RESEARCH ARTICLE
Immuniza ion wi h
Lipopolysaccha ide-De icien Whole Cells
P o ides P o ec i e Immuni y in an
Expe imen al Mouse Model o
Acine obac e baumannii In ec ion
Me i xell Ga cı´a-Quin anilla, Ma ina R. Pulido, Je o´nimo Pacho´n,
Michael J. McConnell*
Ins i u e o Biomedicine o Se illa (IBiS), Uni e si y Hospi al Vi gen del Rocı´o/CSIC/Uni e si y o Se illa,
Se illa, Spain
*[email protected]
Abs ac
The inc easing clinical impo ance o in ec ions caused by mul id ug esis an
Acine obac e baumannii wa an s he de elopmen o no el app oaches o
p e en ion and ea men . In his con ex , accina ion o ce ain pa ien popula ions
may con ibu e o educing he mo bidi y and mo ali y caused by his pa hogen.
Vaccines agains G am-nega i e bac e ia based on inac i a ed bac e ial cells a e
highly immunogenic and ha e been shown o p oduce p o ec i e immuni y agains
a numbe o bac e ial species. Howe e , he high endo oxin le els p esen in hese
accines due o he p esence o lipopolysaccha ide complica es hei use in human
accina ion. In he p esen s udy, we used a labo a o y-de i ed s ain o A.
baumannii ha comple ely lacks lipopolysaccha ide due o a mu a ion in he lpxD
gene (IB010), one o he genes in ol ed in he i s s eps o lipopolysaccha ide
biosyn hesis, o accina ion. We demons a e ha IB010 has g ea ly educed
endo oxin con en (,1.0 endo oxin uni /10
6
cells) compa ed o wild ype cells.
Immuniza ion wi h o malin inac i a ed IB010 p oduced a obus an ibody esponse
consis ing o bo h IgG1 and IgG2c sub ypes. Mice immunized wi h IB010 had
signi ican ly lowe pos -in ec ion issue bac e ial loads and signi ican ly lowe se um
le els o he p o-in lamma o y cy okines IL-1b, TNF-aand IL-6 compa ed o con ol
mice in a mouse model o dissemina ed A. baumannii in ec ion. Impo an ly,
immunized mice we e p o ec ed om in ec ion wi h he ATCC 19606 s ain and an
A. baumannii clinical isola e. These da a sugges ha immuniza ion wi h inac i a ed
OPEN ACCESS
Ci a ion: Ga cı´a-Quin anilla M, Pulido MR, Pacho´n
J, McConnell MJ (2014) Immuniza ion wi h
Lipopolysaccha ide-De icien Whole Cells P o ides
P o ec i e Immuni y in an Expe imen al Mouse
Model o Acine obac e baumannii In ec ion. PLoS
ONE 9(12): e114410. doi:10.1371/jou nal.pone.
0114410
Edi o : Gunna F. Kau mann, The Sc ipps
Resea ch Ins i u e and So en o The apeu ics, Inc.,
Uni ed S a es o Ame ica
Recei ed: Ap il 16, 2014
Accep ed: No embe 9, 2014
Published: Decembe 8, 2014
Copy igh : ß2014 Ga cı´a-Quin anilla e al. This
is an open-access a icle dis ibu ed unde he
e ms o he C ea i e Commons A ibu ion
License, which pe mi s un es ic ed use, dis ibu-
ion, and ep oduc ion in any medium, p o ided he
o iginal au ho and sou ce a e c edi ed.
Da a A ailabili y: The au ho s con i m ha all da a
unde lying he indings a e ully a ailable wi hou
es ic ion. All ele an da a a e wi hin he pape .
Funding: Suppo was p o ided by REIPI REIPI
RD06/0008/0000 Conseje ı´a de Salud de la Jun a
de Andalucı´a (PI-0046-2011) Subp og ama Miguel
Se e om he Minis e io de Economı´a y
Compe i i idad o Spain (CP11/00314). The un-
de s had no ole in s udy design, da a collec ion
and analysis, decision o publish, o p epa a ion o
he manusc ip .
Compe ing In e es s: MJM and JP a e ounde s
and scien i ic ad iso s o he bio echnology
compnay Vaxdyn, S.L. This does no al e he
au ho s’ adhe ence o PLOS ONE policies on
sha ing da a and ma e ials.
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 1/14
A. baumannii whole cells de icien in lipopolysaccha ide could se e as he basis o
a accine o he p e en ion o in ec ion caused by A. baumannii.
