mic oo ganisms
A icle
Combined Use o he Ab105-2ϕ∆CI Ly ic Mu an
Phage and Di e en An ibio ics in Clinical Isola es o
Mul i-Resis an Acine obac e baumannii
Lucia Blasco 1,†, An on Amb oa 1,†, Ma ia Lopez 1, Lau a Fe nandez-Ga cia 1, Ines Ble io 1,
Rocio T as oy 1, Jose Ramos-Vi as 2, Tom Coenye 3, Felipe Fe nandez-Cuenca 4, Jo di Vila 5,
Luis Ma inez-Ma inez 6, Jesus Rod iguez-Baño 4, Al a o Pascual 4, Jose Miguel Cisne os 7,
Je onimo Pachon 7, Ge man Bou 1and Ma ia Tomas 1,*,‡
1
Mic obiology Depa men -Resea ch Ins i u e Biomedical A Co uña (INIBIC), Hospi al A Co uña (CHUAC),
Uni e si y o A Co uña (UDC), 15495 A Co uña, Spain; [email p o ec ed] (L.B.);
an on17@mundo- .com (A.A.); ma ia.lopez.diaz@se gas.es (M.L.); [email p o ec ed] (L.F.-G.);
[email p o ec ed] (I.B.); as oy[email p o ec ed] (R.T.); ge man.bou.a e alo@se gas.es (G.B.)
2Mic obiology Depa men -Resea ch Ins i u e Biomedical Valdecilla (IDIVAL), Hospi al Ma ques de
Valdecilla, 39008 San ande , Spain; [email p o ec ed]
3
Labo a o y o Pha maceu ical Mic obiology, Ghen Uni e si y, 9000 Gen , Belgium; T[email p o ec ed]
4
Clinical Uni o In ec ious Diseases, Mic obiology and P e en i e Medicine, Hospi al Uni e si a io Vi gen
Maca ena/Depa men o Mic obiology and Medicine, Uni e si y o Se ille/Biomedicine Ins i u e o
Se ille (IBIS), 41009 Se ille, Spain; [email p o ec ed] (F.F.-C.); [email p o ec ed] (J.R.-B.); [email p o ec ed] (A.P.)
5Ins i u e o Global Heal h o Ba celona (ISGlobal), Hospi al Clínic-Uni e si a de Ba celona,
170, 08036 Ba celona, Spain; [email p o ec ed]
6
Uni o Mic obiology, Uni e si y Hospi al Reina So
í
a, Depa men o Mic obiology, Uni e si y o C
ó
doba,
Maimonides Biomedical Resea ch Ins i u e o Co doba (IMIBIC), 14004 Co doba, Spain;
[email p o ec ed]
7
Clinical Uni o In ec ious Diseases, Mic obiology and P e en i e Medicine, Hospi al Uni e si a io Vi gen
del Rocío/Depa men o Mic obiology and Medicine, Uni e si y o Se ille/Biomedicine Ins i u e o
Se ille (IBIS), 41009 Se ille, Spain; [email p o ec ed] (J.M.C.); [email p o ec ed] (J.P.)
*Co espondence: ma.del.ma [email p o ec ed]; Tel.: +34-981-176-399; Fax: +34-981-178-273
†These au ho s equally con ibu ed o his wo k.
‡On Behal o S udy G oup on Mechanisms o Ac ion and Resis ance o An imic obials (GEMARA) o
Spanish Socie y o In ec ious Diseases and Clinical Mic obiology (SEIMC)/Spanish Ne wo k o he Resea ch
in In ec ious Diseases (REIPI).
Recei ed: 30 Sep embe 2019; Accep ed: 9 No embe 2019; Published: 12 No embe 2019


Abs ac :
Phage he apy is an abandoned an imic obial he apy ha has been esumed in ecen
yea s. In his s udy, we mu a ed a lysogenic phage om Acine obac e baumannii in o a ly ic
phage (Ab105-2phi
∆
CI) ha displayed an imic obial ac i i y agains A. baumannii clinical s ain
Ab177_GEIH-2000 (isola ed in he GEIH-REIPI Spanish Mul icen e A. baumannii S udy II 2000/2010,
Umb ella Genbank Biop ojec PRJNA422585, and o which me openem and imipenem MICs
o espec i ely, 32
µ
g/mL, and 16
µ
g/mL we e ob ained). We obse ed an
in i o
syne gis ic
an imic obial e ec ( educ ion o 4 log–7 log CFU/mL) be ween me openem and he ly ic phage in all
combina ions analyzed (Ab105-2phi
∆
CI mu an a 0.1, 1 and 10 MOI and me openem a 1/4 and 1/8
MIC).
