scieee Science in your language
[en] (orig)

Revision of the morphology, phylogenetic relationships, behaviour and diversity of the Iberian and Italian ant-like Tachydromia Meigen, 1803 (Diptera: Hybotidae)

Abstract

Phylogenetic inference, based on five molecular markers (COI, 28S, AATS, 12S, PGD), corroborates the synonymy of the flightless genera Pieltainia Arias, 1919 and Ariasella Gil, 1923 with Tachydromia Meigen, 1803. The secondary structure of the 28S rRNA gene is used for the first time in this family to align the multiple sequences. Molecular and morphological data are largely congruent for all known species of flightless Tachydromia. This paper treats ten western Mediterranean species (nine Iberian and one Italian) in detail, including the description of four new species: T. ebejeri Gonçalves, Grootaert & Andrade sp. nov., T. stenoptera Gonçalves, Grootaert & Andrade sp. nov., T. cantabrica Gonçalves, Grootaert & Andrade sp. nov. and T. nigrohirta Gonçalves, Grootaert & Andrade sp. nov. The male of Tachydromia pieltaini (Gil Collado, 1936) and the female of Tachydromia apterygon Plant & Deeming, 2006 are described for the first time, while a lectotype is assigned to Tachydromia pandellei (Séguy, 1941). A key to all non-macropterous Tachydromia is supplied. Knowledge on the geographic distribution of most species is considerably enhanced. The mating behaviour of Tachydromia semiaptera (Gil Collado, 1923) and Tachydromia iberica (Arias, 1919) is documented for the first time, and we propose a change in the definition of terms apterous and micropterous to properly accommodate the diversity of wing states in this cluster of species.

Read accessible full text

Revision of the morphology, phylogenetic relationships, behaviour and diversity of the Iberian and Italian ant-like Tachydromia Meigen, 1803 (Diptera: Hybotidae)

Author: Gonçalves, Ana Rita,Grootaert, Patrick,Andrade, Rui,S. Paulo, Octávio,Mengual, Ximo
Publisher: Publications scientifiques du Muséum
Year: 2021
Source: https://repositorio.ulisboa.pt/bitstream/10451/49257/1/1213-Article%20Text-5285-1-10-20210122.pdf
Re ision o he mo phology, phylogene ic ela ionships, beha iou and
di e si y o he Ibe ian and I alian an -like Tachyd omia Meigen, 1803
(Dip e a: Hybo idae)
Ana Ri a GONÇALVES 1,*, Pa ick GROOTAERT 2, Rui ANDRADE 3,
Oc á io S. PAULO 4 & Ximo MENGUAL 5
1,4 Compu a ional Biology and Popula ion Genomics G oup, cE3c, Faculdade de Ciências,
Uni e sidade de Lisboa, Campo G ande, 1749-016 Lisboa, Po ugal.
2 Royal Belgian Ins i u e o Na u al Sciences, B ussels, Belgium and Lee Kong Chian Na u al His o y
Museum, Na ional Uni e si y o Singapo e, Singapo e.
3 Rua Calous e Gulbenkian 237 4H3, 4050-145 Po o, Po ugal.
5 Zoologisches Fo schungsmuseum Alexande Koenig, Leibniz-Ins i u ü Biodi e si ä de Tie e,
Adenaue allee 160, 53113, Bonn, Ge many.
* Co esponding au ho : [email p o ec ed]
2 Email: [email p o ec ed]
3 Email: [email p o ec ed]
4 Email: [email p o ec ed]
5 Email: [email p o ec ed]
1 u n:lsid:zoobank.o g:au ho :1A0C6FC2-1273-4DFD-A306-874D90860F61
2 u n:lsid:zoobank.o g:au ho :B80BC556-9087-4D0D-9D69-7FA9BE5779C4
3 u n:lsid:zoobank.o g:au ho :36D41774-1466-4297-BB51-CCCEEE6DCB4E
4 u n:lsid:zoobank.o g:au ho :2F8855AC-67EC-47BC-ADF5-019EAF332A7A
5 u n:lsid:zoobank.o g:au ho :A509310D-B567-4830-B8A4-BCB139BB8768
1 h ps://o cid.o g/0000-0003-1776-3728
2 h ps://o cid.o g/0000-0003-2149-9229
3 h ps://o cid.o g/0000-0003-2356-3706
4 h ps://o cid.o g/0000-0001-5408-5212
5 h ps://o cid.o g/0000-0002-6185-9404
Abs ac . Phylogene ic in e ence, based on i e molecula ma ke s (COI, 28S, AATS, 12S, PGD),
co obo a es he synonymy o he ligh less gene a Piel ainia A ias, 1919 and A iasella Gil, 1923 wi h
Tachyd omia Meigen, 1803. The seconda y s uc u e o he 28S RNA gene is used o he i s ime in
his amily o align he mul iple sequences. Molecula and mo phological da a a e la gely cong uen o
all known species o ligh less Tachyd omia. This pape ea s en wes e n Medi e anean species (nine
Ibe ian and one I alian) in de ail, including he desc ip ion o ou new species: T. ebeje i Gonçal es,
G oo ae & And ade sp. no ., T. s enop e a Gonçal es, G oo ae & And ade sp. no ., T. can ab ica
Gonçal es, G oo ae & And ade sp. no . and T. nig ohi a Gonçal es, G oo ae & And ade sp. no .
The male o Tachyd omia piel aini (Gil Collado, 1936) and he emale o Tachyd omia ap e ygon
1
Eu opean Jou nal o Taxonomy 732: 1–56 ISSN 2118-9773
h ps://doi.o g/10.5852/ej .2021.732.1213 www.eu opeanjou nalo axonomy.eu
2021 · Gonçal es A.R e al.
This wo k is licensed unde a C ea i e Commons A ibu ion License (CC BY 4.0).
Monog aph
u n:lsid:zoobank.o g:pub:39F0C998-10AE-44BF-B1ED-7593AD4AE3AA
Plan & Deeming, 2006 a e desc ibed o he i s ime, while a lec o ype is assigned o Tachyd omia
pandellei (Séguy, 1941). A key o all non-mac op e ous Tachyd omia is supplied. Knowledge on he
geog aphic dis ibu ion o mos species is conside ably enhanced. The ma ing beha iou o Tachyd omia
semiap e a (Gil Collado, 1923) and Tachyd omia ibe ica (A ias, 1919) is documen ed o he i s ime,
and we p opose a change in he de ini ion o e ms ap e ous and mic op e ous o p ope ly accommoda e
he di e si y o wing s a es in his clus e o species.
Keywo ds. Ibe ian Peninsula, Hybo idae, ligh less, molecula phylogeny, synonym, new species.
Gonçal es A.R., G oo ae P., And ade R., Paulo O.S. & Mengual X. 2021. Re ision o he mo phology,
phylogene ic ela ionships, beha iou and di e si y o he Ibe ian and I alian an -like Tachyd omia Meigen, 1803
(Dip e a: Hybo idae). Eu opean Jou nal o Taxonomy 732: 1–56. h ps://doi.o g/10.5852/ej .2021.732.1213
Table o Con en s
Abs ac .................................................................................................................................................... 2
In oduc ion .............................................................................................................................................. 3
Ma e ial and me hods ............................................................................................................................... 4
Sampling, species dis ibu ion and specimen deposi ion ...................................................................... 4
Mo phological analysis ......................................................................................................................... 5
Wing educ ion e minology in Dip e a ................................................................................................ 6
Obse a ions on ma ing beha iou ....................................................................................................... 6
Molecula analysis ................................................................................................................................ 6
Taxon sampling .................................................................................................................................. 6
Molecula ma ke selec ion ............................................................................................................... 6
DNA ex ac ion and sequencing ........................................................................................................ 8
Sequence alignmen ......................................................................................................................... 10
Sequence analysis ............................................................................................................................ 10
Phylogene ic analyses ...................................................................................................................... 10
Resul s .....................................................................................................................................................11
Sequence cha ac e is ics ......................................................................................................................11
Recons uc ion o phylogene ic ela ionships ..................................................................................... 12
Taxonomy ........................................................................................................................................... 14
Key o he non-mac op e ous Tachyd omia ..................................................................................... 14
Gene al diagnosis o he Ibe ian and I alian an -like species o Tachyd omia ................................ 16
Tachyd omia ap e ygon Plan & Deeming, 2006 ......................................................................... 16
Tachyd omia can ab ica Gonçal es, G oo ae & And ade sp. no . ............................................ 18
Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no . .................................................. 21
Tachyd omia ibe ica (A ias, 1919) ............................................................................................... 23
Tachyd omia lusi anica (G oo ae , Shamshe & And ade, 2009) ............................................... 27
Tachyd omia nig ohi a Gonçal es, G oo ae & And ade sp. no . ............................................. 29
Tachyd omia pandellei (Séguy, 1941) .......................................................................................... 30
Tachyd omia piel aini (Gil Collado, 1936) ................................................................................... 33
Tachyd omia semiap e a (Gil Collado, 1923) .............................................................................. 35
Tachyd omia s enop e a Gonçal es, G oo ae & And ade sp. no . ............................................ 37
No es on habi a , dis ibu ion and phenology ..................................................................................... 46
Obse a ions on ma ing beha iou o T. semiap e a and T. ibe ica ................................................... 47
Discussion .............................................................................................................................................. 48
Phylogene ic ela ionships and sys ema ics ........................................................................................ 48
Wing educ ion/modi ica ion in Tachyd omia and i s e olu iona y signi icance ............................... 51
Rema ks on he habi a and dis ibu ion wi h implica ions on conse a ion ...................................... 51
Acknowledgemen s ................................................................................................................................ 52
Re e ences .............................................................................................................................................. 53
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
2
In oduc ion
The genus Tachyd omia Meigen, 1803 (Dip e a Linnaeus, 1758, Hybo idae Meigen, 1820) includes
o e 100 alid species dis ibu ed wo ldwide, mos o hem desc ibed in he empe a e a eas o he
Hola c ic egion (Shamshe & G oo ae 2018). These a e small-bodied lies (1–3.5 mm) usually shiny
black o blackish b own in colou , wi h da k banded o clouded wings (Ch ála 1975). This genus is
cu en ly di ided in o nine species g oups based on mo phological cha ac e s: he annulimana, a ogans,
calcanea, connexa, in e up a, o na ipes, punc i e a and e icola g oups (Ch ála 1970, 1975; S a k &
Doczkal 2017).
This pape e iews he ligh less Tachyd omia om he wes e n Medi e anean, he Ibe ian Peninsula
and I aly, comp ising en species in o al, including ou newly desc ibed species om Ibe ia. They a e
minu e an -like lies, ca 2.5 mm, which occupy speci ic mic ohabi a s among he lea li e o deciduous
o es s. One o hese an -like Tachyd omia, Tachyd omia ap e ygon Plan & Deeming 2006, is endemic
o I aly, while he emaining nine species a e es ic ed o he Ibe ian Peninsula and he Py enees.
Apa om Tachyd omia ap e ygon, which has scale-like wings in bo h sexes and lacks hal e es, i e o
hese species we e o iginally placed in he gene a Piel ainia A ias, 1919 and A iasella Gil Collado, 1923,
bu hese wo gene a ha e since been placed in synonymy wi h Tachyd omia (Shamshe & G oo ae
2018): Tachyd omia ibe ica (A ias, 1919), Tachyd omia semiap e a (Gil Collado, 1923), Tachyd omia
piel aini (Gil Collado, 1936), Tachyd omia pandellei (Séguy, 1941) and he mo e ecen ly desc ibed
Tachyd omia lusi anica (G oo ae , Shamshe & And ade, 2009). Despi e being mo phologically
simila o Tachyd omia, hey we e o iginally assigned o he abo e-men ioned gene a solely based on he
comple e absence o hal e es and on he ex emely educed o absen wings. The o me monospeci ic
Piel ainia was cha ac e ized by ap e y in bo h sexes, while in A iasella spp. males a e s enop e ous,
i.e., e y na ow bu long wings (comple e loss o ligh abili y) (Figs 20E, 21A–B, D). The males o
he species p e iously placed in A iasella ha e ubula , s alk-like wings wi h a lobed ip, which, a
leas in T. lusi anica, a e wa ed du ing ma ing (And ade 2011). Females o bo h T. semiap e a and
T. lusi anica a e mic op e ous (Figs 20F, 21E), wi h wings educed o a minu e bilobed scale, while
emales o T. pandellei and T. piel aini a e s enop e ous bu lack he de eloped lobed ip p esen in males
(Fig. 21C).
To ou knowledge, he e is no published in o ma ion on he imma u e s ages, bu adul Tachyd omia
a e p eda o s o small lies, mos ly so -bodied ‘nema oce a’. They a e commonly encoun e ed in la ge
numbe s, swi ly unning ei he on e ical o ho izon al su aces such as ee unks, logs, low ege a ion
and i e ma gins (Ch ála 1970), and o en e en ully winged species a e eluc an o ly, bu ins ead
un o a oid p eda o s. In addi ion o he Ibe ian and I alian an -like species, equen cu so ial habi s
a e also aken o an ex eme in only h ee o he p e iously desc ibed species o Tachyd omia. These
ha e e ol ed o become comple ely ligh less by lacking unc ional wings, while s ill conse ing he
hal e es: Tachyd omia ossica Shamshe , 1994 (Russian Fa Eas and Mongolia) has s alk-like wings,
wi hou he lobed ip whe eas Tachyd omia mic op e a (Loew, 1864) and Tachyd omia schni e i S a k,
1996 (cen al Eu ope) a e b achyp e ous ( ena ion and shape simila o mac op e ous Tachyd omia).
Howe e , wing educ ion is p esen in a leas 20 dip e an amilies (Hackman 1964) and i is equen
in Hybo idae (G oo ae & Shamshe 2008). This phenomenon may be explained by se e al ac o s,
including he s abili y o he habi a and c yp ic beha iou (Hackman 1964).
Due o a combina ion o hei small size, c yp ic habi a p e e ences and ela i ely sho pe iod o
ac i i y, mos Ibe ian an -like species o Tachyd omia ha e been poo ly s udied a he mo phological,
beha iou al, sys ema ic and ecological le els. The o iginal desc ip ions we e gene ally supe icial
and lacked in o ma ion on impo an axonomic cha ac e s, such as he male e minalia. The species
dis ibu ion was also only known om ei he he ype locali y, o jus a ew locali ies, gene ally based on
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
3
a ew specimens, and in he case o T. piel aini, only he emale was known and desc ibed. Addi ionally,
he ypes o T. ibe ica, T. semiap e a and T. piel aini seem o be los and no holo ype was assigned o
T. pandellei. The e is, howe e , a no ewo hy excep ion o his scena io ha is he case o T. lusi anica,
whose desc ip ion includes he male e minalia and o he impo an de ails o axonomic ele ance.
Fu he mo e, se e al impo an obse a ions on i s beha iou we e published by And ade (2011). The
only o he obse a ions we e he b ie no es by A ias (1919) on Tachyd omia ibe ica, desc ibing i s g ea
o aci y by p eying on ungus gna s (Dip e a, Scia idae Billbe g, 1820) and i s agili y, esembling small
an s quickly unning on he g ound. A close phylogene ic ela ionship be ween A iasella and Tachyd omia
was eco e ed by J. Mo elmans (MSc hesis, unpublished da a) using se e al genes (COI, 18S, 28S,
EF-1 alpha and PGD). In his s udy, he single s udied species o ‘A iasella’, cu en ly T. piel aini, was
esol ed embedded among species o Tachyd omia. Nagy e al. (2013) esol ed T. piel aini again wi hin
he s udied species o Tachyd omia in a simple Neighbou -Joining ee econs uc ion using he 5’-end
o he mi ochond ial COI gene. Un il now, T. ibe ica (p e iously ega ded as he mono ypic genus
Piel ainia), has no been included in any phylogene ic in e ences.