In oduc ion
Acine obac e baumannii is a G am-nega i e coccobacillus wi h inc easing clinical
impo ance in he hospi al se ing. This o ganism is widely dissemina ed in he
soil and wa e o na u al en i onmen s [1], and can cause di e en ypes o
in ec ions as a nosocomial pa hogen including pneumonia, bac e emia,
meningi is and skin and so issue in ec ion, among o he s [2]. This pa hogen
ypically in ec s pa ien s ecei ing mechanical en ila ion and bu n pa ien s [3],
howe e , i has also been isola ed om communi y-acqui ed pneumonia samples
[4,5] and mili a y pe sonnel wi h auma ic inju ies in Vie nam, I aq, Kuwai and
A ghanis an [6,7]. C ude mo ali y a es associa ed wi h A. baumannii in ec ion
ha e been epo ed o be be ween 35% and 70% o nosocomial in ec ions [8].
Impo an ly, due o he well-documen ed abili y o A. baumannii o acqui e
an ibio ic esis ance, he numbe o mul id ug and pand ug esis an s ains has
inc eased ala mingly in ecen yea s [9,10]. The global eme gence o hese highly
esis an s ains has se e ely complica ed he clinical managemen o in ec ions
caused by A. baumannii. In his con ex o inc easing an ibio ic esis ance, he
de elopmen o an e icien accine agains A. baumannii could con ibu e o
educing mo bidi y and mo ali y in ce ain pa ien popula ions [11].
The expe imen al accines ha ha e been desc ibed o A. baumannii can be
classi ied in o wo b oad g oups, accines ha consis o a single pu i ied an igen,
and mul icomponen accines. Wi hin he i s g oup, he ou e memb ane
p o ein OmpA [12], he bio ilm-associa ed p o ein Bap [13], he memb ane
anspo e A a [14], and he memb ane associa ed polysaccha ide poly-N-ace yl-
b-(1–6)-glucosamine [15] ha e been epo ed as good candida es due o hei
abili y o elici speci ic immune esponse. Howe e , su i al expe imen s a e
ac i e immuniza ion ha e only been epo ed o OmpA, which showed pa ial
p o ec ion, and Bap, whose exp ession in s ains ha do no o m bio ilms is
unclea . The s a egies employing mul icomponen accines ha e included ou e
memb ane complexes [16], ou e memb ane esicles [17], and o malin-
inac i a ed whole cells [18]. Each o hese accines induced no only a po en
immune esponse bu also p o ided high le els o p o ec ion agains A. baumannii
in ec ions in a mu ine model using bo h he ATCC 19606 ype s ain and clinical
isola es. Howe e , despi e hese p omising esul s, he use o hese mul i-
componen app oaches in humans is complica ed by he ele a ed endo oxin
con en o hese accines due o he high le els o lipopolysaccha ide (LPS)
p esen in hese p epa a ions.
LPS consis s o he O-an igen, a co e polysaccha ide and lipid A, he moie y
esponsible o he endo oxin ac i i y o LPS. Ea ly s udies employing Esche ichia
Immuniza ion wi h LPS-De icien A. baumannii
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 2/14
coli demons a ed ha he p oduc ion o LPS was essen ial o bac e ial iabili y
[19]. Howe e , i was la e demons a ed ha ce ain bac e ial species, namely
Neisse ia meningi idis and Mo axella ca a halis, we e iable e en a e mu a ing
he enzymes in ol ed in LPS biosyn hesis, esul ing in a comple e lack o LPS
p oduc ion [20,21]. A ecen epo demons a ed ha A. baumannii can acqui e
esis ance o he pep ide an ibio ic colis in ia mu a ion in he genes in ol ed in
he i s s eps o lipid A syn hesis lpxA,lpxC and lpxD [22], esul ing in s ains
comple ely de icien in LPS. These esul s indica e ha A. baumannii is also iable
in he absence o LPS p oduc ion, aising he possibili y ha accines based on
hese LPS-de icien s ains could be de eloped.
The objec i e o he p esen s udy was o de elop an LPS-de icien inac i a ed
whole cell (IWC) accine agains A. baumannii and o cha ac e ize he immune
esponse o immuniza ion and i s e icacy in a mu ine sepsis model. We
demons a e ha he LPS de icien IWC p oduces a obus an ibody esponse ha
is able o educe pos -in ec ion issue bac e ial loads and p o ide p o ec ion
agains in ec ion in a mouse model o A. baumannii in ec ion.