Mo eo e , bac e ial
g ow h was educed by 8 log CFU/mL o he combina ion o imipenem
a 1/4 MIC plus ly ic phage (Ab105-2phi
∆
CI mu an ) and by 4 log CFU/mL o he combina ion o
imipenem a 1/8 MIC plus ly ic phage (Ab105-2phi
∆
CI mu an ) a bo h MOI 1 and 10. These esul s
we e con i med in
an in i o
model (G. mellonella), and he combina ion o imipenem and mu an
Ab105-2phi
∆
CI was mos e ec i e (p<0.05). This app oach could help o educe he eme gence o
phage esis an bac e ia and es o e sensi i i y o an ibio ics used o comba mul i- esis an s ains o
Acine obac e baumannii.
Mic oo ganisms 2019,7, 556; doi:10.3390/mic oo ganisms7110556 www.mdpi.com/jou nal/mic oo ganisms
Mic oo ganisms 2019,7, 556 2 o 14
Keywo ds:
Acine obac e baumannii; mul i esis an ; mu an ly ic phage; phage he apy;
an ibio ic-phage syne gy
1. In oduc ion
Mul i-d ug esis an (MDR) bac e ia, such as A. baumannii a e conside ed o be a majo conce n by
he Wo ld Heal h O ganiza ion (WHO), because o hei abili y o acqui e an imic obial esis ance ia
in insic cha ac e is ics and mechanisms (e.g., p esence o he ou e memb ane) o ia mechanisms
acqui ed by ho izon al gene ic ans e [1,2]. This si ua ion has led o an u gen need o de elop new
an imic obial agen s and o a enewed in e es in phage he apy. Phage he apy was i s de eloped in
he 1920s bu was abandoned in he Wes e n wo ld a e he disco e y o an ibio ics. Howe e , he use
o phage he apy con inued in Eas e n coun ies, such as Poland and USSR, whe e bac e iophages
a e used o he p ophylaxis and ea men o in ec ions, such as dysen e y, ulce s, and me hicillin
esis an S aphylococcus au eus (MRSA) in ec ions [3,4].
Phage he apy is now conside ed a eal op ion o ea ing MDR bac e ia, and he e a e some
examples o i s use in ea ing human pa ien s [
5
]. Phages a e bac e ial i uses, and like o he
i uses, hey a e obliga e pa asi es ha en e hos cells h ough mechanisms ha a e based on ecep o
ecogni ion. Gene ic ma e ial is hen injec ed in o he bac e ia and use he bac e ial machine y o
p oduce phage p o eins [
6
,
7
]. Phages gene ally unde go a ly ic ( i ulen ) o lysogenic ( empe a e)
li e cycle. Ly ic phages in ec , and apidly lyse and kill hos cells, eleasing phage p ogeny in o he
su ounding medium. Lysogenic phages in ec he hos cell and in eg a e hei nucleic acid in o
he hos genome, o exis as plasmids in he hos cells, emaining in a s able p ophage s a e o
gene a ions. P ophages can be “induced” o exi he cell as ly ic phages unde some condi ions, such as
he p esence o an ibio ics [
8
,
9
]. The lysogenic/ly ic cycle o empe a e bac e iophages is con olled by
C o,
CI, and CII
p o eins; he C o p o ein induces he ly ic s a e and he CI ep esso p o ein inhibi s
he C o p o ein, he eby inducing he lysogenic s a e [10].
Only ly ic phages a e used in phage he apy as lysogenic phages can ans e esis ance genes o
i ulence ac o s o he hos [11].
The combined use o an ibio ics and phages has been es ed in se e al s udies, demons a ing s ong
con ol o he bac e ia, and a educ ion in he de elopmen o phage and/o an ibio ic esis ance [
12
,
13
].
Phages a e good candida es o use in combina ion wi h an ibio ics o a ious easons, including
ha hey ha e a di e en mechanism o ac ion om an ibio ics; hold a na ow spec um o ac i i y,
which p o ec s
he no mal mic obio a; hey can mul iply a he in ec ion si e; hey a e abundan in
na u e and can be easily isola ed; and p oduc ion cos s a e low [14–16].
In his s udy, we p oduced a mu an ly ic phage om a lysogenic phage, ha is inco po a ed in he
genome o a clinical s ain o A. baumannii by dele ing he CI ep esso gene, and hus,
p e en ing he
en y o he phage in o he lysogenic cycle [
10
,
17
]. We hen es ed he an imic obial ac i i y o he
no el ly ic phage, Ab105-2phi
∆
CI, in combina ion wi h ca bapenem an ibio ics (me openem and
imipenem) agains a ca bapenem- esis an s ain o A. baumannii. The combined he apy enhanced
he an imic obial ac i i y o bo h, he phage and he an ibio ic; he bac e ium became sensi i e o he
an ibio ics and he eme gence a e o phage esis an bac e ia was educed.
2. Ma e ial and Me hods
2.1. Bac e ial S ains
In his s udy, we used 20 clinical s ains isola ed om Spanish hospi als du ing he GEIH-REIPI
Spanish Mul icen e Acine obac e baumannii S udy II 2000–2010, GenBank Umb ella p ojec
PRJNA422585 (h ps://www.ncbi.nlm.nih.go /biop ojec ) (Table 1).
