Re ision o he mo phology, phylogene ic ela ionships, beha iou and
di e si y o he Ibe ian and I alian an -like Tachyd omia Meigen, 1803
(Dip e a: Hybo idae)
Ana Ri a GONÇALVES 1,*, Pa ick GROOTAERT 2, Rui ANDRADE 3,
Oc á io S. PAULO 4 & Ximo MENGUAL 5
1,4 Compu a ional Biology and Popula ion Genomics G oup, cE3c, Faculdade de Ciências,
Uni e sidade de Lisboa, Campo G ande, 1749-016 Lisboa, Po ugal.
2 Royal Belgian Ins i u e o Na u al Sciences, B ussels, Belgium and Lee Kong Chian Na u al His o y
Museum, Na ional Uni e si y o Singapo e, Singapo e.
3 Rua Calous e Gulbenkian 237 4H3, 4050-145 Po o, Po ugal.
5 Zoologisches Fo schungsmuseum Alexande Koenig, Leibniz-Ins i u ü Biodi e si ä de Tie e,
Adenaue allee 160, 53113, Bonn, Ge many.
* Co esponding au ho : [email p o ec ed]
2 Email: [email p o ec ed]
3 Email: [email p o ec ed]
4 Email: [email p o ec ed]
5 Email: [email p o ec ed]
1 u n:lsid:zoobank.o g:au ho :1A0C6FC2-1273-4DFD-A306-874D90860F61
2 u n:lsid:zoobank.o g:au ho :B80BC556-9087-4D0D-9D69-7FA9BE5779C4
3 u n:lsid:zoobank.o g:au ho :36D41774-1466-4297-BB51-CCCEEE6DCB4E
4 u n:lsid:zoobank.o g:au ho :2F8855AC-67EC-47BC-ADF5-019EAF332A7A
5 u n:lsid:zoobank.o g:au ho :A509310D-B567-4830-B8A4-BCB139BB8768
1 h ps://o cid.o g/0000-0003-1776-3728
2 h ps://o cid.o g/0000-0003-2149-9229
3 h ps://o cid.o g/0000-0003-2356-3706
4 h ps://o cid.o g/0000-0001-5408-5212
5 h ps://o cid.o g/0000-0002-6185-9404
Abs ac . Phylogene ic in e ence, based on i e molecula ma ke s (COI, 28S, AATS, 12S, PGD),
co obo a es he synonymy o he ligh less gene a Piel ainia A ias, 1919 and A iasella Gil, 1923 wi h
Tachyd omia Meigen, 1803. The seconda y s uc u e o he 28S RNA gene is used o he i s ime in
his amily o align he mul iple sequences. Molecula and mo phological da a a e la gely cong uen o
all known species o ligh less Tachyd omia. This pape ea s en wes e n Medi e anean species (nine
Ibe ian and one I alian) in de ail, including he desc ip ion o ou new species: T. ebeje i Gonçal es,
G oo ae & And ade sp. no ., T. s enop e a Gonçal es, G oo ae & And ade sp. no ., T. can ab ica
Gonçal es, G oo ae & And ade sp. no . and T. nig ohi a Gonçal es, G oo ae & And ade sp. no .
The male o Tachyd omia piel aini (Gil Collado, 1936) and he emale o Tachyd omia ap e ygon
1
Eu opean Jou nal o Taxonomy 732: 1–56 ISSN 2118-9773
h ps://doi.o g/10.5852/ej .2021.732.1213 www.eu opeanjou nalo axonomy.eu
2021 · Gonçal es A.R e al.
This wo k is licensed unde a C ea i e Commons A ibu ion License (CC BY 4.0).
Monog aph
u n:lsid:zoobank.o g:pub:39F0C998-10AE-44BF-B1ED-7593AD4AE3AA
Plan & Deeming, 2006 a e desc ibed o he i s ime, while a lec o ype is assigned o Tachyd omia
pandellei (Séguy, 1941). A key o all non-mac op e ous Tachyd omia is supplied. Knowledge on he
geog aphic dis ibu ion o mos species is conside ably enhanced. The ma ing beha iou o Tachyd omia
semiap e a (Gil Collado, 1923) and Tachyd omia ibe ica (A ias, 1919) is documen ed o he i s ime,
and we p opose a change in he de ini ion o e ms ap e ous and mic op e ous o p ope ly accommoda e
he di e si y o wing s a es in his clus e o species.
Keywo ds. Ibe ian Peninsula, Hybo idae, ligh less, molecula phylogeny, synonym, new species.