In he p esen s udy we pu sue a mo e inclusi e phylogene ic analysis by including all species p e iously
ega ded as A iasella, Tachyd omia ibe ica om h ee geog aphically dis an locali ies, and ou newly
desc ibed species. We used i e di e en molecula ma ke s: he en i e mi ochond ial p o ein-coding
gene o he cy och ome c oxidase subuni I (COI), he pa ial mi ochond ial ibosomal 12S RNA gene,
he pa ial nuclea p o ein-coding genes PGD and AATS, and he pa ial nuclea ibosomal 28S RNA
gene. Fu he mo e, he p esen s udy uses a mode n mo phological analysis (e.g., by including SEM
imaging) in he ( e)desc ip ion o he a ge axa, including in he desc ip ion o he male o T. piel aini,
and a lec o ype o T. pandellei is designa ed. Addi ionally, we conside ably imp o e he knowledge on
he geog aphic dis ibu ion o hese species as well as p o ide new obse a ions on ma ing beha iou .
This esea ch has he o e all aims o : i) desc ibing new ligh less an -like Ibe ian species; ii) in e ing
he phylogene ic ela ionships among he ligh less an -like Ibe ian species; iii) unde s anding he
phylogene ic ela ionship be ween Tachyd omia and he species p e iously placed in gene a Piel ainia
and A iasella; and inally i ) shedding ligh on he wing e olu ion o he an -like Ibe ian species.
Ma e ial and me hods
Sampling, species dis ibu ion and specimen deposi ion
Specimens we e manually collec ed wi h a ial a e being di ec ly sea ched o on he lea li e .
A e wa ds, hey we e p ese ed ei he d y-moun ed, in 70% e hanol o absolu e e hanol ( o molecula
analysis). In he cases whe e ype ma e ial is los , species we e iden i ied based on he illus a ions and
on he o iginal desc ip ions p e iously published (A ias 1919; Gil 1923, 1936; Séguy 1941; Plan &
Deeming 2006; G oo ae e al. 2009). In mos cases, addi ional specimens we e collec ed a hei ype
locali ies o e y close by. Dis ibu ion da a was compiled om published eco ds and based on ecen
sampling e o s. Se e al sampling expedi ions ook place ac oss he Ibe ian Peninsula and he Py enees
(Fig. 1) as well as he Apennine Moun ains, mos ly om Janua y o July (2013–2018). His o ical and
new occu ence eco ds we e plo ed using QGIS e . 2.18.16, wi h he coo dina es p ojec ed in he
e e ence sys em Mad id 1870 (Mad id), code 4903. The as e map da ase (Na u al Ea h II wi h
Shaded Relie , Wa e , and D ainages) was ob ained om h ps://www.na u alea hda a.com.
The abb e ia ions o he specimen eposi o ies a e:
NHMUK = The Na u al His o y Museum, London, Uni ed Kingdom
NMWC = Na ional Museum o Wales, Ca di , Uni ed Kingdom
RBINS = Royal Belgian Ins i u e o Na u al Sciences, B ussels, Belgium
ZFMK = Zoologisches Fo schungsmuseum Alexande Koenig, Bonn, Ge many
Specimens no assigned o a o mal eposi o y a e placed in he i s au ho ’s collec ion.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
4
Mo phological analysis
Te ms used o adul s uc u es ollow hose o Cumming & Wood (2017). Male e minalia we e
mace a ed in ho (a ound 90°C) 10% KOH o 10 minu es and le a oom empe a u e o se e al hou s,
clea ed in e hanol and imme sed in glyce ine o long- e m p ese a ion. D awings o he e minalia
we e made wi h a came a lucida a ached o a Lei z Labo lux 12 compound mic oscope. D awings o
he wing we e made based on di ec obse a ion by using a s e eo mic oscope, S eREO Luma .V12
(Ca l Zeiss Mic oImaging). Images o minu e wings and spu s we e ob ained using a scanning elec on
mic oscope JSM-5200LV (JEOL, L d). Pho og aphs o pinned specimens we e aken wi h a Canon EOS
7D moun ed on a P-51 Cam-Li (Dun Inc.) and expo ed wi h he help o Adobe Ligh oom ( e . 5.6).
A e wa ds, he images we e s acked using he so wa e Ze ene S acke e . 1.04. Pho og aphs o li e
specimens we e aken wi h a Fuji ilm FinePix HS10, wi h a Raynox DCR-250 mac o lens.
The body leng h was measu ed om he ons o he end o he e minalia in la e al iew. The wing
leng h was measu ed om he wing ip o i s base. Measu emen s we e aken using d ied specimens. In
he desc ip ions, he igh and le side o he male e minalia a e based on he un o a ed posi ion iewed
pos e io ly, such ha in he illus a ions he igh su s ylus appea s on he eade ’s le side and ice
e sa. All male e minalia a e igu ed in hei un o a ed posi ion.
Fig. 1. Cu en ly known dis ibu ion o he Ibe ian an -like Tachyd omia Meigen, 1803. Each do
ep esen s a p esence poin , wi h each colou co esponding o a di e en species. When wo species
co-occu in he same a ea, hei p esence is ep esen ed by a smalle do on op o a do o egula
dimension, each o hose wi h he colou co esponding o he co-occu ing species. The do s su ounded
by a black ci cle wi h a e ical line ep esen locali ies p e iously known.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
5

Wing educ ion e minology in Dip e a
Hackman (1964) p oposed a e minology ega ding he deg ee o wing educ ion in Dip e a. B achyp e ous
means educed wing, sho e han abdomen, b oad and mo e o less blun , no pe mi ing ligh , wi h a
leas adial eins dis inc . S enop e ous a e specimens wi h wings e y na ow bu some imes long, no
pe mi ing ligh , wi h a leas adial eins dis inc . Mic op e ous a e species wi h wing educed o small
appendage o a ying shape wi h a mos aces o he adial ein. And, inally, ap e ous species ha e
wings a mos ep esen ed by a minu e scale, a mos ca ying some se ae o o ally absen . Recen ly,
Roháček (2012) added he e m submac op e ous o species wi h wings simila ly shaped, including
ena ion, as in no mal mac op e ous specimens, bu dis inc ly sho e , da ke , abou as long as he
abdomen. He e, we p opose an emenda ion o his e minology whe e he e m mic op e ous assumes
a mo e inclusi e de ini ion: wing educed o a small appendage, s ub o minu e scale, o a ying shape
wi h a mos aces o he adial eins p esen . Fu he mo e, we change he e m ap e ous, wi h i s
de ini ion being es ic ed o wings o ally absen , wi hou any aces o i s p esence.
Obse a ions on ma ing beha iou
Obse a ions in cap i i y we e made o Tachyd omia semiap e a (popula ion o Spain, Cáce es, Las
Villue cas) and Tachyd omia ibe ica (popula ion o Po ugal, Lei ia, A imal). These species we e
selec ed because o hei le el o wing educ ion: he o me species is s enop e ous, wi h e y lexible
s alk-like wings (in opposi ion o he igid wings o he o he s enop e ous Ibe ian an -like species);
and he la e is ap e ous. The ma ing beha iou o a s enop e ous species wi h igid s alk-like wings,
T. lusi anica, was desc ibed by And ade (2011). Specimens we e kep in a small e a ium (27 ×
15 × 17 cm), wi h a sec ion o 4 cm deep soil, including lea li e . In wo sepa a ed ins ances, each
species (10 ♂♂, 10 ♀♀) was kep and obse ed o i e consecu i e days. Obse a ions we e made
using a Fuji ilm FinePix HS20 EXR, wi h a Raynox DCR-250 mac o lens. Specimens o Scia idae we e
o e ed as a ood sou ce. To es in aspeci ic in e ac ions in p e-de ined condi ions (e.g., quan i y o
specimens, sex), specimens we e empo a ily aken om he e a ium and pu inside anspa en plas ic
ials. Va ious ypes o in e ac ions we e obse ed bu he e, only he ma ing beha iou is desc ibed
because o i s ele ance o help unde s and he e olu iona y impo ance o wing educ ion/modi ica ion.
These obse a ions we e aimed a ob aining quali a i e desc ip ions o beha iou .
Molecula analysis
Taxon sampling
The axon sampling included 35 specimens belonging o 31 di e en species: 30 Hybo idae and one
Empididae La eille, 1809. We sequenced and analysed o he i s ime nine species o Tachyd omia,
namely eigh Ibe ian an -like Tachyd omia as well as Tachyd omia ap e ygon. In o he wo ds, he analysis
co e ed all he nine p e iously desc ibed and newly desc ibed species o he Ibe ian ligh less an -like
Tachyd omia. Addi ionally, i included ou mac op e ous and one ap e ous species o Tachyd omia
assigned o h ee species-g oups sensu Ch ála (1970): he e icola, connexa and a ogans g oups. The
abo emen ioned axa cons i u e he ing oup. Rep esen a i es o each o he six sub amilies o Hybo idae
we e included as ou g oups, as we e he ibes wi hin Tachyd omiinae sensu Sinclai & Cumming (2006).
Empis essella a Fab icius, 1794 (Empididae) was used o oo he ee. Table 1 lis s he species included
in he analysis, as well as he collec ion da a. The samples we e made a ailable ei he by ob aining
eshly collec ed specimens o om he Ge man Ba code o Li e (GBOL) DNA collec ion p ese ed in
he ZFMK BioBank.
Molecula ma ke selec ion
Th ee nuclea genes (28S, PGD, AATS) and wo mi ochond ial genes (COI and 12S) we e selec ed
o be sequenced. The choice o hese genes was based on hei di e en e olu iona y a es and on he
exis ence o p ime s (Table 2) used in g oups o insec s, including some speci ic o Dip e a.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
6
Species
DNA ouche
ZMFK Label in o ma ion GBOL ca alogue
numbe COI–5’ COI–3’ 28S AATS 12S PGD
Tachyd omia
ebeje i sp. no . AR01 Po ugal: Sabugal, 1 Ap . 2017.
Leg: A. Gonçal es & R. And ade – X X X X X X
Tachyd omia
s enop e a sp. no . AR02
Po ugal: Gua da, Adão,
1 Ap . 2017.
Leg: A. Gonçal es & R. And ade
– X X X X X X
Tachyd omia
nig ohi a sp. no . AR03 Spain: Salamanca, El Maíllo,
25 Ap . 2017. Leg: A. Gonçal es – X X X X X –
Tachyd omia
lusi anica AR04 Po ugal: Fa e, Felguei as,
9 Ap . 2017. Leg: R. And ade – X X X X X X
Tachyd omia
pandellei AR05
F ance: Hau es-Py énées,
A ens-Ma sous, A ens,
Rou e d’As e, 19 Jun. 2017.
Leg: A. Gonçal es & E. Ma abu o
– X X X X X X
Tachyd omia
semiap e a AR06
Spain: Á ila, El Ba aco,
13 Ap . 2016.
Leg: A. Gonçal es & R. And ade
– X X X X X X
Tachyd omia
ibe ica AR07
Spain: Mad id, A oyo de la
Fuen ecilla (La Hi uela),
23 Ap . 2017. Leg: A. Gonçal es
– X X X X X X
Tachyd omia
ibe ica AR08
Po ugal: Po o de Mós, A imal,
11 Ma . 2017.
Leg: A. Gonçal es & F. Ba os
– X X X X X X
Tachyd omia
ibe ica AR09
Spain: Badajoz, Ten udía,
3 Ap . 2015.
Leg: A. Gonçal es & R. And ade
– X X X X X X
Tachyd omia
ap e ygon AR10
I aly: F osinone, San Dona o Val
di Comino, 26 Jun. 2017.
Leg: A. Gonçal es & R. And ade
– X X – – X X
Empis
essella a AR11
Po ugal: Lisboa, Monsan o,
1 Ma . 2017.
Leg: A. Gonçal es & S. Ma ins
– X X X X X –
Hybos
emo a us AR12 Ne he lands.
Leg. Ruud an de Weele – X X X X X –
D ape is
ephippia a AR13 Ne he lands.
Leg. Ruud an de Weele – X X X X – X
S ilpon sp. AR14 Po ugal: A ei o, Sal eu.
Leg. R. And ade – X X X X X –
Symballoph halmus
usci a sis
AR15 Belgium.
Leg. P. G oo ae – X X X – X X
Tachyd omia
can ab ica sp. no . AR16
Spain: Palencia, Río Ca ión,
14 May 2014.
Leg: A. Gonçal es & R. And ade
– X X X X X –
Tachyd omia
piel aini AR17 Spain: As u ias, Cangas de Onís,
9 Ap . 2016. Leg: A. Gonçal es – X X X X X X
Tachyd omia
connexa AR18 Uni ed Kindgom – X X X X X X
Tachyd omia
a ogans AR19 Belgium.
Leg. P. G oo ae – X X X X X X
Tachyd omia
umb a um AR20 Ne he lands.
Leg. Ruud an de Weele – X X X X X X
Tachyd omia
umb a um AR21 Ne he lands.
Leg. Ruud an de Weele – X X X X X X
O opezella
sphenop e a AR22 No way ZFMK–TIS–
2547243 X X X – – –
Oedalea
hybo ina AR24 Finland ZFMK–TIS–
2580838 X X X – – –
Bicella ia
in e media AR25 Finland ZFMK–TIS–
2580874 X X X X X X
Pla ypalpus
pec o alis AR26 Finland ZFMK–TIS–
2580880 X X X X X X
Tachypeza
unco um AR28 Finland ZFMK–TIS–
2586890 X X X – – –
T ichina
cla ipes AR29 Ge many ZFMK–TIS–
2593538 X X X – – X
Table 1 (con inued on nex page). Taxon sampling used in he molecula analysis. The c oss (X) deno es
success in ob aining a sequence o he espec i e molecula ma ke .
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
7
DNA ex ac ion and sequencing
En i e specimens, e hanol p ese ed and s o ed a -20°C, we e used o DNA ex ac ion. Ex ac ions
we e ca ied ou on comple e specimens using he Dneasy Blood & Tissue Ki (Qiagen, Valencia, CA,
USA) o ex ac o al nucleic acids ollowing he manu ac u e ’s ins uc ions; samples we e esuspended
in 50–100 µl ul a-pu e wa e ins ead o in he supplied elu ion bu e . En i e specimens we e p ese ed
and labelled as DNA ouche specimens o he pu pose o mo phological s udies and deposi ed in
ZFMK. The Qiagen Mul iplex PCR Ki (Qiagen, Valencia, CA, USA) was used o ca y ou he PCRs.
PCRs (20 µl) included 2.5 µl DNA ex ac , 1.6 µl o each p ime (a 10 pmol/µl), 2 µl o Q-solu ion,
10 µl o Qiagen Mul iplex-Mix and 2.3 µl o ul a-pu e wa e . PCR ampli ica ions we e ca ied ou wi h
a Biome a PCR The mal Cycle . PCR ‘ ouchdown’ p og ams a e lis ed in Table 3, p ime s used o
ampli ying and sequencing he molecula ma ke s a e lis ed in Table 4. Ampli ied DNA was isualized
on 1.5% aga ose gels o inspec ion o ampli ied p oduc s. PCR p oduc s we e cleaned up using he
comme cially a ailable QIAquick PCR Pu i ica ion Ki (Qiagen, Valencia, CA, USA). Bi-di ec ional
Sange sequencing eac ions we e ca ied ou by Mac ogen Inc. using he same p ime pai s as hose
used o PCR eac ion.
