1
da Sil aEM, e al. J Clin Pa hol 2020;0:1–4. doi:10.1136/jclinpa h-2020-207062
S omal MED12 exon 2 mu a ions in complex
ib oadenomas o heb eas
Edaise M da Sil a ,1 F ancisco Beca ,2 Ana Paula Ma ins Sebas iao,1,3
Melissa P Mu ay,1 Ca a ina Sil ei a,1,4 A naud Da C uz Paula,5 F esia Pa eja ,1
Hannah Y Wen,1 Timo hy M D’Al onso ,1 Ma cia Edelweiss,1 B i a Weigel ,1
Edi B ogi,1 Jo ge S Reis- Filho,1 Hong Zhang1
Sho epo
To ci e: da Sil aEM, BecaF,
Sebas iaoAPM, e al.
J Clin Pa hol Epub ahead o
p in : [please include Day
Mon h Yea ]. doi:10.1136/
jclinpa h-2020-207062
►Supplemen al ma e ial is
published online only. To iew
please isi he jou nal online
(h p:// dx. doi. o g/ 10. 1136/
jclinpa h- 2020- 207062).
1Depa men o Pa hology,
Memo ial Sloan Ke e ing
Cance Cen e , New Yo k, NY,
USA
2Pa hology, S an o d Uni e si y
School o Medicine, S an o d,
Cali o nia, USA
3Depa men o Medical
Pa hology, Uni e sidade Fede al
do Pa ana Se o de Ciencias da
Saude, Cu i iba, B azil
4GenoMed SA, Ins i u e o
Molecula Medicine, Uni e si y
o Lisbon, Lisboa, Po ugal
5Su ge y, Memo ial Sloan
Ke e ing Cance Cen e , New
Yo k, NY, USA
Co espondence o
D Hong Zhang, Depa men
o Pa hology, Memo ial Sloan
Ke e ing Cance Cen e , New
Yo k 10065, New Yo k, USA;
zhangh3@ mskcc. o g
Recei ed 26 Augus 2020
Re ised 23 No embe 2020
Accep ed 7 Decembe 2020
© Au ho (s) (o hei
employe (s)) 2020. Re- use
pe mi ed unde CC BY- NC. No
comme cial e- use. See igh s
and pe missions. Published
by BMJ.
ABSTRACT
Aims He e we explo e he p esence o media o
complex subuni 12 (MED12) exon 2 and elome ase
e e se ansc ip ase (TERT) p omo e ho spo mu a ions
in complex ib oadenomas (CFAs) o he b eas .
Me hods The s omal componen s om 18 CFAs
we e subjec ed o Sange sequencing o MED12 exon 2
and he TERT p omo e ho spo loci. The epi helial and
s omal componen s o wo MED12 mu a ed CFAs we e
subjec ed o lase cap u e mic odissec ion, and Sange
sequencing o MED12 exon 2, TERT p omo e and
PIK3CA exons 9 and 20, sepa a ely.
Resul s MED12 exon 2 mu a ions we e iden i ied in he
s oma o 17% o CFAs. The analyses o epi helial and
s omal componen s, mic odissec ed sepa a ely, e ealed
ha MED12 mu a ions we e es ic ed o he s oma. No
TERT p omo e o PIK3CA mu a ions in exons 9 and 20
we e de ec ed in analysed CFAs.
Conclusions Like con en ional ib oadenomas, MED12
exon 2 mu a ions appea o be es ic ed o he s omal
componen o CFAs, suppo ing he no ion ha CFAs a e
s omal neoplasms.