Gonçal es A.R., G oo ae P., And ade R., Paulo O.S. & Mengual X. 2021. Re ision o he mo phology,
phylogene ic ela ionships, beha iou and di e si y o he Ibe ian and I alian an -like Tachyd omia Meigen, 1803
(Dip e a: Hybo idae). Eu opean Jou nal o Taxonomy 732: 1–56. h ps://doi.o g/10.5852/ej .2021.732.1213
Table o Con en s
Abs ac .................................................................................................................................................... 2
In oduc ion .............................................................................................................................................. 3
Ma e ial and me hods ............................................................................................................................... 4
Sampling, species dis ibu ion and specimen deposi ion ...................................................................... 4
Mo phological analysis ......................................................................................................................... 5
Wing educ ion e minology in Dip e a ................................................................................................ 6
Obse a ions on ma ing beha iou ....................................................................................................... 6
Molecula analysis ................................................................................................................................ 6
Taxon sampling .................................................................................................................................. 6
Molecula ma ke selec ion ............................................................................................................... 6
DNA ex ac ion and sequencing ........................................................................................................ 8
Sequence alignmen ......................................................................................................................... 10
Sequence analysis ............................................................................................................................ 10
Phylogene ic analyses ...................................................................................................................... 10
Resul s .....................................................................................................................................................11
Sequence cha ac e is ics ......................................................................................................................11
Recons uc ion o phylogene ic ela ionships ..................................................................................... 12
Taxonomy ........................................................................................................................................... 14
Key o he non-mac op e ous Tachyd omia ..................................................................................... 14
Gene al diagnosis o he Ibe ian and I alian an -like species o Tachyd omia ................................ 16
Tachyd omia ap e ygon Plan & Deeming, 2006 ......................................................................... 16
Tachyd omia can ab ica Gonçal es, G oo ae & And ade sp. no . ............................................ 18
Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no . .................................................. 21
Tachyd omia ibe ica (A ias, 1919) ............................................................................................... 23
Tachyd omia lusi anica (G oo ae , Shamshe & And ade, 2009) ............................................... 27
Tachyd omia nig ohi a Gonçal es, G oo ae & And ade sp. no . ............................................. 29
Tachyd omia pandellei (Séguy, 1941) .......................................................................................... 30
Tachyd omia piel aini (Gil Collado, 1936) ................................................................................... 33
Tachyd omia semiap e a (Gil Collado, 1923) .............................................................................. 35
Tachyd omia s enop e a Gonçal es, G oo ae & And ade sp. no . ............................................ 37
No es on habi a , dis ibu ion and phenology ..................................................................................... 46
Obse a ions on ma ing beha iou o T. semiap e a and T. ibe ica ................................................... 47
Discussion .............................................................................................................................................. 48
Phylogene ic ela ionships and sys ema ics ........................................................................................ 48
Wing educ ion/modi ica ion in Tachyd omia and i s e olu iona y signi icance ............................... 51
Rema ks on he habi a and dis ibu ion wi h implica ions on conse a ion ...................................... 51
Acknowledgemen s ................................................................................................................................ 52
Re e ences .............................................................................................................................................. 53
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
2
In oduc ion
The genus Tachyd omia Meigen, 1803 (Dip e a Linnaeus, 1758, Hybo idae Meigen, 1820) includes
o e 100 alid species dis ibu ed wo ldwide, mos o hem desc ibed in he empe a e a eas o he
Hola c ic egion (Shamshe & G oo ae 2018). These a e small-bodied lies (1–3.5 mm) usually shiny
black o blackish b own in colou , wi h da k banded o clouded wings (Ch ála 1975). This genus is
cu en ly di ided in o nine species g oups based on mo phological cha ac e s: he annulimana, a ogans,
calcanea, connexa, in e up a, o na ipes, punc i e a and e icola g oups (Ch ála 1970, 1975; S a k &
Doczkal 2017).
This pape e iews he ligh less Tachyd omia om he wes e n Medi e anean, he Ibe ian Peninsula
and I aly, comp ising en species in o al, including ou newly desc ibed species om Ibe ia. They a e
minu e an -like lies, ca 2.5 mm, which occupy speci ic mic ohabi a s among he lea li e o deciduous
o es s. One o hese an -like Tachyd omia, Tachyd omia ap e ygon Plan & Deeming 2006, is endemic
o I aly, while he emaining nine species a e es ic ed o he Ibe ian Peninsula and he Py enees.
Apa om Tachyd omia ap e ygon, which has scale-like wings in bo h sexes and lacks hal e es, i e o
hese species we e o iginally placed in he gene a Piel ainia A ias, 1919 and A iasella Gil Collado, 1923,
bu hese wo gene a ha e since been placed in synonymy wi h Tachyd omia (Shamshe & G oo ae
2018): Tachyd omia ibe ica (A ias, 1919), Tachyd omia semiap e a (Gil Collado, 1923), Tachyd omia
piel aini (Gil Collado, 1936), Tachyd omia pandellei (Séguy, 1941) and he mo e ecen ly desc ibed
Tachyd omia lusi anica (G oo ae , Shamshe & And ade, 2009). Despi e being mo phologically
simila o Tachyd omia, hey we e o iginally assigned o he abo e-men ioned gene a solely based on he
comple e absence o hal e es and on he ex emely educed o absen wings. The o me monospeci ic
Piel ainia was cha ac e ized by ap e y in bo h sexes, while in A iasella spp. males a e s enop e ous,
i.e., e y na ow bu long wings (comple e loss o ligh abili y) (Figs 20E, 21A–B, D). The males o
he species p e iously placed in A iasella ha e ubula , s alk-like wings wi h a lobed ip, which, a
leas in T. lusi anica, a e wa ed du ing ma ing (And ade 2011). Females o bo h T. semiap e a and
T. lusi anica a e mic op e ous (Figs 20F, 21E), wi h wings educed o a minu e bilobed scale, while
emales o T. pandellei and T. piel aini a e s enop e ous bu lack he de eloped lobed ip p esen in males
(Fig. 21C).