Species
DNA ouche
ZMFK Label in o ma ion GBOL ca alogue
numbe COI–5’ COI–3’ 28S AATS 12S PGD
Tachyd omia
e icola AR30 Finland ZFMK–TIS–
2593583 X X X X X X
Tachypeza
nubila AR31 Ne he lands.
Leg. Ruud an de Weele – X X X – X –
T ichina
biloba a AR32 Ge many ZFMK–TIS–
2513222 X X X X X X
Pla ypalpus
pseudo lu ipes AR33 Finland ZFMK–TIS–
2593700 X X X X X X
Bicella ia
sulca a
AR34 Ge many ZFMK–TIS–
2601004 X X X X – –
Oedalea
ze e s ed i AR35 Ge many ZFMK–TIS–
2595873 X X X – X X
Tachypeza
unco um AR36 Finland ZFMK–TIS–
2586890 X X X – – X
C ossopalpus
sp. AR37 Po ugal: A ei o, Sal eu. Leg.
R. And ade – X X X X – X
Table 1 (con inued).
Table 2. P ime s used o ampli ying and sequencing he molecula ma ke s.
Gene P ime ’s name Sequence Re e ence
COI-5’ LCO-1490 GGTCAACAAATCATAAAGATATTG Folme e al. 1994
COI-5’ HCO-2198 TAAACTTCAGGGTGACCAAAAAATCA Folme e al. 1994
COI-3’ COI-Dip -283F CARCAYYTATTYTGATTTTTTGG Gibson e al. 2011
COI-3’ TLS-N-3014 (Pa ) TCCAATGCACTAATCTGCCATATTA Simon e al. 1994
PGD PGD-2F ATHGARTAYGGNGAYATGCA Regie 2008
PGD PGD-3R GTRTGNGCNCCRAARTARTC Be one e al. 2008
28S 28s-D1F TGTAAAACGACGGCCAGTCCCCCTGAATTTAAGCATAT Jemu 2011
28S 28s-D2R CAGGAAACAGCTATGACGTTAGACTCCTTGGTCCGTG Jemu 2011
12S 12S bi AAGAGCGACGGGCGATGTGT Simon e al. 1994
12S 12S ai AAACTAGGATTAGATACCCTATTAT Simon e al. 1994
AATS AATS-1F40 GNATGAAYCARTTYAARCCNAT Su e al. 2008
AATS AATS-1R244 CATNCCRCARTCNATRTGYTT Su e al. 2008
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
8
Reac ions o 20 μl
H2O 2.3
Q-Solu ion 2
Qiagen Mul iplex-Mix 10
P ime A (10 pmol/μl) 1.6
P ime B (10 pmol/μl) 1.6
DNA 2.5
COI
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 95 15:00
Dena u a ion 94 00:35 25
Annealing 55 01:30 25
Elonga ion 72 01:30 25
Final Elonga ion 72 10:00
Cooling 10 ∞
PGD
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 95 15:00
Dena u a ion 95 00:30 36
Annealing 50 01:00 36
Elonga ion 72 01:00 36
Final Elonga ion 72 10:00
Cooling 10 ∞
28S
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 95 15:00
Dena u a ion 94 00:35 40
Annealing 60 01:30 40
Elonga ion 72 01:30 40
Final Elonga ion 72 10:00
Cooling 10 ∞
AATS
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 95 15:00
Dena u a ion 95 00:30 38
Annealing 50 01:00 38
Elonga ion 72 01:00 38
Final Elonga ion 72 10:00
Cooling 10 ∞
12S
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 94 01:30
Dena u a ion 94 00:45 38
Annealing 50 01:00 38
Elonga ion 74 02:00 38
Final Elonga ion 74 05:00
Cooling 10 ∞
Table 3. De ailed PCR p o ocols o each molecula ma ke .
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
9
18. Palpi yellow in g ound colou ; wing bilobed, oundish, apical ma gin o pos e io lobe bea ing one
long se a, an e io lobe bea ing h ee sho e se ae ..............................................................................
............................................................................... Tachyd omia ap e ygon Plan & Deeming, 2006
– Palpi black in-g ound colou ; wing as single lobe, oundish, bea ing one long se a and one sho se a
on apical ma gin (Fig. 21E) ........................................ Tachyd omia semiap e a (Gil Collado, 1923)
19. Fou p escu ella se ae and ou scu ella se ae; wing as single lobe, usually longe han wide, a mos
wi h single dis inc se a p esen (Fig. 20B); coxae, emo a and mos o ibia da k b own o black;
ochan e s, knee, an e o en al su ace o ibia, dis al ¼ o a some e 1, dis al hal o a some e 2
and ollowing a some es, yellowish ...................................................................................................
.........................................................Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no .
– Di e en numbe o p escu ella and scu ella se ae; wing biloba e, oundish, wi h dis inc se ae
(Figs 20D, F, H, 21G) ...................................................................................................................... 20
20. Te gi es wi h ew and sca e ed se ae, mos ly p esen on pos e oma ginal su ace and nea spi acles;
s e ni es wi h e enly dis ibu ed se ae; legs almos comple ely black, excep ing e y small b own
po ions, speci ically: en al and do sal pos e io su aces o coxae, ochan e , basal en al su ace
o emo a and knees ...................Tachyd omia s enop e a Gonçal es, G oo ae & And ade sp. no .
– Te gi es and s e ni es wi h e enly dis ibu ed se ae; legs wi h di e en colou pa e n o black and
yellow o b own ............................................................................................................................... 21
21. Pos p ono al lobe bea ing ca 4 se ae la e ally; wings biloba e, bea ing one se a on apical ma gin
o each lobe (Fig. 20D); legs black wi h ollowing segmen s pale b own/yellowish: apical
po ion o coxae, ochan e s, basal po ion o mid and hind emo a, dis al apical su ace o
o e and mid emo a, knees, basal su ace o a some e 1 and basal ⅔ su ace o a some e
2 ................................................Tachyd omia can ab ica Gonçal es, G oo ae & And ade sp. no .
– Pos p ono al lobe bea ing mo e han 4 se ae la e ally; wings biloba e, bea ing mo e han wo se ae
on bo h lobes combined (Fig. 20F, H); legs wi h a di e en colou pa e n .................................... 22
22. Legs black, excep o ochan e s, knees and a some es 1 and 2 yellowish o b own ......................
...................................................Tachyd omia nig ohi a Gonçal es, G oo ae & And ade sp. no .
– Legs black wi h ollowing segmen s yellowish-b own: coxa, ochan e , knee, an e io and en al
su ace o o e and mid emo a, base o o e and mid ibia, basal 4/5 su ace o a some e 1, basal su ace
⅔ o mid and hind a some e 2 ....Tachyd omia lusi anica (G oo ae , Shamshe & And ade, 2009)
Gene al diagnosis o he Ibe ian and I alian an -like species o Tachyd omia
The Ibe ian and I alian an -like Tachyd omia species can be join ly cha ac e ized by lacking hal e es
and unc ional wings (ap e ous, mic op e ous o s enop e ous). Conside ing hei o e all mo phology
(e.g., shape and colou a ion o palpus and pubescence o legs), i can be said ha Ibe ian species a e
gene ally mo e ela ed o he a ogans species g oup han o any o he ; howe e , a ious species di e
om his g oup in ha ing a sho e s ylus 1.5 imes as long as he an enna (T. semiap e a, T. piel aini
and T. pandellei) and/o o ha ing male geni alia la ge and globula (T. s enop e a sp. no .). Plan &
Deeming (2006) sugges ed ha T. ap e ygon is mo e ela ed o e icola g oup. They a e quick and
agile unne s and o en mo e hei abdomens up and downwa ds, esembling an s o ce ain ligh less
pa asi ic wasps.
Tachyd omia ap e ygon Plan & Deeming, 2006
Figs 3, 16I–J, 19J, 22–24
Tachyd omia ap e ygon Plan & Deeming, 2006: 13 (male only).
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
16

Diagnosis
Small (leng h = 2 mm), slende , o e all da k, wi h minu e bilobed squami o m wings (Fig. 22) in bo h
sexes and hal e es absen . F ons, e ex and occipu la gely co e ed by g ey mic o ichia; 1 pai o
la e oclina e ocella s; 1 pai o p oclina e e icals; palpi pale yellow, an ennae wi h scape and pedicel
yellow, pos pedicel b own; p oboscis shiny black; pos pedicel sub-conical, simila leng h as o pedicel.
Tho ax black wi h po ion o epis e num densely co e ed wi h g ey mic o ichia. Legs wi h colou
pa e n o yellowish and da k b own o black; o e ibia wi h cilia ion o sho coa se se ae. Mid ibia
wi h an e o en al spu a apex, p oduced in o sho apical elonga ion, abou as long as diame e o ibia
a apex (Fig. 19J); spu wi h se e al dis inc se ae and, on dis al hal ma gin, a ew sho , s ou , cu ed
spinose se ae. Abdomen black, co e ed wi h g ey mic o ichia and sho se ae, longe a hind ma gin o
las s e ni e.
Type ma e ial examined
Holo ype
ITALY • 1 ♂; Lazio, 10 km sou h o Fo ca d’Ace o, on oad o So a; 1 Jul. 2005; J.C. Deeming leg.;
NMWC.
Addi ional ma e ial examined
ITALY • 5 ♂♂, 10 ♀♀; F osinone, San Dona o Val di Comino; 41°43′58.7″ N, 13°49′12.2″ E; 26–29
Jun. 2017; A.R. Gonçal es and R. And ade leg. • 2 ♂♂; L’Aquila, Gioia dei Ma si, Pa co Nazionale
D’Ab uzzo Lazio e Molise; 41°51′34.0″ N, 13°46′52.1″ E; 26–29 Jun. 2017; A.R. Gonçal es and
R. And ade leg. • 19 ♂♂, 13 ♀♀; L’Aquila, Pacen o; 42°02′56.7″ N, 14°02′51.7″ E; 26–29 Jun. 2017;
A.R. Gonçal es and R. And ade leg. • 18 ♂♂, 14 ♀♀; Pesca a, San ’Eu emia a Maiella; 42°06′01.2″ N,
14°02′10.5″ E; 26–29 Jun. 2017; A.R. Gonçal es and R. And ade leg. • 13 ♂♂, 13 ♀♀; L’Aquila, O ena;
42°23′06.1″ N, 13°45′37.8″ E; 26–29 Jun. 2017; A.R. Gonçal es and R. And ade leg. • 2 ♂♂; Pesca a,
Fig. 3. Te minalia o Tachyd omia ap e ygon Plan & Deeming, 2006 om I aly, Lazio, Pos a (RBINS).
A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial lamella and
le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
17
Fa indola; 42°23′45.7″ N, 13°47′06.8″ E; 26–29 Jun. 2017; A.R. Gonçal es and R. And ade leg. •
2 ♂♂, 3 ♀♀; Lazio, Leonessa; 42°30′59.3″ N, 12°59′10.9″ E; 26–29 Jun. 2017; A.R. Gonçal es and
R. And ade leg.; ZFMK • 4 ♂♂, 3 ♀♀ (all male e minalia s udied, RBINS); Lazio, Pos a; 42°31′51.2″ N,
13°03′37.4″ E; 26–29 Jun. 2017; A.R. Gonçal es and R. And ade leg.
Desc ip ion
Female (p e iously undesc ibed)
Simila o male. Mic op e ous, wing ound, b ownish, biloba e, apical ma gin o pos e io lobe bea ing 1
long se a, an e io lobe bea ing 3 sho e se ae, lobes co e ed wi h g ey mic o ichia. Di e s om male
in ollowing: legs mainly co e ed wi h mic o ichia and egula ows o se ae; spu on mid ibia absen ;
ce cus pale b own wi h g ey mic o ichia and long se ae; a ew longe se ae on apical s e ni es.
Dis ibu ion and habi a
I aly. Cu en ly, his species is only known om he cen al Apennine Moun ains (Fig. 23). I occu s on
he edge o o es s o Fagus syl a ica L. (Fig. 24), on he lea li e and sho he baceous ege a ion,
whe e i can be abundan . I has also been ound in mixed deciduous woodland a lowe al i udes, inside
he o es , on he lea li e .
Rema ks
Despi e he sampling e o a he end o July, he species was no ound a he mixed deciduous woodland
ype locali y. Howe e , i was s ill e y abundan a highe al i udes. The ype specimen was collec ed
a he beginning o July, so by he end o he mon h, i may al eady be oo ho and d y o his species o
su i e a lowe al i udes.
Tachyd omia can ab ica Gonçal es, G oo ae & And ade sp. no .
u n:lsid:zoobank.o g:ac :1F27952E-DD08-44E5-AF55-39019FD06488
Figs 1, 4, 15I–J, 18A–B, 19H, 20C–D
Diagnosis
O e all da k. Wing dimo phic: male s enop e ous; wing wi h lobed dis al apex, no eins dis inguishable,
da k b own o mos pa , wi h black and whi e lobe; emale mic op e ous, wing biloba e, wi h 1 se a
on each lobe. Palpi, p oboscis and an ennae black; pos pedicel sub-conical, ca 1.5 imes as long as
pedicel. Legs wi h a colou pa e n o yellowish and da k b own o black; male o e ibia wi h cilia ion
o long hai like se ae. Abdomen black, e gi es and s e ni es wi h e enly dis ibu ed se ae, co e ed wi h
g ey mic o ichia. I sha es simila i ies wi h T. nig ohi a sp. no . and T. s enop e a sp. no ., bu can be
dis inguished om hese species by he da ke leg colou a ion, lobed dis al apex o male wing wi hou
any ace o apical digi a ion, sub-conical pos pedicel, and male e minalia.
E ymology
This species is named a e he Spanish Can ab ian moun ain ange, whe e i was ound.
Ma e ial examined
Holo ype
SPAIN • 1 ♂; Palencia, Río Ca ión; 42º50′34.9″ N, 4º51′16.9″ W; 14 May 2014; A.R. Gonçal es and
R. And ade leg.; RBINS.
Pa a ypes
SPAIN • 4 ♂♂, 2 ♀♀; Palencia, Río Ca ión; 42º50′34.9″ N, 4º51′16.9″ W; 14 May 2014; A.R. Gonçal es
and R. And ade leg.; RBINS.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
18
Addi ional ma e ial examined
SPAIN • 2 ♂♂ ( e minalia s udied, RBINS); León, La Pola de Go dón; 42°51′00.5″ N, 5°39′46.0″ W;
13–14 May 2014; A.R. Gonçal es and R. And ade leg. • 1 ♀ ( e minalia s udied, RBINS); León, Boca
de Hué gano 42º56′27.3″ N, 4º54′10.0″ W; 13–14 May 2014; A.R. Gonçal es and R. And ade leg.
Desc ip ion
Male
Measu eMen s. Body leng h: 2.1–2.3 mm (n = 3). Wing leng h: 0.8–0.9 mm (n = 3).