Mic oo ganisms 2019,7, 556 3 o 14
Table 1.
Bac e ial s ains used in his s udy. Phage hos ange de e mined by spo es and e iciency o
pla ing (EOP).
S ain ST Spo EOP Spanish Hospi al Whe e he S ain Was Isola ed
Ab105_GEIH-2010
2+/−1 Hospi al Uni e si a io Vi gen del Rocío (Se ille, Spain)
Ab192_GEIH-2000
2+/−0.22 Hospi al Uni e si a io Vi gen del Rocío (Se ille, Spain)
Ab404_GEIH-2010
80 +0.0002 Hospi al D . Molines (Valencia, Spain)
Ab166_GEIH-2000
2+/−- Hospi al Uni e si a io Vi gen del Rocío (Se ille, Spain)
Ab177_GEIH-2000
2+1.55 Hospi al Uni e si a io Vi gen del Rocío (Se ille, Spain)
Ab13_GEIH-2010 79 - - Hospi al San iago de Compos ela
(San iago de Compos ela, Spain)
Ab09_GEIH-2010 297 - - Hospi al San iago de Compos ela
(San iago de Compos ela, Spain)
Ab160_GEIH-2000
2 - - Hospi al Uni e si a io Vi gen del Rocío (Se ille, Spain)
Ab155_GEIH-2000
2 - - Hospi al Uni e si a io Vi gen del Rocío (Se ille, Spain)
Ab05_GEIH-2010 186 - - Hospi al A Co uña (A Co uña, Spain)
Ab22_GEIH-2010 52 - - Hospi al Pon e ed a (Pon e ed a, Spain)
Ab421_GEIH-2010
2 - - Hospi al Insula (G an Cana ia, Spain)
Ab77_GEIH-2000 2 - - Hospi al Uni e si a io Ramon y Cajal (Mad id, Spain)
Ab141_GEIH-2000
179 - - Complejo Hospi ala io Toledo (Toledo, Spain)
Ab217_GEIH-2010
2 - - Hospi al Reina So ía (Co doba, Spain)
Ab235_GEIH-2010
2 - - Hospi al Ma qués de Valdecilla (San ande , Spain
Ab37_GEIH-2010 2 - - Hospi al Vi gen del Rocío (Se ille, Spain)
Ab222_GEIH-2000
181 - - Hospi al Bell i ge (Ba celona)
Ab461_GEIH-2010
2 - - Hospi al del Ma (Ba celona, Spain)
Ab173_GEIH-2010
88 - - Hospi al San Agus ín (A ilés, Spain)
ST: Sequence Type. Spo es : (+) clea spo ; (+/−) u bid spo ; (-) no spo .
2.2. Ob aining he Ly ic Phage Mu an
The bac e iophage sequence Ab105-2phi (Genbank: KT5880759) de ec ed in clinical s ain
A. baumannii
Ab105GEIH_2010 was analyzed and he CI gene iden i ied as ORF 17. The CI gene was
dele ed by double homologous ecombina ion wi h he suicide ec o pMo130TelR [
18
,
19
].
The p ime s
we e i s designed o he ampli ica ion o he lanking egions (1000 bp) o he CI gene.
These egions
we e ampli ied by PCR and liga ed and cloned in o he pMo130 elR ec o (Table 2).
This cons uc ion
was ans o med in Esche ichia coli DH5
α
o p oduce la ge numbe s o he plasmid wi h he gene
lanking egions. The plasmid was pu i ied and ans o med in he A. baumannii Ab105 clinical
s ain by elec opo a ion, and incuba ed o wo hou s a 37
◦
C wi hou an ibio ic, he eby p oducing
a ecombinan
wild ype wi h he mu a ed gene in eg a ed in i s genome. Finally, he mu an s we e
selec ed in he p esence o kanamycin (50
µ
g/mL). In o de o isola e only hose mu an s wi h he CI
gene dele ion in he ch omosome, he plasmid loss was induced in he absence o kanamycin,
and he
ecombinan clones we e selec ed in he p esence o 15% suc ose. In o de o isola e he mu an phage
Ab105-2phi
∆
CI om he bac e ial clones by which he CI gene was dele ed, a selec ed clone was
incuba ed in LB b o h, which is supplemen ed wi h mi omycin (10 ug/mL) o induce elease o he
phages. The supe na an was collec ed, ea ed wi h chlo o o m, and il e ed (20
µ
m). The il e ed
supe na an was used o in ec he clone wi hou he phage, and plaques we e ob ained by he aga
Mic oo ganisms 2019,7, 556 4 o 14
o e lay me hod [
20
]. A clea plaque was isola ed by PCR and sequencing was conduc ed o con i m
he co ec dele ion o he CI gene.
Table 2. P ime s used o dele e he CI gene.