To ou knowledge, he e is no published in o ma ion on he imma u e s ages, bu adul Tachyd omia
a e p eda o s o small lies, mos ly so -bodied ‘nema oce a’. They a e commonly encoun e ed in la ge
numbe s, swi ly unning ei he on e ical o ho izon al su aces such as ee unks, logs, low ege a ion
and i e ma gins (Ch ála 1970), and o en e en ully winged species a e eluc an o ly, bu ins ead
un o a oid p eda o s. In addi ion o he Ibe ian and I alian an -like species, equen cu so ial habi s
a e also aken o an ex eme in only h ee o he p e iously desc ibed species o Tachyd omia. These
ha e e ol ed o become comple ely ligh less by lacking unc ional wings, while s ill conse ing he
hal e es: Tachyd omia ossica Shamshe , 1994 (Russian Fa Eas and Mongolia) has s alk-like wings,
wi hou he lobed ip whe eas Tachyd omia mic op e a (Loew, 1864) and Tachyd omia schni e i S a k,
1996 (cen al Eu ope) a e b achyp e ous ( ena ion and shape simila o mac op e ous Tachyd omia).
Howe e , wing educ ion is p esen in a leas 20 dip e an amilies (Hackman 1964) and i is equen
in Hybo idae (G oo ae & Shamshe 2008). This phenomenon may be explained by se e al ac o s,
including he s abili y o he habi a and c yp ic beha iou (Hackman 1964).
Due o a combina ion o hei small size, c yp ic habi a p e e ences and ela i ely sho pe iod o
ac i i y, mos Ibe ian an -like species o Tachyd omia ha e been poo ly s udied a he mo phological,
beha iou al, sys ema ic and ecological le els. The o iginal desc ip ions we e gene ally supe icial
and lacked in o ma ion on impo an axonomic cha ac e s, such as he male e minalia. The species
dis ibu ion was also only known om ei he he ype locali y, o jus a ew locali ies, gene ally based on
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
3
a ew specimens, and in he case o T. piel aini, only he emale was known and desc ibed. Addi ionally,
he ypes o T. ibe ica, T. semiap e a and T. piel aini seem o be los and no holo ype was assigned o
T. pandellei. The e is, howe e , a no ewo hy excep ion o his scena io ha is he case o T. lusi anica,
whose desc ip ion includes he male e minalia and o he impo an de ails o axonomic ele ance.
Fu he mo e, se e al impo an obse a ions on i s beha iou we e published by And ade (2011). The
only o he obse a ions we e he b ie no es by A ias (1919) on Tachyd omia ibe ica, desc ibing i s g ea
o aci y by p eying on ungus gna s (Dip e a, Scia idae Billbe g, 1820) and i s agili y, esembling small
an s quickly unning on he g ound. A close phylogene ic ela ionship be ween A iasella and Tachyd omia
was eco e ed by J. Mo elmans (MSc hesis, unpublished da a) using se e al genes (COI, 18S, 28S,
EF-1 alpha and PGD). In his s udy, he single s udied species o ‘A iasella’, cu en ly T. piel aini, was
esol ed embedded among species o Tachyd omia. Nagy e al. (2013) esol ed T. piel aini again wi hin
he s udied species o Tachyd omia in a simple Neighbou -Joining ee econs uc ion using he 5’-end
o he mi ochond ial COI gene. Un il now, T. ibe ica (p e iously ega ded as he mono ypic genus
Piel ainia), has no been included in any phylogene ic in e ences.
In he p esen s udy we pu sue a mo e inclusi e phylogene ic analysis by including all species p e iously
ega ded as A iasella, Tachyd omia ibe ica om h ee geog aphically dis an locali ies, and ou newly
desc ibed species. We used i e di e en molecula ma ke s: he en i e mi ochond ial p o ein-coding
gene o he cy och ome c oxidase subuni I (COI), he pa ial mi ochond ial ibosomal 12S RNA gene,
he pa ial nuclea p o ein-coding genes PGD and AATS, and he pa ial nuclea ibosomal 28S RNA
gene. Fu he mo e, he p esen s udy uses a mode n mo phological analysis (e.g., by including SEM
imaging) in he ( e)desc ip ion o he a ge axa, including in he desc ip ion o he male o T. piel aini,
and a lec o ype o T. pandellei is designa ed. Addi ionally, we conside ably imp o e he knowledge on
he geog aphic dis ibu ion o hese species as well as p o ide new obse a ions on ma ing beha iou .