Ma e ials and Me hods
E hics S a emen
All expe imen s in ol ing he use o animals we e app o ed by he Uni e si y
Hospi al Vi gen del Rocı
´o Commi ee on E hics and Expe imen a ion (E alua ion
code: 2013PI/296). In all expe imen s, e o s we e made o minimize su e ing,
and any animals appea ing mo ibund du ing he cou se o expe imen a ion we e
immedia ely eu hanized using hiopen al.
Bac e ial s ains
A. baumannii ATCC 19606 is an an ibio ic suscep ible e e ence s ain. An LPS-
de icien de i a i e o ATCC 19606 was ob ained by pla ing an o e nigh cul u e
o ATCC 19606 on Muelle Hin on aga con aining 10 mg/ml o colis in, as
desc ibed p e iously [22]. S ains wi h mu a ions in he genes in ol ed in LPS
biosyn hesis we e iden i ied by sequencing he lpxA,lpxC and lpxD genes o he
colis in esis an mu an s ha we e p esen a e o e nigh g ow h a 37˚C. A
s ain wi h a la ge dele ion in he lpxD gene was iden i ied and designa ed IB010.
Resis ance o colis in was con i med by b o h mic odilu ion acco ding o Clinical
Labo a o y S anda d Ins i u e guidelines [23]. Absence o LPS was con i med by
measu ing he endo oxin le els o h ee independen cul u es o each s ain using
he QCL-1000 Limulus Amebocy e Assay (Lonza) acco ding o he manu ac u e ’s
ins uc ions. The Ab-154 s ain is a p e iously cha ac e ized A. baumannii clinical
isola e [24].
Immuniza ion wi h LPS-De icien A. baumannii
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 3/14
Vaccine p epa a ion and mouse immuniza ion
The IWC accines (bo h LPS-con aining and LPS-de icien ) we e p epa ed as
desc ibed based on a p e iously desc ibed me hod [22]. B ie ly, he ATCC 19606
and IB010 s ains we e g own in Muelle - Hin on b o h o OD
600
o 0.8. In he
case o IB010, 10 mg/ml o colis in we e added o he cul u e. In o de o con i m
he p esence o he dele ion a e g ow h o IB010, h ee independen cul u es o
ATCC 19606 and IB010 we e g own, and genomic DNA was isola ed om each
cul u e using he QIAmp DNA Mini Ki (Qiagen). The lpxD speci ic p ime s 59
GCTAATTGGTGAAGGTAGTC 39and 59GACGAATCGTTTGAATCTGC 39
we e used o ampli y genomic DNA om he cul u es in o de o con i m ha he
dele ion in lpxD o IB010 was p esen a e g ow h.
Fo accine p epa a ion, bac e ia we e washed ex ensi ely in phospha e bu e
saline be o e inac i a ion in 0.5 M o malin o 18 h wi h shaking a oom
empe a u e. Comple e inac i a ion o he bac e ia was con i med by pla ing on
blood aga . The concen a ion o inac i a ed cells was adjus ed o 1610
10
cells/ml
and combined 1:1 ( / ) wi h he aluminium-based adju an , Alhyd ogel 2% (w/ )
(In i oGen). Vaccina ion was ca ied ou in 6 o 8-week-old, emale C57BL/6 o
BALB/c mice by in amuscula injec ion o 100 ml o he accine in o each
quad iceps muscle on days 0 and 14. Con ol mice we e injec ed simila ly wi h a
mix u e o phospha e bu e saline and adju an .
Mouse model o A. baumannii in ec ion
A mouse model o sepsis p e iously de eloped by ou g oup and used o he
e alua ion o accines agains A. baumannii was used o cha ac e ize he e icacy
o he accine [25,26]. This model p oduces a dissemina ed in ec ion a e
in ape i oneal ins illa ion o he inoculum, ypically esul ing in dea h wi hin 24
o 48 hou s. Fo p epa a ion o he inocula, A. baumannii s ains we e g own o
18 h a 37˚C in Muelle -Hin on b o h cul u es and adjus ed o he app op ia ed
concen a ion in physiological saline as desc ibed p e iously [8,27]. Bac e ial
concen a ions o he inocula we e de e mined by pla ing on blood aga . Mice
we e in ec ed on day 21 (one week a e he second immuniza ion) o C57BL/6
and on day 28 o BALB/c mice by in ape i oneal injec ion wi h 0.5 ml o he
bac e ial suspension and su i al was moni o ed o 7 days.