P ime Sequence S ain/Plasmid
UPCI [No I]Fw
GGGGCGGCCGCTGAAGAATTCATCACTTG
Ab105_GEIH-2010
UPCI[BamHI]Re
GGGGGATCCCGTTACTTCTATCGGAAT
Ab105_GEIH-2010
DWCI[BamHI]Fw
GGGGGATCCATTAAGGTTTTAGGTGAT
Ab105_GEIH-2010
DWCI[SphI]Re
GGGGCATGCTAAATCATCCAAATCGAC
Ab105_GEIH-2010
CIFw ATGGACAAATTTATGGCTAC Ab105_GEIH-2010
CIRe TAACTTTTTCTAACACGCT Ab105_GEIH-2010
In CIFw AAAGCGCTGCCAACTTTT Ab105_GEIH-2010
In CIRe CAACAGATTCATCCTCAT Ab105_GEIH-2010
pMo130TelRFw ATTCATGACCGTGCTGAC pMo130TelR
pMo130TelRRe CTTGTCTGTAAGCGGATG pMo130TelR
Plasmid Desc ip ion O igin
pMo130TelR
Suicide plasmid, xylE
+
,sacB
+
, km
R
, Tel
R[19]
Res ic ion enzyme si es a e shown in i alics.
A clone o s ain Ab105GEIH_2010, induced wi h mi omycin, was isola ed and excision o he
phage was con i med by PCR o he CI gene and he lanking egions (1000 pb each egion) o he gene.
2.3. Hos Range and E iciency o Pla ing Analysis
The hos ange o he ly ic mu an phage Ab105-2phi
∆
CI was es ablished by applying he spo
es [
21
] o he 20 clinical s ains o A. baumannii unde s udy. E iciency o Pla ing (EOP) was es ablished
as he a io be ween he es s ain i e and he hos s ain i e [22].
2.4. T ansmission Elec on Mmic oscopy (TEM) and Li e-Cell Imaging
A b o h cul u e o s ain Ab177_GEIH-2000 was in ec ed wi h he ly ic mu an phage
Ab105-2phi
∆
CI. The lysa es we e cen i uged a 3400
×
g o 10 min and he supe na an was il e ed
h ough a 0.22
µ
m il e (Me ck Millipo e, L d. Tullag een, Ca ig wahill, Co Co k, I eland). NaCl was
added o a inal concen a ion o 0.5 M, and he suspensions we e mixed ho oughly and le on ice
o 1 h. The suspensions we e cen i uged a 3400
×
g o 40 min a 4
◦
C, and he supe na an s we e
ans e ed o s e ile ubes. PEG 6000 (10% w/ ) was added, dissol ed, and incuba ed o e nigh a 4
◦
C.
Bac e iophages we e hen p ecipi a ed a 3400
×
g o 40 min a 4
◦
C and esuspended in SM bu e (0.1
M NaCl, 1 mM MgSO4, 0.2 M T is-HCl, pH 7.5) [
23
]. The samples we e nega i ely s ained wi h 1%
aqueous u anyl ace a e be o e examina ion by elec on mic oscopy.
Li e-cell imaging was ca ied ou by ime-lapse mic oscopy a e ini ial adso p ion o he mu an
ly ic phage Ab105-2phi
∆
CI o he clinical s ain Ab177_GEIH-2000 a 37
◦
C in aga slices, which we e
placed di ec ly be ween s ainless s eel O- ings. The use o ex acellula DNA ma ke s enabled he lysis
o mo e han 300 bac e ia o be moni o ed in eal ime.
2.5. Adso p ion Cu e, One S ep G ow h Cu e, and In ec ion Cu e
An o e nigh cul u e o A. baumannii clinical s ain Ab177_GEIH-2000 was dilu ed 1:100 in LB
b o h, and incuba ed a 37
◦
C a 180 pm, un il an ea ly loga i hmic phase, i.e., a an op ical densi y o
0.2 (OD 600nm). A his poin he cul u e was in ec ed wi h he ly ic mu an phage Ab105-2phi
∆
CI a
Mic oo ganisms 2019,7, 556 5 o 14
a mul iplici y o in ec ion (MOI) o 0.1. The adso p ion cu e and he one s ep g ow h cu e we e
de e mined a e g owing he phage in LB, supplemen ed wi h CaCl
2
, as p e iously desc ibed [
20
,
24
].
In he one s ep g ow h cu e, he la en pe iod was de ined as he in e al be ween adso p ion o
he phages o he bac e ial cells and he elease o phage p ogeny. The bu s size o he phage was
de e mined as he a io o he inal numbe o ee phage pa icles o he numbe o in ec ed bac e ial
cells du ing he la en pe iod [22].
An ea ly exponen ial cul u e o he s ain Ab177_GEIH-2000 in LB, supplemen ed wi h CaCl
2
,
was in ec ed
wi h he lysogenic phage Ab105phi2 and he mu an ly ic phage Ab105phi2
∆
CI a di e en
MOIs (0.1, 1 and 10), and he co esponding in ec ion cu es we e cons uc ed. The phage cul u es
we e main ained a oom empe a u e du ing he adso p ion pe iod and hen incuba ed a 37
◦
C and
180 pm o 6 h. The op ical densi y was measu ed a in e als o one hou du ing his pe iod.