This esea ch has he o e all aims o : i) desc ibing new ligh less an -like Ibe ian species; ii) in e ing
he phylogene ic ela ionships among he ligh less an -like Ibe ian species; iii) unde s anding he
phylogene ic ela ionship be ween Tachyd omia and he species p e iously placed in gene a Piel ainia
and A iasella; and inally i ) shedding ligh on he wing e olu ion o he an -like Ibe ian species.
Ma e ial and me hods
Sampling, species dis ibu ion and specimen deposi ion
Specimens we e manually collec ed wi h a ial a e being di ec ly sea ched o on he lea li e .
A e wa ds, hey we e p ese ed ei he d y-moun ed, in 70% e hanol o absolu e e hanol ( o molecula
analysis). In he cases whe e ype ma e ial is los , species we e iden i ied based on he illus a ions and
on he o iginal desc ip ions p e iously published (A ias 1919; Gil 1923, 1936; Séguy 1941; Plan &
Deeming 2006; G oo ae e al. 2009). In mos cases, addi ional specimens we e collec ed a hei ype
locali ies o e y close by. Dis ibu ion da a was compiled om published eco ds and based on ecen
sampling e o s. Se e al sampling expedi ions ook place ac oss he Ibe ian Peninsula and he Py enees
(Fig. 1) as well as he Apennine Moun ains, mos ly om Janua y o July (2013–2018). His o ical and
new occu ence eco ds we e plo ed using QGIS e . 2.18.16, wi h he coo dina es p ojec ed in he
e e ence sys em Mad id 1870 (Mad id), code 4903. The as e map da ase (Na u al Ea h II wi h
Shaded Relie , Wa e , and D ainages) was ob ained om h ps://www.na u alea hda a.com.
The abb e ia ions o he specimen eposi o ies a e:
NHMUK = The Na u al His o y Museum, London, Uni ed Kingdom
NMWC = Na ional Museum o Wales, Ca di , Uni ed Kingdom
RBINS = Royal Belgian Ins i u e o Na u al Sciences, B ussels, Belgium
ZFMK = Zoologisches Fo schungsmuseum Alexande Koenig, Bonn, Ge many
Specimens no assigned o a o mal eposi o y a e placed in he i s au ho ’s collec ion.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
4
Mo phological analysis
Te ms used o adul s uc u es ollow hose o Cumming & Wood (2017). Male e minalia we e
mace a ed in ho (a ound 90°C) 10% KOH o 10 minu es and le a oom empe a u e o se e al hou s,
clea ed in e hanol and imme sed in glyce ine o long- e m p ese a ion. D awings o he e minalia
we e made wi h a came a lucida a ached o a Lei z Labo lux 12 compound mic oscope. D awings o
he wing we e made based on di ec obse a ion by using a s e eo mic oscope, S eREO Luma .V12
(Ca l Zeiss Mic oImaging). Images o minu e wings and spu s we e ob ained using a scanning elec on
mic oscope JSM-5200LV (JEOL, L d). Pho og aphs o pinned specimens we e aken wi h a Canon EOS
7D moun ed on a P-51 Cam-Li (Dun Inc.) and expo ed wi h he help o Adobe Ligh oom ( e . 5.6).
A e wa ds, he images we e s acked using he so wa e Ze ene S acke e . 1.04. Pho og aphs o li e
specimens we e aken wi h a Fuji ilm FinePix HS10, wi h a Raynox DCR-250 mac o lens.
The body leng h was measu ed om he ons o he end o he e minalia in la e al iew. The wing
leng h was measu ed om he wing ip o i s base. Measu emen s we e aken using d ied specimens. In
he desc ip ions, he igh and le side o he male e minalia a e based on he un o a ed posi ion iewed
pos e io ly, such ha in he illus a ions he igh su s ylus appea s on he eade ’s le side and ice
e sa. All male e minalia a e igu ed in hei un o a ed posi ion.