INTRODUCTION
Fib oadenomas (FAs) o he b eas a e a g oup o
benign biphasic neoplasms consis ing o a p oli -
e a ion o bo h epi helial and s omal compo-
nen s.1 A e he seminal publica ion by Lim e al,2
desc ibing media o complex subuni 12 (MED12)
exon 2 mu a ions in app oxima ely 60% o FAs,
ou g oup and o he s ha e no only con i med
he p esence o hese mu a ions in FAs, bu also
demons a ed ha hey a e es ic ed o he s omal
componen o hese lesions.2–5 MED12 exon 2
mu a ions ha e also been de ec ed in o he ib oep-
i helial neoplasms, including phyllodes umou s
(PTs), whe e hese mu a ions a e p esen in 88%
o benign, in 78% o bo de line and in 8% o
malignan PTs.5–8 In addi ion, ou g oup ini ially
desc ibed he p esence o elome ase e e se an-
sc ip ase (TERT) p omo e ho spo mu a ions in
PTs,7 which ha e been con i med o inc ease in
equency om benign o malignan PTs and o be
anishingly a e in con en ional FAs.9–11
FAs comp ise his ologic a ian s, including ju e-
nile ib oadenoma, cellula FAs and complex ib o-
adenomas (CFAs), which display di e en his ologic
ea u es and a ia ions in hei clinicopa hologic
cha ac e is ics. A subse o FAs, cha ac e ised by
abundan myxoid ma ix and hypocellula s omal
componen , was p e iously ca ego ised as myxoid
ib oadenomas (MFAs) as pe ou h edi ion WHO
classi ica ion.12 These lesions we e epo ed o lack
MED12 exon 2 mu a ions in he s omal compo-
nen , and o ha bou ecu en mu a ions in TP53,
PIK3R1, ERCC5 and PIK3CA in he epi helial a he
han he s omal componen .13 Impo an ly, in one
case o MFA included in Lozada e al,13 a mu a-
ion a ec ing PRKAR1A was de ec ed in he s omal
componen , and he case was subsequen ly eclassi ied
as a myxoma. Pe i h edi ion WHO classi ica ion o
b eas neoplasms,1 CFA is a a ian o ib oadenoma
ha con ains one o mo e o he ollowing his ological
indings: cys s >3 mm, scle osing adenosis, epi helial
calci ica ions and papilla y apoc ine me aplasia. As
compa ed wi h con en ional FAs, CFAs ha e mo e
abundan epi helial componen s sha ing his ological
ea u es o p oli e a i e ib ocys ic disease o b eas
and less cha ac e is ic neoplas ic s oma. An inc eased
ela i e isk (RR) o subsequen in asi e b eas ca ci-
noma was epo ed o pa ien s wi h CFAs (RR 3.10;
95 % CI 1.9 o 5.1) in compa ison o pa ien s wi h
con en ional FAs (RR 2.17; 95 % CI 1.5 o 3.2).14
O he s udies, howe e , ha e indica ed ha CFAs
may no esul in inc eased b eas cance isk beyond
he p esence o o he es ablished isk ac o s such as
p oli e a i e disease o a ypical epi helial hype plasia
o b eas . The clinical beha iou o CFAs, howe e ,
emains con en ious, and he cu en ecommenda-
ion is o manage pa ien s wi h CFA wi h a conse -
a i e app oach, simila ly o he app oach employed
o he managemen o women wi h con en ional
FAs.15 16
The gene ic unde pinning o CFAs, whe he
he abundan epi helial componen con ibu es o
he umo igenesis o whe he hey a e gene ically
ela ed o con en ional FAs o PTs is unclea . He e
we conduc ed an explo a o y analysis o de e mine
whe he MED12 exon 2 and TERT p omo e ho spo
mu a ions would be p esen in CFAs. Fu he mo e,
gi en ou p e ious indings ha PIK3CA ho spo
mu a ions we e p esen in PTs wi hou FA- like a eas
and in a subse o FAs, classi ied as MFAs in he p io
( ou h edi ion) WHO classi ica ion,8 12 13 in addi ion
o he MED12 exon 2 and TERT p omo e ho spo
mu a ions, we also assessed he p esence o mu a ions
in exons 9 and 20 o PIK3CA in sepa a e epi helial and
s omal componen s o wo CFAs subjec ed o lase
cap u e mic odissec ion (LCM).
on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om
2da Sil aEM, e al. J Clin Pa hol 2020;0:1–4. doi:10.1136/jclinpa h-2020-207062
Sho epo
MATERIALS AND METHODS
Subjec s and samples
Following ins i u ional e iew boa d app o al, slides and
o malin- ixed pa a in- embedded (FFPE) issue blocks o 24
CFAs om 23 adul pa ien s we e e ie ed om he a chi es
o he Depa men o Pa hology o Memo ial Sloan Ke e ing
Cance Cen e (New Yo k, USA). All cases we e e iewed by
nine b eas pa hologis s (APMS, FP, ME, TMD, MPM, HYW,
EB, JSR- F and HZ) and we e eclassi ied acco ding o he WHO
c i e ia i h edi ion (2019).1 A diagnosis o CFA was ende ed
when a leas one o mo e complex ea u es we e p esen (ie,
cys s >3 mm, scle osing adenosis, epi helial calci ica ions and
papilla y apoc ine me aplasia). Eigh een CFAs ( om 17 anony-
mised pa ien s) we e included in his s udy on a consensus diag-
nosis being ende ed. All cases a e unique o his s udy, and none
has been p e iously epo ed.
