Evaluation of different species-specific PCR protocols for the detection 4 of Vibrio tapetis

1 2 Evaluation of different species-specific PCR protocols for the detection 3 of Vibrio tapetis 4 5 Sabela Balboa, Alejandra Doce, Ana L. Diéguez, Jesús L. Romalde* 6 7 Departamento de Microbiología y Parasitología. CIBUS-Facultad de Biología. 8 Universidad de Santiago de Compostela. 15782, Santiago de Compostela. Spain. 9 10 11 12 13 14 15 16 17 18 19 20 21 Submitted to: Journal of Invertebrate Pathology, January 2011 22 23 24 25 26 27 * Corresponding author: 28 Phone: +34 881816908 29 Fax: +34 881896938 30 E-mail: [email protected] 31 32 33 *Manuscript Click here to view linked References Graphical abstract Alignment of the 16S rRNA gene sequences of the three strains of V. tapetis, CECT4600T (NR026361) GR0202RD (FR797810) and HH6087 (AY800101), representatives of the different genetic groups described within this bacterial species, and the sequences of the Vibrio species with cross-reactivity in the PCR protocols using primer pairs VtF-VtR and VtKF-VtKR. The correspondences among the sequences explain why these primer-pairs yield positive amplification with non-target Vibrio species. *Graphical Abstract *Graphical Abstract Highlights: V. tapetis is a fastidious bacterium difficult to detect and/or isolate. A comparative evaluation of the performance of three PCR protocols developed for the detection of this pathogen. Only one protocol showed to be specific for V. tapetis, yielding also a good limit of detection (2-20 cells), and was therefore, proposed as the more addequate for diagnosis of Brown Ring Diseases in clams. The low specifity of the other two protocols can be explained on the basis of primer design. *Research Highlights 2 Abstract 34 In this study the specificity and sensitivity of three primer pairs, Jvt1-Jvt2, VtF-35 VtR and VtKF-VtKR, for the detection of Vibrio tapetis were evaluated in parallel 36 using 23 V. tapetis strains isolated from different mollusc and fish species and with 37 different geographical origin, as well as 29 representatives of related Vibrio species. The 38 three primer pairs amplified all the V. tapetis strains, regardless their host or 39 geographical origin. However, with primer sets VtF-VtR and VtKF-VtKR amplification 40 products of the expected size were obtained from chromosomal DNA of some of the 41 non-V. tapetis bacteria tested. The sensitivity of the three PCR detection methods was 42 also different. The detection limit obtained with primer pairs Jvt1-Jvt2 and VtF-VtR 43 was between 1 and 10 pg DNA /PCR tube (2-20 bacterial cells per reaction). The primer 44 set VtKF-VtKR showed a reduction of sensitivity in at least one order of magnitude. 45 The results were highly reproducibly with all primer sets when using the same thermal 46 cycler, although some differences were observed in the results obtained in different 47 PCR machines. Based on the findings reported here, we propose the Jvt1-Jvt2 PCR 48 protocol as the most adequate for an accurate detection of V. tapetis in diagnostic 49 pathology as well as in epidemiological studies of this clam pathogen. 50 51 52 Keywords: Brown ring disease (BRD); Vibrio tapetis; PCR-detection; PCR 53 performance. 54 55 56 3 1. Introduction 57 Brown Ring Disease (BRD), caused by Vibrio tapetis (Borrego et al., 1996), is an 58 epizootic infection described in adult clams. The main sign characterizing the disease is 59 a brown conchiolin deposit on the inner surface of the valves, typically located between 60 the pallial line and the edge of the shell. This organic deposit perturbs the calcification 61 process (Paillard et al, 1994, Paillard, 2004) causing severe deformations of the clam’s 62 shell and subsequently the death of the animal. 