Fig. 1. Cu en ly known dis ibu ion o he Ibe ian an -like Tachyd omia Meigen, 1803. Each do
ep esen s a p esence poin , wi h each colou co esponding o a di e en species. When wo species
co-occu in he same a ea, hei p esence is ep esen ed by a smalle do on op o a do o egula
dimension, each o hose wi h he colou co esponding o he co-occu ing species. The do s su ounded
by a black ci cle wi h a e ical line ep esen locali ies p e iously known.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
5
Wing educ ion e minology in Dip e a
Hackman (1964) p oposed a e minology ega ding he deg ee o wing educ ion in Dip e a. B achyp e ous
means educed wing, sho e han abdomen, b oad and mo e o less blun , no pe mi ing ligh , wi h a
leas adial eins dis inc . S enop e ous a e specimens wi h wings e y na ow bu some imes long, no
pe mi ing ligh , wi h a leas adial eins dis inc . Mic op e ous a e species wi h wing educed o small
appendage o a ying shape wi h a mos aces o he adial ein. And, inally, ap e ous species ha e
wings a mos ep esen ed by a minu e scale, a mos ca ying some se ae o o ally absen . Recen ly,
Roháček (2012) added he e m submac op e ous o species wi h wings simila ly shaped, including
ena ion, as in no mal mac op e ous specimens, bu dis inc ly sho e , da ke , abou as long as he
abdomen. He e, we p opose an emenda ion o his e minology whe e he e m mic op e ous assumes
a mo e inclusi e de ini ion: wing educed o a small appendage, s ub o minu e scale, o a ying shape
wi h a mos aces o he adial eins p esen . Fu he mo e, we change he e m ap e ous, wi h i s
de ini ion being es ic ed o wings o ally absen , wi hou any aces o i s p esence.
Obse a ions on ma ing beha iou
Obse a ions in cap i i y we e made o Tachyd omia semiap e a (popula ion o Spain, Cáce es, Las
Villue cas) and Tachyd omia ibe ica (popula ion o Po ugal, Lei ia, A imal). These species we e
selec ed because o hei le el o wing educ ion: he o me species is s enop e ous, wi h e y lexible
s alk-like wings (in opposi ion o he igid wings o he o he s enop e ous Ibe ian an -like species);
and he la e is ap e ous. The ma ing beha iou o a s enop e ous species wi h igid s alk-like wings,
T. lusi anica, was desc ibed by And ade (2011). Specimens we e kep in a small e a ium (27 ×
15 × 17 cm), wi h a sec ion o 4 cm deep soil, including lea li e . In wo sepa a ed ins ances, each
species (10 ♂♂, 10 ♀♀) was kep and obse ed o i e consecu i e days. Obse a ions we e made
using a Fuji ilm FinePix HS20 EXR, wi h a Raynox DCR-250 mac o lens. Specimens o Scia idae we e
o e ed as a ood sou ce. To es in aspeci ic in e ac ions in p e-de ined condi ions (e.g., quan i y o
specimens, sex), specimens we e empo a ily aken om he e a ium and pu inside anspa en plas ic
ials. Va ious ypes o in e ac ions we e obse ed bu he e, only he ma ing beha iou is desc ibed
because o i s ele ance o help unde s and he e olu iona y impo ance o wing educ ion/modi ica ion.
These obse a ions we e aimed a ob aining quali a i e desc ip ions o beha iou .
Molecula analysis
Taxon sampling
The axon sampling included 35 specimens belonging o 31 di e en species: 30 Hybo idae and one
Empididae La eille, 1809. We sequenced and analysed o he i s ime nine species o Tachyd omia,
namely eigh Ibe ian an -like Tachyd omia as well as Tachyd omia ap e ygon. In o he wo ds, he analysis
co e ed all he nine p e iously desc ibed and newly desc ibed species o he Ibe ian ligh less an -like
Tachyd omia. Addi ionally, i included ou mac op e ous and one ap e ous species o Tachyd omia
assigned o h ee species-g oups sensu Ch ála (1970): he e icola, connexa and a ogans g oups. The
abo emen ioned axa cons i u e he ing oup. Rep esen a i es o each o he six sub amilies o Hybo idae
we e included as ou g oups, as we e he ibes wi hin Tachyd omiinae sensu Sinclai & Cumming (2006).
Empis essella a Fab icius, 1794 (Empididae) was used o oo he ee. Table 1 lis s he species included
in he analysis, as well as he collec ion da a. The samples we e made a ailable ei he by ob aining
eshly collec ed specimens o om he Ge man Ba code o Li e (GBOL) DNA collec ion p ese ed in
he ZFMK BioBank.
Molecula ma ke selec ion
Th ee nuclea genes (28S, PGD, AATS) and wo mi ochond ial genes (COI and 12S) we e selec ed
o be sequenced. The choice o hese genes was based on hei di e en e olu iona y a es and on he
exis ence o p ime s (Table 2) used in g oups o insec s, including some speci ic o Dip e a.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
6
Species
DNA ouche
ZMFK Label in o ma ion GBOL ca alogue
numbe COI–5’ COI–3’ 28S AATS 12S PGD
Tachyd omia
ebeje i sp. no . AR01 Po ugal: Sabugal, 1 Ap . 2017.
Leg: A. Gonçal es & R. And ade – X X X X X X
Tachyd omia
s enop e a sp. no . AR02
Po ugal: Gua da, Adão,
1 Ap . 2017.
Leg: A. Gonçal es & R. And ade
– X X X X X X
Tachyd omia
nig ohi a sp. no . AR03 Spain: Salamanca, El Maíllo,
25 Ap . 2017. Leg: A. Gonçal es – X X X X X –
Tachyd omia
lusi anica AR04 Po ugal: Fa e, Felguei as,
9 Ap . 2017. Leg: R. And ade – X X X X X X
Tachyd omia
pandellei AR05
F ance: Hau es-Py énées,
A ens-Ma sous, A ens,
Rou e d’As e, 19 Jun. 2017.