Tumou mic odissec ion and sequencing
Eigh mic ome e hick FFPE ep esen a i e his ological sec ions
o 18 CFAs we e mic odissec ed unde a s e eomic oscope
(Olympus SZ61) o ensu e a s omal cell con en >80%. DNA
was ex ac ed using he DNeasy Blood and Tissue Ki (Qiagen)
acco ding o he manu ac u e ’s ins uc ions. Sange sequencing
was used o he assessmen o mu a ions a ec ing MED12 exon
2 and TERT p omo e ho spo s in he s omal componen s o 18
CFAs. Sange sequencing and PCR ampli ica ion me hods we e
pe o med as p e iously desc ibed17 and a e de ailed in online
supplemen al me hods and able S1.
To de ine whe he he mu a ions a ec ing he exon 2 o
MED12 would be es ic ed o he s oma o would also be
p esen in he epi helial componen in he MED12 mu a ed
cases, ep esen a i e samples om hese umou s we e subjec ed
o LCM o ob ain he epi helial and s omal componen s sepa-
a ely (online supplemen al me hods). Due o he limi ed ma e-
ial a ailable in one o he cases (CFA7), LCM was pe o med
in wo (CFA18 and CFA22) CFAs ha bou ing MED12 exon 2
mu a ions. DNA samples om he epi helial and s omal compo-
nen s we e subjec ed o Sange sequencing o MED12 exon 2,
TERT p omo e ho spo s and PIK3CA exons 9 and 20. Sequence
elec ophe og ams o he o wa d and e e se s ands we e anal-
ysed using Mu a ion Su eyo (So Gene ics) and he mu a ions
iden i ied we e manually cu a ed. All analyses we e pe o med
in duplica e.
RESULTS
Ou s udy included 18 CFAs om pa ien s wi h a median age o
48 yea s a diagnosis ( ange 33–82 yea s, (online supplemen al
able S2). All CFAs ha bou ed a leas one complex ea u e,
such as scle osing adenosis o ib ocys ic changes ( igu e 1A and
online supplemen al able S2). Fib ocys ic changes including
usual duc al hype plasia wi hou a ypia, apoc ine me aplasia,
columna cell changes, cys o ma ion and s omal ib osis we e
iden i ied in all CFAs, and scle osing adenosis we e p esen in
he adjacen b eas issue in 13 (72%) cases. Based on he da a
e ie ed om he pa hology epo s, concu en duc al ca ci-
noma in si u (67%, 12/18), in asi e duc al ca cinoma (22%,
4/18), in asi e lobula ca cinomas (6%, 1/18), lobula ca cinoma
in si u (11%, 2/18) o a ypical duc al hype plasia (6%, 1/18)
we e iden i ied in he b eas issue away om CFAs included in
his s udy.
MED12 exon 2 mu a ions we e iden i ied in he s omal
componen o 17% (3/18) o CFAs ( igu e 1B and online supple-
men al able S2). Two CFAs ha bou ed he ho spo p.G44S
(c.130G>A) and one case ha bou ed he pa hogenic p.L36R
(c.107T>G) MED12 mu a ions ( igu e 2A–C and online supple-
men al able S3. No di e ences in he his ologic and clinical
ea u es o he CFAs, acco ding o he p esence o absence o
MED12 mu a ions we e ound online supplemen al igu e S1 and
able S2. No TERT p omo e ho spo mu a ions we e de ec ed
in he CFAs analysed ( igu e 1B, online supplemen al able S2).
In CFA18 and CFA22, whe e he epi helial and s omal
componen s we e success ully sepa a ed, Sange sequencing
analysis e ealed ha he MED12 mu a ions (p.G44S) we e
exclusi ely es ic ed o hei espec i e s omal componen s.
