JOURNAL OF BACTERIOLOGY,
0021-9193/00/$04.00⫹0Jan. 2000, p. 38–44 Vol. 182, No. 1
Copy igh © 2000, Ame ican Socie y o Mic obiology. All Righ s Rese ed.
Ligh -Dependen Regula ion o Cyanobac e ial
Phy och ome Exp ession
M. GARCI
´A-DOMI
´NGUEZ, M. I. MURO-PASTOR, J. C. REYES, AND F. J. FLORENCIO*
Ins i u o de Bioquı´mica Vege al y Fo osı´n esis, Uni e sidad de Se illa-CSIC, Cen o de In es igaciones Cien ı´ icas
Isla de la Ca uja, Isla de la Ca uja, E-41092 Se ille, Spain
Recei ed 11 June 1999/Accep ed 14 Oc obe 1999
A his idine kinase p o ein (Cph1) wi h sequence homology and spec al cha ac e is ics e y simila o hose
o he plan phy och ome has been ecen ly iden i ied in he cyanobac e ium Synechocys is sp. s ain PCC 6803.
Cph1 oge he wi h Rcp1 (a p o ein homologue o he esponse egula o CheY) o ms a ligh - egula ed
wo-componen sys em whose unc ion is p esen ly unknown. Le els o cph1 cp1 mRNA inc ease in he da k
and dec ease upon eillumina ion. A da k-media ed inc ease in cph1 cp1 mRNA le els was inhibi ed by he
p esence o glucose, bu no by inhibi ion o he pho osyn he ic elec on low. The hal -li e o cph1 cp1
ansc ip in he ligh was abou ou old sho e han in he da k, indica ing ha con ol o cph1 cp1
ansc ip s abili y is one o he mechanisms by which ligh egula es exp ession o he cyanobac e ial
phy och ome. A e 15 min o da kness, 3-min pulses o ed, blue, g een, and a - ed ligh we e equally e icien
in dec easing he cph1 cp1 mRNA le els. Red ligh down egula ion was no e e sed by a - ed ligh ,
sugges ing ha cph1 cp1 mRNA le els a e no con olled by a phy och ome-like pho o ecep o . Fu he mo e,
aSynechocys is s ain con aining an H538R Cph1 poin mu a ion, unable o phospho yla e Rcp1, shows no mal
ligh -da k egula ion o he cph1 cp1 ansc ip le els. Ou da a sugges a ole o cyanobac e ial phy och ome
in he con ol o p ocesses equi ed o adap a ion in ligh -da k and da k-ligh ansi ions.
Pho osyn he ic o ganisms mus main ain a me abolic ho-
meos asis despi e daily a ia ions in inciden ligh . No only
does ligh p o ide ene gy o pho osyn hesis, bu a la ge num-
be o plan de elopmen al e en s a e also esponsi e o ligh
cues. Acco dingly, pho osyn he ic o ganisms ha e e ol ed ligh
de ec ion sys ems (pho o ecep o s) ha con ol gene exp es-
sion h ough signal ansduc ion pa hways (25).
Phy och omes a e he bes cha ac e ized o hose pho o e-
cep o s. Phy och omes exis in wo di e en pho ocon e ible
o ms, he ed-ligh -abso bing o m (P ) and he a - ed-ligh -
abso bing o m (P ) ( o e iews, see e e ences 27 and 34). In
plan s, phy och omes a e soluble homodime s cons i u ed by
wo subuni s o abou 125 kDa, each o which olds in o wo
majo s uc u al domains: an amino- e minal domain ha
binds he ch omopho e and a ca boxy- e minal domain ha
con ains egions necessa y o dime iza ion and biological ac-
i i y. How he plan phy och ome ansduces pe cei ed pho-
osenso y in o ma ion o downs eam signaling componen s
emains unclea , al hough some p og ess has been made o-
wa d de e mining i ( o a e iew, see e e ence 10).
The ield o phy och ome esea ch has ecen ly been e o-
lu ionized by he inding o a phy och ome in he cyanobac e-
ium Synechocys is sp. s ain PCC 6803 (16, 18, 20, 37) ( o
e iews, see e e ences 9, 24, and 26). Cyanobac e ia a e pho-
osyn he ic p oka yo es ha ca y ou oxygenic pho osyn hesis
simila o euka yo ic algae and highe plan s. The mos exci ing
aspec o his disco e y is ha cyanobac e ial phy och ome,
Cph1, is he senso componen o a ypical bac e ial wo-com-
ponen signal ansduc ion sys em ( o e iews, see e e ences
15 and 23). The amino- e minal domain o Cph1 shows 30 o
35% amino acid iden i y o he ch omopho e-bea ing domain
o highe plan phy och omes, and i is able o ca alyze i s own
ch omopho e a achmen in i o, whe eas he ca boxy e mi-
nus con ains he consensus sequences o his idine kinases. Im-
media ely downs eam o cph1 is ound an open eading ame
(called cp1) encoding a p o ein wi h s iking sequence simi-
la i y o he CheY amily o esponse egula o s. In ac , Yeh
e al. ha e shown ha , in i o, Cph1 is a ligh - egula ed his-
idine kinase ha media es ed/ a - ed e e sible phospho y-
la ion o he esponse egula o Rcp1 (37). These indings shed
ligh on he ini ial s ep o ligh signal ansduc ion by phy o-
ch ome. Howe e , he unc ion o Cph1 as a phy och ome in
i o has no ye been demons a ed.
He e we cha ac e ize he pa e n o exp ession o he cph1
cp1 ope on unde di e en condi ions. We demons a e ha
he amoun o cph1 cp1 ansc ip is ep essed by ligh , p ob-
ably h ough he concou se o di e en pho o ecep o s. Da k-
dependen up egula ion o cph1 cp1 ansc ip le els is abol-
ished by glucose. This pa e n o exp ession sugges s a ole o
cyanobac e ial phy och ome in ligh -da k ansi ions.