2.6. F equency o Occu ence o Phage Resis an Bac e ia
Phage esis an mu an s we e p oduced as p e iously desc ibed [
25
]. To de e mine he eme gence
o phage esis an mu an s, an o e nigh cul u e o s ain Ab177_GEIH-2000 was dilu ed 1:100 in LB
and g own o an OD600nm o 0.6–0.7. An aliquo o 100
µ
L o he cul u e con aining 10
8
colony o ming
uni s (CFU)/mL was se ially dilu ed, and each dilu ion mixed wi h 100
µ
L o 10
9
plaque o ming uni s
(PFU)/mL, and pla ed by he aga o e lay me hod [
20
]. The pla es we e incuba ed a 37
◦
C o 18h and
he numbe o CFUs was coun ed. The same p ocedu e was used o p oduce phage esis an mu an s
in he p esence o he an ibio ics doxycycline, me openem, o imipenem, which we e added o he
pla es, each a 25% o he minimum inhibi o y concen a ion (MIC). The equency o occu ence o
phage esis an mu an s and phage-an ibio ic esis an mu an s was calcula ed by di iding he numbe
o esis an bac e ia by he o al numbe o sensi i e bac e ia.
2.7. An imic obial Ac i i y o he Mu an Ly ic Phage Ab105-2phi∆CI in Bio ilm
An o e nigh cul u e o he A. baumannii clinical s ain Ab177_GEIH-2000 was dilu ed 1:100 and
used o inocula e 100
µ
L o LB in some wells o a 96 mul i-well pla e. The pla e was main ained
a
37 ◦C
in s a ic condi ions o 4 h. The medium was hen disca ded and he wells we e washed
wice wi h PBS be o e 100
µ
L o esh LB was added. A e 24 h a 37
◦
C, he medium was again
disca ded and he wells we e washed wi h PBS, and illed wi h 90
µ
L o SM bu e , hen 10
µ
L o phage
Ab105-2phi
∆
CI (10
7
PFU/mL) was added. SM bu e (100
µ
L) was added o con ol wells.
The pla es
we e hen incuba ed a 37
◦
C o 24 h. Finally, he supe na an was disca ded and he wells we e
washed wi h PBS. Hal o he wells we e used o quan i y he CFUs and he o he hal we e used o
quan i y he bio ilm. PBS (100
µ
L) was added o he wells used o quan i y he CFUs and he pla es
we e agi a ed o 5 min and sonica ed o ano he 5 min. The suspension was se ially dilu ed and
pla ed on LB pla es. Fo quan i ica ion o he bio ilm, 100
µ
L o me hanol was added o each well and
disca ded a e
10 min
. Once he me hanol had comple ely e apo a ed, 100
µ
L o c ys al iole (0.1%)
was added and disca ded a e 15 min. Finally, he wells we e washed wi h PBS be o e he addi ion o
150 µL o ace ic acid (30%), and he abso bance was measu ed a OD 595 nm.
2.8. An imic obial Ac i i y in Combina ion wi h An ibio ics
A bac e ial killing assay was cons uc ed o de e mine he syne gy o phage Ab105-2phi
∆
CI
in combina ion wi h me openem, imipenem and doxycycline a 1/8 and 1/4 o he espec i e MICs
(me openem 32 µg/mL, imipenem 16 µg/mL and doxycycline 64 µg/mL). An o e nigh cul u e o he
es ed s ain was dilu ed a 1:100 in LB b o h supplemen ed wi h 10uM CaCl
2
and incuba ed a 37
◦
C
and 180 pm un il he cul u e eached an ea ly exponen ial phase a 0.2 OD (600nm). A his poin ,
an ibio ic and he Ab105-2phi
∆
CI phage we e added o he cul u e. The lasks we e main ained a
oom empe a u e du ing he adso p ion pe iod be o e being incuba ed a 37
◦
C and 180 pm o
24 h
. Aliquo s we e emo ed a e 6 h and 24 h and we e se ially dilu ed and pla ed in LB pla es o
subsequen coun ing o CFU.