No MED12 mu a ions we e ound in he epi helial componen
o he CFAs ( igu e 2D and online supplemen al able S4). No
TERT p omo e ho spo mu a ions o PIK3CA mu a ions in
exons 9 o 20 we e ound in ei he he epi helial o s omal
componen o he CFAs subjec ed o LCM.
DISCUSSION
CFAs a e a a ian o FAs12 and comp ise 22.7% o 40.4% o
diagnosed FAs.14 18 O en clinically o e looked, CFAs end o
occu in pa ien s olde han hose wi h con en ional FAs15 18
wi h an a e age size o hal o o he FAs.15 His ologically,
he p esence o epi helial al e a ions o e lapping wi h ib o-
cys ic changes inside he lesion is cha ac e is ic o his FA
sub ype. Tubula adenoma o b eas , which is a a e epi helial
p oli e a ion a ising om he e minal duc lobula uni , is
occasionally in he di e en ial diagnosis due o he p esence
o p ominen scle osing adenosis inside he CFA.19 Al hough
some s udies sugges ha CFAs ca y a sligh ly inc eased isk
o subsequen de elopmen o b eas cance s compa ing o
gene al popula ion,14 o he s did no con i m his isk.15 16
The explo a o y, hypo hesis gene a ing analysis pe o med
he e e ealed ha , akin o con en ional FAs, a subse o CFAs
ha bou pa hogenic mu a ions in MED12 exon 2, al hough
a a lowe equency (17% CFAs s up o 65% con en ional
FAs).5 17 These indings suppo he no ion ha while CFAs
and con en ional FAs a e mo phologically and, o a ce ain
ex en , clinically sepa a e en i ies, hey sha e simila gene ic
al e a ions in MED12 in a subse o cases, in ag eemen wi h
wha was epo ed by Lien e al.20 Due o he ich na u e
o epi helial componen and i s in eg al g ow h mixed wi h
s omal componen s, i is echnically challenging o ob ain
adequa e amoun o DNA om he sepa a e componen s
in CFAs by LCM. We success ully assessed mu a ions in
MED12 exon 2 and TERT p omo e loci in he sepa a ely
lase mic odissec ed epi helial and s omal componen s o
Figu e 1 His ologic ea u es and equency o MED12 exon 2
and TERT p omo e mu a ions in complex FAs o he b eas . (A)
Rep esen a i e H&E mic og aph o a complex FA displaying apoc ine
me aplasia (bo om igh ) and scle osing adenosis ( op igh ), scale
ba , 2 mm. (B) F equency o MED12 exon 2 and TERT p omo e ho spo
mu a ions in he s omal componen o 18 CFAs included in his s udy.
CFAs, complex ib oadenomas; FAs, ib oadenomas; MED12, media o
complex subuni 12; TERT, elome ase e e se ansc ip ase.
on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om
3
da Sil aEM, e al. J Clin Pa hol 2020;0:1–4. doi:10.1136/jclinpa h-2020-207062
Sho epo
wo CFAs. These cases we e also subjec ed o Sange analysis
o PIK3CA exons 9 and 20. Gi en ha MED12 mu a ions a e
es ic ed o he s omal componen , CFAs, akin o con en-
ional FAs, likely cons i u e s omal a he han ib oepi he-
lial neoplasms. No PIK3CA mu a ions in exon 9 and 20 we e
iden i ied in hese cases, consis en wi h p e ious obse a-
ions de i ed om he analysis o ib oepi helial lesions
ha bou ing MED12 mu a ions.10
Ou s udy has limi a ions. Due o limi ed a chi ed FFPE
issue a ailabili y, we es ic ed ou analysis o speci ic gene ic
al e a ions. Ou analysis was es ic ed o he mu a ions
a ec ing MED12 exon 2, TERT p omo e ho spo mu a ions,
and in wo MED12 exon 2 mu a ed cases, also PIK3CA exons
9 and 20. Al hough ou indings suppo he no ion ha
MED12 exon 2 mu a ions do no cons i u e he main d i e
o CFAs, we canno ule ou ha he e a e o he genes which
may play a ole in he biology o CFAs. Mo eo e , due o he
size o ou coho and a i y o ecu en e en s, ou s udy
may ha e a limi ed powe o assess he signi icance o he
p esence o MED12 exon 2 mu a ions in he s omal compo-
nen o CFAs. All CFAs included in his s udy we e e ie ed
om he pa hology a chi es o a cance cen e, which migh
ha e con ibu ed o he high equency o co- occu en in a-
si e and/o in si u ca cinomas a he ime o he diagnosis o
CFA. Gi en he scope o his s udy, we could no de e mine
he p ognos ic signi icance o MED12 exon 2 mu a ions and
i s associa ion wi h he p esence o co- occu en in asi e and/
o in si u ca cinomas iden i ied in ou coho . Fu he s udies
o assess he impac o MED12 exon 2 mu a ions in CFAs
in he isk o de elopmen o b eas cance a e wa an ed.