63 Identification of this shellfish pathogen is based on the study of its phenotypical and 64 antigenic characteristics. However, biochemical identification of V. tapetis strains 65 involve the isolation of the microorganism from affected clams. This methodology is 66 timeconsuming given the very fact that incubation periods range from 24h to 7 days. 67 (Bergh et al., 2007; Castro et al., 1997; Jensen et al., 2003; Novoa et al., 1998; Reid et 68 al., 2003). Once pure cultures are achieved, identification of the pathogen is based 69 mainly on four biochemical characteristics: growth on TCBS, non utilization of sucrose, 70 inability to grow above 27 to 30ºC (varying among authors), and lack of acid production 71 from mannitol (Paillard, 2004). It has been often described that classical methods may 72 fail in the detection of V. tapetis or that, although being detected by indirect procedures 73 (i.e. immunoflurescence), the pathogen could not be isolated on culture media (Castro et 74 al., 1992, 1995). This methodology has been proved to be unsuccessful in some 75 geographical areas as in Southwest of Spain where, although the incidence of the 76 disease is nearly 40%, the isolation of the etiological agent was impossible (Castro et al, 77 1992, 1997) 78 In the recent years there has been much interest in the development of specific PCR 79 protocols based, most of them, on the amplification of 16S rRNA genes for detection 80 bacterial fish and shellfish pathogens (Beaz-Hidalgo et al., 2008; Brown et al., 1994; 81 Del Cerro et al., 2002; Gonzalez et al., 2003; Lee et al., 1998; Nhung et al., 2007; 82 Osorio et al., 1999; Romalde and Toranzo 2002; Romalde et al., 2004; Saulnier et al., 83 2000). These methods have proved to be very useful to improve the detection, not only 84 in acute cases of infection but also from asymptomatic carrier organisms. 85 In the last years three PCR protocols for detection of V. tapetis have been developed 86 (Paillard et al., 2006, Park et al., 2006; Romalde et al., 2007) based on a variable area of 87 16S rDNA. In this work, we tested the specificity as well as the sensitivity of these three 88 PCR protocols. 89 4 2. Material and methods 90 2.1. Bacterial strains 91 Bacterial strains used in the primer specificity studies are listed in Table 1 and 2. This 92 collection comprises 23 Vibrio tapetis strains with different host and geographical 93 origin, including representative strains of the three major genetic groups described for 94 this pathogen (Rodríguez et al., 2006). In addition, 29 Vibrio species selected on the 95 basis of 16S rRNA gene similarity with V. tapetis were also analyzed. 96 All the bacteria were routinely cultured on Marine Agar (MA) (Pronadisa, Madrid, 97 Spain) and incubated for 24 hours at 25ºC except for V. tapetis strains that were grown 98 for 72h at 15ºC. Stock cultures were stored at –70ºC in Marine Broth (MB)(Pronadisa, 99 Madrid, Spain) supplemented with 15% glycerol. 100 101 2.2. DNA extraction 102 Chromosomal DNA was extracted using InstaGene Matrix (BioRad, Madrid, Spain) as 103 previously described by Romalde et al. (1999). Strains of V. tapetis and other Vibrio 104 species were resuspended from the plates in 1 ml of tri-sterile distilled water, 105 centrifuged at 12000 rpm for 1 min and the supernatant was removed. The pellets were 106 resuspended in 200 μl of InstaGene Matrix and incubated for 30 min at 56ºC. Then, the 107 cell suspensions were vigorously vortexed and boiled in a water bath for 8 min. The 108 lysates were mixed again at high speed and then centrifuged at 12000 rpm for 3 min. 109 The DNA concentration of each sample was spectrophotometrically (Lambda2 UV/VIS 110 Spectophotometer. Perkin Elmer, Überlingen, Germany) measured at 580 nm and 111 adjusted to 1000 ng/μl. All DNA was maintained at -20ºC until used for PCR reactions. 