Mic oo ganisms 2019,7, 556 6 o 14
2.9. Galle ia mellonella Su i al Assay
The Galle ia mellonella model used was an adap ed e sion o a p e iously de eloped model
also used o s udy bac e iophage he apy [
26
,
27
]. The p ocedu e was as ollows: wel e G. mellonella
la ae, acqui ed om T uLa TM (Biosys ems Technology, Exe e , De on, UK), we e each injec ed
in he le p oleg wi h 10
µ
L o a suspension o A. baumannii Ab177_GEIH-2000, dilu ed in s e ile
phospha e bu e saline (PBS) con aining 1
×
10
5
CFU (
±
0. 5 log). The injec ion was pe o med wi h
a Hamil on
sy inge ( olume 100
µ
L) (Hamil on, Shanghai, China). One hou a e in ec ion, he la ae
we e injec ed in he igh p oleg wi h 10
µ
L o he ly ic mu an phage Ab105-2phi
∆
CI, a MOI 10,
in combina ion
wi h me openem a 1/4 MIC and imipenem a
1
4
MIC. The con ols included 10
µ
L o
he ly ic mu an phage Ab105-2phi
∆
CI a MOI 10, o me openem a 1/4 MIC and imipenem a 1/4 MIC.
The injec ed la ae we e placed in Pe i dishes and incuba ed in da kness a 37
◦
C. The numbe o dead
la ae was eco ded a e 72 h. The la ae we e conside ed dead when hey showed no mo emen in
esponse o ouch [26].
The su i al cu es o he
in i o
G. mellonella in ec ion model we e cons uc ed using G aphPad
P ism .6 (San Diego, CA, USA), whe e he da a we e analyzed using he Log-Rank (Man el-Cox,
Ci y, S a e i USA, Coun y) es . The da a we e exp essed as mean alues, and he di e ences we e
conside ed s a is ically signi ican a p<0.05.
3. Resul s
3.1. Ob aining he Ly ic Mu an o he Phage Ab105phi-2∆CI
A e dele ing he CI gene om he empe a e phage Ab105-phi2, as p e iously epo ed in
Salmonella [
17
], we ob ained a ly ic mu an , designa ed Ab105-phi2
∆
CI, which p oduced cha ac e is ic
clea ly ic plaques. This is in con as wi h he u bid plaques p oduced by he empe a e Ab105-phi2
phage (Figu e 1A1). PCR o he DNA, isola ed om he Ab105-2phi
∆
CI phage, con i med he dele ion
o he CI gene. PCRs we e conduc ed wi h he CI genes and combina ions o hese p ime s wi h
hose o he lanking egions, con i ming ha no ampli ica ion was ob ained. PCRs wi h he p ime s
(UPCI[No I]Fw/DWCI[SphI]Re ) o he lanking egions o he gene CI we e also conduc ed,
and he
expec ed egion o 2000 pb was ob ained (size wi hou he CI gene). Finally, his amplicon was
sequenced and he CI gene dele ion was con i med. Excision o he phage was also con i med in
a clone
induced wi h mi omycin, as no posi i e PCR we e ob ained wi h he CI p ime s o wi h he
lanking egion p ime s.
In ec ion cu es o he empe a e phage Ab105-2phi and he ly ic mu an phage Ab105-2phi
∆
CI
we e cons uc ed and compa ed, showing ha he ly ic mu an killed he cul u e a all MOI le els es ed,
as e lec ed by a la ge dec ease in he op ical densi y. Al hough, a educ ion in g ow h was obse ed
when he cul u e was in ec ed wi h he lysogenic phage Ab105-2phi, he dec ease was less han wi h
he ly ic mu an . In bo h cases, he educ ion in g ow h was i s obse ed a MOI 10,
bu eg ow h
was also i s obse ed a his MOI, p obably due o he eme gence o esis ance (Figu e 1B).
Mic oo ganisms 2019,7, 556 7 o 14
Mic oo ganisms 2019, 7, x 7 o 13
Figu e 1. G aphical ep esen a ion o he Ab105-2phiΔCI phage. The ORF and di ec ion o
ansc ip ion a e indica ed by a ows. (A1) The p o ein unc ions a e indica ed in di e en colou s,
and he GC con en and GC skew a e shown as pink and g een ci cles espec i ely. (A2) TEM image
o he mu an ly ic phage Ab105-phi2ΔCI and mu an ly ic phage Ab105-phi2ΔCI a ached o he cell
su ace. (B1) In ec ion cu es o he lysogenic phage Ab105-2phi and (B2) he mu an ly ic phage
Ab105-2phiΔCI. (C) One s ep g ow h cu e o he mu an ly ic phage Ab105-phi2ΔCI (L: La en
pe iod; B: bu s size). Mu an ly ic phage Ab105-phi2ΔCI an ibio ilm ac i i y on he bio ilm
p oduced by he clinical s ain o A. baumannii Ab177_GEIH-2000. (D1) Reduc ion in he bio ilm and
educ ion in he numbe o CFUs p esen in he bio ilm a e ea men wi h he mu an ly ic phage
Ab105-phi2ΔCI. Figu es B, C and D show he mean alues +/− SD om h ee independen assays.
S a is ically signi ican di e ences (p < 0.05) we e de e mined by -S uden es (G aphPad P ism .6).
3.5. De e mina ion o he Eme gence Ra e o Phage Resis an Mu an s
S ain Ab177_GEIH-2000 was esis an o me openem, imipenem and doxycycline (MICs:
Me openem 32 μg/mL, imipenem 16 μg/mL, and doxycycline 64 μg/mL). In all cases he
Figu e 1.