Despi e hese limi a ions, he e we demons a ed ha CFAs
ha bou MED12 exon 2 mu a ions in he s omal componen ,
akin o o he his ologic a ian s o FAs. A a iance wi h
con en ional FAs, howe e , he equency o MED12 exon 2
mu a ions in CFAs appea s o be lowe han ha o con en-
ional FAs. Fu he s udies a e wa an ed o de ine he gene ic
unde pinning o MED12 wild- ype CFAs.
Handling edi o Cheok Soon Lee.
Con ibu o s FP, EB, JSR- F and HZ concei ed he s udy. EMdS and HZ coo dina ed
he e ie al o samples. APMS, MPM, FP, HYW, TMD, ME, EB, JSR- F and HZ
pe o med he pa hology e iew. EMdS, APMS, CS and ADCP pe o med expe imen s
and analysis. EMdS, FB, BW, JSR- F and HZ analysed and in e p e ed he da a. EMdS,
FB, JSR- F and HZ w o e he i s manusc ip , which was e iewed by all coau ho s.
Funding This s udy was unded by he B eas Cance Resea ch Founda ion. BW is
unded by a Cycle o Su i al g an , CS by a Fundação pa a a Ciência e Tecnologia
g an (SFRH/BDE/110544/2015). FP is pa ially unded by a K12 CA184746 g an .
The esea ch epo ed in his pape was suppo ed in pa by a Cance Cen e
Suppo G an o he Na ional Ins i u es o Heal h/Na ional Cance Ins i u e (g an
No P30CA008748).
Compe ing in e es s JSR- F epo s ecei ing pe sonal/consul ancy ees om
Goldman Sachs and REPARE The apeu ics, membe ship o he scien i ic ad iso y
boa ds o Voli ionRx, REPARE The apeu ics and Paige. AI, membe ship o he Boa d
o Di ec o s o G upo Oncoclinicas, and ad hoc membe ship o he scien i ic ad iso y
boa ds o Roche Tissue Diagnos ics, Ven ana Medical Sys ems, No a is, Genen ech
and InVic o, ou side he scope o his s udy. HZ epo s consul ancy ee om Roche/
Genen ech, ou side he scope o he submi ed wo k. FB is cu en ly an employee
and equi y holde o Sea le Gene ics, Inc bu he p esen wo k is ou side he scope
o his ole.
Pa ien consen o publica ion No equi ed.
P o enance and pee e iew No commissioned; ex e nally pee e iewed.
Supplemen al ma e ial This con en has been supplied by he au ho (s). I
has no been e ed by BMJ Publishing G oup Limi ed (BMJ) and may no ha e
been pee - e iewed. Any opinions o ecommenda ions discussed a e solely hose
o he au ho (s) and a e no endo sed by BMJ. BMJ disclaims all liabili y and
esponsibili y a ising om any eliance placed on he con en . Whe e he con en
includes any ansla ed ma e ial, BMJ does no wa an he accu acy and eliabili y
o he ansla ions (including bu no limi ed o local egula ions, clinical guidelines,
e minology, d ug names and d ug dosages), and is no esponsible o any e o
and/o omissions a ising om ansla ion and adap a ion o o he wise.
Open access This is an open access a icle dis ibu ed in acco dance wi h he
C ea i e Commons A ibu ion Non Comme cial (CC BY- NC 4.0) license, which
pe mi s o he s o dis ibu e, emix, adap , build upon his wo k non- comme cially,
and license hei de i a i e wo ks on di e en e ms, p o ided he o iginal wo k is
p ope ly ci ed, app op ia e c edi is gi en, any changes made indica ed, and he use
is non- comme cial. See:h p:// c ea i ecommons. o g/ licenses/ by- nc/ 4. 0/.