MATERIALS AND METHODS
Bac e ial s ains and g ow h condi ions. Synechocys is sp. s ain PCC 6803 was
g own pho oau o ophically a 30°C in BG11c medium (30) and bubbled wi h a
con inuous s eam o 1% ( ol/ ol) CO
2
in ai unde con inuous luo escen
illumina ion (50 E o whi e ligh m
⫺2
s
⫺1
) ( e e ed o in he ex as “no mal
illumina ion condi ions”). Fo mixo ophic g ow h, glucose was added o a inal
concen a ion o 10 mM. Da k condi ions we e ob ained by w apping cul u e
lasks wi h aluminum oil. Ligh in ensi y was measu ed wi h an LI-188B In e-
g a ing Quan um/Radiome e /Pho ome e (LI-COR, Inc). Fo ligh quali y ex-
pe imen s, Synechocys is cul u es we e i adia ed wi h 20 E o ligh o a speci ic
wa eleng h m
⫺2
s
⫺1
. Selec i e i adia ion was gene a ed wi h he ollowing
na ow-band il e s: blue,
max
⫽455 nm; g een,
max
⫽500 nm; ed,
max
⫽650
nm; a - ed,
max
⫽725 nm. 3-(3,4-Dichlo ophenyl)-1,1-dime hylu ea (DCMU)
and 2,5-dib omo-3-me hyl-6-isop opylbenzoquinone (DBMIB) we e used a a
inal concen a ion o 5 M when indica ed.
Esche ichia coli DH5␣(Be hesda Resea ch Labo a o ies) g own in Lu ia
b o h medium was used o plasmid cons uc ion and eplica ion. E. coli was
supplemen ed wi h 100 g o ampicillin pe ml o 50 g o kanamycin pe ml
when equi ed.
RNA isola ion and No he n blo hyb idiza ion. To al RNA was isola ed om
25-ml samples o Synechocys is sp. s ain PCC 6803 cul u es a he mid-exponen-
* Co esponding au ho . Mailing add ess: Ins i u o de Bioquı´mica
Vege al y Fo osı´n esis, Uni e sidad de Se illa-CSIC, Cen o de In es-
igaciones Cien ı´ icas Isla de la Ca uja, A . Ame´ ico Vespucio s/n, Isla
de la Ca uja, E-41092 Se illa, Spain. Phone: 34-5-4489518. Fax: 34-
5-4620154. E-mail: [email p o ec ed].
38
on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om
ial phase (3 o 5 g o chlo ophyll/ml). Ex ac ions we e pe o med by o exing
cells in he p esence o phenol-chlo o o m and acid-washed baked glass beads
(0.25 o 0.3 mm in diame e ; B aun, Melsungen, Ge many) as p e iously de-
sc ibed (12).
Fo No he n blo ing, 15 g o o al RNA was loaded pe lane and elec o-
pho esed in 1.2% aga ose dena u ing o maldehyde gels. T ans e o nylon
memb anes (Hybond N-plus; Ame sham), p ehyb idiza ion, hyb idiza ion, and
washes we e pe o med in acco dance wi h Ame sham ins uc ion manuals, wi h
hyb idiza ion aking place a 42°C in he p esence o 50% o mamide. The
1,150-bp DNA agmen ob ained by PCR ampli ica ion wi h oligonucleo ides
ph 1 (5⬘GATCCCATCCAGAGTCGCCTAACG 3⬘) ( om nucleo ide ⫹223 o
nucleo ide ⫹246, conside ing he i s nucleo ide o he cph1 gene ansla ion
s a codon as ⫹1) and ph 2 (5⬘AAGCATGATTTGGGTCACCGCCCC 3⬘)
( om nucleo ide ⫹1372 o nucleo ide ⫹1349) and he 467-bp DNA agmen
ob ained wi h oligonucleo ides ph 5 (5⬘GGTATTGAACCATGTCCGACG 3⬘)
( om nucleo ide ⫺11 o nucleo ide ⫹10, conside ing he i s nucleo ide o he
cp1 gene ansla ion s a codon as ⫹1) and ph 6 (5⬘GGAGGATGCCAATT
AAGCTGC 3⬘) ( om nucleo ide ⫹456 o nucleo ide ⫹436) we e used as he
cph1 and cp1 p obes, espec i ely. As a con ol, in all cases, he il e s we e
ep obed wi h a HindIII-BamHI 580-bp p obe om plasmid pAV1100 ha
con ains he cons i u i ely exp essed RNase P RNA gene om Synechocys is sp.
s ain PCC 6803 (36). To de e mine he cpm o adioac i e a eas in No he n
blo hyb idiza ions, an Ins an Image Elec onic Au o adiog aphy appa a us
(Packa d Ins umen Company, Me iden, Conn.) was used.
P ime ex ension analysis. Oligonucleo ide ph 3 (5⬘GGTCGCTGAGTTGT
ACGG 3⬘) ( om nucleo ide ⫹28 o nucleo ide ⫹11) end labeled wi h T4 polynu-
cleo ide kinase and [␥-
32
P]dATP (3,000 Ci/mmol) ollowing s anda d p ocedu es
(31) was used o p ime ex ension analysis. Fo annealing, a 10-l mix u e
con aining 0.15 M NaCl, 10 mM T is-HCl (pH 8.0), 1 mM EDTA, 20 g o o al
RNA, and abou 2 pmol o oligonucleo ide (10
6
cpm) was p epa ed. The an-
nealing mix u e was hea ed o 2 min a 90°C in a wa e ba h ha was subse-
quen ly kep a oom empe a u e o each 50°C. Fo ex ension, a 10-l mix u e
was p epa ed wi h one-hal o he annealing mix u e, 10 mM di hio h ei ol, 0.5
mM each deoxynucleoside iphospha e (dNTP), 2 g o ac inomycin D, 50 mM
T is-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl
2
, and 100 U o Supe sc ip II RNase
H- e e se ansc ip ase (Gibco BRL, Gai he sbu g, Md.). The mix u e was in-
cuba ed o 45 min a 45°C, and he eac ion was s opped by adding 4 lo
o mamide-loading bu e . One-hal o he eac ion mix u e was elec opho esed
on a 6% polyac ylamide sequencing gel oge he wi h a sequencing eac ion
mix u e o he cph1 gene 5⬘ egion by using he ph 3 oligonucleo ide.
T ansc ip ional gene usion. A ansc ip ional gene usion was cons uc ed in
he plasmid pFF11, a p omo e -p obe ec o based on he chlo amphenicol
ace yl ans e ase (CAT) epo e gene (ca ) (11). A 413-bp DNA agmen om
nucleo ide ⫺245 o ⫹168 bp wi h espec o he cph1 ansc ip ion s a poin was
subcloned in o pFF11, yielding he plasmid pFF11-cph. This epo e plasmid
was used o ans o m he SFC⍀5 a ian o Synechocys is sp. s ain PCC 6803
(4).
CAT ac i i y was assayed in i o a 37°C by he colo ime ic p ocedu e (33).
One uni o CAT ep esen s 1 mol o chlo amphenicol ace yla ed pe min pe
mg o p o ein. C ude ex ac s om Synechocys is s ains we e p epa ed wi h glass
beads as desc ibed in e e ence 28, excep ha he bu e was subs i u ed o by
50 mM T is-HCl (pH 8.0).