112 All the experiments were carried out with DNA obtained from 3 different extractions 113 for each bacterial strain. 114 115 2.3. PCR amplification 116 All PCR amplifications were performed with the commercial kit Ready-To-GoTMPCR 117 beads (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, England, UK), 118 which included all the reagents needed for the PCR reactions except the specific primer 119 pairs and DNA. 120 Primer pairs used for the comparison VtF-VtR, VtKf-VtKr and Jvt1-Jvt2, were 121 previously described by Paillard et al. (2006), Park et al. (2006) and Romalde et al. 122 (2007) respectively. All the primer pairs were designed on the basis of the 16S rRNA 123 5 gene, yielding amplification products of 416, 413 and 816 bp respectively. All PCR 124 reactions were carried out in parallel in a T-Professional basic (Biometra, Goettingen, 125 Germany) and an Uno Cycler (VWR, Barcelona, Spain) thermocyclers. PCR conditions 126 and amplification cycles used for denaturation, primer annealing and extension were 127 carried out according to each published PCR protocol. 128 Negative controls, consisting of the same reaction mixtures but with sterile distilled 129 water instead of DNA template, were included in each batch of PCR reaction. The 130 reproducibility of the results was assessed by repetition of the amplifications in at least 131 3 independent PCR assays. 132 133 2.4. Analysis of PCR products 134 Amplified products were detected by horizontal 1% (w/v) agarose gel electrophoresis 135 for 60 min at 100 V in TAE 1x electrophoresis buffer, visualized using 0.06 μg ml-1 of 136 ethidium bromide (BioRad, Madrid, Spain) and photographed under UV light and 137 computer digitized (Gel Doc 100, Bio-Rad). A 50 to 2000 bp ladder (Sigma-Aldrich, 138 Saint Louis, MO, USA) was used as a molecular mass marker. The presence of a single 139 product of the appropriate size, identical to the reference strains, was considered as a 140 positive result. 141 142 2.5. Determination of PCRs sensitivity and specificity 143 The detection limits of the three primer sets were evaluated using cultures of the type 144 strain CECT 4600T grown until exponential phase on MB. Culture was centrifugated 145 and resuspended on sterile saline (0.85% NaCl) adjusting turbidity to a OD=1at 580 nm 146 (Lambda2 UV/VIS Spectophotometer. Perkin Elmer). DNA was extracted, adjusted to 147 1000 ng/μl and serially diluted to 1 ag/μl. In each PCR tube, one μl of these dilutions 148 was loaded. 149 For the study of the specificity with the 23 V. tapetis isolates and the representatives of 150 the related 29 Vibrio species, DNA was adjusted to 1000 ng/μl and serially diluted to 151 use 100 ng of DNA in each PCR reaction. 152 In both cases, PCR conditions and electrophoresis were the same as described above. 153 154 2.6. Sequence analysis 155 In order to arise an explanation for the cross-reactivity observed for some primer sets, 156 sequence analysis and multiple alignments were performed with the BioEdit package, 157 6 version 2.1, and the MEGA version 4.0 softwares (Tamura et al., 2007). 158 Due to the lack of a 16S rRNA gene sequence for the strain GR0202RD in the 159 GeneBank database, this gen was sequenced as previously described (Osorio et al., 160 1999) using a GenomeLab DTCS-Quick Start kit (Beckman Coulter). Sequence editing 161 was performed with the DNASTAR Lasergene SEQMAN program. Ther obtained 162 sequence was deposited in the GeneBank with accession number FR797810. 