ORCID iDs
Edaise Mda Sil a h p:// o cid. o g/ 0000- 0003- 3281- 7333
F anciscoBeca h p:// o cid. o g/ 0000- 0002- 4409- 012X
F esiaPa eja h p:// o cid. o g/ 0000- 0003- 3748- 8049
Timo hy MD’Al onso h p:// o cid. o g/ 0000- 0003- 0464- 0868
REFERENCES
1 Thike AA, B ogi E, Ha ada O, e al. B eas umou s. In: WHO classi ica ion o umo s.
5 h edn. Lyon: IARC, 2019: 168–71.
2 Lim WK, Ong CK, Tan J, e al. Exome sequencing iden i ies highly ecu en MED12
soma ic mu a ions in b eas ib oadenoma. Na Gene 2014;46:877–80.
3 Mishima C, Kaga a N, Tanei T, e al. Mu a ional analysis o MED12 in ib oadenomas
and phyllodes umo s o he b eas by means o a ge ed nex - gene a ion sequencing.
B eas Cance Res T ea 2015;152:305–12.
4 Yoshida M, Sekine S, Ogawa R, e al. F equen MED12 mu a ions in phyllodes
umou s o he b eas . B J Cance 2015;112:1703–8.
5 Piscuoglio S, Mu ay M, Fusco N, e al. MED12 soma ic mu a ions in ib oadenomas
and phyllodes umou s o he b eas . His opa hology 2015;67:719–29.
6 Tan J, Ong CK, Lim WK, e al. Genomic landscapes o b eas ib oepi helial umo s.
Na Gene 2015;47:1341–5.
7 Piscuoglio S, Ng CK, Mu ay M, e al. Massi ely pa allel sequencing o phyllodes
umou s o he b eas e eals ac ionable mu a ions, and TERT p omo e ho spo
mu a ions and TERT gene ampli ica ion as likely d i e s o p og ession. J Pa hol
2016;238:508–18.
8 Pa eja F, Geye FC, Kuma R, e al. Phyllodes umo s wi h and wi hou ib oadenoma-
like a eas display dis inc genomic ea u es and may e ol e h ough dis inc pa hways.
NPJ B eas Cance 2017;3:40.
Figu e 2 Complex FAs ha e MED12 exon 2 mu a ions es ic ed
o he s omal componen . Rep esen a i e H&E mic og aphs o CFAs
and Sange sequencing elec ophe og ams o (A) MED12 exon 2 L36R
mu a ion (CFA7), (B–C) MED12 exon 2 G44S mu a ions (CFA18 and
CFA22, espec i ely) iden i ied, scale ba , 2 mm, (D) CFA18 subjec ed
o LCM and independen sequencing o he epi helial and s omal
componen s (le , blue a ow—s oma, ed a ow—epi helium);
ep esen a i e sequence elec ophe og ams o exon 2 o MED12 in
he s oma ( igh op) and he epi helial componen ( igh bo om).
** MED12 mu a ed CFAs subjec ed o lase cap u e mic odissec ion.
CFA, complex ib oadenomas; FAs, ib oadenomas; LCM, lase
cap u e mic odissec ion; MED12, media o complex subuni 12; TERT,
elome ase e e se ansc ip ase.
on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om
4da Sil aEM, e al. J Clin Pa hol 2020;0:1–4. doi:10.1136/jclinpa h-2020-207062
Sho epo
9 Yoshida M, Ogawa R, Yoshida H, e al. TERT p omo e mu a ions a e equen and
show associa ion wi h MED12 mu a ions in phyllodes umo s o he b eas . B J
Cance 2015;113:1244–8.
10 Md Nasi ND, Ng CCY, Rajasega an V, e al. Genomic cha ac e isa ion o b eas
ib oepi helial lesions in an in e na ional coho . J Pa hol 2019;249:447–60.
11 Ga cia- Dios DA, Le i D, Shah V, e al. MED12, TERT p omo e and RBM15 mu a ions in
p ima y and ecu en phyllodes umou s. B J Cance 2018;118:277–84.
12 Lakhani IE SR, Schni SJ, Tan PH, e al. WHO classi ica ion o b eas umo s. 4 h edn.
Lyon, 2012.
13 Lozada JR, Bu ke KA, Magui e A, e al. Myxoid ib oadenomas di e om
con en ional ib oadenomas: a hypo hesis- gene a ing s udy. His opa hology
2017;71:626–34.