Head. Face and ons la gely glab ous, shiny black; ocella ube cle shiny an e io ly and inely pollinose
pos e io ly. 1 pai la e oclina e ocella s, same leng h as pos pedicel, no pos e io ocella s. 1 pai p oclina e
e icals, ca ¼ sho e han leng h o pos pedicel, and nume ous se ae on occipu ; no pos ocula ciliae
p esen ; mou h ma gin co e ed by g ey mic o ichia and wi h long se ulae.
an enna. Black, co e ed by g ey mic o ichia. Scape as long as wide; pedicel wice as long as wide,
wi h apical ci cle o black se ae, en als longe ; pos pedicel sub-conical, ca 1.5 imes as long as pedicel,
wi h nume ous pale se ulae longe do sally and apically; s ylus almos wice as long as scape, pedicel
and pos pedicel combined.
PalPus. Elonga e o al, abou 3 imes as long as wide. Black in g ound colou wi h g ey mic o ichia,
do sally clo hed in s ong, long sil e y-whi e and black se ae, bea ing one s ong black sub-apical se a
sligh ly sho e han palpus; less nume ous se ae p esen en ally wi h dis inc se a on en al apex.
P oboscis. Black, mos ly glab ous, se ae p esen en ally, sligh ly la ge han palpus.
Ho ax. Elonga ed, o e all black and la gely shiny, wi h long se ae black, sho ones pale. Pos p ono al
lobe, epis e num, mesopleu on and s e nopleu on almos undi e en ia ed, scu ellum sho ; no opleu on,
Fig. 4. Te minalia o Tachyd omia can ab ica Gonçal es, G oo ae & And ade sp. no ., holo ype
(RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial
lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
19
anepis e num, ka epime on, me on and pos scu ellum well de eloped. Pleu a black, o e all glab ous
wi h de ined pa ches o g ey mic o ichia: p os e num and p o ho acic epis e num pa ially, bu densely
co e ed, appea ing sub iangula in la e al iew; ka epime on, me on, scu ellum and uppe pa o
he me a ho ax hinly co e ed. Pos p ono al lobe bea ing ca 4 se ae la e ally, no do socen als, eigh
ac os ichal se ae, bise ia e, o equal leng h; no opleu on wi h 1 s ong, p ominen , se a plus 2 small
se ae; 4 small, incu a ed, p escu ella se ae; scu ellum bea ing 2 s ong, long se ae medially; 1 p e-ala
se a.
Wing. S enop e ous. Lobed dis al apex, subo al, wi h minu e digi a ion. S alk-like po ion da k b own,
dis al ⅔ o lobe black wi h basal ⅓ and digi a ion anslucid (appea ing whi e unde mos ligh condi ions)
(Fig. 20C). No eins dis inguishable. Uni o mly co e ed in mic o ichia.
legs. Fo e emu s ou and in la ed basally, mid emu less so and hind emu leas . Black wi h he
ollowing pale b own/yellowish: basal po ion o coxae, ochan e s, basal po ion o mid and hind
emo a, dis al apical su ace o o e and mid emo a, knees, basal 4/5 su ace o a some e 1 and basal
⅔ su ace o a some e 2. Legs mos ly co e ed wi h egula ows o nume ous black and pale se ulae,
excep o coxae, ochan e s and pos e o en al su ace o emo a; an e o en al su ace o coxae,
emo a (excep mos o en al su ace) and ibiae co e ed by g ey mic o ichia; coxae wi h se e al
sho , downwa d di ec ed, do sal an e oapical se ae. Femo a wi h a ew dis inc apical se ae. Fo e ibia
bea ing spa se cilia ion o hai -like se ae (sho e han maximum diame e o ibia) wi h sligh ly cu ed
ips, and ow o long, e ec , se ae p esen a i s dis al ⅓ pos e odo sal su ace. Ta some e 1 o o e a sus
wi h s ong and long ( wice a some e 1 wid h) se ae; a pos e io dis al su ace wi h ow o dis inc ,
sho , black se ae. Mid ibia wi h spu a an e o en al apex, wi h ba ely no iceable apical elonga ion,
abou as long as diame e o ibia a apex (Fig. 19H); spu has se e al dis inc se ae and, on dis al hal
ma gin, i e sho , s ou , cu ed, spinose se ae.
abdoMen. Black, uni o mly co e ed wi h g ey mic o ichia. Te gi es and s e ni es wi h e enly dis ibu ed
se ae; apical s e ni es wi h long, dis inc se ae.
e Minalia (Fig. 4). Subglobula , mos ly co e ed wi h g ey mic o ichia, da k b own. Righ su s ylus
sho wi h an e io ma gin p oduced in o sho slende p ojec ion, mos ly glab ous, wi hou mic o ichia,
bea ing s onge se ae mos ly on do sal ma gin, wi h se e al (ca 8) dis inc den icles, mos o which
agg ega ed on dis al apex. Righ epand ial lamella wi h i egula ly placed long se ae, wi h pa ch o
simila se ae on la e al su ace. Ce ci o simila leng h, bo h wi h long se ae o unequal leng h, enclosed
in epand ial lamellae. Le epand ial lamella sligh ly sho e han le ce cus, bilobed, wi h a ew long
se ulae on apical ma gin. Le su s ylus sub ec angula wi h ounded apical ma gin, 3 imes as long as
wide, dis inc i ely longe han ce cus, densely co e ed wi h g ey mic o ichia wi h equally long se ae
on apical ma gin.
Female
Simila o male, excep o ollowing ea u es: mic op e ous, wi h wings ound, b ownish, biloba e,
bea ing 1 se a on apical ma gin o each lobe, co e ed by g ey mic o ichia (Fig. 20D); legs co e ed wi h
egula ows o se ae; spu on mid ibia absen ; ce cus pale b own wi h g ey mic o ichia and se ae; no
longe se ae on apical s e ni es.
Dis ibu ion
Spain. Cu en ly only known om he Can ab ian Moun ains.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
20
Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no .
u n:lsid:zoobank.o g:ac :1FF1B253-96ED-46A8-B8EB-1822B9789B2A
Figs 1, 5, 15E–F, 17E–F, 19D, 20A–B, 25
Diagnosis
O e all da k. Mic op e ous, wi h minu e squami o m wings in bo h sexes. Palpi, p oboscis and an ennae
black; pos pedicel lanceola e, ca 1.5 imes longe han pedicel. Legs wi h a colou pa e n o yellowish
and da k b own o black; o e ibia wi h cilia ion o long hai -like se ae. Abdomen black, co e ed wi h
g ey mic o ichia and wi h dis inc , s ong, se ae on pos e io ma gin o i s s e ni e. I sha es gene al
simila i ies wi h T. can ab ica sp. no ., T. s enop e a sp. no . T. nig ohi a sp. no . and T. lusi anica,
om which i can be mainly dis inguished by mic op e y in bo h sexes - while he males o he o he
species a e s enop e ous - and male e minalia.
E ymology
The species is named a e he dip e ologis Ma in J. Ebeje o his con ibu ion o he ad ancemen o
he knowledge on Po uguese Dip e a.
Ma e ial examined
Holo ype
PORTUGAL • 1 ♂; Ma ão, San a Ma ia de Ma ão; 39º23′49.2″ N, 7º21′51.4″ W; 14 Ma . 2015;
A.R. Gonçal es and R. And ade leg.; RBINS.
Pa a ypes
PORTUGAL • 3 ♂♂, 3 ♀♀; Ma ão, San a Ma ia de Ma ão; 39º23′49.2″ N, 7º21′51.4″ W; 14 Ma .
2015; A.R. Gonçal es and R. And ade leg.; RBINS • 2 ♂♂, 2 ♀♀; same collec ion da a as o p ecedcing;
ZFMK.
Addi ional ma e ial examined
PORTUGAL • 5 ♂♂, 1 ♀ (all male e minalia s udied, RBINS); Gou eia, Aldeias; 40º28′05.4″ N,
7º35′15.7″ W; 25 Ap . 2013; A.R. Gonçal es and R. And ade leg. • 3 ♂♂, 4 ♀♀ (all male e minalia
s udied, RBINS); A ganil, Ben ei a (Ma a da Ma ga aça); 40º12′59.6″ N, 7º55′12.5″ W; 22 Feb. 2014;
A.R. Gonçal es leg. • 10 ♂♂, 8 ♀♀; Ma ão, San a Ma ia de Ma ão; 39º23′49.2″ N, 7º21′51.4″ W;
14 Ma . 2015; A.R. Gonçal es and R. And ade leg. • 4 ♂♂, 10 ♀♀; Gua da, Gou eia, São Cosmado;
40°28′4.49″ N, 7°35′25.18″ W; 20 Ap . 2015; A.R. Gonçal es leg. • 1 ♀ ( e minalia s udied, RBINS);
Gua da, Seia, Al oco da Se a; 40°18′03.4″ N, 7°41′22.6″ W; Ap . 2015; A.R. Gonçal es leg. • 1 ♂, 2 ♀♀
(all male e minalia s udied, RBINS); Gua da, Gou eia, Aldeias (Ei as); 40°28′26.5″ N, 7°35′49.6″ W;
20 Ap . 2015; A.R. Gonçal es leg. • 3 ♂♂, 4 ♀♀; Vila Real, Lamas de Ôlo; 41º22′27.6″ N, 7º48′23.7″ W;
30 Ap . 2016; R. And ade leg. • 4 ♂♂, 4 ♀♀; Mondim de Bas o, E melo; 41º22′44.0″ N, 7º51′14.4″ W;
30 Ap . 2016; R. And ade leg. • 1 ♂, 3 ♀♀; Cas o Labo ei o; 42º00′09.3″ N, 8º10′09.6″ W; 29 May
2016; R. And ade leg. • 4 ♀♀; Viseu, Pó oa Dão; 40°33′03.9″ N, 7°57′05.6″ W; 18 Ma . 2017; J.
Almeida leg. • 1 ♂, 1 ♀; Vouzela, Campia; 40°40′53.0″ N, 8°13′18.5″ W; 21 Ma . 2017; E. Ma abu o
leg. • 3 ♂♂, 1 ♀; Gua da, Panóias de Cima; 40°29′10.2″ N, 7°13′18.4″ W; 1 Ap . 2017; A.R. Gonçal es
and R. And ade leg. • 3 ♂, 2 ♀♀; Sabugal, Sabugal; 40°20′39.9″ N, 7°04′18.6″ W; 1 Ap . 2017; A.R.
Gonçal es and R. And ade leg. • 1 ♂, 2 ♀♀; Sabugal, Quad azais; 40°18′30.6″ N, 6°59′08.7″ W; 1 Ap .
2017; A.R. Gonçal es and R. And ade leg. • 1 ♂, 5 ♀♀; Gua da, Adão; 40°27′03.0″ N, 7°09′41.8″ W;
1 Ap . 2017; A.R. Gonçal es and R. And ade leg. • 4 ♂♂, 2 ♀♀; Fa e, Felguei as; 41°31′24.0″ N,
8°06′01.2″ W; 9 Ap . 2017; R. And ade and J. Almeida leg. • 1 ♂; Fa e, T a assós; 41°30′06.4″ N,
8°10′55.6″ W; 9 Ap . 2017; R. And ade and J. Almeida leg. • 3 ♂♂, 7 ♀♀; Coimb a, Lousã, Ca a edo ;
40°04′20.9″ N, 8°13′04.2″ W; 19 Ap . 2017; A.R. Gonçal es and D. Rod igues leg.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
21

SPAIN • 10 ♂♂, 21 ♀♀ (all male e minalia s udied, RBINS); Ou ense, Viana do Bolo; 42º09′06.2″ N,
7º07′12.3″ W; 11 May 2014; A.R. Gonçal es and R. And ade leg. • 3 ♀♀ (all male e minalia s udied,
RBINS); Ou ense, O Bolo; 42º15′03.2″ N, 7º06′46.9″ W; 11 May 2014; A.R. Gonçal es and R. And ade
leg. • 8 ♂♂, 12 ♀♀; Ou ense, A Gudiña; 42º04′14.6″ N, 7º07′47.5″ W; 11 May 2014; A.R. Gonçal es
and R. And ade leg. • 1 ♂; Mos ei o de Ca boei o; 42°45′18.8″ N, 8°14′46.6″ W; 6 May 2018; A.R.
Gonçal es leg. • 3 ♂♂, 2 ♀♀; Galiza, Ou ense, Piño ; 42°31′17.3″ N, 8°00′14.3″ W; 7 May 2018; A.R.
Gonçal es leg.
Desc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
Male
Measu eMen s. Body leng h: 1.9–2.4 mm (n = 5). Wing leng h: 0.05–0.16 mm (n = 5).
Head. La e oclina e ocella s ¾ as long as pos pedicel. P oclina e e icals ca ½ as long as pos pedicel.
an enna. Pos pedicel lanceola e, ca 2 imes as long as pedicel.
Ho ax. Pos p ono al wi h ca 6 se ae la e ally, 7 ac os ichal se ae; no opleu on wi h 1 s ong, p ominen ,
se a plus 4 small se ae; scu ellum wi h 4 se ae medially, cen al pai long and hick, la e al hick bu
sho e .
Wing (Fig. 20A). Mic op e ous, co e ed by g ey mic oscopic se ulae, no se ae p esen .
Fig. 5. Te minalia o he holo ype o Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no .,
holo ype (RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le
epand ial lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
22
legs. Coxae, emo a and mos o ibia da k b own o black; ochan e s, knee, an e o en al su ace
o ibia, dis al ¼ o a some e 1, dis al hal o a some e 2 and ollowing a some es yellowish. Spa se
cilia ion o hai -like se ae on o e ibia sligh ly longe han maximum diame e o ibia.
abdoMen. Fi s e gi e wi h di e en ia ed, s ong pos e oma ginal se ae.
e Minalia (Fig. 5). Righ su s ylus co e ed wi h long se ulae, wi hou mic o ichia, bea ing s onge
se ae mos ly on do sal ma gin, wi h se e al (ca 10) dis inc den icles, ⅔ o which agg ega ed on dis al
apex. Righ ce ci wi h b oad ip, le na owing dis ally, bo h wi h long se ae o unequal leng h on apical
hal , enclosed in epand ial lamellae. Le epand ial lamella ⅔ as long as le ce cus. Le su s ylus 2
imes as long as wide, longe han ce ci, wi h sho se ae o equal leng h on apical ma gin.
Female
Simila o male, including being mic op e ous (Fig. 20B), excep o ollowing ea u es: no dis inc i e
hai s o se ae on o e emu ; spu on mid ibia absen ; ce cus pale b own wi h g ey mic o ichia and
se ae; no longe se ae on apical s e ni es.
Dis ibu ion
Po ugal and Spain. Mos ly dis ibu ed in he no hwes e n Ibe ia (No h and Cen al Po ugal and
Galicia), wi h jus one locali y sou h o he Tagus i e (San a Ma ia de Ma ão).
Tachyd omia ibe ica (A ias, 1919)
Figs 1, 6–8 16A–B, 18C–D
Piel ainia ibe ica A ias, 1919: 479 (male and emale).
Tachyd omia ibe ica Shamshe & G oo ae 2018: 425 (comb. no .).
Diagnosis
P edominan ly da k and glab ous. Wings, o any aces o i , absen . Palpi, p oboscis and an ennae
black. Pos pedicel subconical, 2 imes longe han pedicel; s ylus 2 imes as long as scape, pedicel and
pos pedicel combined. Legs wi h da k b own o black and yellow colou pa e n. Abdomen black, e gi es
and s e ni es mos ly co e ed by g ey mic o ichia and by spa se, e y sho , se ae; apical s e ni es wi h
long, dis inc , se ae.
Type ma e ial (los )
Holo ype
SPAIN • Huel a, Cala; 22 Feb. 1915; C. Bolí a leg.
Pa a ypes
SPAIN • se e al specimens; Sego ia, San Ra ael; (sp ing) 1917; C. Bolí a leg.