163 164 3. Results 165 3.1. Detection limit for the primer pairs 166 The sensitivity of each species-specific PCR primer pairs were determined by 167 amplification of different dilutions of DNA extracted from the V. tapetis type strain 168 CECT 4600T. 169 With primer pairs VtF-VtR and Jvt1-Jvt2 and the T-Professional basic (Biometra) 170 machine, the expected products of 416 and 816 bp respectively were obtained with 171 samples containing as low as 1 pg of DNA per PCR tube (Fig. 1A and B), which 172 corresponded to 2 to 20 cells per reaction (data not shown). When amplifications were 173 performed in the Uno Cycler (VWR) apparatus, the same detection limit was achieved 174 with the VtF-VtR primer set, being one log-unit less sensitive the primer pair Jvt1-Jvt2 175 (Fig. 1A and B). The primer set VtKF-VtKR showed less sensitivity, being able to 176 amplify 10 pg (Biometra apparatus) or 100 pg (VWR machine) of DNA (Fig. 1C), 177 corresponding to 20 to 200 bacterial cells. The robustness of these results was 178 determined by making these assays by triplicate, obtaining the same results in all cases. 179 180 3.2. Specificity study 181 All V. tapetis isolates, regardless their geographical and host origin, were correctly 182 identified by the three PCR protocols and primers pairs analyzed, rendering specific 183 amplicons with the expected sizes of 816 (Jvt1-Jvt2), 416 (VtF-VtR) and 413 bp (VtKF-184 VtKR)(Table 1). 185 On the other hand, when DNA from the 29 related Vibrio species were subjected to 186 amplification, different results were obtained depending on the primer set and the 187 thermocycler employed. The best specificity was obtained using Jvt1-Jvt2, since no 188 positive amplifications were achieved in any of the PCR apparatus (Table 2; Fig. 2A). 189 With the primer set VtF-VtR, amplicons of the expected size (816 bp) were observed 190 for V. proteolyticus ATCC 15338T, V. ezurae DSM 17533T, V. nigripulchritudo CECT 191 13 Romalde, J.L., Magariños, B., Villar, C., Barja, J.L., Toranzo, A.E. 1999. Genetic 390 analysis of turbot pathogenic Streptococcus parauberis strains by ribotyping and 391 random amplified polymorphic DNA. FEMS Microbiol. Lett. 459, 297-304. 392 Romalde, J.L., Toranzo, A.E., 2002. Molecular approach for the study and diagnosis of 393 salmonid estreptococcosis. In Cunningham, C. (Ed), Molecular Diagnosis of 394 Salmonid Diseases. Kluwer Academic Publishers, Dordreecht, The Netherlands, pp 395 211-233. 396 Romalde, J.L., LópezRomalde, S., Ravelo, C., Magariños, B., Toranzo, A.E., 2004. 397 Developmente and validation of a PCR-based protocol for the detection of 398 Pseudomonas anguilliseptica. Fish Pathol. 39, 33-41. 399 Saulnier, D., Avarre, J.C., Moullac, G., Ansquer, D., Levy, P., Vonau, V., 2000. Rapid 400 and sensitive PCR detection of Vibrio penaeicida, the putative etiological agent of 401 Syndrome 93 in New Caledonia. Dis. Aquat. Org. 40, 109-115. 402 Sommer, R., Tautz, D., 1989. Minimal homology requirements for PCR primers. 403 Nucleic Acids Res. 17, 6749. 404 Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary 405 Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596-1599. 406 Toyama, T., Kita-Tsukamoto, K., Wakabayashi, H., 1996. Identification of Flexibacter 407 maritimus, Flavobacterium brachiophilum and Cytophaga columnaris by PCR 408 targeted 16S Ribosomal DNA. Fish Pathol. 31, 25-31. 409 410 411 412 413 14 Table 1.- Strains of Vibrio tapetis included in this study and results obtained with the three PCR detection protocols employed. Results for each 414 primer set in two thermocyclers are shown. 415 Strain Host Country/date of isolation Jvt1-Jvt2 VtF-VtR VtKF-VtKR VWR Biometra VWR Biometra VWR Biometra CECT 4600T Ruditapes philippinarum France, 1990 + + + + + + GR0202RD R. decussatus Spain, 1994 + + + + + + HH6087 Hippoglossus hippoglossus United Kingdom. 