D.; Liu, S.; Bu kewi z, K.; Ko y, N.; Knudsen, N.H.; Alexande , R.K.; Unlu u k, U.; Li, X.; Kong, X.; Hyde, A.L.; e al.
Hepa ic Bmal1 egula es hy hmic mi ochond ial dynamics and p omo es me abolic i ness. Cell Me ab.
2015
,22, 709–720.
[C ossRe ]
68.
Saha , S.; Sassone-Co si, P. Me abolism and cance : The ci cadian clock connec ion. Na . Re . Cance
2009
,9, 886–896. [C ossRe ]
69.
Fuchs, B.C.; Fujii, T.; Do man, J.D.; Goodwin, J.M.; Zhu, A.X.; Lanu i, M.; Tanabe, K.K. Epi helial- o-mesenchymal ansi ion and
in eg in-linked kinase media e sensi i i y o epide mal g ow h ac o ecep o inhibi ion in human hepa oma cells. Cance Res.
2008,68, 2391–2399. [C ossRe ]
70.
Hi sch ield, H.; Bian, C.B.; Higashi, T.; Nakagawa, S.; Zeleke, T.Z.; Nai , V.D.; Fuchs, B.C.; Hoshida, Y. In Vi o modeling o
hepa ocellula ca cinoma molecula sub ypes o an i-cance d ug assessmen . Exp. Mol. Med. 2018,50, e419. [C ossRe ]
71. Clay on, N.S.; Ridley, A.J. Ta ge ing Rho GTPase signaling ne wo ks in cance . F on . Cell De . Biol. 2020,8, 222. [C ossRe ]
72.
B uix, J.; Go es, G.J.; Mazza e o, V. Hepa ocellula ca cinoma: Clinical on ie s and pe spec i es. Gu
2014
,63, 844–855.
[C ossRe ] [PubMed]
73.
Paech, F.; Boui bi , J.; K ähenbaühl, S. Hepa ocellula oxici y associa ed wi h y osine kinase inhibi o s: Mi ochond ial damage
and inhibi ion o glycolysis. F on . Pha macol. 2017,8, 367. [C ossRe ] [PubMed]
74.
Asgha , U.; Meye , T. A e he e oppo uni ies o chemo he apy in he ea men o hepa ocellula cance ? J. Hepa ol.
2012
,56,
686–695. [C ossRe ] [PubMed]
75.
Regan-Fend , K.; Li, D.; Reyes, R.; Yu, L.; Wani, N.A.; Hu, P.; Jacob, S.T.; Ghoshal, K.; Payne, P.R.O.; Mo iwala, T. T ansc ip omics-
based d ug epu posing app oach iden i ies no el d ugs agains So a enib- esis an hepa ocellula ca cinoma. Cance s
2020
,
12, 2730. [C ossRe ] [PubMed]
76.
Ye, L.; Maye le, J.; Ziesch, A.; Rei e , F.P.; Ge bes, A.L.; De Toni, E.N. The PI3K inhibi o copanlisib syne gizes wi h so a enib o
induce cell dea h in hepa ocellula ca cinoma. Cell. Dea h Disco . 2019,5, 86. [C ossRe ]
77.
Tang, Y.; Chen, J.; Li, J.; Zheng, Y.; Zhong, X.; Huang, S.; Chen, B.; Peng, B.; Zou, X.; Chen, X. P is ime in syne gis ically sensi izes
condi ionally ep og ammed pa ien de i ed-p ima y hepa ocellula ca cinoma cells o so a enib h ough endoplasmic e iculum
s ess and ROS gene a ion by modula ing Ak /FoxO1/p27(kip1) signaling pa hway. Phy omedicine 2021,86, 153563. [C ossRe ]
78.
¸Si in, N.; Elmas, L.; Secme, M.; Dodu ga, Y. In es iga ion o possible e ec s o apigenin, so a enib and combined applica ions on
apop osis and cell cycle in hepa ocellula cance cells. Gene 2020,737, 144428. [C ossRe ]