The s ains SFF16 (11), which con ains a p omo e less ca gene, and SFC57
(5), which con ains he ca gene unde he con ol o i s own p omo e , we e used
as con ols.
The amoun o p o ein in cell ex ac s was de e mined by he me hod o
B ad o d (2) wi h o albumin as a s anda d.
Cons uc ion o Synechocys is sp. s ain PCC 6803 cph1 mu an s. The Syn-
echocys is sp. mu an s ain SPHY1 was c ea ed by in e up ing he cph1 gene
wi h a neomycin phospho ans e ase (np )-con aining casse e (C.K1) (8), which
con e s kanamycin esis ance (Km
). The C.K1 casse e was isola ed as a 1.3-kb
HincII DNA agmen and inse ed in o he unique HpaI si e o cph1 in bo h
o ien a ions. T ans o ma ion o Synechocys is sp. s ain PCC 6803 cells was
ca ied ou as p e iously desc ibed (4).
A His538- o-A g si e-di ec ed mu an o Cph1 was c ea ed by a wo-s ep
s a egy. Fi s , a egion o he Synechocys is sp. s ain PCC 6803 cph1 cp1 ope on
was dele ed and eplaced by a kanamycin esis ance casse e, o gene a e s ain
SPHY5 (see Fig. 6B). The si e-di ec ed mu an s ain (SPHY6) was hen gen-
e a ed by eplacing he kanamycin esis ance casse e wi h a cons uc con aining
he p e iously dele ed egion wi h he si e-di ec ed mu a ion. A chlo amphenicol
esis ance (Cm
) gene was also in oduced downs eam o he cp1 coding egion
in o de o be used as selec able ma ke (see Fig. 6B).
The SPHY5 s ain was c ea ed by eplacing a 1,580-bp Bs EII-BsmI DNA
agmen wi h a C.K1 casse e (Km
). The si e-di ec ed mu a ion plasmid pHR3
was gene a ed by changing he His538 CAT codon o an A g CGG codon by
s anda d PCR echniques. The poin mu a ion c ea ed a SmaI si e, which was
used o es he mu an s. The C.C1 casse e (Cm
) (8) was hen inse ed a he
BsmI si e loca ed 228 bp downs eam o he cp1 STOP codon, in he same
o ien a ion as he ope on. Plasmid pHR3 was used o ans o m Synechocys is sp.
s ain PCC 6803 SPHY5 cells. Cm
Km
s
cells we e selec ed. Recombinan s ha
ha e inco po a ed he C.C1 casse e in s ain SPHY5 also in oduce he
His538A g mu a ion, in ol ing he loss o he C.K1 casse e. Whole seg ega ion
o he mu an s was checked by Sou he n blo ing.
RESULTS
Exp ession o cph1 cp1 mRNA is up egula ed by da kness.
In highe plan s, he phy och omes a e encoded by a gene
amily o up o i e membe s (named PHYA–E) (6, 32). In mos
plan s, PHYA mRNA is syn hesized in e iola ed issue and
down- egula ed apidly in he ligh , whe eas PHYB–E mRNAs
a e no a ec ed by ligh ( o example, see e e ence 6). To
de e mine i ligh -da k ansi ions also a ec he cyanobac e-
ial phy och ome ansc ip le els, No he n blo hyb idiza-
ions o o al RNA om exponen ially g owing Synechocys is
sp. s ain PCC 6803 cul u es unde illumina ion condi ions o
a e 0.25, 1, 2, 4, o 8ho da kness we e ca ied ou . Only one
band o abou 3 kb was obse ed when il e s we e hyb idized
wi h p obes o cph1 o cp1 genes, demons a ing ha bo h
genes a e co ansc ibed, o ming an ope on. As shown in Fig.
1A, cph1 cp1 mRNA le els we e up egula ed (abou a i e old
inc ease) a e ans e o he cul u es o he da k. Maximal
le els o exp ession we e ob ained a e 15 min o da kness.
The ea e , he quan i y o he ansc ip dec eased slowly,
eaching, a e 8 h, le els simila o hose p esen unde con-
inuous illumina ion. When cul u es ha ha e been main-
FIG. 1. Da k-dependen up egula ion o cph1 cp1 mRNA le els. (A) To al
RNA was isola ed om mid-log-phase Synechocys is sp. s ain 6803 cells g owing
unde no mal illumina ion condi ions (whi e ligh , 50 Em
⫺2
s
⫺1
) (L) o a e
ans e o he cul u e o he da k o 0.25, 1, 2, 4, o 8 h. (B) Synechocys is sp.
s ain 6803 cells g owing unde illumina ion (lane 1) we e ans e ed o he da k
o 1 h (lane 2), and hen he cul u e was di ided in o wo ac ions; one o hem
was subjec ed o an addi ional 30-min pe iod o da kness (lane 3), while he
o he one was eillumina ed o 5 min (lane 4) o 30 min (lane 5). Fi een
mic og ams o o al RNA was subjec ed o No he n blo analysis wi h in e nal
cph1 o cp1 p obes (see Ma e ials and Me hods). The il e s we e s ipped and
ehyb idized wi h an npB gene p obe. T ansc ip size was es ima ed by compa -
ison wi h 23S, 16S, and 5S RNAs.
VOL. 182, 2000 REGULATION OF cph1 cp1 OPERON EXPRESSION 39
on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om
ained in he da k o 1 h we e eillumina ed, cph1 cp1 mRNA
le els dec eased d ama ically, becoming almos unde ec able
(Fig. 1B, lane 4). Howe e , 30 min a e eillumina ion, cph1
cp1 mRNA s eady-s a e ligh le els we e es o ed (Fig. 1B,
lanes 1 and 5). The same pa e n was obse ed when an cp1
gene p obe was used (Fig. 1B).
Redox- and glucose-dependen con ol o cph1 cp1 mRNA
exp ession. Ac i i y o he pho osyn he ic appa a us is likely o
exe a eedback egula o y ole on he exp ession o pho o-
syn he ic genes. In ac , he exp ession o many cyanobac e ial
genes has been shown o be a ec ed by edox signals (12, 22,
28). Figu e 2A shows ha inhibi ion o pho osyn he ic low by
DCMU (which blocks ans e o elec ons be ween he PSII
complex and he plas oquinone pool [35]) o DBMIB (which
p e en s he oxida ion o plas oquinone by he cy och ome b
6
complex [29]) did no up egula e cph1 cp1 mRNA le els.