Addi ional ma e ial (los )
SPAIN • se e al specimens; Mad id, El Esco ial; C. Bolí a leg. • Cuenca, Ciudad Encan ada; J.G.
Collado leg.
Ma e ial examined
SPAIN • 12 ♂♂, 7 ♀♀ (all male e minalia s udied, RBINS); Badajoz, Ten udía; 38º03′16.17″ N,
6º20′14.7″ W; 3 Ap . 2015; A.R. Gonçal es and R. And ade leg. • 5 ♂♂, 5 ♀♀; same collec ion da a
as o p eceding; ZFMK • 8 ♂♂, 13 ♀♀ (all male e minalia s udied, RBINS); Sego ia, El Espina ;
40º42′35.3″ N, 4º14′08.3″ W; 1 Ap . 2015; A.R. Gonçal es and R. And ade leg. • 3 ♂♂, 4 ♀♀ (all
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
23
male e minalia s udied, RBINS); Mad id, Mon ejo de la Sie a, P ádena del Rincón; 41°03′03.6″ N,
3°31′10.8″ W; 23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 3 ♂♂; Mad id, Mon ejo de la Sie a,
P ádena del Rincón; 41°02′40.8″ N, 3°29′28.7″ W; 23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. •
3 ♂♂, 9 ♀♀; Mad id, A oyo de la Fuen ecilla (La Hi uela); 41°04′18.0″ N, 3°27′28.2″ W; 23 Ap . 2017;
A.R. Gonçal es and P. Ál a ez leg. • 2 ♂♂, 1 ♀; Mad id, La Hi uela; 41°04′59.3″ N, 3°25′45.3″ W;
23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 2 ♂♂, 1 ♀; Guadalaja a, El Ca doso de la Sie a;
41°05′46.2″ N, 3°28′56.1″ W; 23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 6 ♂♂, 9 ♀♀; Mad id,
Pinilla de Bui ago; 40°57′02.0″ N, 3°43′11.6″ W; 24 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. •
3 ♂♂, 2 ♀♀; Mad id, Mi a lo es de la Sie a; 40°50′24.4″ N, 3°48′24.4″ W; 24 Ap . 2017; P. Ál a ez
leg. • 4 ♂♂, 5 ♀♀; Mad id, Rasca ía, Calle del Aguilón; 40°52′35.6″ N, 3°50′44.0″ W; 24 Ap . 2017;
A.R. Gonçal es and P. Ál a ez leg. • 5 ♂♂, 2 ♀♀; Mad id, Lozoya; 40°58′07.9″ N, 3°48′01.6″ W; 24
Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 3 ♂♂, 5 ♀♀; Mad id, Mi a lo es de la Sie a (Fuen e
del Cu a); 40°48′51.1″ N, 3°47′02.2″ W; 7 May 2017; P. Ál a ez leg. • 5 ♂♂, 3 ♀♀; Mad id, Mi a lo es
de la Sie a (Fuen e del Cu a); 40°49′19.2″ N, 3°47′21.5″ W; 7 May 2017; P. Ál a ez leg.
PORTUGAL • 1 ♂, 2 ♀♀ (all male e minalia s udied, RBINS); Po o de Mós, A imal; 39º31′54.6″ N,
8º52′20.7″ W; 9 Ma . 2014; A.R. Gonçal es leg. • 1 ♂; Lei ia, Pombal, Cumiei a; 39°53′33.5″ N,
8°35′53.6″ W; 18 Feb. 2017; S. Hen iques leg.; NHMUK • 10 ♂♂, 12 ♀♀ (all male e minalia s udied,
RBINS); Po o de Mós, A imal; 39º31′54.6″ N, 8º52′20.7″ W; 11 Ma . 2017; A.R. Gonçal es and F.
Ba os leg. • 4 ♂♂, 5 ♀♀; Lei ia, Pombal, Cumiei a; 39°53′33.5″ N, 8°35′53.6″ W; 18 Ma . 2017; A.R.
Gonçal es and J. Rose e leg. • 3 ♂♂, 7 ♀♀; Po o de Mós, A imal; 39º31′54.6″ N, 8º52′20.7″ W; 8
Ap . 2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg. • 15 ♂♂, 13 ♀♀; Po o de Mós, A imal;
39º31′54.6″ N, 8º52′20.7″ W; 16 Ap . 2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg. • 4 ♂♂,
6 ♀♀; Po o de Mós; 39°31′56.53″ N, 8°52′17.86″ W; 16 Ap . 2018; A.R. Gonçal es, S. Ma ins and
F. Ba os leg. • 1 ♂; Po o de Mós; 39°33′52.41″ N, 8°49′13.07″ W; 16 Ap . 2018; A.R. Gonçal es,
S. Ma ins and F. Ba os leg. • 2 ♂♂, 3 ♀♀; Po o de Mós; 39°32′20.18″ N, 8°49′22.41″ W; 16 Ap .
2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg. • 2 ♂♂, 2 ♀♀; Po o de Mós; 39°30′37.37″ N,
Fig. 6. Te minalia o Tachyd omia ibe ica (A ias, 1919) om Spain, Mad id (RBINS). A. Righ su s ylus
and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial lamella and le su s ylus.
D. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
24
8°50′3.13″ W; 16 Ap . 2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg. • 1 ♂, 2 ♀♀; Po o de Mós;
39°26′16.57″ N, 8°55′6.93″ W; 16 Ap . 2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg.
Redesc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
Male
Measu eMen s. Body leng h: 1.9–2.5 mm (n = 5).
Head. Ocella ube cle glab ous, shiny black. La e oclina e ocella s ca ½ smalle han leng h o
pos pedicel. P oclina e e icals ca ⅔ sho e han leng h o pos pedicel.
an enna. Pos pedicel 2 imes as long as pedicel.
PalPus. Less nume ous se ae p esen en ally wi h a ew dis inc se ae.
Ho ax. Scu ellum almos undis inguishable and pos scu ellum poo ly de eloped. Pos p ono al lobe
wi h ca 8 se ae la e ally, ca 8 ac os ichal se ae, i egula bise ia e, o equal leng h, and 6 simila o he
se ae placed i egula ly; no opleu on wi h 2 se ae; 2 se ae nea meso ho acic spi acle; 2 long, incu a ed
p escu ella se ae; scu ella se ae absen .
Wing. Absen .
legs. Da k b own o black wi h ollowing yellow: ochan e s, apical hal o o e and mid emo a, do sal
su ace and basal ⅓ o o e and mid ibiae, mos o a some es 1 and 2, excep o black apical ma gin.
Cilia ion o hai -like se ae absen om o e ibia. Spu absen .
Fig. 7. Te minalia o Tachyd omia ibe ica (A ias, 1919) om Spain, Sego ia, El Espina (Cen al
Sys em) (RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le
epand ial lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
25
legs. O e all yellow, excep o ollowing b own o black po ions: pos e odo sal su ace o coxae,
apical ¼ do sal su ace, pos e io and an e io su aces o hind emu , mos o hind ibia, a some e 5 o
o e and mid-legs, dis al apex o a some es 1 and 2, dis al ⅓ o a some e 3, dis al ¾ o a some es 4
and 5. Mid ibia an e o en al apical spu p oduced in o dis inc and long apical elonga ion (Fig. 19B),
longe han diame e o ibia a apex; mos ly glab ous en ally bu do sally co e ed by mic o ichia,
wi h a ew dis inc se ae and, on basal hal ma gin, 3 sho , s ou , cu ed se ae. Elonga ion mos ly
glab ous, wi h a ew se ae a ising ma ginally and apically.
e Minalia (Fig. 11). Righ epand ial lamella wi h long, e ec se ae mos ly on apical hal . Righ su s ylus
bi u ca ed in o sho p ojec ion and e y long and slende p ojec ion; mos ly glab ous bu wi h long,
cu ed la e al se ae and 2 den icle-like se ae a dis al ma gin o longe p ojec ion; sho p ojec ion wi h
simila se ae a dis al ma gin. Righ ce cus sligh ly longe han le , bo h enclosed in epand ial lamellae.
Le epand ial lamella as long as le ce cus. Le su s ylus subcylind ical, na owing p oxima ely,
4 imes as long as wide, as long as igh ce cus, wi h se ae on la e al ma gins and apical ⅓.
Female
Simila o male, excep o ollowing ea u es: s enop e ous (leng h o wing (n = 2): 0.7–0.8 mm), wi h
e y minu e lobed apex, s alk-like po ion yellowish wi h lobe ligh b own, co e ed by g ey mic o ichia
(Fig. 21C); legs co e ed wi h egula ows o se ae, wi h dis inc ci cle o se ae on o e emu and
an e oapical se ae on coxae, bu no o he dis inc i e hai s o se ae; spu on mid ibia absen ; ce cus pale
b own wi h g ey mic o ichia and se ae.
Va iabili y
The e is a a iabili y in he shape o he wing lobe in males be ween he popula ions sampled in he
F ench Py enees compa ed wi h hose om Spain. In he o me , he lobed apex is dis inc i ely la ge
and co di o m, while in he la e he lobed apex is compa a i ely smalle and o al.
Fig. 11. Te minalia o he opo ype o Tachyd omia pandellei (Séguy, 1941) om F ance, Hau es-Py énées,
A ens-Ma sous, lec o ype (RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h
ce ci. C. Le epand ial lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
32

Dis ibu ion
Spain and F ance. I is known om he F ench Py enees and a ew locali ies in he no he n Spanish
p o ince o Bu gos and he Basque Coun y.
Tachyd omia piel aini (Gil Collado, 1936)
Figs 1, 12, 16E–F, 18G–H, 19C, 21B–C
A iasella piel aini Gil Collado, 1936: 191.
Tachyd omia piel aini – Shamshe & G oo ae 2018: 425 (comb. no .).
Diagnosis
Shiny black wi h dis inc yellow pa s. Wing dimo phic: male s enop e ous; wing wi h o al apex; s alk-
like p ocess yellow o ligh b own; lobed apex wi h hyaline cells, eins and dis al ma gin black; emale
s enop e ous, s alk-like po ion yellowish wi h minu e lobed apex pale b own. P oboscis and an ennae
black; palpi yellow; pos pedicel oundish, app oxima ely as long as pedicel. Legs o e all yellow only
wi h he dis al a some es black. Abdomen black, e gi es and s e ni es o e all co e ed wi h se ae; g ey
mic o ichia p esen a las apical e gi e and mos s e ni es, esul ing in shiny appea ance o do sal
su ace.
Type ma e ial (no examined, los )
SPAIN • 1 ♀; As u ias, Po a de Enol; C. Bolí a leg.
Addi ional ma e ial examined
SPAIN • 3 ♂♂, 3 ♀♀; As u ias, Cangas de Onís, Co adonga; 43°18′42.4″ N, 5°03′28.0″ W; 26. Ap .
2011; R. And ade leg. • 2 ♂♂, 2 ♀♀; same collec ion da a as o p eceding; ZFMK • 2 ♂♂, 4 ♀♀ (all
male e minalia s udied, RBINS); As u ias, Cangas de Onís; 43º21′14.6″ N, 5º07′25.9″ W; 9 Ap . 2016;
A.R. Gonçal es leg.
Redesc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
Male (p e iously undesc ibed)
Measu eMen s. Body leng h: 2.6–2.9 mm (n = 5). Wing leng h: 0.9–1.1 mm (n = 5).
Head. Ocella ube cle glab ous. La e oclina e ocella s 2 imes as long as pos pedicel. P oclina e
e icals 1.8 imes as long as pos pedicel.
an enna. Yellow. Pos pedicel oundish, as long as wide and, app oxima ely as long as pedicel; s ylus
almos 4 imes as long as scape, pedicel and pos pedicel combined.
PalPus. Abou 4 imes as long as wide. Yellow in g ound colou .
Ho ax. Pos p ono al lobe, no opleu on, epis e num, anepis e num, s e nopleu on, ka epime on and
me on weakly di e en ia ed. Scu ellum sho , pos scu ellum longe and me ano um well de eloped.
P os e num and basal hal o epis e num densely co e ed by g ey mic o ichia. Pos p ono al lobe
bea ing 7 se ae la e ally, 5 ac os ichal se ae, i egula ly placed; no opleu on wi h 1 s ong, p ominen ,
e y long se a, plus 3 smalle ones
Wing (Fig. 21B). Lobed apex o al. S alk-like po ion igid, yellow o ligh b own; lobed apex wi h
hyaline cells, eins and dis al ma gin black. Vena ion e y educed (cos al, longi udinal and c oss eins
dis inguishable), o ming 4 cells.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
33
legs. O e all yellow, wi h he ollowing b own o black: do sal s ip on o e and mid emo a, pos e io
coxae, a some e 5 o o e and mid-legs, apical po ions o a some es 2 and 3, a some es 4 and 5 o
hind leg. Mid ochan e wi h se e al black an e o en al ma ginal se ae. Mid emu wi h small oundish
pos e o en al p ojec ion on basal su ace wi h se e al black den icle-like se ae and ca 3 black se ae.
Mid ibia an e o en al apical spu p oduced in o dis inc , long elonga ion (Fig. 19C); sligh ly longe
han diame e o ibia a apex. Spu co e ed wi h mic o ichia and > 10 sho , blun den icle-like se ae;
addi ionally, wi h 6 longe , s ou , cu ed se ae along la e al ma gin. Elonga ion mos ly glab ous wi h a
ew se ae a ising ma ginally and apically.
abdoMen. Shiny black, wi h g ey mic o ichia co e ing only las e gi e and almos all s e ni es, excep
o s e ni es 1 and 2. Te gi es and s e ni es o e all co e ed wi h se ae, excep o do sal su ace o all
e gi es and mos o s e ni e 1 (dis al ma gin wi h a ew se ae); apical s e ni e and e gi e wi h longe
se ae.
e Minalia (Fig. 12). Righ su s ylus sho wi h i egula ma gins, na owing dis ally, bea ing long
se ae, wi h se e al (ca 8) dis inc den icle-like se ae agg ega ed on dis al ma gin. Righ ce cus longe
han le . Righ ce cus wi h se ae on apical ⅓; le ce cus wi h se ae o unequal leng hs on apical hal
and 2 long apical se ae. Le epand ial lamella ⅓ sho e han le ce cus, wi h se ae o simila leng h on
apical hal o en al su ace and on apex o do sal ma gin. Le su s ylus longe han igh ce cus, wi h
e y long se ae on la e al and apical ma gins.
Female
Simila o male, excep o ollowing ea u es: s enop e ous (leng h o wing (n = 2): 0.7–0.8 mm), wi h
e y minu e lobed apex, s alk-like po ion yellowish wi h lobe ligh b own, co e ed by g ey mic o ichia
(Fig. 21C); legs co e ed wi h egula ows o se ae, wi h dis inc ci cle o se ae on o e emu and
an e oapical se ae on coxae; wi hou o he dis inc i e hai s o se ae; spu s on mid ibia absen ; ce cus
pale b own wi h g ey mic o ichia and se ae.
Fig. 12. Te minalia o Tachyd omia piel aini (Gil Collado, 1936) om Spain, As u ias, Co adonga
(RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial
lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
34
Dis ibu ion
Spain. Only known om he Picos de Eu opa moun ain ange.
Tachyd omia semiap e a (Gil Collado, 1923)
Figs 1, 13, 16C–D, 18E–F, 19E–F, 21D–E
A iasella semiap e a Gil Collado, 1923: 150 (male and emale).
Tachyd omia semiap e a – Shamshe & G oo ae 2018: 425 (comb. no .).