14 Dupon WD, Page DL, Pa l FF, e al. Long- e m isk o b eas cance in women wi h
ib oadenoma. N Engl J Med 1994;331:10–15.
15 Sklai - Le y M, Sella T, Alweiss T, e al. Incidence and managemen o complex
ib oadenomas. AJR Am J Roen genol 2008;190:214–8.
16 Nassa A, Vissche DW, Degnim AC, e al. Complex ib oadenoma and b eas cance
isk: a Mayo clinic benign b eas disease coho s udy. B eas Cance Res T ea
2015;153:397–405.
17 Pa eja F, Da C uz Paula A, Mu ay MP, e al. Recu en MED12 exon 2 mu a ions in
benign b eas ib oepi helial lesions in adolescen s and young adul s. J Clin Pa hol
2019;72:258–62.
18 Kuijpe A, Momme s EC, an de Wall E, e al. His opa hology o ib oadenoma o he
b eas . Am J Clin Pa hol 2001;115:736–42.
19 Volckma A- L, Leichsen ing J, Flech enmache C, e al. Tubula , lac a ing, and duc al
adenomas a e de oid o MED12 Exon2 mu a ions, and duc al adenomas show
ecu en mu a ions in GNAS and he PI3K- AKT pa hway. Genes Ch omosomes
Cance 2017;56:11–17.
20 Lien H- C, Huang C- S, Yang Y- W, e al. Mu a ional analysis o MED12 exon 2 in a
spec um o ib oepi helial umou s o he b eas : implica ions o pa hogenesis and
his ogenesis. His opa hology 2016;68:433–41.
on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om
1
SUPPLEMENTARY MATERIALS
S omal MED12 Exon 2 Mu a ions in Complex Fib oadenomas o he B eas
da Sil a e al.
Supplemen a y Figu e S1
Supplemen a y Me hods
Supplemen a y Tables S1-S4
Supplemen a y Figu e 1. His ologic ea u es o complex ib oadenomas o he b eas .
Rep esen a i e hema oxylin and eosin mic og aphs o complex ib oadenomas lacking MED12
exon 2 mu a ions included in he s udy. Scale ba , 2mm. Co esponding sample IDs a e indica ed
on each image ( op le ) and inse (bo om igh ) depic ing his ological ea u es iden i ied in he
complex ib oadenomas.
Supplemen a y Me hods
Supplemen a y Table S1: P ime s used o Sange sequencing.
Supplemen a y Table S2. Clinicopa hological cha ac e is ics, MED12 exon 2 and TERT
p omo e s a us o he complex ib oadenomas o he b eas included in his s udy.
Supplemen a y Table S3. MED12 exon 2 mu a ions iden i ied in he complex ib oadenomas o
he b eas and hei p edic ed pa hogenici y.
Supplemen a y Table S4. MED12 exon 2, TERT p omo e and PIK3CA exon 9 and exon 20
s a us in he complex ib oadenomas o he b eas subjec ed o lase cap u e mic odissec ion o
he epi helial and s omal componen s.
BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance
Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol
doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM

2
Supplemen a y Me hods
Lase cap u e mic odissec ion
Eigh -μm- hick FFPE sec ions o cases CFA18 and CFA22 we e cu using a mic o ome c yos a
(Leica) and moun ed on o A c u us PEN Memb ane glass slides (Li e Technologies). Slides we e
dehyd a ed and s ained wi h hema oxylin. Lase cap u e mic odissec ion was pe o med using an
LMD 6500 ins umen (Leica Mic osys em). The s omal and epi helial componen s o a gi en
case we e ou lined using he associa ed so wa e and hen cap u ed sepa a ely using an in a ed
cap u e lase . DNA om he mic odissec ed componen s was ex ac ed using he DNeasy Blood
and Tissue Ki (Qiagen) acco ding o manu ac u e ’ ins uc ions and subjec ed o mu a ion
sc eening desc ibed below.
PCR ampli ica ion and Sange sequencing
Pu a i e soma ic mu a ions in selec ed genes o in e es we e in es iga ed by Sange sequencing.