G aphical ep esen a ion o he Ab105-2phi
∆
CI phage. The ORF and di ec ion o ansc ip ion
a e indica ed by a ows. (
A1
) The p o ein unc ions a e indica ed in di e en colou s, and he GC con en
and GC skew a e shown as pink and g een ci cles espec i ely. (
A2
) TEM image o he mu an ly ic
phage Ab105-phi2
∆
CI and mu an ly ic phage Ab105-phi2
∆
CI a ached o he cell su ace.
(B1) In ec ion
cu es o he lysogenic phage Ab105-2phi and (
B2
) he mu an ly ic phage Ab105-2phi
∆
CI. (
C
) One s ep
g ow h cu e o he mu an ly ic phage Ab105-phi2
∆
CI (L: La en pe iod; B: bu s size). Mu an ly ic
phage Ab105-phi2
∆
CI an ibio ilm ac i i y on he bio ilm p oduced by he clinical s ain o A. baumannii
Ab177_GEIH-2000. (
D1
) Reduc ion in he bio ilm and educ ion in he numbe o CFUs p esen in he
bio ilm a e ea men wi h he mu an ly ic phage Ab105-phi2
∆
CI (
D2
). Figu es B,
C and D
show he
mean alues +/
−
SD om h ee independen assays. S a is ically signi ican di e ences (p<0.05) we e
de e mined by -S uden es (G aphPad P ism .6).
Mic oo ganisms 2019,7, 556 8 o 14
3.2. Mo phology and Hos Range o he Ly ic Mu an Phage Ab105-phi2∆CI
The ly ic mu an Ab105-2phi
∆
CI was isola ed and he i ion mo phology was obse ed by
TEM, e ealing ha his phage has he ypical s uc u e o he Sipho i idae as he wild ype phage
Ab105-phi2 [28]. All plaques we e anspa en and abou 1mm in diame e (Figu e 1A2).
The ly ic spec um o ac i i y o he mu an phage Ab105-2phi
∆
CI co e ed 25% o he clinical
s ains o A. baumannii es ed. The s ain Ab177_GEIH-2000 yielded he highes EOP (1.55) (Table 1).
This s ain was hus selec ed o u he assays.
3.3. Adso p ion and One S ep G ow h Cu e
Bo h, he adso p ion and he one s ep g ow h cu e we e es ablished using hos s ain
Ab177_GEIH-2000, as he EOP o his s ain was he mos app op ia e and also because his s ain
does no ha e comple e p ophages, as p e iously de e mined [
28
]. The adso p ion ime (12 min) was
de e mined in o de o es ablish he one s ep g ow h cu e, which e ealed a la en pe iod o 30 min
and a bu s size o app oxima ely 32 ±2 PFU pe in ec ed cell (Figu e 1C).
3.4. An imic obial Ac i i y o he Mu an Ly ic Phage Ab105-2phi∆CI on Bio ilm
Bio ilm was p oduced wi h he clinical s ain o A. baumannii Ab177_GEIH-2000 suscep ible o he
mu an ly ic phage Ab105-phi2
∆
CI. The ea men o he bio ilm wi h 10
7
PFU o his ly ic mu an
phage caused a s a is ically signi ican educ ion in he bio ilm biomass. The an imic obial ac i i y
agains he bio ilm o ming bac e ia was con i med by a dec ease in he CFU, quan i ied in he p esence
o he mu an ly ic phage (Figu e 1D).
Finally, he ly ic ac i i y o he mu an phage can be obse ed in Video 1 (Supplemen a y Ma e ials).
3.5. De e mina ion o he Eme gence Ra e o Phage Resis an Mu an s
S ain Ab177_GEIH-2000 was esis an o me openem, imipenem and doxycycline (MICs:
Me openem 32
µ
g/mL, imipenem 16
µ
g/mL, and doxycycline 64
µ
g/mL). In all cases he combina ion
o he phage and an ibio ic educed he a e o eme gence o phage- esis an mu an s, ela i e o he
a e o esis an mu an s in he p esence o he phage alone (Table 3).
Table 3.
F equency o phage esis an mu an s. Phage esis an mu an equency in he p esence o he
combina ion o doxycycline, me openem and imipenem a
1
4
MIC in combina ion wi h ly ic mu an
phage Ab105-2phi∆CI (MOI 10) was calcula ed.
Sample F equency o Phage Resis an Mu an s
Ab105-2phi∆CI 1.70 ×10−6
Ab105-2phi∆CI +Doxycycline 1.31 ×10−7
Ab105-2phi∆CI +Me openem 2.10 ×10−7
Ab105-2phi∆CI +Imipenem 1.90 ×10−7
3.6. E ec o he Combina ion o Phage and An ibio ic on he Bac e ial Killing Assays
Bac e ial killing assays we e cons uc ed o A. baumannii clinical s ain Ab177_GEIH-2000 in he
p esence o a combina ion o he ly ic mu an phage Ab105-2phi
∆
CI a di e en MOIs (
0.1, 1, and 10
)
and h ee an ibio ics (a 1/4 and 1/8 MIC) o which Ab177_GEIH-2000 is esis an : Me openem,
imipenem, and doxycycline (Figu e 2).