Diagnosis
O e all da k species wi h dis inc yellow pa s. Wing dimo phic: male s enop e ous; oblong apex; s alk-
like po ion ligh b own wi h dis inc black spo on lobed apex; emale mic op e ous, wi h wing ound,
b ownish. Palpi, p oboscis and an ennae black; pos pedicel oundish, app oxima ely as long as pedicel.
Legs wi h colou pa e n o yellowish and da k b own o black. Male legs wi h ollowing ea u es:
o e ibia black, s ou and in la ed; mid ibia bea ing wo p ojec ions and ow o i e spinose se ae on
pos e o en al basal su ace. Abdomen black, o e all co e ed wi h mic o ichia and spa se se ae; wo
apical s e ni es wi h long se ae.
Type ma e ial (no examined, los )
SPAIN • ca 20 specimens; Á ila, Valle de I uelas; May 1919; C. Bolí a leg.
Addi ional ma e ial (no examined, los )
SPAIN • Ciudad Real, Na as de Es ena; C. Bolí a leg. • Mad id, El Esco ial; C. Bolí a leg.
Ma e ial examined
Topo ype
SPAIN • 3 ♂♂, 16 ♀♀; Á ila, El Ba aco; 40º23′08.4″ N, 4º34′05.7″ W; 13 Ap . 2016; A.R. Gonçal es
and R. And ade leg.; RBINS.
Addi ional ma e ial
PORTUGAL • 2 ♂♂, 1 ♀; Mi anda do Dou o; 41°33′25.9″ N, 6°15′43.3″ W; 3 May 2015; A.R.
Gonçal es leg. • 3 ♂♂, 9 ♀♀ (all male e minalia s udied, RBINS); B agança, Cas elos; 41º50′22.1″ N,
6º53′24.2″ W; 10 May 2015; A.R. Gonçal es and R. And ade leg. • 8 ♂♂, 5 ♀♀; Ca azeda de Ansiães,
Fon elonga; 41º14′16.2″ N, 7º14′57.6″ W; 1 May 2016; R. And ade leg. • 5 ♂♂, 5 ♀♀; same collec ion
da a as o p eceding; ZFMK.
SPAIN • 10 ♂♂, 11 ♀♀ (all male e minalia s udied, RBINS); Zamo a, Alcañices; 41º41′26.9″ N,
6º21′45.1″ W; 11 May 2015; A.R. Gonçal es and R. And ade leg. • 4 ♂♂, 6 ♀♀; Toledo, Los Na alucillos;
39º36′02.0″ N, 4º42′07.0″ W; 15 Ap . 2016; A.R. Gonçal es and R. And ade leg. • 7 ♂♂, 1 ♀; Toledo,
Los Na alucillos; 39º34′25.0″ N, 4º44′57.0″ W; 15 Ap . 2016; A.R. Gonçal es and R. And ade leg. •
5 ♂♂, 4 ♀♀; Guadalaja a, El Ca doso de la Sie a; 41°05′46.2″ N, 3°28′56.1″ W; 23 Ap . 2017; A.R.
Gonçal es and P. Ál a ez leg. • 4 ♂♂, 3 ♀♀; Guadalaja a, El Ca doso de la Sie a (Río Be bellido);
41°06′22.6″ N, 3°24′59.7″ W; 23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 5 ♂♂, 2 ♀♀;
Salamanca, La Albe ca; 40º29′04.0″ N, 6º05′10.2″ W; 25 Ap . 2017; A.R. Gonçal es leg. • 9 ♂♂, 6 ♀♀;
Mad id, Bus a iejo; 40°50′29.8″ N, 3°45′59.1″ W; 21 May 2017; P. Ál a ez leg. • 17 ♂♂, 23 ♀♀;
Cáce es, Alía; 39°30′40.3″ N, 5°20′47.7″ W; 23 Ap . 2018; P. Ál a ez leg. • 3 ♂♂, 5 ♀♀; Cáce es,
Be zocana; 39°24′55.6″ N, 5°25′10.3″ W; 23 Ap . 2018; A.R. Gonçal es and P. Ál a ez leg.
Redesc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
35
Male
Measu eMen s. Body leng h: 2.4–2.8 mm (n = 5). Wing leng h: 1.2–1.3 mm (n = 5).
Head. La e oclina e ocella s 2.5 imes as long as pos pedicel. P oclina e e icals 2 imes as long as
pos pedicel.
an enna. Ligh b own. Pos pedicel oundish, as long as wide; s ylus mo e han 4 imes as long as scape,
pedicel and pos pedicel combined.
Ho ax. Wi h e y long black se ae. Well-dis inguished scle i es, wi h clea sepa a ion be ween
anepis e num and anepime on; pos p ono al lobe e y la ge; scu ellum and me ano um well de eloped,
pos scu ellum poo ly de eloped. P os e num and epis e num densely co e ed by g ey mic o ichia.
Pos p ono al lobe wi h 5 se ae la e ally, mesono um wi h 6 sca e ed se ae o equal leng h; 5 se ae
nea ala egion; no opleu on wi h 1 s ong, p ominen , e y long se a; 2 se ae nea pos e io ma gin o
pos p ono al lobe; scu ellum wi h 2 s ong, long se ae medially.
Wing (Fig. 21D). Lobed apex oblong, wi hou digi a ion. S alk-like p ocess e y lexible, ligh b own
wi h dis inc black spo on lobed apex. Vena ion e y educed (cos al, longi udinal and c oss eins
dis inguishable), o ming 4 cells.
legs. Fo e ibia s ou and in la ed dis ally. O e all da k b own o black, ollowing po ions yellow:
ochan e s, an e io apical hal and apex o o e and mid ibiae, do sal s ip and apical hal o o e and
mid ibiae, o e and mid a some es 1, 2, 3, basal ⅔ 4, hind a some es 1 and 2. Fo e ibia wi h ows o
long, e ec se ae; mid ibia bea ing ow o 5 s ong, spine-like pos e o en al basal se ae. Mid ibia wi h
2 an e o en al apical p ojec ions (Fig. 19E–F): 1 sligh ly sho e han diame e o ibia a apex; clo hed
in mic o ichia, se e al dis inc se ae and 2 sho , s ou , cu ed spinose se ae on ma gin o dis al hal ;
second p ojec ion as long as diame e o ibia a apex wi h a ew long se ae.
Fig. 13. Te minalia o Tachyd omia semiap e a (Gil Collado, 1923) (RBINS). A. Righ su s ylus and
igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial lamella and le su s ylus. D. Righ
su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
36
e Minalia (Fig. 13). Righ epand ial lamella wi h long, e ec se ae on apical hal . Righ su s ylus
sho , na owing dis ally, wi h spa se mic o ichia, bea ing long, i egula ly cu ed se ae, wi h se e al
(ca 6) dis inc den icle-like se ae, agg ega ed on dis al ma gin. Righ ce cus wi h se ae on apical hal
and dis inc apical se a; le ce cus wi h apical se ae o unequal leng hs. Righ ce cus longe han le ,
bo h enclosed in epand ial lamellae. Le epand ial lamella sho e han le ce cus, deeply bilobed.
Le su s ylus 1.5 imes as long as wide, app oxima ely as long as igh ce cus, wi h e y long se ae,
la e oclina e, acing inwa ds.
Female
Simila o male, excep o ollowing ea u es: mic op e ous, wi h wing ound, b ownish, bea ing 1
long se a and 1 sho se a on apical ma gin, co e ed by g ey mic o ichia (Fig. 21E); legs co e ed wi h
egula ows o se ae, wi h dis inc apical se ae on o e emu and an e oapical se ae on coxae; wi hou
o he dis inc i e se ae; spu s on mid ibia absen ; ce cus pale b own wi h g ey mic o ichia and se ae.
Dis ibu ion
Spain and Po ugal. I is known om se e al locali ies along he Ibe ian Cen al Sys em, and om
he Mon es de Toledo moun ain ange, he no heas o Po ugal and om one locali y in he Spanish
p o ince o Zamo a nea he bo de wi h Po ugal.
Tachyd omia s enop e a Gonçal es, G oo ae & And ade sp. no .
u n:lsid:zoobank.o g:ac :AB1CBE5D-22D9-4153-9EE5-FA711157B977
Figs 1, 14, 15G–H, 17G–H, 19G, 21F–G
Diagnosis
O e all e y da k. Wing dimo phic: male s enop e ous; wing wi h sligh ly lobed dis al apex, da k o
mos pa and lobe black and whi e; emale mic op e ous, wing biloba e. Palpi, p oboscis and an ennae
black; pos pedicel lanceola e, ca 1.5 imes as long as pedicel. Legs almos comple ely black. Abdomen
black, e gi es mos ly glab ous and wi hou g ey mic o ichia.
E ymology
The name o his species means ‘na ow wing’ and de i es om he combina ion o wo G eek wo ds:
he p e ix s eno- (s enos), meaning ‘na ow’, wi h he su ix -p e a (p e á), meaning ‘wing’. Hence, he
name e lec s he e y na ow lobed dis al apex o he male wing.
Type ma e ial examined
Holo ype
PORTUGAL • 1 ♂; Gou eia, São Ped o; 40°29′10.9″ N, 7°34′38.5″ W; 25 Ap . 2013; A.R. Gonçal es
and R. And ade leg.; RBINS.
Pa a ypes
PORTUGAL • 1 ♂♂, 5 ♀♀; Gou eia, São Ped o; 40°29′10.9″ N, 7°34′38.5″ W; 25 Ap . 2013; A.R.
Gonçal es and R. And ade leg.; RBINS • 5 ♂♂, 5 ♀♀; Gua da, Panóias de Cima; 40°29′10.2″ N,
7°13′18.4″ W; 1 Ap . 2017; A.R. Gonçal es and R. And ade leg.; RBINS.
Addi ional examined ma e ial
PORTUGAL • 1 ♀; Man eigas, São Ped o; 40º19′07.0″ N, 7º34′37.4″ W; 25 Ap . 2013; A.R. Gonçal es
leg. • 2 ♂♂, 9 ♀♀; Gou eia, São Ped o; 40°29′10.9″ N, 7°34′38.5″ W; 25 Ap . 2013; A.R. Gonçal es
and R. And ade leg. • 3 ♂♂, 1 ♀; Gua da, Panóias de Cima; 40°29′10.2″ N, 7°13′18.4″ W; 1 Ap . 2017;
A.R. Gonçal es and R. And ade leg. • 5 ♂♂, 5 ♀♀; same collec ion da a as o p eceding; ZFMK •
4 ♂♂, 1 ♀; Gua da, Adão; 40°27′03.0″ N, 7°09′41.8″ W; A.R. Gonçal es and R. And ade leg. • 3 ♂♂,
4 ♀♀; Sabugal, Quad azais; 40°18′30.6″ N, 6°59′08.7″ W; 1 Ap . 2017; A.R. Gonçal es and R. And ade
leg. • 1 ♂, 1 ♀; Sabugal, Seixo do Côa; 40°24′48.0″ N, 7°01′07.6″ W; 1 Ap . 2017; A.R. Gonçal es
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
37

and R. And ade leg. • 1 ♂, 4 ♀♀; Sabugal, Fóios; 40°17′43.3″ N, 6°52′38.9″ W; 1 Ap . 2017; A.R.
Gonçal es and R. And ade leg.
Desc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
Male
Measu eMen s. Body leng h: 2.1–2.8 mm (n = 5). Wing leng h: 0.8 mm–0.9 mm (n = 5).
Head. La e oclina e ocella s same leng h as pos pedicel. P oclina e e icals ca ¾ as long as pos pedicel.
an enna. Pos pedicel lanceola e, ca 2 imes as long as pedicel.
Ho ax. Pos p ono al lobe bea ing ca 7 se ae la e ally, ca 6 ac os ichal se ae, sca e ed; no opleu on wi h
1 s ong, p ominen se a; 6 small se ae nea meso ho acic spi acle.
Wing. Sligh ly lobed dis al apex, wi hou digi a ion (Fig. 21F).
legs. O e all black; en al and do sal pos e io su ace o coxae, ochan e , basal 0.1 en al su ace
o emo a and knees, pale . Fo e ibia bea ing spa se cilia ion o hai -like se ae sligh ly longe han
maximum diame e o ibia. Mid ibia an e o en al apical spu wi h 4 sho , s ou , cu ed spinose se ae
on dis al hal ma gin.
abdoMen. Te gi es wi h g ey mic o ichia only on an e io ma gin o e gi e 1 and nea spi acles;
s e ni es o e all co e ed by g ey mic o ichia. Te gi es wi h ew and sca e ed se ae, mos ly p esen on
pos e oma ginal su ace and nea spi acles; s e ni es wi h e enly dis ibu ed se ae; apical s e ni es wi h
long, dis inc se ae.
Fig. 14. Te minalia o Tachyd omia s enop e a Gonçal es, G oo ae & And ade sp. no ., holo ype
(RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial
lamella and le su s ylus. D–E. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
38
Fig. 15. Habi us o li e specimens o he Ibe ian an -like Tachyd omia Meigen, 1803. Males a e pic u ed
in he le column, emales in he igh . A–B. T. lusi anica (G oo ae , Shamshe & And ade, 2009).
C–D. T. nig ohi a Gonçal es, G oo ae & And ade sp. no . E–F. T. ebeje i Gonçal es, G oo ae &
And ade sp. no . G–H. T. s enop e a Gonçal es, G oo ae & And ade sp. no . I–J. T. can ab ica
Gonçal es, G oo ae & And ade sp. no .
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
39
Fig. 16. Habi us o li e specimens o he Ibe ian an -like Tachyd omia Meigen, 1803 and he I alian
ligh less Tachyd omia. Males a e pic u ed in he le column, emales in he igh . A–B. T. ibe ica (A ias,
1919). C–D. T. semiap e a (Gil Collado, 1923). E–F. T. piel aini (Gil Collado, 1936). G–H. T. pandellei
(Séguy, 1941). I–J. T. ap e ygon Plan & Deeming, 2006 (I aly).
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
40
Fig. 17. Moun ed specimens o he Ibe ian an -like Tachyd omia Meigen, 1803. Males a e pic u ed
in he le column, emales in he igh . A–B. T. lusi anica (G oo ae , Shamshe & And ade, 2009).
C–D. T. nig ohi a Gonçal es, G oo ae & And ade sp. no . E–F. T. ebeje i Gonçal es, G oo ae &
And ade sp. no . G–H. T. s enop e a Gonçal es, G oo ae & And ade sp. no . Scale ba s: 1 mm.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
41
a emp . Ins an ly, he male places his o elegs abo e he emale’s eye le el, while he mid legs a e
placed in he emale’s wais in an a emp o g ab i . A he beginning o he copula, he male mo es
his o elegs sideways a he emale’s eye le el, while, wi h his pos e io legs, ubs his own las e gi e
and wi ches i . The mo emen o he o elegs is e y simila o he mo emen o he wings desc ibed
in T. lusi anica by And ade (2011). When hei geni alia seem o be locked, he male keeps himsel
e y s ill, always wi h his o elegs abo e he emale’s eye le el. The emale hen may mo e a ound,
some imes e y as , while keeping he p ey wi h he male on op. F equen ly, he male o T. ibe ica le s
himsel be ca ied a ound by he emale in a ail- o- ail posi ion. When he specimens disconnec , bo h
indi iduals usually igh igo ously o he p ey.