Leg: A. Gonçal es & E. Ma abu o
– X X X X X X
Tachyd omia
semiap e a AR06
Spain: Á ila, El Ba aco,
13 Ap . 2016.
Leg: A. Gonçal es & R. And ade
– X X X X X X
Tachyd omia
ibe ica AR07
Spain: Mad id, A oyo de la
Fuen ecilla (La Hi uela),
23 Ap . 2017. Leg: A. Gonçal es
– X X X X X X
Tachyd omia
ibe ica AR08
Po ugal: Po o de Mós, A imal,
11 Ma . 2017.
Leg: A. Gonçal es & F. Ba os
– X X X X X X
Tachyd omia
ibe ica AR09
Spain: Badajoz, Ten udía,
3 Ap . 2015.
Leg: A. Gonçal es & R. And ade
– X X X X X X
Tachyd omia
ap e ygon AR10
I aly: F osinone, San Dona o Val
di Comino, 26 Jun. 2017.
Leg: A. Gonçal es & R. And ade
– X X – – X X
Empis
essella a AR11
Po ugal: Lisboa, Monsan o,
1 Ma . 2017.
Leg: A. Gonçal es & S. Ma ins
– X X X X X –
Hybos
emo a us AR12 Ne he lands.
Leg. Ruud an de Weele – X X X X X –
D ape is
ephippia a AR13 Ne he lands.
Leg. Ruud an de Weele – X X X X – X
S ilpon sp. AR14 Po ugal: A ei o, Sal eu.
Leg. R. And ade – X X X X X –
Symballoph halmus
usci a sis
AR15 Belgium.
Leg. P. G oo ae – X X X – X X
Tachyd omia
can ab ica sp. no . AR16
Spain: Palencia, Río Ca ión,
14 May 2014.
Leg: A. Gonçal es & R. And ade
– X X X X X –
Tachyd omia
piel aini AR17 Spain: As u ias, Cangas de Onís,
9 Ap . 2016. Leg: A. Gonçal es – X X X X X X
Tachyd omia
connexa AR18 Uni ed Kindgom – X X X X X X
Tachyd omia
a ogans AR19 Belgium.
Leg. P. G oo ae – X X X X X X
Tachyd omia
umb a um AR20 Ne he lands.
Leg. Ruud an de Weele – X X X X X X
Tachyd omia
umb a um AR21 Ne he lands.
Leg. Ruud an de Weele – X X X X X X
O opezella
sphenop e a AR22 No way ZFMK–TIS–
2547243 X X X – – –
Oedalea
hybo ina AR24 Finland ZFMK–TIS–
2580838 X X X – – –
Bicella ia
in e media AR25 Finland ZFMK–TIS–
2580874 X X X X X X
Pla ypalpus
pec o alis AR26 Finland ZFMK–TIS–
2580880 X X X X X X
Tachypeza
unco um AR28 Finland ZFMK–TIS–
2586890 X X X – – –
T ichina
cla ipes AR29 Ge many ZFMK–TIS–
2593538 X X X – – X
Table 1 (con inued on nex page). Taxon sampling used in he molecula analysis. The c oss (X) deno es
success in ob aining a sequence o he espec i e molecula ma ke .
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
7
DNA ex ac ion and sequencing
En i e specimens, e hanol p ese ed and s o ed a -20°C, we e used o DNA ex ac ion. Ex ac ions
we e ca ied ou on comple e specimens using he Dneasy Blood & Tissue Ki (Qiagen, Valencia, CA,
USA) o ex ac o al nucleic acids ollowing he manu ac u e ’s ins uc ions; samples we e esuspended
in 50–100 µl ul a-pu e wa e ins ead o in he supplied elu ion bu e . En i e specimens we e p ese ed
and labelled as DNA ouche specimens o he pu pose o mo phological s udies and deposi ed in
ZFMK. The Qiagen Mul iplex PCR Ki (Qiagen, Valencia, CA, USA) was used o ca y ou he PCRs.
PCRs (20 µl) included 2.5 µl DNA ex ac , 1.6 µl o each p ime (a 10 pmol/µl), 2 µl o Q-solu ion,
10 µl o Qiagen Mul iplex-Mix and 2.3 µl o ul a-pu e wa e . PCR ampli ica ions we e ca ied ou wi h
a Biome a PCR The mal Cycle . PCR ‘ ouchdown’ p og ams a e lis ed in Table 3, p ime s used o
ampli ying and sequencing he molecula ma ke s a e lis ed in Table 4. Ampli ied DNA was isualized
on 1.5% aga ose gels o inspec ion o ampli ied p oduc s. PCR p oduc s we e cleaned up using he
comme cially a ailable QIAquick PCR Pu i ica ion Ki (Qiagen, Valencia, CA, USA). Bi-di ec ional
Sange sequencing eac ions we e ca ied ou by Mac ogen Inc. using he same p ime pai s as hose
used o PCR eac ion.