PCR ampli ica ion o 10ng o genomic DNA was pe o med using he AmpliTaq 360 Mas e Mix
Ki (Li e Technologies) as p e iously desc ibed.1,2 PCR p oduc s we e pu i ied (ExoSAP-IT,
The mo Fishe Scien i ic) and subjec ed o Sange sequencing encompassing MED12 exon 2,
TERT p omo e ho spo locus and PIK3CA exons 9 and 20 (Supplemen a y Table S1). All
analyses we e pe o med in duplica e.
Supplemen a y Re e ences
1. Pa eja F, Da C uz Paula A, Mu ay MP e al. Recu en MED12 exon 2 mu a ions in
benign b eas ib oepi helial lesions in adolescen s and young adul s. Jou nal o Clinical
Pa hology 2019; 72; 258-262.
2. Piscuoglio S, Ng CK, Mu ay M e al. Massi ely pa allel sequencing o phyllodes
umou s o he b eas e eals ac ionable mu a ions, and TERT p omo e ho spo
mu a ions and TERT gene ampli ica ion as likely d i e s o p og ession. The Jou nal o
Pa hology 2016; 238; 508-518.
BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance
Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol
doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM
3
Supplemen a y Table S1: P ime s used o Sange sequencing.
Gene
Fo wa d
Re e se
MED12 exon 2
TGTTCTACACGGAACCCTCCTC
CTGGGCAAATGCCAATGAGAT
TERT p omo e
CCAGGGCTTCCCACGTGC
ACTGGGGACCCGGGCACC
PIK3CA exon 9
CTGTGAATCCAGAGGGGAAA
GCACTTACCTGTGACTCCATAGAA
PIK3CA exon 20
CTCAATGATGCTTGGCTCTG
TGGAATCCAGAGTGAGCTTTC
BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance
Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol
doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM
4
Supplemen a y Table S2. Clinicopa hological cha ac e is ics, MED12 exon 2 mu a ions and
TERT p omo e s a us o he complex ib oadenomas o he b eas included in his s udy.
Sample
ID
Age
(yea s)
Menopausal
s a us
Scle osing
adenosis
Fib ocys ic
changes
Size
(cm)
MED12
mu a ion
TERT
s a us
CFA 1
54
Pos
Y
Y
NA
WT
CFA 2
67
Pos
Y
NA
WT
CFA 4
62
Pos
Y
1
WT
CFA 5
39
P e
Y
Y
NA
WT
CFA 6
41
P e
Y
1.5
WT
CFA 7
36
P e
Y
NA
c.107T>G
WT
CFA 8
63
Pos
Y
Y
2.1
WT
CFA 9
47
P e
Y
Y
NA
WT
CFA 10
52
P e
Y
Y
NA
WT
CFA 11
63
Pos
Y
Y
NA
WT
CFA 13
33
P e
Y
Y
NA
WT
CFA 16
33
P e
Y
Y
NA
WT
CFA 17
82
Pos
Y
Y
NA
WT
CFA 18
41
P e
Y
Y
NA
c.130G>A
WT
CFA 19
45
P e
Y
0.9
WT
CFA 21
37
P e
Y
Y
1.8
WT
CFA 22
52
Pe i
Y
Y
1.6
c.130G>A
WT
CFA 24
48
P e
Y
Y
NA
WT
NA, no a ailable; WT, wild ype
BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance
Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol
doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM
5
Supplemen a y Table S3. MED12 exon 2 non-synonymous soma ic mu a ions iden i ied in he
complex ib oadenomas o he b eas and hei p edic ed pa hogenici y.
Sample
ID
MED12
mu a ion
MED12
Amino
Acid
Change
S a
Posi ion
Mu a ion
Tas e
P o ean
Polyphen-
2
CADD
ClinVa
In e p e a ion
COSMIC
Mu a ion ID
CFA 1
CFA 2
CFA 4
CFA 5
CFA 6
CFA 7
c.107T>G
p.L36R
70339230
disease
causing
dele e ious
p obably
damaging
dele e ious
No p o ided
COSM131590
CFA 8
CFA 9
CFA 10
CFA 11
CFA 13
CFA 16
CFA 17
CFA 18
c.130G>A
p.G44S
70339253
disease
causing
dele e ious
p obably
damaging
dele e ious
o he
COSM131594
CFA 19
CFA 21
CFA 22
c.130G>A
p.G44S
70339253
disease
causing
dele e ious
p obably
damaging
dele e ious
o he
COSM131594
CFA 24
BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance
Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol
doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM