1
2
E alua ion o di e en species-speci ic PCR p o ocols o he de ec ion 3
o Vib io ape is 4
5
Sabela Balboa, Alejand a Doce, Ana L. Diéguez, Jesús L. Romalde* 6
7
Depa amen o de Mic obiología y Pa asi ología. CIBUS-Facul ad de Biología. 8
Uni e sidad de San iago de Compos ela. 15782, San iago de Compos ela. Spain. 9
10
11
12
13
14
15
16
17
18
19
20
21
Submi ed o: Jou nal o In e eb a e Pa hology, Janua y 2011 22
23
24
25
26
27
* Co esponding au ho : 28
Phone: +34 881816908 29
Fax: +34 881896938 30
E-mail: [email p o ec ed] 31
32
33
*Manusc ip
Click he e o iew linked Re e ences
G aphical abs ac
Alignmen o he 16S RNA gene sequences o he h ee s ains o V. ape is,
CECT4600T (NR026361) GR0202RD (FR797810) and HH6087 (AY800101),
ep esen a i es o he di e en gene ic g oups desc ibed wi hin his bac e ial
species, and he sequences o he Vib io species wi h c oss- eac i i y in he PCR
p o ocols using p ime pai s V F-V R and V KF-V KR. The co espondences among
he sequences explain why hese p ime -pai s yield posi i e ampli ica ion wi h
non- a ge Vib io species.
*G aphical Abs ac
*G aphical Abs ac
Highligh s:
V. ape is is a as idious bac e ium di icul o de ec and/o isola e.
A compa a i e e alua ion o he pe o mance o h ee PCR p o ocols de eloped o he
de ec ion o his pa hogen.
Only one p o ocol showed o be speci ic o V. ape is, yielding also a good limi o
de ec ion (2-20 cells), and was he e o e, p oposed as he mo e addequa e o diagnosis
o B own Ring Diseases in clams.
The low speci i y o he o he wo p o ocols can be explained on he basis o p ime
design.
*Resea ch Highligh s
2
Abs ac 34
In his s udy he speci ici y and sensi i i y o h ee p ime pai s, J 1-J 2, V F-35
V R and V KF-V KR, o he de ec ion o Vib io ape is we e e alua ed in pa allel 36
using 23 V. ape is s ains isola ed om di e en mollusc and ish species and wi h 37
di e en geog aphical o igin, as well as 29 ep esen a i es o ela ed Vib io species. The 38
h ee p ime pai s ampli ied all he V. ape is s ains, ega dless hei hos o 39
geog aphical o igin. Howe e , wi h p ime se s V F-V R and V KF-V KR ampli ica ion 40
p oduc s o he expec ed size we e ob ained om ch omosomal DNA o some o he 41
non-V. ape is bac e ia es ed. The sensi i i y o he h ee PCR de ec ion me hods was 42
also di e en . The de ec ion limi ob ained wi h p ime pai s J 1-J 2 and V F-V R 43
was be ween 1 and 10 pg DNA /PCR ube (2-20 bac e ial cells pe eac ion). The p ime 44
se V KF-V KR showed a educ ion o sensi i i y in a leas one o de o magni ude. 45
The esul s we e highly ep oducibly wi h all p ime se s when using he same he mal 46
cycle , al hough some di e ences we e obse ed in he esul s ob ained in di e en 47
PCR machines. Based on he indings epo ed he e, we p opose he J 1-J 2 PCR 48
p o ocol as he mos adequa e o an accu a e de ec ion o V. ape is in diagnos ic 49
pa hology as well as in epidemiological s udies o his clam pa hogen. 50
51
52
Keywo ds: B own ing disease (BRD); Vib io ape is; PCR-de ec ion; PCR 53
pe o mance. 54
55
56

3
1. In oduc ion 57
B own Ring Disease (BRD), caused by Vib io ape is (Bo ego e al., 1996), is an 58
epizoo ic in ec ion desc ibed in adul clams. The main sign cha ac e izing he disease is 59
a b own conchiolin deposi on he inne su ace o he al es, ypically loca ed be ween 60
he pallial line and he edge o he shell. This o ganic deposi pe u bs he calci ica ion 61
p ocess (Pailla d e al, 1994, Pailla d, 2004) causing se e e de o ma ions o he clam’s 62
shell and subsequen ly he dea h o he animal. 63
Iden i ica ion o his shell ish pa hogen is based on he s udy o i s pheno ypical and 64
an igenic cha ac e is ics. Howe e , biochemical iden i ica ion o V. ape is s ains 65
in ol e he isola ion o he mic oo ganism om a ec ed clams. This me hodology is 66
imeconsuming gi en he e y ac ha incuba ion pe iods ange om 24h o 7 days. 67
(Be gh e al., 2007; Cas o e al., 1997; Jensen e al., 2003; No oa e al., 1998; Reid e 68
al., 2003). Once pu e cul u es a e achie ed, iden i ica ion o he pa hogen is based 69
mainly on ou biochemical cha ac e is ics: g ow h on TCBS, non u iliza ion o suc ose, 70
inabili y o g ow abo e 27 o 30ºC ( a ying among au ho s), and lack o acid p oduc ion 71
om manni ol (Pailla d, 2004). I has been o en desc ibed ha classical me hods may 72
ail in he de ec ion o V. ape is o ha , al hough being de ec ed by indi ec p ocedu es 73
(i.e. immuno lu escence), he pa hogen could no be isola ed on cul u e media (Cas o e 74
al., 1992, 1995). This me hodology has been p o ed o be unsuccess ul in some 75
geog aphical a eas as in Sou hwes o Spain whe e, al hough he incidence o he 76
disease is nea ly 40%, he isola ion o he e iological agen was impossible (Cas o e al, 77
1992, 1997) 78
In he ecen yea s he e has been much in e es in he de elopmen o speci ic PCR 79
p o ocols based, mos o hem, on he ampli ica ion o 16S RNA genes o de ec ion 80
bac e ial ish and shell ish pa hogens (Beaz-Hidalgo e al., 2008; B own e al., 1994; 81
Del Ce o e al., 2002; Gonzalez e al., 2003; Lee e al., 1998; Nhung e al., 2007; 82
Oso io e al., 1999; Romalde and To anzo 2002; Romalde e al., 2004; Saulnie e al., 83
2000). These me hods ha e p o ed o be e y use ul o imp o e he de ec ion, no only 84
in acu e cases o in ec ion bu also om asymp oma ic ca ie o ganisms. 85
In he las yea s h ee PCR p o ocols o de ec ion o V. ape is ha e been de eloped 86
(Pailla d e al., 2006, Pa k e al., 2006; Romalde e al., 2007) based on a a iable a ea o 87
16S DNA. In his wo k, we es ed he speci ici y as well as he sensi i i y o hese h ee 88
PCR p o ocols. 89
4
2. Ma e ial and me hods 90
2.1. Bac e ial s ains 91
Bac e ial s ains used in he p ime speci ici y s udies a e lis ed in Table 1 and 2. This 92
collec ion comp ises 23 Vib io ape is s ains wi h di e en hos and geog aphical 93
o igin, including ep esen a i e s ains o he h ee majo gene ic g oups desc ibed o 94
his pa hogen (Rod íguez e al., 2006). In addi ion, 29 Vib io species selec ed on he 95
basis o 16S RNA gene simila i y wi h V. ape is we e also analyzed. 96
All he bac e ia we e ou inely cul u ed on Ma ine Aga (MA) (P onadisa, Mad id, 97
Spain) and incuba ed o 24 hou s a 25ºC excep o V. ape is s ains ha we e g own 98