Spleen bac e ial loads and se um cy okine le els
Pos -in ec ion bac e ial loads we e de e mined in accina ed and con ol mice
12 h a e in ec ion. Mice we e eu hanized wi h an o e dose o hiopen al and
a e collec ion o blood samples om he e o-o bi al sinus, spleens we e
asep ically emo ed, weighed and homogenized in 2 ml o physiological saline.
Se ial log dilu ions we e pla ed on blood aga pla es o bac e ial quan i ica ion.
Se um le els o in e leukin-1b(IL-1b), umo nec osis ac o alpha (TNF-a), and
in e leukin-6 (IL-6) we e de e mined in mice a 12 h pos -in ec ion using BD
Op EIA mouse ki s (BD Biosciences).
Immuniza ion wi h LPS-De icien A. baumannii
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 4/14
Enzyme-linked immunoso ben assays (ELISAs)
Fo indi ec enzyme-linked immunoso ben assays (ELISAs), 96-well pla es we e
coa ed wi h 5610
7
bac e ial cells/well in phospha e bu e saline by incuba ing a
4˚C o e nigh . ELISAs we e pe o med using se a collec ed on days 0, 7 and 21 as
desc ibed p e iously [28]. An ibody i e s we e measu ed agains he s ain which
was used o immunize he mouse, and we e de ined as he dilu ion in which
spec opho ome ic eadings we e a leas 0.1 uni s abo e backg ound wells (wells
con aining no se um).
S a is ical analysis
An ibody i e s, bac e ial loads, and cy okine le els we e compa ed using he
K uskal-Wallis H es and he Mann-Whi ney U es o independen samples, and
he F iedmann and Wilcoxon es s o dependen samples. The Bon e oni
co ec ion was applied when app op ia e. Su i al da a we e compa ed using he
log- ank es . All s a is ics we e pe o med using SPSS e sion 15.0 so wa e (SPSS
Inc.), and a p alue o #0.05 was conside ed signi ican .
Resul s
Selec ion o an LPS-de icien s ain o accine de elopmen
G ow h o ATCC 19606 in he p esence o 10 mg/ml colis in esul ed in nume ous
colis in- esis an de i a i es wi h mu a ions in he lpxA,lpxC and lpxD genes
(da a no shown). One o hese s ains, IB010, con ained a la ge dele ion o 462
nucleo ides in he lpxD (nucleo ides 104–565) gene and was chosen o u he use
in accine s udies. We easoned ha on he basis ha he s ain con ained a la ge
dele ion, his s ain would be less likely o e e o wild ype du ing g ow h han
s ains con aining single nucleo ide changes o small dele ions in he LPS
biosyn hesis genes. B o h mic odilu ion expe imen s demons a ed ha he
minimum inhibi o y concen a ion o he ATCC 19606 s ain was #0.25 mg/ml
and .128 mg/ml o IB010, demons a ing ha , simila o esul s desc ibed
p e iously [22], mu a ions in lpxD can esul in esis ance o colis in. In o de o
ensu e ha he IB010 was gene ically s able du ing g ow h, genomic DNA om
h ee independen cul u es o ATCC 19606 and IB010 we e ampli ied wi h lpxD-
speci ic p ime s o con i m ha he dele ion was p esen . As shown inFigu e 1A,a
band co esponding o he mu a ed lpxD gene o IB010 con aining a dele ion o
462 nucleo ides was p esen a e ampli ica ion om h ee independen IB010
cul u es. Pheno ypic loss o LPS and educ ion in endo oxin le els we e
cha ac e ized by he Limulus Amebocy e Assay o ATCC 19606 and IB010, and
demons a ed ha mu a ion in he lpxD gene esul ed in a d ama ic educ ion in
endo oxin le els o .1 EU pe 10
6
cells (Figu e 1B).
Immuniza ion wi h LPS-De icien A. baumannii
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 5/14

An ibody esponse o he LPS-de icien IWC accine
Fo malin ea men o ATCC 19606 and IB010 esul ed in no iable bac e ia,
indica ing comple e bac e ial inac i a ion. No ad e se e ec s we e obse ed in
mice accina ed wi h inac i a ed IB010 and inac i a ed ATCC 19606 cells. In
o de o quan i y he an ibody esponse p oduced by immuniza ion wi h
inac i a ed IB010, indi ec ELISAs we e pe o med using se a collec ed om
nega i e con ol mice (immunized wi h PBS and adju an ) and mice accina ed
wi h 1610
9
inac i a ed IB010 cells. As a posi i e con ol, one g oup o mice was
immunized wi h 1610
9
inac i a ed ATCC 19606 cells on he basis ha we ha e
p e iously shown ha immuniza ion wi h hese cells induces a obus immune
esponse and p oduces p o ec i e immuni y agains expe imen al in ec ion [18].
As shown in Figu e 2A, immuniza ion wi h inac i a ed IB010 elici ed de ec able
le els o an igen-speci ic o al IgG in all mice se en days a e a single
in amuscula adminis a ion, and hese an ibody le els we e signi ican ly
inc eased upon boos ing wi h a second adminis a ion o he accine (p50.03
Wilcoxon es ). To al IgG i e s in mice ecei ing wo adminis a ions o
inac i a ed IB010 accine we e simila o i e s in mice ecei ing he accine
con aining inac i a ed wild ype cells (p50.726 Mann Whi ney U es ). Con ol
mice had no de ec able an igen-speci ic IgG a any poin . In con as , IgM le els
we e simila be ween mice immunized wi h he inac i a ed IB010 accine and
mice ecei ing inac i a ed wild ype cells se en days a e a single adminis a ion
(p50.186 Mann Whi ney U es ), howe e se en days a e a second
immuniza ion he e was no de ec able an igen-speci ic IgM in IB010- accina ed
mice whe eas all mice immunized wi h inac i a ed wild ype cells had de ec able
le els o IgM (Figu e 2B).
Le els o he IgG sub ypes IgG1 and IgG2c, he IgG2a homolog in C57BL/6
[27], we e de e mined in 21-day se um (Figu e 2C and D). Bo h g oups o mice
ecei ing he inac i a ed accines had signi ican le els o IgG1 and IgG2c
compa ed o con ol mice (p,0.001; Mann-Whi ney U es ). In e es ingly, IgG1
Figu e 1. Mu a ion and endo oxin con en o IB010. (A) Genomic DNA om h ee independen cul u es o
ATCC 19606 and IB010 was ex ac ed and ampli ied using p ime s speci ic o he lpxD gene. The band
co esponding o app oxima ely 1000 Kb co esponds o he in ac lpxD gene, whe eas he as e mig a ing
band co esponds o he lpxD gene wi h a dele ion o 462 nucleo ides. (B) Endo oxin le els o ATCC 19606
and IB010 de e mined by he Limulus Amebocy e Assay. Ba s ep esen he median alues o h ee
independen cul u es, and e o ba s ep esen he s anda d e o o he mean. EU; endo oxin uni s.
doi:10.1371/jou nal.pone.0114410.g001
Immuniza ion wi h LPS-De icien A. baumannii
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 6/14
i e s we e signi ican ly highe in IB010- accina ed mice compa ed o ATCC
19606- accina ed mice (p50.003; Mann-Whi ney U es ), whe eas IgG2c i e s
we e simila be ween hese g oups. These esul s indica e ha bo h Th1 and Th2
esponses a e elici ed by he inac i a ed IB010 accine simila o wha was
p e iously shown o he inac i a ed ATCC 19606 accine [18].
E ec o accina ion on pos -in ec ion bac e ial loads
In o de o cha ac e ize he e ec o accina ion on pos -in ec ion issue bac e ial
loads, we employed a mouse model p e iously de eloped by ou g oup o he
cha ac e iza ion o accine o p e en ing in ec ion by A. baumannii [16-18]. This
model apidly p oduces a dissemina ed in ec ion in which bac e ia a e de ec ed in
dis al o gans as soon as one hou pos -in ec ion [16]. Vaccina ed and con ol
mice we e in ec ed wi h 2.0610
6
c u (3006LD
50
) o he ATCC 19606 s ain, and
Figu e 2. An ibody esponse o immuniza ion wi h IB010. Se um samples we e collec ed om ATCC 19606 accina ed, IB010 accina ed and con ol
mice be o e accina ion (Day 0) and a day 7 and 21 a e he i s immuniza ion, and le els o an igen speci ic o al IgG (A) and IgM (B) we e measu ed by
ELISA (n58 mice/g oup). IgG1 (C) and IgG2c (D) le els in se um collec ed 7 days a e he second immuniza ion we e de e mined in se um we e measu ed
by ELISA in ATCC 19606 accina ed, IB010 accina ed and con ol mice In all panels box and whiske plo s ep esen he in e qua ile anges and anges,
espec i ely, and ho izon al lines ep esen median alues. * p,0.05 compa ed o le els in con ol mice a he same ime poin , #p,0.05 compa ed o 7-day
samples om he same expe imen al g oup, {p,0.05 compa ed o 21-day samples in ATCC 19606 accina ed mice.
doi:10.1371/jou nal.pone.0114410.g002
Immuniza ion wi h LPS-De icien A. baumannii
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 7/14
12 hou s a e in ec ion spleen bac e ial loads we e de e mined (Figu e 3). IB010
accina ion educed he numbe o bac e ia in spleens app oxima ely 1000- old
compa ed o con ol mice (p,0.05; Mann-Whi ney U es ).
E ec o accina ion on pos -in ec ion se um cy okine le els and
su i al
In o de o cha ac e ize he e ec o immuniza ion wi h he inac i a ed LPS
de icien accine on cy okine le els, se a we e collec ed om accina ed and
con ol mice 12 h pos -in ec ion and he le els o IL-1b, IL-6 and TNF-awe e
de e mined (Figu e 4). Le els o all h ee cy okines we e signi ican ly lowe in
bo h g oups o accina ed mice han in con ol mice (p50.003 o IL-1b, IL-6 and
TNF-a; Mann-Whi ney U es ), sugges ing ha accina ed mice did no
expe ience he p o-in lamma o y cy okine elease associa ed wi h he
de elopmen o sep ic shock.
Vaccine e icacy was es ed by in ec ing immunized and con ol mice wi h
2.25610
6
c u (340.96LD
50
) o he ATCC 19606 s ain se en days a e he
second immuniza ion, and su i al was moni o ed o e se en days (Figu e 5). All
mice accina ed wi h he IB010 accine we e p o ec ed om challenge, whe eas all
con ol mice died wi hin 48 hou s (P,0.001; log- ank es ). As expec ed, all mice
immunized wi h he ATCC 19606 s ain su i ed challenge, simila o esul s ha
we e p e iously epo ed [18]. In o de o de e mine i accina ion wi h IB010
could p o ec agains he e ologous challenge wi h an un ela ed s ain, immunized
and con ol mice we e in ec ed wi h 1.05610
6
c u (2.186LD
50
) o he p e iously
cha ac e ized A. baumannii clinical isola e Ab-154 [29]. Once again, all
immunized mice su i ed challenge whe eas con ol mice succumbed o in ec ion
wi hin 48 hou s (p,0.001; log- ank es ), indica ing ha immuniza ion wi h
IB010 can p o ide c oss p o ec ion agains challenge wi h a he e ologous s ain.
Figu e 3. E ec o accina ion on issue bac e ial loads. Immunized and con ol mice we e in ec ed wi h
2.0610
6
c u (3006LD
50
) o he ATCC 19606 s ain and spleen bac e ial loads we e de e mined 12 hou s
pos -in ec ion (n58 mice/g oup). Da a poin s ep esen bac e ial loads om indi idual mice, and ho izon al
lines ep esen median alues om g oups o mice. * p,0.05 compa ed o con ol mice. #p,0.05 compa ed
o ATCC 19606 accina ed mice.
doi:10.1371/jou nal.pone.0114410.g003
Immuniza ion wi h LPS-De icien A. baumannii
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 8/14
We nex wan ed o cha ac e ize he immune esponse o accina ion and he
p o ec i e capaci y o he accine in a di e en mouse s ain. As shown in
Figu e 6A, bac e ial loads in spleens, kidneys, and lungs we e signi ican ly
(app oxima ely 1000- old) lowe in BALB/c mice accina ed wi h he ATCC
19606 accine and he IB010 accine compa ed o con ol mice 12 hou s a e
in ec ion wi h 4.0610
5
c u (4.146LD
50
) o he ATCC 19606 s ain (p,0.05;
Figu e 4. E ec o accina ion on pos -in ec ion p o-in lamma o y cy okine le els. Immunized and
con ol mice we e in ec ed wi h 2.0610
6
c u (3006LD
50
) o he ATCC 19606 s ain and se um le els o IL-
1b, TNF-a, and IL-6 we e de e mined (n58 mice/g oup). Da a poin s ep esen cy okine le els om indi idual
mice, and ho izon al lines ep esen median alues om g oups o mice. * p,0.05 compa ed o con ol mice,
#p,0.05 compa ed o ATCC 19606 accina ed mice.
doi:10.1371/jou nal.pone.0114410.g004
Immuniza ion wi h LPS-De icien A. baumannii
PLOS ONE | DOI:10.1371/jou nal.pone.0114410 Decembe 8, 2014 9/14