These da a sugges ha i is he absence o ligh pe se, and no
he absence o pho osyn he ic low, ha media es he da k-
dependen inc ease in cph1 cp1 mRNA le els. This was dem-
ons a ed by ans e ing DCMU- o DBMIB- ea ed cells o
he da k. Unde hese condi ions, cph1 cp1 mRNA le els
inc eased in a way simila o ha in non ea ed cells (Fig. 2B).
Synechocys is sp. s ain PCC 6803 is a he e o ophic acul a-
i e cyanobac e ium ha can u ilize glucose as a sou ce o
ene gy, edox powe , and ca bon (30). In e es ingly, when Syn-
echocys is sp. s ain PCC 6803 cells g own in he ligh and in he
p esence o glucose (mixo ophic g ow h) we e ans e ed o
he da k, he le el o cph1 cp1 mRNA emained cons an (Fig.
2C). This sugges s ha no only he absence o he p esence o
ligh bu also o he me abolic signals a e in ol ed in he con-
ol o he exp ession o he cph1 cp1 ope on.
De e mina ion o he cph1 cp1 p omo e egion. As a i s
s ep in he cha ac e iza ion o he cyanobac e ial phy och ome
p omo e , we ha e de e mined he ansc ip ion s a poin o
he cph1 cp1 ope on. Re e se p ime ex ension o o al RNA
om ligh -g own cul u es o om cul u es subjec ed o1ho
da kness was ca ied ou . The ansc ip ion s a poin was
localized a ⫺150 bp wi h espec o he i s ansla ed nucle-
o ide (Fig. 3A, lanes 3 and 4). ⫺10 (TAGGAT) and ⫺35
(TTGGAA) sequences wi h ou o six si es ma ching he ⫺10
(TATAAT) and ⫺35 (TTGACA) boxes o he Esche ichia coli
70
-like consensus p omo e s (14) we e ound ups eam o he
cph1 cp1 i s ansc ibed nucleo ide (Fig. 3B). cDNA was
mo e abundan when p ime ex ension was ca ied ou wi h
RNA isola ed om da k- ea ed wild- ype Synechocys is sp.
FIG. 2. E ec s o pho osyn he ic inhibi o s and glucose on cph1 cp1 mRNA
le els. (A) Ligh -g owing Synechocys is sp. s ain 6803 cells we e incuba ed ei he
in he absence (L) o in he p esence o 5 M DCMU o DBMIB. RNA was
isola ed a e 1 h and p ocessed and hyb idized as o Fig. 1. (B) Synechocys is sp.
s ain 6803 cells g own unde illumina ion condi ions (lane 1) we e ea ed wi h
DCMU (lane 2) o DBMIB (lane 5) and ans e ed o he da k o 1ho
main ained in he ligh o 1 h (lanes 3 and 6, espec i ely) and hen subjec ed o
da kness o 1 h (lanes 4 and 7, espec i ely). No he n blo hyb idiza ions we e
pe o med wi h RNA om cells g own unde he di e en condi ions. (C) To al
RNA was isola ed om mid-log-phase Synechocys is sp. s ain 6803 cells g owing
unde illumina ion condi ions (L) o a e 1 o 4ho da kness in he p esence o
absence o 10 mM glucose. RNA was subjec ed o No he n blo analysis wi h an
in e nal cph1 p obe.
FIG. 3. P ime ex ension analysis o he cph1 cp1 ansc ip . (A) To al RNA
(20 g) om illumina ed (whi e segmen ) o 1-h-da k-incuba ed (black segmen )
Synechocys is sp. s ain 6803 wild- ype (WT) and SPHY1 mu an cells was an-
nealed o he ph 3 oligonucleo ide and ex ended wi h e e se ansc ip ase as
desc ibed p e iously (15). A sequencing ladde used wi h he same p ime is also
shown. An a ow indica es ex ension p oduc s. The ansc ip ion s a nucleo ide
is ma ked wi h an as e isk on he sequence. These esul s we e con i med o
h ee imes wi h RNAs om h ee independen se s o cul u es. (B) Sequence o
he p omo e egion o he cph1 cp1 ope on. The ansc ip ion s a poin is
indica ed by a ben a ow. ⫺10 and ⫺35 sequences based on he ansc ip ional
s a si e a e boxed. The ansla ion s a codon is in lowe case. The pu a i e
Shine-Dalga no sequence is unde lined. The nucleo ides a e numbe ed wi h
espec o he i s nucleo ide o he ansla ion s a codon. Di ec epea
sequences a e no ed by a ows.
40 GARCI
´A-DOMI
´NGUEZ ET AL. J. BACTERIOL.
on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om
s ain PCC 6803 cells han wi h RNA isola ed om con inu-
ously illumina ed cells (Fig. 3A). A di ec nucleo ide epe i ion
in he o m CGTTGN
5
CGTTG cen e ed a posi ion ⫺45 was
ound (Fig. 3B). To de e mine whe he he cph1 cp1 5⬘-up-
s eam egion con ains all o he cis- egula o y elemen s e-
sponsible o he obse ed ligh -da k egula ion, we subcloned
he ⫺245 o ⫹168 egion o he cph1 gene in o pFF11, a
p omo e -p obe plasmid based on he ca epo e gene and
cons uc ed o es ing p omo e s in Synechocys is sp. s ain
PCC 6803 (11). In i o cph1 cp1 p omo e ac i i y was mon-
i o ed by de e mining CAT ac i i y o he cyanobac e ial e-
po e s ain unde no mal illumina ion condi ions o a e 3 h
o da kness. The ⫺245 o ⫹168 egion o he cph1 gene dis-
played a signi ican p omo e ac i i y, and s ong da k induc-
ion o he epo e gene ac i i y was no obse ed. Howe e ,
a 1.5- o 1.8- old inc ease in CAT ac i i y was consis en ly
obse ed a e 3ho da kness (4.66 ⫾1 mU/mg unde no mal
illumina ion condi ions, e sus 8.3 ⫾1.1 mU/mg in da kness).
CAT ac i i y le els o con ol s ains ha bo ing a p omo e less
ca gene o a ca gene d i en by i s own p omo e we e no
a ec ed by ligh -da k changes (da a no shown).
Ligh -dec eased s abili y o cph1 cp1 mRNA. In o de o
in es iga e whe he ligh a ec s cph1 cp1 mRNA s abili y, we
ha e de e mined he hal -li e o he cph1 cp1 ansc ip unde
da k condi ions o upon eillumina ion. Fo ha pu pose, i-
ampin (400 g/ml) was added o 15-min-da k- ea ed cells,
and cul u es we e kep in he da k. Aliquo s we e aken a 0, 1,
2, 3, 5, and 8 min a e he addi ion o i ampin, and o al RNA
was isola ed and subjec ed o No he n blo ing. The da a
showed ha , unde hese condi ions, he hal -li e o cph1 cp1
mRNA was close o 2 min (Fig. 4). Howe e , when da k-
ea ed cells we e exposed o ligh in he absence o i ampin,
a apid dec ease in ansc ip le el was seen, wi h a hal -li e o
abou 30 s.