o 72h a 15ºC. S ock cul u es we e s o ed a –70ºC in Ma ine B o h (MB)(P onadisa, 99
Mad id, Spain) supplemen ed wi h 15% glyce ol. 100
101
2.2. DNA ex ac ion 102
Ch omosomal DNA was ex ac ed using Ins aGene Ma ix (BioRad, Mad id, Spain) as 103
p e iously desc ibed by Romalde e al. (1999). S ains o V. ape is and o he Vib io 104
species we e esuspended om he pla es in 1 ml o i-s e ile dis illed wa e , 105
cen i uged a 12000 pm o 1 min and he supe na an was emo ed. The pelle s we e 106
esuspended in 200 μl o Ins aGene Ma ix and incuba ed o 30 min a 56ºC. Then, he 107
cell suspensions we e igo ously o exed and boiled in a wa e ba h o 8 min. The 108
lysa es we e mixed again a high speed and hen cen i uged a 12000 pm o 3 min. 109
The DNA concen a ion o each sample was spec opho ome ically (Lambda2 UV/VIS 110
Spec opho ome e . Pe kin Elme , Übe lingen, Ge many) measu ed a 580 nm and 111
adjus ed o 1000 ng/μl. All DNA was main ained a -20ºC un il used o PCR eac ions. 112
All he expe imen s we e ca ied ou wi h DNA ob ained om 3 di e en ex ac ions 113
o each bac e ial s ain. 114
115
2.3. PCR ampli ica ion 116
All PCR ampli ica ions we e pe o med wi h he comme cial ki Ready-To-GoTMPCR 117
beads (Ame sham Pha macia Bio ech, Li le Chal on , Buckinghamshi e, England, UK), 118
which included all he eagen s needed o he PCR eac ions excep he speci ic p ime 119
pai s and DNA. 120
P ime pai s used o he compa ison V F-V R, V K -V K and J 1-J 2, we e 121
p e iously desc ibed by Pailla d e al. (2006), Pa k e al. (2006) and Romalde e al. 122
(2007) espec i ely. All he p ime pai s we e designed on he basis o he 16S RNA 123
5
gene, yielding ampli ica ion p oduc s o 416, 413 and 816 bp espec i ely. All PCR 124
eac ions we e ca ied ou in pa allel in a T-P o essional basic (Biome a, Goe ingen, 125
Ge many) and an Uno Cycle (VWR, Ba celona, Spain) he mocycle s. PCR condi ions 126
and ampli ica ion cycles used o dena u a ion, p ime annealing and ex ension we e 127
ca ied ou acco ding o each published PCR p o ocol. 128
Nega i e con ols, consis ing o he same eac ion mix u es bu wi h s e ile dis illed 129
wa e ins ead o DNA empla e, we e included in each ba ch o PCR eac ion. The 130
ep oducibili y o he esul s was assessed by epe i ion o he ampli ica ions in a leas 131
3 independen PCR assays. 132
133
2.4. Analysis o PCR p oduc s 134
Ampli ied p oduc s we e de ec ed by ho izon al 1% (w/ ) aga ose gel elec opho esis 135
o 60 min a 100 V in TAE 1x elec opho esis bu e , isualized using 0.06 μg ml-1 o 136
e hidium b omide (BioRad, Mad id, Spain) and pho og aphed unde UV ligh and 137
compu e digi ized (Gel Doc 100, Bio-Rad). A 50 o 2000 bp ladde (Sigma-Ald ich, 138
Sain Louis, MO, USA) was used as a molecula mass ma ke . The p esence o a single 139
p oduc o he app op ia e size, iden ical o he e e ence s ains, was conside ed as a 140
posi i e esul . 141
142
2.5. De e mina ion o PCRs sensi i i y and speci ici y 143
The de ec ion limi s o he h ee p ime se s we e e alua ed using cul u es o he ype 144
s ain CECT 4600T g own un il exponen ial phase on MB. Cul u e was cen i uga ed 145