Discussion
Phylogene ic ela ionships and sys ema ics
The phylogene ic ela ionships wi hin Tachyd omiinae ha e been s udied p e iously, bu mos ly a he
ibe and gene ic le el (e.g., Nagy e al. 2013) wi h he speci ic di e si y wi hin he genus ye o be
s udied in u he de ail. This is he i s ime ha all he Ibe ian and I alian an -like species ha e been
sequenced, and hei phylogene ic ela ionship as well as he e olu iona y ela ionships be ween e e y
an -like species and he genus Tachyd omia analysed.
The in e ed phylogene ic posi ion o he ype species o A iasella as sis e axon o he emaining
A iasella species and Piel ainia suppo s he conclusion by Shamshe & G oo ae (2018) ha he
absence o unc ional wings has no phylogene ic alue a gene ic le el. The placemen o he wo gene a
wi hin he clade o Tachyd omia co obo a es hei synonymy unde Tachyd omia.
Fig. 24. Fo es o Fagus syl a ica L. in he Apennine Moun ains, whe e Tachyd omia ap e ygon Plan &
Deeming, 2006 can be ound.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
48

The Ibe ian an -like species o Tachyd omia o m an e olu iona y closely ela ed g oup and he in e ed
phylogene ic ela ionships a e in acco dance wi h he mo phological cha ac e s. Hence, T. semiap e a is
esol ed as he sis e axon o all o he Ibe ian species as i s peculia mo phology sugges s. This axon
possesses a combina ion o cha ac e s in he male (i.e., wo p ojec ions on mid ibia, lack o cilia ion
o long hai like se ae on he o e ibia, oundish pos pedicel and lexible wing) ha a e no ound in
any o he species. A spu -like s uc u e (Fig. 19) on he mid ibia o he male is p esen in all Ibe ian
and I alian species, apa om T. ibe ica, which comple ely lacks i . As desc ibed in he mo phological
analysis, his s uc u e is, o mos species, composed o a basal sec ion bea ing den icles and a side
p ojec ion. In he case o T. semiap e a, he basal sec ion and p ojec ion a e o ally sepa a ed o , a leas ,
hei sepa a ion is much deepe han in o he species. To ou knowledge, his is he only case in he
genus Tachyd omia whe e his deep o o al sepa a ion occu s. Fu he mo e, his s uc u e likely has a
e olu iona y ele ance, as he males o he species in which ma ing was obse ed, g ab he emales by
using he mid legs.
Tachyd omia ibe ica is a species ha lacks many o he cha ac e s wi h axonomic ele ance ound in
o he species as i is ap e ous in bo h sexes, does no ha e spu -like s uc u es o cha ac e is ic se ae
(e.g., cilia ion o long hai -like se ae on he o e ibia). Some di e ences a he e minalia, mainly
conce ning he igh su s ylus, we e ound among h ee geog aphically dis an popula ions. Howe e ,
hese di e ences a e o deg ee a he han ega ding he basic o m and ha e less axonomic ele ance.
Fig. 25. Habi a o Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no . in a o es o Que cus
py enaica Willd. in Po ugal, A ganil, Ben ei a (Ma a da Ma ga aça), a egion unde submedi e anean
in luence.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
49
Addi ionally, he specimens sequenced a e s ill e y much ela ed as eco e ed in he phylogene ic
analysis, whe e hey a e sepa a ed by sho b anches.
Fu he mo e, and e en hough we conduc ed a o al e idence phylogene ic analysis, i seems ele an
o commen on he COI p-di e gences as his gene is o en used o dis inguish species, despi e some
ecognized issues (e.g., Meie e al. 2006). While he gene ic di e si y a species le el wi hin Hybo idae
emains sca cely s udied, la ge in aspeci ic COI p-di e gences a e no uncommon in Hybo idae (see
Nagy e al. 2013). In he men ioned s udy, o example, an in aspeci ic di e gence o up o 5.48% was
ound wi hin he s udied Tachyd omia. In he speci ic case o T. ibe ica, he high di e gence ound a
in e popula ional le el (4–5%) may be ep esen a i e o ica iance p ocesses, especially as no signi ican
mo phological o ecological di e ences we e ound o subs an ia e he sepa a ion o he popula ions as
dis inc species.
Conce ning he sis e -species T. piel aini and T. pandellei, hese wo species a e mo phologically simila
bu wi h e y clea di e ences ha allow o a s aigh o wa d species sepa a ion. In his case, he wo
mo e ele an cha ac e s a e pe haps he wing pa e n and shape as well as he e minalia (in males),
which a e e y di e en . These mo phological di e ences a e highly cong uen wi h he molecula da a,
as hese species a e sepa a ed by ela i ely long b anches in he in e ed phylogene ic ee.
The ou newly desc ibed species all belong o he same clus e whe e T. lusi anica was esol ed. Wi h
he excep ion o he mic op e ous T. ebeje i sp. no ., he male wing, in his species clus e , is s enop e ous
wi h his lobed ip di ided in o a whi e/ anspa en basal po ion and black dis ally, bu i is in T. lusi anica
whe e i p esen s a mo e ema kable shape by bea ing a dis al p ojec ion. Tachyd omia nig ohi a
sp. no . was in e ed as a sis e axon o T. lusi anica and his pai has less mo phological di e ences
in compa ison wi h, o example, T. piel aini and T. pandellei. The e is no enough phylogene ic signal
in he s udied molecula ma ke s o ully esol e he ela ionships be ween T. s enop e a sp. no .,
T. can ab ica sp. no . and T. ebeje i sp. no ., which may be a esul om a apid specia ion p ocess.
Rega ding he placemen o he Ibe ian an -like species wi hin he species g oups p e iously de ined o
Tachyd omia, i is possible o associa e hem mo e closely wi h he a ogans species g oup, al hough
his associa ion is unce ain due o he lack o de eloped wings and o he mo phological cha ac e is ics
which do no i in o he g oup de ini ion, such as he sho e s ylus and/o he la ge and globula male
geni alia. The o e all mo phology – despi e he lack o de eloped wings – places he I alian Tachyd omia
ap e ygon wi hin he e icola species g oup, as sugges ed by Plan & Deeming (2006). Howe e , he
molecula da a clea ly places i as being mo e closely ela ed o he a ogans species g oup. The e o e,
u he molecula s udies a e necessa y o unde s and he phylogene ic ela ionships o T. ap e ygon and
he monophyly o he sugges ed Tachyd omia species g oups based on mo phological da a.
Conce ning he sligh di e ences o he suppo alues be ween he immed and non immed da ase s,
we assume ha bo h RECs and RSCs ha e some e ec on he b anch suppo alues, no on he opology
as p ima ily hough . In ou esul s, he in e ed opology using he immed e sion o he 28S alignmen
ecei es, o e all, sligh ly lowe suppo alues han he non- immed, indica ing ha he ambiguous
egions o he 28S gene p o ides some suppo o he bes ee.
A hypo hesis on he e olu ion o hese species can be p oposed based on he eco e ed phylogene ic
ela ionships and knowledge abou he beha iou and habi a . While he di e gence e en s a e no da ed,
he sho in e nodes in he clus e o he Ibe ian Tachyd omia may e y well e lec a apid succession
o spli ing p ocesses. I is possible ha geog aphically sepa a ed popula ions adap ed di e en ly o
simila ecological condi ions, hence simul aneously e ol ing di e en sexual signalling s a egies.
Thus, di e ences may ha e a isen ollowing ica iance p ocesses and now hese species show dis inc
beha iou s and li e his o ies, which may block he gene low be ween hem in sympa y.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
50
Wing educ ion/modi ica ion in Tachyd omia and i s e olu iona y signi icance
As men ioned be o e, he lack o unc ional wings is a common phenomenon in Dip e a and se e al
hypo heses o ligh lessness in insec s ha e been discussed, including habi a pe sis ence and c yp ic
beha iou s (Hackman 1964). Ro (1990) concluded ha he loss o wings is common in spa ially
and empo ally homogeneous en i onmen s and ha he e is conside able e idence o an inc ease
in ligh lessness wi h al i ude. The Ibe ian an -like species a e mos ly p esen on moun ains and in
deciduous o es s, which a e known o be s able habi a s (Ro 1990), hei mic ohabi a being es ic ed
o he lea li e . O e all, he e olu ion o ligh lessness in Tachyd omia is cu en ly known om 13
species (including he Ibe ian and I alian axa), ou o some 100 desc ibed species. I is expec ed ha
mo e cases may be disco e ed, especially i ield wo k is ca ied ou a high al i ude in empe a e cold
en i onmen s. Rega ding he e olu ion o he wings in he Ibe ian an -like Tachyd omia, we hypo hesize
ha wo p ocesses may ha e aken place: one is he wing educ ion i sel , which may happen in bo h
sexes, and ano he is he wing modi ica ion wi h a sexual signalling unc ion, which only happens in he
male. The e o e, in some species only wing educ ion o di e en deg ees occu ed, om he s enop e ous
species o he ap e ous, wi h he mic op e ous inbe ween. In ce ain cases, he emale is s enop e ous
wi hou a dis inc lobed ip on i s wing, while he male wing has a e y dis inc and la ge lobed ip (see:
Tachyd omia piel aini, Tachyd omia pandellei, Fig. 21A–C). Howe e , mo e commonly, a mo e dis inc
sexual dimo phism is p esen , whe e he emale is mic op e ous and he male is s enop e ous.
I is in e es ing ha he sexual signalling p ocess does no happen he same way in all species, as obse ed
in he ma ing beha iou o T. semiap e a. Con a y o T. lusi anica, he male o his species does no
wa e i s wings du ing copula, no do he wings seem o ha e any o he unc ion. Mo eo e , i s wings
a e much less igid han he ones o all he emaining ela ed species, so i is possible ha he s i ness
o he s alk-like po ion o he wing is an impo an pa o he wing modi ica ion p ocess, making hem
easie o wa e. Hence, while he wings o he s enop e ous species may look simila a i s glance, hey
ac ually di e in hei mo phology and migh ha e di e en unc ions.
In T. semiap e a only a p ocess o wing educ ion seems o be aking place. None heless, his species has
a e y dis inc ea u e, which has he same signalling unc ion as ha o he wing in T. lusi anica. I s o e
ibia – which is black, s ou and in la ed – is wa ed in on o he emale’s eyes du ing copula. A simila
signalling me hod is used by T. ibe ica (wa ing he o elegs) bu his species, ins ead o a modi ied ibia,
simply has a yellow and black o eleg. Fu he mo e, bo h species lack he cilia ion o hai -like se ae on
he male o eleg, p esen in T. lusi anica, whose o elegs we e obse ed o in e wine wi h hose o he
emale (And ade 2011). This beha iou was no obse ed in T. semiap e a o T. ibe ica.
Taking all in o ma ion in o accoun , a leas in he case o T. lusi anica, wing educ ion seems o be
coupled wi h an impo an modi ica ion o sexual ele ance, and i appea s ha bo h ecological and
sexual p essu es a e d i ing i s e olu ion. Simila si ua ions a e likely o be p esen in he o he species
ha show a dis inc sexual dimo phism in he wing mo phology, bu his emains o be es ed.
Rema ks on he habi a and dis ibu ion wi h implica ions on conse a ion
As p e iously men ioned, he an -like species o Tachyd omia occu in egions o empe a e and sub-
medi e anean bioclima ic in luence. In hese bioclima es, he po en ial na u al ege a ion is composed
o b oad-lea ed deciduous o ma cescen species and, o en, he o es s a e domina ed by oak ees, such
as Que cus obu L. and Que cus py enaica Willd (Fig. 25) (Cos a e al. 2005). A highe al i ude, he
oak ees a e subs i u ed by Fagus syl a ica L., a deciduous ee ha o ms monospeci ic s ands wi h a
closed canopy, which blocks he pene a ion o sunligh and c ea es e y shaded en i onmen s (Cos a
e al. 2005). The soil o hese deciduous and ma cescen o es s ends o ha e a deep laye o lea li e .
This laye o lea li e , wi h some deg ee o ligh pene a ion, high humidi y and ich in o ganic ma e ,
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
51
is he ypical mic ohabi a whe e an -like Tachyd omia can be ound. Wi h he excep ion o he species
occu ing a high al i ude, he adul s o Ibe ian an -like Tachyd omia become ac i e a he beginning o
he sp ing, when he ees a e s ill wi hou lea es, and he sunligh can di ec ly each he g ound. The
lies can hen be ound bo h inside he o es and along he o es edge.
Tachyd omia pandellei and T. piel aini o en occu in habi a s whe e he o es is o en domina ed by
Fagus syl a ica, and hey p obably only li e along he edge o he o es because i p o ides he p esence
o lea li e combined wi h highe ligh pene a ion han mic ohabi a s unde dense canopy. The lea
li e i sel is a humid, s able en i onmen and likely o e s shel e om p eda o s and he wea he
elemen s (e.g., wind, ain). I is also he habi a o p ey, as hese species mainly eed on sap ophilous
lies ha a e dependen on o ganic ma e .
In gene al, a a mac oclima ic scale, he an -like species o Tachyd omia seem o ha e ela i ely simila
ecological equi emen s and some species do co-occu in he same habi a s (Fig. 2). This is, o example,
he case o T. semiap e a, which co-occu s wi h T. ebeje i sp. no ., T. nig ohi a sp. no . and T. ibe ica.
Howe e , T. semiap e a seems o become ac i e la e in he yea han T. ebeje i sp. no . and T. nig ohi a
sp. no ., and does no o e lap a a empo al scale wi h T. ebeje i sp. no . in he same habi a s. We suspec
ha u he ieldwo k likely will inc ease he geog aphic anges epo ed o mos species, especially o
T. semiap e a, T. can ab ica sp. no ., T. pandellei and T. piel aini. Howe e , gi en he p e ious sampling
e o s, T. s enop e a sp. no . and T. nig ohi a sp. no . appea o be genuinely es ic ed o a smalle
a ea o occu ence.
Mos popula ions o he Ibe ian an -like Tachyd omia exis in highly agmen ed landscapes gi en
hei occu ence in empe a e and humid o es ed habi a s. This is especially ue o he species wi h
popula ions in he sou he n hal o he Ibe ian Peninsula, whe e hey a e ci cumsc ibed o small sub-
medi e anean bioclima ic islands su ounded by a d y and ho en i onmen . This is he case o he
sou he nmos popula ions o T. ibe ica, T. semiap e a and T. ebeje i sp. no ., bu e en he popula ions
in he no he n egions occu in agmen ed habi a s. The habi a agmen a ion is o en caused by
dis u bances o an h opogenic o igin, such as he a i icializa ion o he land, ag icul u al in ensi ica ion,
subs i u ion o he na u al ege a ion by monocul u es and in asi e species, as well as induced i es. The
clima e is also expec ed o become wa me , g ea ly educing he a ea occupied by empe a e and sub-
medi e anean ees, as Que qus obu and Q. py enaica (Beni o Ga zón e al. 2008). Clima e change,
coupled wi h habi a agmen a ion, will almos ce ainly impe il he conse a ion o he Ibe ian an -like
species o Tachyd omia.
Acknowledgemen s
The au ho s would like o hank e e yone who has p o ided us wi h e y impo an help inding
sui able a eas o p ospec , o suppo du ing ield wo k and / o by collec ing specimens, namely: Piluca
Ál a ez, Ra ael Ob egón, F ancisco Ba os, Sam Ma ins, Ped o And ade, Diana Rod igues, Isaías
Fe ei a, Ca los Sil a, Jo ge Almeida, Ád ia Mi alles, Ca los Vila-Viçosa, Edua do Ma abu o, Ma in J.