Species
DNA ouche
ZMFK Label in o ma ion GBOL ca alogue
numbe COI–5’ COI–3’ 28S AATS 12S PGD
Tachyd omia
e icola AR30 Finland ZFMK–TIS–
2593583 X X X X X X
Tachypeza
nubila AR31 Ne he lands.
Leg. Ruud an de Weele – X X X – X –
T ichina
biloba a AR32 Ge many ZFMK–TIS–
2513222 X X X X X X
Pla ypalpus
pseudo lu ipes AR33 Finland ZFMK–TIS–
2593700 X X X X X X
Bicella ia
sulca a
AR34 Ge many ZFMK–TIS–
2601004 X X X X – –
Oedalea
ze e s ed i AR35 Ge many ZFMK–TIS–
2595873 X X X – X X
Tachypeza
unco um AR36 Finland ZFMK–TIS–
2586890 X X X – – X
C ossopalpus
sp. AR37 Po ugal: A ei o, Sal eu. Leg.
R. And ade – X X X X – X
Table 1 (con inued).
Table 2. P ime s used o ampli ying and sequencing he molecula ma ke s.
Gene P ime ’s name Sequence Re e ence
COI-5’ LCO-1490 GGTCAACAAATCATAAAGATATTG Folme e al. 1994
COI-5’ HCO-2198 TAAACTTCAGGGTGACCAAAAAATCA Folme e al. 1994
COI-3’ COI-Dip -283F CARCAYYTATTYTGATTTTTTGG Gibson e al. 2011
COI-3’ TLS-N-3014 (Pa ) TCCAATGCACTAATCTGCCATATTA Simon e al. 1994
PGD PGD-2F ATHGARTAYGGNGAYATGCA Regie 2008
PGD PGD-3R GTRTGNGCNCCRAARTARTC Be one e al. 2008
28S 28s-D1F TGTAAAACGACGGCCAGTCCCCCTGAATTTAAGCATAT Jemu 2011
28S 28s-D2R CAGGAAACAGCTATGACGTTAGACTCCTTGGTCCGTG Jemu 2011
12S 12S bi AAGAGCGACGGGCGATGTGT Simon e al. 1994
12S 12S ai AAACTAGGATTAGATACCCTATTAT Simon e al. 1994
AATS AATS-1F40 GNATGAAYCARTTYAARCCNAT Su e al. 2008
AATS AATS-1R244 CATNCCRCARTCNATRTGYTT Su e al. 2008
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
8
Reac ions o 20 μl
H2O 2.3
Q-Solu ion 2
Qiagen Mul iplex-Mix 10
P ime A (10 pmol/μl) 1.6
P ime B (10 pmol/μl) 1.6
DNA 2.5
COI
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 95 15:00
Dena u a ion 94 00:35 25
Annealing 55 01:30 25
Elonga ion 72 01:30 25
Final Elonga ion 72 10:00
Cooling 10 ∞
PGD
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 95 15:00
Dena u a ion 95 00:30 36
Annealing 50 01:00 36
Elonga ion 72 01:00 36
Final Elonga ion 72 10:00
Cooling 10 ∞
28S
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 95 15:00
Dena u a ion 94 00:35 40
Annealing 60 01:30 40
Elonga ion 72 01:30 40
Final Elonga ion 72 10:00
Cooling 10 ∞
AATS
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 95 15:00
Dena u a ion 95 00:30 38
Annealing 50 01:00 38
Elonga ion 72 01:00 38
Final Elonga ion 72 10:00
Cooling 10 ∞
12S
PCR p o ocol Tempe a u e (°C) Time (minu es) Cycles
Ini ial s ep 94 01:30
Dena u a ion 94 00:45 38
Annealing 50 01:00 38
Elonga ion 74 02:00 38
Final Elonga ion 74 05:00
Cooling 10 ∞
Table 3. De ailed PCR p o ocols o each molecula ma ke .
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
9
18. Palpi yellow in g ound colou ; wing bilobed, oundish, apical ma gin o pos e io lobe bea ing one
long se a, an e io lobe bea ing h ee sho e se ae ..............................................................................
............................................................................... Tachyd omia ap e ygon Plan & Deeming, 2006
– Palpi black in-g ound colou ; wing as single lobe, oundish, bea ing one long se a and one sho se a
on apical ma gin (Fig. 21E) ........................................ Tachyd omia semiap e a (Gil Collado, 1923)
19. Fou p escu ella se ae and ou scu ella se ae; wing as single lobe, usually longe han wide, a mos
wi h single dis inc se a p esen (Fig. 20B); coxae, emo a and mos o ibia da k b own o black;
ochan e s, knee, an e o en al su ace o ibia, dis al ¼ o a some e 1, dis al hal o a some e 2
and ollowing a some es, yellowish ...................................................................................................