E ec o spec al quali y on exp ession o he cph1 cp1
ope on. The esul s p esen ed abo e sugges ha edox signals
om he pho osyn he ic appa a us a e no in ol ed in he
up egula ion o he exp ession o cph1 cp1 ope on, and he e-
o e a pho o ecep o migh be in ol ed in such egula ion. As
a i s app oach o iden i y his pu a i e pho o ecep o , he
e ec o spec al quali y on exp ession o he cph1 cp1 ope on
was analyzed. Fo ha analysis, Synechocys is sp. s ain PCC
6803 cells g own unde no mal illumina ion condi ions we e
ans e ed o da kness o 15 min and hen exposed o a 3-min
pulse (20 Em
⫺2
s
⫺1
) o blue (
max
⫽455 nm), g een (
max
⫽
500 nm), ed (
max
⫽650 nm), o a - ed (
max
⫽725 nm)
ligh . As p e iously shown, da k- ea ed cells displayed high
cph1 cp1 mRNA le els. Exposu e o he cells o 20 E o blue,
g een, ed, o a - ed il e ed ligh m
⫺2
s
⫺1
esul ed in a d as ic
dec ease in he cph1 cp1 ansc ip le el (Fig. 5A). In a second
se o expe imen s, exponen ially g owing Synechocys is sp.
s ain PCC 6803 cul u es we e ans e ed o da kness o 15
min, ollowed by one pulse o 3 min o ed (
max
⫽650 nm)
ligh (20 Em
⫺2
s
⫺1
). The cells we e hen ha es ed o incu-
ba ed o ano he 10 min in he p esence o a - ed (
max
⫽
725 nm) ligh (20 Em
⫺2
s
⫺1
). As shown abo e, 3 min o ed
ligh was enough o elici a d as ic educ ion in he quan i y o
cph1 cp1 mRNA. This e ec was no e e sed by a - ed ligh
(Fig. 5B), sugges ing ha cph1 cp1 mRNA le els do no e-
spond in a ypical phy och ome-media ed way.
Cph1 kinase ac i i y is no in ol ed in con ol o cph1 cp1
mRNA le els. In monoco s, i has been ex ensi ely shown ha
ansc ip ion o he phyA gene is phy och ome dependen (3,
19). In o de o in es iga e whe he Cph1 is esponsible o he
ligh -da k-dependen egula ion o he cph1 cp1 ope on ex-
p ession, we cons uc ed a cph1 mu an s ain o Synechocys is
sp. s ain PCC 6803 (SPHY1) by in e up ing he cph1 gene
wi h a neomycin phospho ans e ase (np )-con aining casse e
(C.K1). The casse e was inse ed in o he HpaI si e localized
712 bp downs eam o he cph1 ATG codon (Fig. 6A). Com-
ple e seg ega ion o he mu a ion was con i med by Sou he n
blo analysis (da a no shown). Mu an cells we e iable unde
no mal illumina ion condi ions, and g ow h a es we e simila
o hose o he wild- ype s ain. The s udy o he exp ession o
cph1 cp1 ope on in SPHY1 mu an cells was ca ied ou by
e e se p ime ex ension o o al RNA by using he oligonu-
cleo ide ph 3, which is complemen a y o a egion o he cph1
gene ups eam o he casse e in eg a ion si e. In he SPHY1
mu an cells, he cph1 ansc ip ion s a poin was localized in
he same posi ion as in he wild- ype cells (Fig. 3A, lanes 1 and
2). Analysis o RNA om ligh - o da k- ea ed cells indica ed
ha he cph1 ansc ip was no induced by da kness in he
Cph1-de icien cells (Fig. 3A, lanes 1 and 2). Simila esul s
we e obse ed by No he n blo ing wi h a DNA agmen
ups eam o he C.K1 inse ion poin as a p obe (da a no
shown). These da a migh sugges ha Cph1 is he pho o e-
cep o esponsible o he ligh -da k-dependen egula ion o
FIG. 4. Ligh -dec eased s abili y o cph1 cp1 mRNA. (A) Ri ampin (400
g/ml) was added o 15-min-da k- ea ed cells, and cul u es we e kep in he
da k. Aliquo s we e aken a he indica ed imes, and o al RNA was isola ed.
Al e na i ely, 15-min-da k- ea ed cul u es we e eillumina ed (ligh ), and ali-
quo s we e aken a he indica ed imes o o al RNA isola ion. Fi een mic o-
g ams o o al RNA was subjec ed o No he n blo analysis wi h in e nal cph1
p obes. (B) Band in ensi y was de e mined wi h an Ins an Image , no malized
wi h espec o he npB RNA le el, and plo ed agains ime. Values a e he
a e ages o wo independen expe imen s. Symbols: ■, eillumina ed cells; F,
i ampin- ea ed cells.
VOL. 182, 2000 REGULATION OF cph1 cp1 OPERON EXPRESSION 41
on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om
cph1 cp1 mRNA le els. We ha e shown abo e ha cph1 cp1
ansc ip le els a e egula ed, a leas in pa , by con olling
cph1 cp1 mRNA s abili y. Since inse ion o he C.K1 casse e
in o he cph1 cp1 ope on s ongly modi ies he s uc u e o he
cph1 cp1 ansc ip , his mu a ion migh d ama ically change
he s abili y o he ansc ip . The e o e, we ha e cons uc ed,
by si e-di ec ed mu agenesis, a Synechocys is s ain wi h a mo e
sub le inac i a ion o Cph1 ha does no a ec cph1 cp1
mRNA s uc u e. I has been shown p e iously ha he His538
esidue o Cph1 is essen ial o au ophospho yla ion and phos-
pho ans e o Rcp1 and, he e o e, o ansduc ion o he
ligh signal (37). We ha e cons uc ed an H538R mu an s ain
o Cph1 (Synechocys is sp. s ain SPHY6) by eplacing he
endogenous wild- ype locus by he mu a ed a ian as de-
sc ibed in Ma e ials and Me hods (Fig. 6B). Comple e seg e-
ga ion o he mu a ion was con i med by Sou he n blo analysis
(da a no shown). Mu an cells we e iable unde no mal illu-
mina ion condi ions, and g ow h a es we e simila o hose o
he wild- ype s ain. SPHY6 mu an cells displayed a wild- ype
pheno ype wi h espec o he ligh -da k-dependen egula ion
o he cph1 cp1 mRNA le els (Fig. 6C).