and esuspended on s e ile saline (0.85% NaCl) adjus ing u bidi y o a OD=1a 580 nm 146
(Lambda2 UV/VIS Spec opho ome e . Pe kin Elme ). DNA was ex ac ed, adjus ed o 147
1000 ng/μl and se ially dilu ed o 1 ag/μl. In each PCR ube, one μl o hese dilu ions 148
was loaded. 149
Fo he s udy o he speci ici y wi h he 23 V. ape is isola es and he ep esen a i es o 150
he ela ed 29 Vib io species, DNA was adjus ed o 1000 ng/μl and se ially dilu ed o 151
use 100 ng o DNA in each PCR eac ion. 152
In bo h cases, PCR condi ions and elec opho esis we e he same as desc ibed abo e. 153
154
2.6. Sequence analysis 155
In o de o a ise an explana ion o he c oss- eac i i y obse ed o some p ime se s, 156
sequence analysis and mul iple alignmen s we e pe o med wi h he BioEdi package, 157
6
e sion 2.1, and he MEGA e sion 4.0 so wa es (Tamu a e al., 2007). 158
Due o he lack o a 16S RNA gene sequence o he s ain GR0202RD in he 159
GeneBank da abase, his gen was sequenced as p e iously desc ibed (Oso io e al., 160
1999) using a GenomeLab DTCS-Quick S a ki (Beckman Coul e ). Sequence edi ing 161
was pe o med wi h he DNASTAR Lase gene SEQMAN p og am. The ob ained 162
sequence was deposi ed in he GeneBank wi h accession numbe FR797810. 163
164
3. Resul s 165
3.1. De ec ion limi o he p ime pai s 166
The sensi i i y o each species-speci ic PCR p ime pai s we e de e mined by 167
ampli ica ion o di e en dilu ions o DNA ex ac ed om he V. ape is ype s ain 168
CECT 4600T. 169
Wi h p ime pai s V F-V R and J 1-J 2 and he T-P o essional basic (Biome a) 170
machine, he expec ed p oduc s o 416 and 816 bp espec i ely we e ob ained wi h 171
samples con aining as low as 1 pg o DNA pe PCR ube (Fig. 1A and B), which 172
co esponded o 2 o 20 cells pe eac ion (da a no shown). When ampli ica ions we e 173
pe o med in he Uno Cycle (VWR) appa a us, he same de ec ion limi was achie ed 174
wi h he V F-V R p ime se , being one log-uni less sensi i e he p ime pai J 1-J 2 175
(Fig. 1A and B). The p ime se V KF-V KR showed less sensi i i y, being able o 176
ampli y 10 pg (Biome a appa a us) o 100 pg (VWR machine) o DNA (Fig. 1C), 177
co esponding o 20 o 200 bac e ial cells. The obus ness o hese esul s was 178
de e mined by making hese assays by iplica e, ob aining he same esul s in all cases. 179
180
3.2. Speci ici y s udy 181
All V. ape is isola es, ega dless hei geog aphical and hos o igin, we e co ec ly 182
iden i ied by he h ee PCR p o ocols and p ime s pai s analyzed, ende ing speci ic 183
amplicons wi h he expec ed sizes o 816 (J 1-J 2), 416 (V F-V R) and 413 bp (V KF-184
V KR)(Table 1). 185
On he o he hand, when DNA om he 29 ela ed Vib io species we e subjec ed o 186
ampli ica ion, di e en esul s we e ob ained depending on he p ime se and he 187
he mocycle employed. The bes speci ici y was ob ained using J 1-J 2, since no 188
posi i e ampli ica ions we e achie ed in any o he PCR appa a us (Table 2; Fig. 2A). 189
Wi h he p ime se V F-V R, amplicons o he expec ed size (816 bp) we e obse ed 190
o V. p o eoly icus ATCC 15338T, V. ezu ae DSM 17533T, V. nig ipulch i udo CECT 191
13
Romalde, J.L., Maga iños, B., Villa , C., Ba ja, J.L., To anzo, A.E. 1999. Gene ic 390