Ebeje , Ruud an de Weele, Alice Abela, Nigel Jones, Jo ge Rose e and Sé gio Hen iques. We would
also like o hank Edua do Ma abu o o p o iding suppo on s udying he e olu ion, conse a ion
and axonomy o hese species. We would like o hank Telmo Ma ins o his i al help wi h ob aining
he SEM images (imaging and analysis done a he Facul y o Sciences o he Uni e si y o Lisbon’s
Mic oscopy Facili y, a node o he Po uguese Pla o m o BioImaging, e e ence PPBI-POCI-01-0145-
FEDER-022122). A special g a i ude is due o Claudia E zbaue o eaching and helping he i s au ho
in he labo a o y. We would also like o hank he e iewe s o hei impo an commen s o highly
imp o e he manusc ip . Pa o he ieldwo k was suppo ed by he Sys ema ics Resea ch Fund om
he Sys ema ics Associa ion and he Linnean Socie y o London.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
52
Re e ences
And ade R. 2011. Obse a ions on he beha iou o A iasella lusi anica, G oo ae e al., 2009 (Dip e a,
Hybo idae, Tachyd omiinae) om Po ugal. Bulle in de la Socié é oyale belge d’En omologie 147:
241–250.
A ias J. 1919. Desc ipción p elimina de un nue o Émpido de España. Bole in de la Real Sociedad
Española de His o ia Na u al 19: 479–481.
Beni o Ga zón M., Sánchez de Dios R. & Sainz Olle o H. 2008. E ec s o clima e change on he dis ibu ion
o Ibe ian ee species. Applied Vege a ion Science 11: 169 178. h ps://doi.o g/10.3170/2008-7-18348
Be one M.A., Cou ney G.W. & Wiegmann B.M. 2008. Phylogene ics and empo al di e si ica ion o
he ea lies ue lies (Insec a: Dip e a) based on mul iple nuclea genes. Sys ema ic En omology 33 (4):
668–687. h ps://doi.o g/10.1111/j.1365-3113.2008.00437.x
Ch ála M. 1970. Re ision o Palaea c ic species o he genus Tachyd omia Meig. (= Tachis a Loew)
(Dip e a, Empididae). Ac a En omologica Musei Na ionalis P agae 38 (1969): 415–524.
Ch ála M. 1975. The Tachyd omiinae (Dip . Empididae) o Fennoscandia and Denma k. Fauna
En omologica Scandina ica 3: 1–336.
Cos a M., Mo la C. & Sainz H. 2005. Los Bosques Ibé icos: Una In e p e ación Geobo ánica. 4 h edi ion.
Edi o ial Plane a, Ba celona.
Cumming J.M. & Wood D.M. 2017. Adul mo phology and e minology. In: Ki k-Sp iggs A. & Sinclai
B.J. (eds) Manual o A o opical Dip e a 1: 112. Sou h A ican Na ional Biodi e si y Ins i u e, Cape
Town
Da iba D., Taboada G.L., Doallo R. & Posada D. 2012. jModelTes 2: mo e models, new heu is ics and
pa allel compu ing. Na u e Me hods 9: 772. h ps://doi.o g/10.1038/nme h.2109
Folme O., Black M., Hoeh W., Lu z R. & V ijenhoek R. 1994. DNA p ime s o ampli ica ion o
mi ochond ial cy och ome c oxidase subuni I om di e se me azoan in e eb a es. Molecula Ma ine
Biology and Bio echnology 3: 294–299.
Gibson J.F., Kelso S., Jackson M.D., Ki s J.H., Mi anda G.F. & Ske ing on J.H. 2011. Dip e a-speci ic
polyme ase chain eac ion ampli ica ion p ime s o use in molecula phylogene ic esea ch. Annals o
he En omological Socie y o Ame ica 104 (5): 976–997. h ps://doi.o g/10.1603/AN10153
Gil J. 1923. Es udio de un nue o Taquid omino de España. Bole ín de la Real Sociedad Española de
His o ia Na u al 1923: 150–154.
Gil J. 1936. Una nue a especie del géne o A iasella Gil, con b e es conside aciónes sob e la educcion
del ó ax en los Taquid ominos áp e os. Eos (Re is a Española de En omologia) 11 (3): 191–201.
G oo ae P. & Shamshe I. 2008. No es on he halobion genus Che sod omia (Dip e a: Hybo idae)
om Tunisia wi h he desc ip ion o a new b achyp e ous species and no es on b achyp e y in empidoids.
Bulle in de la Socié é oyale belge d’En omologie 144: 57–63.
G oo ae P., Shamshe I. & And ade R. 2009. Desc ip ion o a new b achyp e ous A iasella Gil
(Dip e a, Hybo idae, Tachyd omiinae) om Po ugal. Bulle in de la Socié é oyale belge d’En omologie
145: 45–48.
Hackman W. 1964. On educ ion and loss o wings in Dip e a. No ulae En omologicae 44: 73–93.
Huelsenbeck J.P. & Ronquis F. 2001. M Bayes: Bayesian in e ence o phylogene ic ees. Bioin o ma ics
17: 754–755. h ps://doi.o g/10.1093/bioin o ma ics/17.8.754
Jemu. 2011. D1.F . A ailable om h p://jemu.myspecies.in o/d1 [accessed 20 Sep. 2017].
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
53

Ka oh K. & S andley D.M. 2013. MAFFT mul iple sequence alignmen so wa e e sion 7: imp o emen s
in pe o mance and usabili y. Molecula Biology and E olu ion 30 (4): 772–780.
h ps://doi.o g/10.1093/molbe /ms 010
Ka oh K., Kuma K., Toh H. & Miya a T. 2005. MAFFT e sion 5: imp o emen in accu acy o mul iple
sequence alignmen . Nucleic Acids Resea ch 33 (2): 511–518. h ps://doi.o g/10.1093/na /gki198
Ka oh K., Asimenos G. & Toh H. 2009. Mul iple alignmen o DNA sequences wi h MAFFT. In:
Posada D. (ed.) Bioin o ma ics o DNA Sequence Analysis. Me hods in Molecula Biology 537: 39–64.
h ps://doi.o g/10.1007/978-1-59745-251-9_3
Kje K.M. 1995. Use o RNA seconda y s uc u e in phylogene ic s udies o iden i y homologous
posi ions: an example o alignmen and da a p esen a ion om he ogs. Molecula Phylogene ics and
E olu ion 4 (3): 314–330. h ps://doi.o g/10.1006/mpe .1995.1028
Kje K.M., Roshan U. & Gillepie J.G. 2009. S uc u al and e olu iona y conside a ions o mul iple
sequence alignmen o RNA, and he challenges o Algo i hms ha igno e hem. In: Rosenbe g
M.S. (ed.) Sequence Alignmen : Me hods, Models, Concep s, and S a egies: 105–150. Uni e si y o
Cali o nia P ess, USA.
Kuma S., S eche G. & Tamu a K. 2016. MEGA7: Molecula E olu iona y Gene ics Analysis Ve sion
7.0 o Bigge Da ase s. Molecula Biology and E olu ion 33: 1870–1874.
h ps://doi.o g/10.1093/molbe /msw054
Meie R., Shiyang K., Vaidya G. & Ng P.K.L. 2006. DNA ba coding and axonomy in Dip e a: a
ale o high in aspeci ic a iabili y and low iden i ica ion success. Sys ema ic Biology 55: 715–728.
h ps://doi.o g/10.1080/10635150600969864
Mille M.A., P ei e W. & Schwa z T. 2010. C ea ing he CIPRES Science Ga eway o in e ence o
la ge phylogene ic ees. In: P oceedings o he Ga eway Compu ing En i onmen s Wo kshop (GCE):
1–8. New O leans.
Nagy Z.T., Sone G., Mo elmans J., Vandewynkel C. & G oo ae P. 2013. Using DNA ba codes
o assessing di e si y in he amily Hybo idae (Dip e a, Empidoidea). ZooKeys 365: 263–278.
h ps://doi.o g/10.3897/zookeys.365.6070
NCBI Resou ce Coo dina o s. 2016. Da abase esou ces o he Na ional Cen e o Bio echnology
In o ma ion. Nucleic Acids Resea ch 44 (D1): D7–D19. h ps://doi.o g/10.1093/na /gk 1290
Plan A.R. & Deeming J.C. 2006. An ap e ous species o Tachyd omia Meigen, 1803 (Dip e a: Hybo idae)
om I aly. An In e na ional Jou nal o Dip e ological Resea ch 17 (1): 13–16.
Posada D. & Buckley T. 2004. Model selec ion and model a e aging in phylogene ics: ad an ages o
Akaike in o ma ion c i e ion and Bayesian app oaches o e likelihood a io es s. Sys ema ic Biology
53 (5): 793–808. h ps://doi.o g/10.1080/10635150490522304
Rambau A. 2009. FigT ee: T ee Figu e D awing Tool. Ve sion 1.3.1.
A ailable om h p:// ee.bio.ed.ac.uk/so wa e/ ig ee/ [accessed 30 No . 2020].
Regie J.C., Shul z J.W., Ganley A.R., Hussey A., Shi D., Ball B., Zwick A., S ajich J.E., Cummings
M.P., Ma in J.W. & Cunningham C.W. 2008. Resol ing a h opod phylogeny: Explo ing phylogene ic
signal wi hin 4 kb o p o ein-coding nuclea gene sequence. Sys ema ic Biology 57: 920–938.
h ps://doi.o g/10.1080/10635150802570791
Ro D.A. 1990. The e olu ion o ligh lessness in insec s. Ecological Monog aphs 60: 389–421.
h ps://doi.o g/10.2307/1943013
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
54
Roháček J. 2012. Wing polymo phism in Eu opean species o Sphae oce idae (Dip e a). Ac a
En omologica Musei Na ionalis P agae 52 (2): 535–558.
Ronquis F. & Huelsenbeck J.P. 2003. M Bayes 3: Bayesian phylogene ic in e ence unde mixed models.
Bioin o ma ics 19: 1572–1574. h ps://doi.o g/10.1093/bioin o ma ics/b g180
Séguy E. 1941. É ude su un nou eau Co yné ine des Py énées. Bulle in de la Socié é en omologique
de F ance 46: 4–6.
Shamshe I.V. & G oo ae P. 2018. P oposed changes in sys ema ics and s a us o some gene a o
Tachyd omiini (Dip e a: Hybo idae: Tachyd omiinae), wi h desc ip ion o a new species o Tachypeza
Meigen om Canada and USA. Russian En omological Jou nal 27 (4): 425–434.
h ps://doi.o g/10.15298/ usen j.27.4.10
Simon C., F a i F., Beckenbach A., C espi B.J., Liu H. & Flook P. 1994. E olu ion, weigh ing, and
phylogene ic u ili y o mi ochond ial gene sequences and a compila ion o conse ed polyme ase chain
eac ion p ime s. Annals o he En omological Socie y o Ame ica 87: 651–701.
h ps://doi.o g/10.1093/aesa/87.6.651
Sinclai B. & Cumming J. 2006. The mo phology, highe -le el phylogeny and classi ica ion o he
Empidoidea (Dip e a). Zoo axa 1180: 1–172. h ps://doi.o g/10.11646/zoo axa.1180.1.1
S a k A. & Doczkal D. 2017. Tachyd omia wend i spec. no . (Dip e a, Empidoidea, Hybo idae) om
i e beds a he No he n slope o he Alps and i s o elands in Ge many. Mau i iana (Al enbu g) 34:
481– 498.
Su K., Ku y S. & Meie R., 2008. Mo phology e sus molecules: he phylogene ic ela ionships o
Sepsidae (Dip e a: Cyclo hapha) based on mo phology and DNA sequence da a om en genes.
Cladis ics 24 (6): 902–916.
Wahlbe g E. & Johanson K.A. 2018. Molecula phylogene ics e eals no el ela ionships wi hin
Empidoidea (Dip e a). Sys ema ic En omology 43: 610–636. h ps://doi.o g/10.1111/syen.12297
Zwickl D.J. 2006. Gene ic Algo i hm App oaches o he Phylogene ic Analysis o la ge biological
Sequence Da ase s unde he Maximum Likelihood C i e ion. PhD hesis, The Uni e si y o Texas,
Aus in, USA.
Manusc ip ecei ed: 23 No embe 2019
Manusc ip accep ed: 9 No embe 2020
Published on: 25 Janua y 2021
Topic edi o : Nes ine Akka i
Sec ion edi o : To bjø n Ek em
Desk edi o : K is iaan Hoedemake s
P in ed e sions o all pape s a e also deposi ed in he lib a ies o he ins i u es ha a e membe s o
he EJT conso ium: Muséum na ional d’his oi e na u elle, Pa is, F ance; Meise Bo anic Ga den,
Belgium; Royal Museum o Cen al A ica, Te u en, Belgium; Royal Belgian Ins i u e o Na u al
Sciences, B ussels, Belgium; Na u al His o y Museum o Denma k, Copenhagen, Denma k; Na u alis
Biodi e si y Cen e , Leiden, he Ne he lands; Museo Nacional de Ciencias Na u ales-CSIC, Mad id,
Spain; Real Ja dín Bo ánico de Mad id CSIC, Spain; Zoological Resea ch Museum Alexande Koenig,
Bonn, Ge many; Na ional Museum, P ague, Czech Republic.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
55
Supplemen a y ma e ial:
Supp. ile 1: Fig.1. Maximum-likelihood ee based on he combined da ase (COI, immed 28S, 12S,
AATS and PGD) using Ga li e . 2.01.1067 and he s uc u al alignmen o 28S. Boo s ap suppo
alues a e depic ed a he nodes (only > 50 o > 0.5, espec i ely). BS = Boo s ap suppo alues.
A g eyscale is used o highligh he ing oup, whe e he da kes shade o g ey highligh s he Ibe ian
ligh less an -like Tachyd omia species, ollowed by a ligh e shade which includes T. ap e ygon, hence
ep esen ing all he ligh less species occu ing in sou he n Eu ope and, inally, he ligh e shade co e s
all Tachyd omia analysed, including he mac op e ous species assigned o di e en species-g oups
sensu Ch ála (1970).
Fig. 2. Bayesian In e ence ee based on he combined da ase (COI, immed 28S, 12S, AATS and PGD)
using M Bayes e . 3.2.6 and he s uc u al alignmen o 28S. Bayesian pos e io p obabili ies a e
depic ed a he nodes (only > 50 o > 0.5, espec i ely). PP = Bayesian pos e io p obabili ies. A g eyscale
is used o highligh he ing oup, whe e he da kes shade o g ey highligh s he Ibe ian ligh less an -like
Tachyd omia species, ollowed by a ligh e shade which includes T. ap e ygon, hence ep esen ing all
he ligh ess species occu ing in sou he n Eu ope and, inally, he ligh e shade co e s all Tachyd omia
analysed, including he mac op e ous species assigned o di e en species-g oups sensu Ch ála (1970).
h ps://doi.o g/10.5852/ej .2021.732.1213.3459
Supp. ile 2: S uc u al alignmen o 28S be o e imming. h ps://doi.o g/10.5852/ej .2021.732.1213.3461
Supp. ile 3: S uc u al alignmen o 28S a e imming. h ps://doi.o g/10.5852/ej .2021.732.1213.3463
Supp. ile 4: Full alignmen o all sequences included in his s udy, con aining he non- immed 28S.
h ps://doi.o g/10.5852/ej .2021.732.1213.3465
Supp. ile 5: Full alignmen o all sequences included in his s udy, con aining he immed 28S.
h ps://doi.o g/10.5852/ej .2021.732.1213.3467
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
56