DISCUSSION
The sequencing o he comple e genome o he cyanobac e-
ium Synechocys is sp. s ain PCC 6803 has unco e ed he
p esence o a wo-componen egula o y sys em (Cph1-Rcp1)
whose senso componen shows e y signi ican amino acid
iden i y o he plan phy och ome (20). Ou da a demons a e
ha cph1 and cp1 a e co ansc ibed and ha cph1 cp1 an-
sc ip exp ession is con olled by ligh .
Yeh e al. ha e demons a ed ha only Cph1-P exhibi s
kinase ac i i y, sugges ing ha Cph1-P is he ac i e o m ha
ansduces he ligh signal by phospha e ans e o Rcp1 (37).
Since P is supposed o be he ac i e o m in plan s (27), his
is an impo an di e ence be ween he cyanobac e ial sys em
and he plan signal ansduc ion sys em. Ou esul s indica e
ha Cph1 and Rcp1 a e exp essed mos ly unde da k condi-
ions. Since Cph1 is de no o syn hesized in he o m P and in
he absence o ligh is no pho ocon e ed o Cph1-P (37),
ou cu en hypo hesis is ha , in he da k, Rcp1 would be
phospho yla ed. In con as , in he ligh , he low le el o
Cph1-P syn hesized is immedia ely con e ed in o P , and
Rcp1 would be mos ly unphospho yla ed.
Absence o ligh seems o be he signal ha igge s he
accumula ion o cph1 cp1 ansc ip . Two ob ious possible
pa hways o sensing he absence o ligh can be imagined:
di ec ly by a pho o ecep o o indi ec ly h ough pho osyn-
he ic elec on anspo and he edox s a e o in e media e
ca ie s. Ou expe imen s wi h he pho osyn he ic inhibi o s
DCMU and DBMIB indica e ha comple e cessa ion o pho-
osyn he ic elec on anspo does no elici he accumula ion
o cph1 cp1 ansc ip . Fu he mo e, he p esence o hese
inhibi o s does no impai he da k e ec . These da a sugges
ha he edox s a e o pho osyn he ic elec on ca ie s is no
in ol ed in he egula ion o cph1 cp1 exp ession and he e-
o e suppo a di ec pho o ecep o -dependen -media ed
mechanism. In o de o in es iga e wha kind o pho o ecep o
may be in ol ed in he con ol o cph1 cp1 exp ession, eillu-
mina ion expe imen s we e ca ied ou wi h ligh o ou di -
e en spec al quali ies. Ligh ha was ed, a - ed, blue, o
g een was able o down egula e he le els o cph1 cp1 an-
sc ip , sugges ing ha mo e han one pho o ecep o pa hway
could be in ol ed in down egula ion o cph1 cp1 ansc ip
le els. One ob ious possibili y is ha Cph1 is able o au o egu-
la e i s own mRNA le els. In monoco s, i has been shown
ex ensi ely ha ansc ip ion o he phyA gene is phy och ome
dependen (3, 19). Howe e , he esul s shown in Fig. 5 sugges
ha he pa e n o cph1 cp1 accumula ion unde ed and
a - ed ligh does no ollow a ypical phy och ome-dependen
esponse. Two Synechocys is cph1 mu an s ains we e gene -
a ed in o de o u he in es iga e his possibili y: a
cph1::C.K1 inse ion mu an (SPHY1) and an H538R poin
mu a ion (SPHY6) ha p oduces a Cph1 p o ein unable o
phospho yla e Rcp1 and, he e o e, unable o ansduce he
ligh signal (37). SPHY1 cells showed uninducible le els o he
5⬘ egion o he cph1 cp1 ansc ip (Fig. 3A). In con as , in
SPHY6 cells, a no mal da k-dependen induc ion o he cph1
cp1 ansc ip was obse ed. While he esul s ob ained wi h
he SPHY1 mu an a e consis en wi h an au o egula o y
mechanism, he esul s ob ained wi h he SPHY6 mu an ex-
clude his hypo hesis. We p opose he ollowing in e p e a ion
o ou esul s. The cph1::C.K1 mu a ion (SPHY1) esul s in
g oss al e a ions o he cph1 mRNA. The sho hal -li e o he
cph1 cp1 ansc ip upon eillumina ion sugges s he exis ence
o a speci ic deg ada ion mechanism con olling cph1 cp1
ansc ip le els in he ligh (Fig. 1B and Fig. 4). The molecula
mechanism by which ligh con ols cph1 cp1 ansc ip s abili y
emains o be elucida ed. Thus, i is possible ha he in e up-
ion o he cph1 mRNA by he C.K1 casse e a ec s elemen s
wi hin he cph1 mRNA coding egion ha con e s abili y o
he message in da kness. Ligh -dependen con ol o mRNA
s abili y de e mined by coding egion elemen s has been e-
po ed ecen ly o he psbAI and psbAII genes in he cya-
nobac e ium Synechococcus sp. s ain PCC 7942 (17). In he
SPHY6 s ain, we ha e in oduced a poin mu a ion ha abol-
ishes he kinase ac i i y o Cph1 wi hou a ec ing he s uc u e
o he cph1 cp1 ansc ip . Since his s ain shows a no mal
egula ion o cph1 cp1 ansc ip le els, we conclude ha he
FIG. 5. E ec o spec al quali y on exp ession o cph1 cp1 ope on. (A)
No he n blo hyb idiza ion o o al RNA om Synechocys is sp. s ain 6803
cul u es g own unde no mal illumina ion condi ions (lane 1 [L]), ans e ed o
da kness o 15 min (lane 2 [D]), and hen di ided in o ou aliquo s ha we e
illumina ed wi h a 3-min pulse o ed (lane 3 [R]), blue (lane 4 [B]), g een (lane
5 [G]), o a - ed (lane 6 [FR]) ligh . (B) No he n blo hyb idiza ion o o al
RNA om Synechocys is sp. s ain 6803 cul u es g own unde no mal illumina-
ion condi ions (lane 1), ans e ed o da kness o 15 min (lane 2), and hen
gi en a ed ligh pulse o 3 min (lane 3), ollowed by a a - ed ligh pulse o 10
min (lane 4).
42 GARCI
´A-DOMI
´NGUEZ ET AL. J. BACTERIOL.
on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om
Cph1 signal ansduc ion pa hway is no in ol ed in he ligh -
da k-media ed egula ion o he cph1 cp1 ansc ip le els.
In addi ion o he con ol o cph1 cp1 ansc ip s abili y, we
ha e in es iga ed he possibili y ha cph1 cp1 ope on an-
sc ip ion is up egula ed by absence o ligh . T ansc ip ional
usion expe imen s wi h a ca epo e gene d i en by he
p omo e and leade egions o cph1 showed only a mino
(1.8- old in he bes case) da k-dependen induc ion, in con-
as o he 5- old inc ease in he amoun o cph1 cp1 mRNA
p omo ed by da kness. Fu he mo e, a ansc ip ional usion
o he ⫺245 o ⫹168 cph1 egion wi h he g een luo escen
p o ein gene was also used as a epo e mRNA. The amoun
o his chime ic mRNA was only sligh ly inc eased by da kness
(1.3- o 1.7- old, depending on he expe imen ) (da a no
shown). The e o e, ou expe imen s sugges ha da k-depen-
den ansc ip ional induc ion ep esen s a mino con ibu ion
o he egula ion o he cph1 cp1 ope on exp ession.
Ou esul s demons a e ha cph1 cp1 mRNA le els a e
also a ec ed by o he ac o s in addi ion o ligh . In ac ,
accumula ion o cph1 cp1 mRNA in da k-incuba ed Synecho-
cys is sp. s ain PCC 6803 cells is comple ely inhibi ed by he
p esence o exogenous glucose. E idence o a speci ic in e -
ac ion be ween plan phy och ome signaling and ca bohyd a e
me abolism has also been epo ed in plan s. Fo example,
suc ose can inhibi PhyA-dependen a - ed ligh -media ed in-
hibi ion o g eening (1, 7). A numbe o anabolic Synechocys is
sp. s ain PCC 6803 genes ha e been shown o be swi ched o
in he da k; howe e , glucose is able o abolish his da k-
media ed inhibi ion o exp ession (12, 21, 22, 28). Since glu-
cose is a sou ce o ene gy, edox powe , and ca bon o Syn-
echocys is sp. s ain PCC 6803, i seems easonable o imagine
ha he p esence o absence o glucose could change he way
ha Synechocys is sp. s ain PCC 6803 adap s o da k condi-
ions.
The ac ha cph1 cp1 mRNA le els a e up egula ed in
da kness sugges s ha Synechocys is sp. s ain PCC 6803 phy-
och ome migh be in ol ed in he egula ion o unc ions
equi ed o he adap a ion om ligh o da k condi ions and
FIG. 6. Inac i a ion o cph1 in Synechocys is sp. s ain 6803. (A) S uc u e o he cph1 cp1 ope on genomic egion in he SPHY1 mu an s ain. (B) S uc u e o
he cph1 cp1 ope on genomic egion in he wild- ype (WT), SPHY5, and SPHY6 mu an s ains. Res ic ion si es used o he cons uc ion o he mu an s a e ma ked.
The posi ion o he CAT codon co esponding o he His538 esidue is also ma ked. Nucleo ides a e numbe ed wi h espec o he ansla ion s a si e. (C) To al RNA
was isola ed om mid-log-phase Synechocys is wild- ype and SPHY6 mu an cells g owing unde no mal illumina ion condi ions (L) o subjec ed o 15 min (L15) o
30 min (L30) in he da k o 30 min a e eillumina ion (L30). RNA was subjec ed o No he n blo analysis by using an in e nal cph1 p obe (see Ma e ials and
Me hods).
VOL. 182, 2000 REGULATION OF cph1 cp1 OPERON EXPRESSION 43
on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om
ice e sa. The exp ession o many cyanobac e ial genes has
been shown o be dependen on he ci cadian hy hms ( o a
e iew, see e e ence 13). A ole o he Cph1-Rcp1 sys em in
se ing he ci cadian clock migh also be specula ed. Finally,
cyanobac e ial phy och ome migh be equi ed only unde spe-
ci ic s ess condi ions. In his ega d, p elimina y expe imen s
indica e ha cph1 cp1 mRNA le els inc ease unde condi ions
o ni ogen de iciency (da a no shown). Cha ac e iza ion o
cph1 and cp1 mu an s will be equi ed in o de o iden i y he
biological unc ions con olled by he cyanobac e ial phy o-
ch ome.
ACKNOWLEDGMENTS
We hank F. Chau a o p o iding pFF11 plasmid and s ains
SFF16 and SFC57. We a e g a e ul o J. Wei zman o c i ical eading
o he manusc ip .
This wo k was suppo ed by g an s om DGESID (PB97-0732)
(Spain) and by Jun a de Andalucı´a (CVI-0112). M.G.-D. was he
ecipien o a p edoc o al ellowship om M.E.C. (Spain).
REFERENCES
1. Ba nes, S. A., N. K. Nishizawa, R. B. Quaggio, G. C. Whi elam, and N. H.
Chua. 1996. Fa - ed ligh blocks g eening o A abidopsis seedlings ia a
phy och ome A-media ed change in plas id de elopmen . Plan Cell 8:601–
615.
2. B ad o d, M. M. 1976. A apid and sensi i e me hod o he quan i a ion o
mic og am quan i ies o p o ein u ilizing he p inciple o p o ein-dye bind-
ing. Anal. Biochem. 72:248–254.
3. B uce, W. B., and P. H. Quail. 1990. Cis-ac ing elemen s in ol ed in pho o-
egula ion o an oa phy och ome p omo e in ice. Plan Cell 2:1081–1089.
4. Chau a , F., L. De V ies, A. Van de Ende, and G. A. Van A kel. 1988. A hos
ec o sys em o gene cloning in he cyanobac e ium Synechocys is PCC
6803. Mol. Gen. Gene . 204:165–191.
5. Chau a , F., J. Laba e, and F. Fe ino. 1988. De elopmen o gene ans e
sys em o he cyanobac e ium Synechocys is PCC 6803. Plan Physiol. Bio-
chem. 26:629–637.
6. Clack, T., S. Ma hews, and R. A. Sha ock. 1994. The phy och ome apop o-
ein amily in A abidopsis is encoded by i e genes: he sequences and ex-
p ession o PHYD and PHYE. Plan Mol. Biol. 25:413–427.
7. Dijkwel, P. P., C. Huijse , P. J. Weisbeek, N. H. Chua, and S. C. Smeekens.
1997. Suc ose con ol o phy och ome A signaling in A abidopsis. Plan Cell
9:583–595.
8. Elhai, J., and C. P. Wolk. 1988. A e sa ile class o posi i e-selec ion ec o s
based on he non iabili y o palind ome-con aining plasmids ha allows
cloning in o long polylinke s. Gene 68:119–138.
9. Elich, T. D., and J. Cho y. 1997. Phy och ome: i i looks and smells like a
his idine kinase, is i a his idine kinase? Cell 91:713–716.
10. Fankhause , C., and J. Cho y. 1997. Ligh con ol o plan de elopmen .
Annu. Re . Cell De . Biol. 13:203–229.
11. Fe ino, F., and F. Chau a . 1989. A p omo e -p obe ec o -hos sys em o
he cyanobac e ium, Synechocys is PCC6803. Gene 84:257–266.
12. Ga cı´a-Domı´nguez, M., and F. J. Flo encio. 1997. Ni ogen a ailabili y and
elec on anspo con ol he exp ession o glnB gene (encoding PII p o ein)
in he cyanobac e ium Synechocys is sp. PCC 6803. Plan . Mol. Biol. 35:723–
734.
13. Golden, S. S., M. Ishiu a, C. H. Johnson, and T. Kondo. 1997. Cyanobac-
e ial ci cadian hy hms. Annu. Re . Plan Physiol. Plan Mol. Biol. 48:327–
354.
14. Hawley, D. K., and W. R. McClu e. 1983. Compila ion and analysis o
Esche ichia coli p omo e DNA sequences. Nucleic Acids Res. 11:2237–
2255.
15. Hoch, J. A., and T. J. Silha y (ed.). 1995. Two-componen signal ansduc-
ion. Ame ican Socie y o Mic obiology P ess, Washing on, D.C.
16. Hughes, J., T. Lampa e , F. Mi mann, E. Ha mann, W. Ga ne , A. Wilde,
and T. Bo ne . 1997. A p oka yo ic phy och ome. Na u e 386:663.
17. Kulka ni, R. D., and S. S. Golden. 1997. mRNA s abili y is egula ed by a
coding- egion elemen and he unique 5⬘un ansla ed leade sequences o
he h ee Synechococcus psbA ansc ip s. Mol. Mic obiol. 24:1131–1142.
18. Lampa e , T., F. Mi mann, W. Ga ne , T. Bo ne , E. Ha mann, and J.
Hughes. 1997. Cha ac e iza ion o ecombinan phy och ome om he cya-
nobac e ium Synechocys is. P oc. Na l. Acad. Sci. USA 94:11792–11797.
19. Lissemo e, J. L., and P. H. Quail. 1988. Rapid ansc ip ional egula ion by
phy och ome o he genes o phy och ome and chlo ophyll a/b-binding
p o ein in A ena sa i a. Mol. Cell. Biol. 8:4840–4850.
20. Mizuno, T., T. Kaneko, and S. Taba a. 1996. Compila ion o all genes
encoding bac e ial wo-componen signal ansduce s in he genome o he
cyanobac e ium, Synechocys is sp. s ain PCC 6803. DNA Res. 3:407–414.
21. Mohamed, A., and C. Jansson. 1989. In luence o ligh on accumula ion o
pho osyn hesis-speci ic ansc ip s in he cyanobac e ium Synechocys is 6803.
Plan . Mol. Biol. 13:693–700.
22. Mohamed, A., and C. Jansson. 1991. Pho osyn he ic elec on anspo con-
ols deg ada ion bu no p oduc ion o psbA ansc ip s in he cyanobac e-
ium Synechocys is 6803. Plan . Mol. Biol. 16:891–897.
23. Pa kinson, J. S., and E. C. Ko oid. 1992. Communica ion modules in bac-
e ial signaling p o eins. Annu. Re . Gene . 26:71–112.
24. Peppe , A. E. 1998. Molecula e olu ion: old b anches on he phy och ome
amily ee. Cu . Biol. 8:R117–R120.
25. Quail, P. H. 1994. Pho osenso y pe cep ion and signal ansduc ion in plan s.
Cu . Opin. Gene . De . 4:652–661.
26. Quail, P. H. 1997. The phy och omes: a biochemical mechanism o signaling
in sigh ? Bioessays 19:571–579.
27. Quail, P. H., M. T. Boylan, B. M. Pa ks, T. W. Sho , Y. Xu, and D. Wagne .
1995. Phy och omes: pho osenso y pe cep ion and signal ansduc ion. Sci-
ence 268:675–680.
28. Reyes, J. C., and F. J. Flo encio. 1995. Elec on anspo con ols ansc ip-
ion o he glu amine syn he ase gene (glnA) om he cyanobac e ium Syn-
echocys is sp. PCC 6803. Plan Mol. Biol. 27:789–799.
29. Rich, P. R., A. E. Jeal, S. A. Madgwick, and A. J. Moody. 1990. Inhibi o
e ec s on edox-linked p o ona ions o he b haems o he mi ochond ial bc1
complex. Biochim. Biophys. Ac a 1018:29–40.
30. Rippka, R., J. De uelles, J. B. Wa e bu y, M. He man, and R. Y. S anie .
1979. Gene ics assignmen s, s ain his o ies and p ope ies o pu e cul u es
o cyanobac e ia. J. Gen. Mic obiol. 111:1–61.
31. Samb ook, J., E. F. F i sch, and T. Mania is. 1989. Molecula cloning: a
labo a o y manual, 2nd ed. Cold Sp ing Ha bo Labo a o y P ess, Cold
Sp ing Ha bo , N.Y.
32. Sha ock, R. A., and P. H. Quail. 1989. No el phy och ome sequences in
A abidopsis haliana: s uc u e, e olu ion, and di e en ial exp ession o a
plan egula o y pho o ecep o amily. Genes De . 3:1745–1757.
33. Shaw, W. V. 1975. Chlo amphenicol ace yl ans e ase om chlo ampheni-
col- esis an bac e ia. Me hods Enzymol. 43:737–755.
34. Smi h, H. 1994. Phy och ome ansgenics: unc ional, ecological and bio-
echnological applica ions. Semin. Cell Biol. 5:315–325.
35. T ebs , A. 1980. Inhibi o s in elec on low: ools o he unc ional and
s uc u al localiza ion o ca ie s and ene gy conse a ion si es. Me hods
Enzymol. 69:675–715.
36. Vioque, A. 1992. Analysis o he gene encoding he RNA subuni s o ibo-
nuclease P om cyanobac e ia. Nucleic Acids Res. 20:6331–6337.
37. Yeh, K. C., S. H. Wu, J. T. Mu phy, and J. C. Laga ias. 1997. A cyanobac-
e ial phy och ome wo-componen ligh senso y sys em. Science 277:1505–
1508.
44 GARCI
´A-DOMI
´NGUEZ ET AL. J. BACTERIOL.
on July 24, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om