analysis o u bo pa hogenic S ep ococcus pa aube is s ains by ibo yping and 391
andom ampli ied polymo phic DNA. FEMS Mic obiol. Le . 459, 297-304. 392
Romalde, J.L., To anzo, A.E., 2002. Molecula app oach o he s udy and diagnosis o 393
salmonid es ep ococcosis. In Cunningham, C. (Ed), Molecula Diagnosis o 394
Salmonid Diseases. Kluwe Academic Publishe s, Do d eech , The Ne he lands, pp 395
211-233. 396
Romalde, J.L., López- Romalde, S., Ra elo, C., Maga iños, B., To anzo, A.E., 2004. 397
De elopmen e and alida ion o a PCR-based p o ocol o he de ec ion o 398
Pseudomonas anguillisep ica. Fish Pa hol. 39, 33-41. 399
Saulnie , D., A a e, J.C., Moullac, G., Ansque , D., Le y, P., Vonau, V., 2000. Rapid 400
and sensi i e PCR de ec ion o Vib io penaeicida, he pu a i e e iological agen o 401
Synd ome 93 in New Caledonia. Dis. Aqua . O g. 40, 109-115. 402
Somme , R., Tau z, D., 1989. Minimal homology equi emen s o PCR p ime s. 403
Nucleic Acids Res. 17, 6749. 404
Tamu a, K., Dudley, J., Nei, M., Kuma , S., 2007. MEGA4: Molecula E olu iona y 405
Gene ics Analysis (MEGA) so wa e e sion 4.0. Mol. Biol. E ol. 24, 1596-1599. 406
Toyama, T., Ki a-Tsukamo o, K., Wakabayashi, H., 1996. Iden i ica ion o Flexibac e 407
ma i imus, Fla obac e ium b achiophilum and Cy ophaga columna is by PCR 408
a ge ed 16S Ribosomal DNA. Fish Pa hol. 31, 25-31. 409
410
411
412
413

14
Table 1.- S ains o Vib io ape is included in his s udy and esul s ob ained wi h he h ee PCR de ec ion p o ocols employed. Resul s o each 414
p ime se in wo he mocycle s a e shown. 415
S ain
Hos
Coun y/da e o isola ion
J 1-J 2
V F-V R
V KF-V KR
VWR
Biome a
VWR
Biome a
VWR
Biome a
CECT 4600T
Rudi apes philippina um
F ance, 1990
+
+
+
+
+
+
GR0202RD
R. decussa us
Spain, 1994
+
+
+
+
+
+
HH6087
Hippoglossus hippoglossus
Uni ed Kingdom. 2001
+
+
+
+
+
+
GR0705RD
R. decussa us
Spain, 1994
+
+
+
+
+
+
CMJ 10.7
R. philippina um
Spain, 2005
+
+
+
+
+
+
C 11.25
R. philippina um
Spain, 2005
+
+
+
+
+
+
102
R. philippina um
I eland, 2005
+
+
+
+
+
+
127
R. philippina um
I eland, 2005
+
+
+
+
+
+
IS 1
R. philippina um
F ance, 1988
+
+
+
+
+
+
IS 8
Vene upis au ea
F ance, 1990
+
+
+
+
+
+
IS 9
Ce as ode ma edulis
F ance, 1990
+
+
+
+
+
+
B 2.3
R. philippina um
F ance, 1991
+
+
+
+
+
+
B 8.3
R. philippina um
F ance, 1991
+
+
+
+
+
+
B 9.3
R. philippina um
F ance, 1991
+
+
+
+
+
+
GR1703RP
R. philippina um
Spain, 1994
+
+
+
+
+
+
LP2
Symphodus melops
No way, 1999
+
+
+
+
+
+
C0620701B
Umb ina ci osa
Spain, 2007
+
+
+
+
+
+
C0620701H
U. ci osa
Spain, 2007
+
+
+
+
+
+
C0620701R
U. ci osa
Spain, 2007
+
+
+
+
+
+
a200
Dicologoglossa cunea a
Spain, 2005
+
+
+
+
+
+
a201
D. cunea a
Spain, 2005
+
+
+
+
+
+
a204
D. cunea a
Spain, 2005
+
+
+
+
+
+
a255
D. cunea a
Spain, 2005
+
+
+
+
+
+
+, speci ic ampli ica ion o he p ime se ; –, no ampli ica ion de ec ed. CECT: Spanish Collec ion o Type Cul u es, Valencia, Spain. 416
15
Table 2.- S ainsa o ela ed Vib io species included in his s udy o es he speci ici y o
417
PCR p o ocols. Resul s o each p ime se in wo he mocycle s a e shownb.