2001 + + + + + + GR0705RD R. decussatus Spain, 1994 + + + + + + CMJ 10.7 R. philippinarum Spain, 2005 + + + + + + C 11.25 R. philippinarum Spain, 2005 + + + + + + 102 R. philippinarum Ireland, 2005 + + + + + + 127 R. philippinarum Ireland, 2005 + + + + + + IS 1 R. philippinarum France, 1988 + + + + + + IS 8 Venerupis aurea France, 1990 + + + + + + IS 9 Cerastoderma edulis France, 1990 + + + + + + B 2.3 R. philippinarum France, 1991 + + + + + + B 8.3 R. philippinarum France, 1991 + + + + + + B 9.3 R. philippinarum France, 1991 + + + + + + GR1703RP R. philippinarum Spain, 1994 + + + + + + LP2 Symphodus melops Norway, 1999 + + + + + + C0620701B Umbrina cirrosa Spain, 2007 + + + + + + C0620701H U. cirrosa Spain, 2007 + + + + + + C0620701R U. cirrosa Spain, 2007 + + + + + + a200 Dicologoglossa cuneata Spain, 2005 + + + + + + a201 D. cuneata Spain, 2005 + + + + + + a204 D. cuneata Spain, 2005 + + + + + + a255 D. cuneata Spain, 2005 + + + + + + +, specific amplification for the primer set; –, no amplification detected. CECT: Spanish Collection of Type Cultures, Valencia, Spain. 416 15 Table 2.- Strainsa of related Vibrio species included in this study to test the specificity of 417 PCR protocols. Results for each primer set in two thermocyclers are shownb. 418 Jvt1-Jvt2 VtF-VtR VtkF-VtkR VWR Biometra VWR Biometra VWR Biometra V. aestuarianus ATCC 35048T – – – – – – V. alginolyticus CCM2575 – – – – – – V. anguillarum ATCC 43306T – – – – – – V. campbellii ATCC25920T – – – – – – V. cyclitrophicus LMG 21359T – – – – – – V. diazotrophicus CECT 627T – – – – – – V. ezurae DSM 17533T – – + + – – V. fluvialis CECT 4217T – – – – – – V. furnisii CECT 4203T – – – – – – V. halioticoli JCM21271T – – – – – – V. harveyi RA 58.2 – – – – – – V. lentus CECT 5110T – – – – – – V. logei NCIMB1443 – – – – – – V. mediterranei CECT 621T – – – – – – V. mimicus CECT 4218T – – – – – – V. mytili CECT 632T – – + – – + V. nereis ATCC 25917T – – – – – – V. nigripulchritudo CECT 628T – – + + – – V. ordalii NCMIB 2167T – – – – – – V. orientalis CECT 629T – – – – – – V. parahaemolyticus ATCC 27969 – – – – – – V. pectenicida A365T – – – – + – V. penaeicida AM101 – – – – – – V. pomeroyi LMG 20537T – – + + + + V. ponticus CECT 5869T – – – – – – V. proteolyticus ATCC 15338T – – + + – – V. splendidus CECT 528T – – + + – – V. tasmaniensis LMG 21574T – – – – – – V. vulnificus ATCC 27562T – – – – – – a ATCC, American Type Culture Collection, Rockville, MD, USA; CCM, Czech 419 Collection of Microorganisms, Czech Republic; LMG, BCCM/LMG Bacteria 420 Collection, Gent, Belgium; CECT, Spanish Collection of Type Cultures, Valencia, 421 Spain; DSM, German Collection of Microorganisms and Cell Cultures; JCM, Japan 422 Collection of Microorganisms; NCIMB: National of Industrial and Marine Bacterial 423 Ltd, Aberdeen, UK; V. harveyi RA 58.2 belongs to the Laboratory collection and strains 424 of V. pectenicida and V. penaeicida were kindly donated by Drs. Lambert and Goarant 425 from the IFREMER in Plouzane (France) and New Caledonia respectively. 426 b +, specific amplification for the primer set; –, no amplification detected. 427 16 Figure legends 428 429 Figure 1.- Sensitivity of the PCR protocols for detection of V. tapetis using Jvt1-Jvt2 430 (A), VtF-VtR (B), and VtKF-VtKR (C) primer sets. Lanes: M, PCR Marker (50-2000 431 bp ladder, Sigma); 1-11 and 13-23, Serial dilutions of DNA extracted from the type 432 strain CECT 4600T, ranging from 1000 ng/μl to 1 ag/μl.; 12 and 24, negative control 433 (water). 1 to 12, amplifications performed in a T-Professional basic (Biometra) 434 thermocycler; 13 to 24, amplifications performed in an Uno Cycler (VWR) 435 thermocycler. Numbers on the left indicate the position of molecular size marker in bp. 436 Numbers on the right indicate the size of the amplified products and the restriction 437 fragment in bp. 438 439 Figure 2.- Non-specific PCR products obtained for Vibrio sp. strains using Jvt1-Jvt2 440 (A), VtF-VtR (B), and VtKF-VtKR (C) primer stes. Lanes: M, PCR Marker (50-2000 441 bp ladder, Sigma); 1 and 18, V. parahaemolyticus ATCC 27969; 2 and 19, V. 442 pectenicida A365T; 3 and 20, V. mediterranei CECT 621T; 4 and 21, V. proteolyticus 443 ATCC 15338T; 5 and 22, V. nereis ATCC 25917T; 6 and 23, V. cyclitrophicus LMG 444 21359T; 7 and 24, V. ezurae DSM 17533T; 8 and 25, V. nigripulchritudo CECT 628T; 9 445 and 26, V. splendidus CECT 528T; 10 and 27, V. lentus CECT 5110T; 11 and 28, V. 446 orientalis CECT 629T; 12 and 29, V. campbellii ATCC25920T; 13 and 30, V. pomeroyi 447 LMG 20537T; 14 and 31, V. mytili CECT 632T; 15 and 32, V. furnisii CECT 4203T; 16 448 and 33, positive control (V. tapetis CECT4600T); 17 and 34, negative control (water). 1 449 to 17, amplifications performed in a T-Professional basic (Biometra) thermocycler; 18 450 to 34, amplifications performed in an Uno Cycler (VWR) thermocycler. Numbers on 451 the left indicate the position of molecular size marker in bp. Numbers on the right 452 indicate the size of the amplified products and the restriction fragment in bp. 453 454 Figure 3.- Alignment of the 16S rRNA gene sequences of the three strains of V. tapetis, 455 CECT4600T (NR026361) GR0202RD (FR797810) and HH6087 (AY800101), 456 representatives of the different genetic groups described within this bacterial species, 457 and the sequences of the Vibrio species with cross-reactivity in the PCR protocols using 458 primer pairs VtF-VtR and VtKF-VtKR, including V. nigripulchritudo ATCC27043T 459 (X74717), V. splendidus ATCC33125T (X74724) V. penaeicida DSM14398T 460 17 (AJ421444), V. pectenicida A365T (Y13830), V. ezurae HDS1-1T (AY426980), V. 461 pomeroyi LMG20537T (AJ491290), V. mytili CECT632T (X99761) and V. proteolyticus 462 ATCC15338T (X74723). The location of the each primer-set used in this study is 463 indicated. Sequence annotations based on 16S rRNA gene sequence of V. tapetis CECT 464 4600T. 465 466 M 1 2 3 4 5 6 7 8 9 10 11 12 M M 13 14 15 16 17 18 19 20 21 22 23 24 M A M 1 2 3 4 5 6 7 8 9 10 11 12 M M 13 14 15 16 17 18 19 20 21 22 23 24 M B M 1 2 3 4 5 6 7 8 9 10 11 12 M M 13 14 15 16 17 18 19 20 21 22 23 24 M C 816 816 416 416 413 413 1000 500 300 1000 500 300 1000 500 300 1000 500 300 1000 500 300 1000 500 300 Fig. 1.- Balboa et al. Figures 1 & 2 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M M 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 M 1000 500 300 1000 500 300 816 816 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M M 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 M 1000 500 300 1000 500 300 416 416 M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 M M 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 M 1000 500 300 1000 500 300 413 413 A B C Fig. 2.- Balboa et al. 10 20 30 40 50 60 70 80 90 100 110 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| V. tapetis CECT4600T --------------------CTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGAAACGAGAA----GTAGCTT------GCTACTTCGGCGTCGAG V. tapetis 0202RD --------GTTTGATCCTGG........................................................----.......------................. V. tapetis HH6087 --------------------........................................................----.......------................. V. nigripulchritudo ATCC27043T -----AGAGTTTGATCATGG......................................................TTNTCT.A.C...CGGGGAA.G..AA.......... V. splendidus ATCC33125T ATTGAAGAGTTTGATCATGG.....................................................C.CTAACAATC...CGGGTGNN.TAA.G......... V. penaeicida DSM14398T -----------------TGG.......................................................-----A......------....T.-.......... V. pectenicida A365T -------AGTTTGATCATGG........................................................----.......------................. V. ezurae HDS1-1T ------------------GG......................................................TTATCT.A.C...CGGGGAA.G.TAA.......... V. pomeroyi LMG20537T -------------------------................................................C.CTAACAATC...CGGGTGCG.TAA.G......... V. mytili CECT632T --------------------------................................................TTAACT.A.C...CGGGGAA.GTTAA.......... V. proteolyticus ATCC15338T ------GAGTTTGATCATGG......................................................TTATCT.A.C...CGGGGAA.G.TA........... 450 460 470 480 490 500 510 520 530 540 550 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| V. tapetis CECT4600T CCTTCGGGTTGTAAAGTACTTTCAGCAGTGAGGAAGGGGTGTAC-GTTAATAGCGTGCATCCTTGACGTTAGCTGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCC V. tapetis 0202RD ............................................-................................................................. V. tapetis HH6087 ............................................-................................................................. V. nigripulchritudo ATCC27043T ................C.....................-...GTAT.......ATGCACANT................................................ V. splendidus ATCC33125T .........................TT...........-G...NC..........NNATCT............AA................................... V. penaeicida DSM14398T ......................................-...GAA.........T.CATAT................................................. V. pectenicida A365T .....................................T.GA.GT-..........CATTCAT................................................ V. ezurae HDS1-1T .........................TC..........C-A...TA.........TGTAT.GT...........GA................................... V. pomeroyi LMG20537T .........................TT...........-G..RDM.........KBYATCT............AA................................... V. mytili CECT632T ..........................................GT-..........CA....T................................................ V. proteolyticus ATCC15338T ................C........TC..........T-A..GTA........ATGCAT.AT...........GA................................... 1220 1230 1240 1250 1260 1270 1280 1290 1300 1310 1320 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| V. tapetis CECT4600T GGACGACGTCAAGTCATCATGGCCCTTACGAGTAGGGCTACACACGTGCTACAATGGCGCATACAGAGGGCAGCCAACCAGCGATGGTGAGCGAATCCCAAAAAGTGCGT V. tapetis 0202RD .............................................................................................................. V. tapetis HH6087 .............................................................................................................. V. nigripulchritudo ATCC27043T .......................................................................G......TT....GA........................ V. splendidus ATCC33125T ..........................................................................A.G.T......A........................ V. penaeicida DSM14398T .......................................................................G...................................... V. pectenicida A365T .......................................................................G......TT..A.AA........................ V. ezurae HDS1-1T .............................................................................................................. V. pomeroyi LMG20537T ..........................................................................A.G...........R..................... V. mytili CECT632T ..............................................................................TT....GA........................ V. proteolyticus ATCC15338T .......................................................................G......TT....AA........................ VtF VtKF VtR VtKF Jvt1 Jvt2 Figure 3