Mic oo ganisms 2019,7, 556 9 o 14
Mic oo ganisms 2019, 7, x 9 o 13
Figu e 2. Bac e ial killing assays o A. baumannii clinical s ain Ab177_GEIH-2000 de e mined using
he mu an ly ic phage Ab105-2phi∆CI a MOI 1 and MOI10 in combina ion wi h me openem a (A1)
1/8 MIC and (A2) 1/4 MIC;(B1) imipenem a 1/8 MIC and (B2)1/4 MIC, and (C1) doxycycline a 1/8
MIC and (C2)1/4 MIC. Values shown in he g aphs a e he means +/− SD om h ee independen
assays.
The cu es ob ained o he ly ic mu an phage con ols showed ha Ab177_GEIH-2000 g ew a
con ol a es a e 24h, due o he acquisi ion o phage esis ance. Howe e , he g ow h was highe a
MOI 10, han a MOI 1 a e 6 h, p obably because esis ance eme ges as e a his MOI han a lowe
MOI.
3.7. Galle ia mellonella Su i al Assays in he P esence o Me openem and Imipenem in Combina ion wi h he
Ly ic Mu an Phage Ab105-phi2ΔCI
The combina ions o an ibio ic and he phage Ab105-2phiΔCI, ha esul ed in he educ ion o
he CFU o Ab177_GEIH-2000 a 24h in i o we e assayed in a G. mellonella (wax mo h) la ae
su i al model (Figu e 3). When he in ec ed la ae we e ea ed wi h imipenem and mu an ly ic
phage Ab105-2phiΔCI, he su i al a e was ound o be s a is ically signi ican ly highe han he
la ae ea ed wi h he an ibio ic o he phage alone and o un ea ed la ae (p < 0.05). Simila esul s
we e ob ained o me openem bu in his case. Al hough, la al su i al was highe a e he
combina o y ea men han a e phage only o no ea men , he di e ence ela i e o me openem
alone was no s a is ically signi ican (p = 0.2183). This was p obably due o he highe MIC o
me openem han o imipenem (32 μg/mL e sus 16 μg/mL) o he Ab177_GEIH-2000 s ain,
indica ing he need o adminis e g ea e amoun s o mu an ly ic phage Ab105-2phiΔCI.
Figu e 2.
Bac e ial killing assays o A. baumannii clinical s ain Ab177_GEIH-2000 de e mined using
he mu an ly ic phage Ab105-2phi
∆
CI a MOI 1 and MOI10 in combina ion wi h me openem a (
A1
)
1/8 MIC and (
A2
) 1/4 MIC;(
B1
) imipenem a 1/8 MIC and (
B2
)1/4 MIC, and (
C1
) doxycycline a 1/8 MIC
and (C2)1/4 MIC. Values shown in he g aphs a e he means +/−SD om h ee independen assays.
A educ ion in he numbe o CFU was obse ed wi h he phage a bo h MOI 1 (4 log) and MOI
10 (1 log) a e 6 h, bu no di e ences om he con ol we e obse ed a e 24 h. The educ ion was
e en g ea e when he phage was combined wi h me openem o imipenem (bo h ca bapenems).
Fo me openem plus phage, a syne gis ic e ec was obse ed a e 6 h o all combina ions
( om 4 log o 7 log CFU/mL). The g ow h o he A. baumanni s ain was simila o con ol le els
a e 24 h o all concen a ions o me openem plus phage a MOI 1. The syne gis ic e ec was
only main ained wi h he combina ion o me openem a 1/4 MIC and phage Ab105-2phi
∆
CI a
MOI10,
yielding a di e ence
in bac e ial g ow h o 6 log CFU/mL, ela i e o ha co esponding o he
me openem con ol (Figu e 2A1,2A2).
As wi h me openem, he combina ion o di e en concen a ions o imipenem and he ly ic mu an
phage had a syne gis ic e ec a e 6 h in all cases, wi h a educ ion in bac e ial g ow h o 8 log CFU/mL
o he combina ion o imipenem a 1/4 MIC, plus phage, and 4 log CFU/mL o he combina ion o
imipenem a 1/8 MIC plus phage. The syne gis ic e ec was main ained o 24 h in he combina ions o
imipenen a 1/4 MIC, wi h phage a MOI1 and MOI10, bu no in he combina ions o imipenem a
1/8 MIC and bo h phage concen a ions (Figu e 2B1,2B2).
No syne gis ic e ec s we e obse ed wi h doxycycline, and he combina ion had no mo e e ec
han he phage alone a MOI 1. Howe e , when he combina ions included he phage a MOI 10,