418
J 1-J 2
V F-V R
V kF-V kR
VWR
Biome a
VWR
Biome a
VWR
Biome a
V. aes ua ianus ATCC 35048T
–
–
–
–
–
–
V. alginoly icus CCM2575
–
–
–
–
–
–
V. anguilla um ATCC 43306T
–
–
–
–
–
–
V. campbellii ATCC25920T
–
–
–
–
–
–
V. cycli ophicus LMG 21359T
–
–
–
–
–
–
V. diazo ophicus CECT 627T
–
–
–
–
–
–
V. ezu ae DSM 17533T
–
–
+
+
–
–
V. lu ialis CECT 4217T
–
–
–
–
–
–
V. u nisii CECT 4203T
–
–
–
–
–
–
V. halio icoli JCM21271T
–
–
–
–
–
–
V. ha eyi RA 58.2
–
–
–
–
–
–
V. len us CECT 5110T
–
–
–
–
–
–
V. logei NCIMB1443
–
–
–
–
–
–
V. medi e anei CECT 621T
–
–
–
–
–
–
V. mimicus CECT 4218T
–
–
–
–
–
–
V. my ili CECT 632T
–
–
+
–
–
+
V. ne eis ATCC 25917T
–
–
–
–
–
–
V. nig ipulch i udo CECT 628T
–
–
+
+
–
–
V. o dalii NCMIB 2167T
–
–
–
–
–
–
V. o ien alis CECT 629T
–
–
–
–
–
–
V. pa ahaemoly icus ATCC 27969
–
–
–
–
–
–
V. pec enicida A365T
–
–
–
–
+
–
V. penaeicida AM101
–
–
–
–
–
–
V. pome oyi LMG 20537T
–
–
+
+
+
+
V. pon icus CECT 5869T
–
–
–
–
–
–
V. p o eoly icus ATCC 15338T
–
–
+
+
–
–
V. splendidus CECT 528T
–
–
+
+
–
–
V. asmaniensis LMG 21574T
–
–
–
–
–
–
V. ulni icus ATCC 27562T
–
–
–
–
–
–
a ATCC, Ame ican Type Cul u e Collec ion, Rock ille, MD, USA; CCM, Czech
419
Collec ion o Mic oo ganisms, Czech Republic; LMG, BCCM/LMG Bac e ia
420
Collec ion, Gen , Belgium; CECT, Spanish Collec ion o Type Cul u es, Valencia,
421
Spain; DSM, Ge man Collec ion o Mic oo ganisms and Cell Cul u es; JCM, Japan
422
Collec ion o Mic oo ganisms; NCIMB: Na ional o Indus ial and Ma ine Bac e ial
423
L d, Abe deen, UK; V. ha eyi RA 58.2 belongs o he Labo a o y collec ion and s ains
424
o V. pec enicida and V. penaeicida we e kindly dona ed by D s. Lambe and Goa an
425
om he IFREMER in Plouzane (F ance) and New Caledonia espec i ely.
426
b +, speci ic ampli ica ion o he p ime se ; –, no ampli ica ion de ec ed.
427
16
Figu e legends
428
429
Figu e 1.- Sensi i i y o he PCR p o ocols o de ec ion o V. ape is using J 1-J 2
430
(A), V F-V R (B), and V KF-V KR (C) p ime se s. Lanes: M, PCR Ma ke (50-2000
431
bp ladde , Sigma); 1-11 and 13-23, Se ial dilu ions o DNA ex ac ed om he ype
432
s ain CECT 4600T, anging om 1000 ng/μl o 1 ag/μl.; 12 and 24, nega i e con ol
433
(wa e ). 1 o 12, ampli ica ions pe o med in a T-P o essional basic (Biome a)
434
he mocycle ; 13 o 24, ampli ica ions pe o med in an Uno Cycle (VWR)
435
he mocycle . Numbe s on he le indica e he posi ion o molecula size ma ke in bp.
436
Numbe s on he igh indica e he size o he ampli ied p oduc s and he es ic ion
437
agmen in bp.
438
439
Figu e 2.- Non-speci ic PCR p oduc s ob ained o Vib io sp. s ains using J 1-J 2
440
(A), V F-V R (B), and V KF-V KR (C) p ime s es. Lanes: M, PCR Ma ke (50-2000
441
bp ladde , Sigma); 1 and 18, V. pa ahaemoly icus ATCC 27969; 2 and 19, V.
442
pec enicida A365T; 3 and 20, V. medi e anei CECT 621T; 4 and 21, V. p o eoly icus
443
ATCC 15338T; 5 and 22, V. ne eis ATCC 25917T; 6 and 23, V. cycli ophicus LMG
444
21359T; 7 and 24, V. ezu ae DSM 17533T; 8 and 25, V. nig ipulch i udo CECT 628T; 9
445
and 26, V. splendidus CECT 528T; 10 and 27, V. len us CECT 5110T; 11 and 28, V.
446
o ien alis CECT 629T; 12 and 29, V. campbellii ATCC25920T; 13 and 30, V. pome oyi
447
LMG 20537T; 14 and 31, V. my ili CECT 632T; 15 and 32, V. u nisii CECT 4203T; 16
448
and 33, posi i e con ol (V. ape is CECT4600T); 17 and 34, nega i e con ol (wa e ). 1
449
o 17, ampli ica ions pe o med in a T-P o essional basic (Biome a) he mocycle ; 18
450
o 34, ampli ica ions pe o med in an Uno Cycle (VWR) he mocycle . Numbe s on
451
he le indica e he posi ion o molecula size ma ke in bp. Numbe s on he igh
452
indica e he size o he ampli ied p oduc s and he es ic ion agmen in bp.
453
454
Figu e 3.- Alignmen o he 16S RNA gene sequences o he h ee s ains o V. ape is,
455
CECT4600T (NR026361) GR0202RD (FR797810) and HH6087 (AY800101),
456
ep esen a i es o he di e en gene ic g oups desc ibed wi hin his bac e ial species,
457
and he sequences o he Vib io species wi h c oss- eac i i y in he PCR p o ocols using
458
p ime pai s V F-V R and V KF-V KR, including V. nig ipulch i udo ATCC27043T
459
(X74717), V. splendidus ATCC33125T (X74724) V. penaeicida DSM14398T
460
17
(AJ421444), V. pec enicida A365T (Y13830), V. ezu ae HDS1-1T (AY426980), V.
461
pome oyi LMG20537T (AJ491290), V. my ili CECT632T (X99761) and V. p o eoly icus
462
ATCC15338T (X74723). The loca ion o he each p ime -se used in his s udy is
463
indica ed. Sequence anno a ions based on 16S RNA gene sequence o V. ape is CECT
464
4600T.
465
466
M 1 2 3 4 5 6 7 8 9 10 11 12 M
M 13 14 15 16 17 18 19 20 21 22 23 24 M
A
M 1 2 3 4 5 6 7 8 9 10 11 12 M
M 13 14 15 16 17 18 19 20 21 22 23 24 M
B
M 1 2 3 4 5 6 7 8 9 10 11 12 M
M 13 14 15 16 17 18 19 20 21 22 23 24 M
C
816
816
416
416
413
413
1000
500
300
1000
500
300
1000
500
300
1000
500
300
1000
500
300
1000
500
300
Fig. 1.- Balboa e al.
Figu es 1 & 2

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M
M 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 M
1000
500
300
1000
500
300
816
816
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M
M 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 M
1000
500
300
1000
500
300
416
416
M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M
M 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 M
1000
500
300
1000
500
300
413
413
A
B
C
Fig. 2.- Balboa e al.
10 20 30 40 50 60 70 80 90 100 110
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
V. ape is CECT4600T --------------------CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGAAACGAGAA----GTAGCTT------GCTACTTCGGCGTCGAG
V. ape is 0202RD --------GTTTGATCCTGG........................................................----.......------.................
V. ape is HH6087 --------------------........................................................----.......------.................
V. nig ipulch i udo ATCC27043T -----AGAGTTTGATCATGG......................................................TTNTCT.A.C...CGGGGAA.G..AA..........
V. splendidus ATCC33125T ATTGAAGAGTTTGATCATGG.....................................................C.CTAACAATC...CGGGTGNN.TAA.G.........
V. penaeicida DSM14398T -----------------TGG.......................................................-----A......------....T.-..........
V. pec enicida A365T -------AGTTTGATCATGG........................................................----.......------.................
V. ezu ae HDS1-1T ------------------GG......................................................TTATCT.A.C...CGGGGAA.G.TAA..........
V. pome oyi LMG20537T -------------------------................................................C.CTAACAATC...CGGGTGCG.TAA.G.........
V. my ili CECT632T --------------------------................................................TTAACT.A.C...CGGGGAA.GTTAA..........
V. p o eoly icus ATCC15338T ------GAGTTTGATCATGG......................................................TTATCT.A.C...CGGGGAA.G.TA...........
450 460 470 480 490 500 510 520 530 540 550
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
V. ape is CECT4600T CCTTCGGGTTGTAAAGTACTTTCAGCAGTGAGGAAGGGGTGTAC-GTTAATAGCGTGCATCCTTGACGTTAGCTGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCC
V. ape is 0202RD ............................................-.................................................................
V. ape is HH6087 ............................................-.................................................................
V. nig ipulch i udo ATCC27043T ................C.....................-...GTAT.......ATGCACANT................................................
V. splendidus ATCC33125T .........................TT...........-G...NC..........NNATCT............AA...................................
V. penaeicida DSM14398T ......................................-...GAA.........T.CATAT.................................................
V. pec enicida A365T .....................................T.GA.GT-..........CATTCAT................................................
V. ezu ae HDS1-1T .........................TC..........C-A...TA.........TGTAT.GT...........GA...................................
V. pome oyi LMG20537T .........................TT...........-G..RDM.........KBYATCT............AA...................................
V. my ili CECT632T ..........................................GT-..........CA....T................................................
V. p o eoly icus ATCC15338T ................C........TC..........T-A..GTA........ATGCAT.AT...........GA...................................
1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320
....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|
V. ape is CECT4600T GGACGACGTCAAGTCATCATGGCCCTTACGAGTAGGGCTACACACGTGCTACAATGGCGCATACAGAGGGCAGCCAACCAGCGATGGTGAGCGAATCCCAAAAAGTGCGT
V. ape is 0202RD ..............................................................................................................
V. ape is HH6087 ..............................................................................................................
V. nig ipulch i udo ATCC27043T .......................................................................G......TT....GA........................
V. splendidus ATCC33125T ..........................................................................A.G.T......A........................
V. penaeicida DSM14398T .......................................................................G......................................
V. pec enicida A365T .......................................................................G......TT..A.AA........................
V. ezu ae HDS1-1T ..............................................................................................................
V. pome oyi LMG20537T ..........................................................................A.G...........R.....................
V. my ili CECT632T ..............................................................................TT....GA........................
V. p o eoly icus ATCC15338T .......................................................................G......TT....AA........................
V F
V KF
V R
V KF
J 1
J 2
Figu e 3