.........................................................Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no .
– Di e en numbe o p escu ella and scu ella se ae; wing biloba e, oundish, wi h dis inc se ae
(Figs 20D, F, H, 21G) ...................................................................................................................... 20
20. Te gi es wi h ew and sca e ed se ae, mos ly p esen on pos e oma ginal su ace and nea spi acles;
s e ni es wi h e enly dis ibu ed se ae; legs almos comple ely black, excep ing e y small b own
po ions, speci ically: en al and do sal pos e io su aces o coxae, ochan e , basal en al su ace
o emo a and knees ...................Tachyd omia s enop e a Gonçal es, G oo ae & And ade sp. no .
– Te gi es and s e ni es wi h e enly dis ibu ed se ae; legs wi h di e en colou pa e n o black and
yellow o b own ............................................................................................................................... 21
21. Pos p ono al lobe bea ing ca 4 se ae la e ally; wings biloba e, bea ing one se a on apical ma gin
o each lobe (Fig. 20D); legs black wi h ollowing segmen s pale b own/yellowish: apical
po ion o coxae, ochan e s, basal po ion o mid and hind emo a, dis al apical su ace o
o e and mid emo a, knees, basal su ace o a some e 1 and basal ⅔ su ace o a some e
2 ................................................Tachyd omia can ab ica Gonçal es, G oo ae & And ade sp. no .
– Pos p ono al lobe bea ing mo e han 4 se ae la e ally; wings biloba e, bea ing mo e han wo se ae
on bo h lobes combined (Fig. 20F, H); legs wi h a di e en colou pa e n .................................... 22
22. Legs black, excep o ochan e s, knees and a some es 1 and 2 yellowish o b own ......................
...................................................Tachyd omia nig ohi a Gonçal es, G oo ae & And ade sp. no .
– Legs black wi h ollowing segmen s yellowish-b own: coxa, ochan e , knee, an e io and en al
su ace o o e and mid emo a, base o o e and mid ibia, basal 4/5 su ace o a some e 1, basal su ace
⅔ o mid and hind a some e 2 ....Tachyd omia lusi anica (G oo ae , Shamshe & And ade, 2009)
Gene al diagnosis o he Ibe ian and I alian an -like species o Tachyd omia
The Ibe ian and I alian an -like Tachyd omia species can be join ly cha ac e ized by lacking hal e es
and unc ional wings (ap e ous, mic op e ous o s enop e ous). Conside ing hei o e all mo phology
(e.g., shape and colou a ion o palpus and pubescence o legs), i can be said ha Ibe ian species a e
gene ally mo e ela ed o he a ogans species g oup han o any o he ; howe e , a ious species di e
om his g oup in ha ing a sho e s ylus 1.5 imes as long as he an enna (T. semiap e a, T. piel aini
and T. pandellei) and/o o ha ing male geni alia la ge and globula (T. s enop e a sp. no .). Plan &
Deeming (2006) sugges ed ha T. ap e ygon is mo e ela ed o e icola g oup. They a e quick and
agile unne s and o en mo e hei abdomens up and downwa ds, esembling an s o ce ain ligh less
pa asi ic wasps.
Tachyd omia ap e ygon Plan & Deeming, 2006
Figs 3, 16I–J, 19J, 22–24
Tachyd omia ap e ygon Plan & Deeming, 2006: 13 (male only).
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
16
Diagnosis
Small (leng h = 2 mm), slende , o e all da k, wi h minu e bilobed squami o m wings (Fig. 22) in bo h
sexes and hal e es absen . F ons, e ex and occipu la gely co e ed by g ey mic o ichia; 1 pai o
la e oclina e ocella s; 1 pai o p oclina e e icals; palpi pale yellow, an ennae wi h scape and pedicel
yellow, pos pedicel b own; p oboscis shiny black; pos pedicel sub-conical, simila leng h as o pedicel.
Tho ax black wi h po ion o epis e num densely co e ed wi h g ey mic o ichia. Legs wi h colou
pa e n o yellowish and da k b own o black; o e ibia wi h cilia ion o sho coa se se ae. Mid ibia
wi h an e o en al spu a apex, p oduced in o sho apical elonga ion, abou as long as diame e o ibia
a apex (Fig. 19J); spu wi h se e al dis inc se ae and, on dis al hal ma gin, a ew sho , s ou , cu ed
spinose se ae. Abdomen black, co e ed wi h g ey mic o ichia and sho se ae, longe a hind ma gin o
las s e ni e.
Type ma e ial examined
Holo ype
ITALY • 1 ♂; Lazio, 10 km sou h o Fo ca d’Ace o, on oad o So a; 1 Jul. 2005; J.C. Deeming leg.;
NMWC.
Addi ional ma e ial examined
ITALY • 5 ♂♂, 10 ♀♀; F osinone, San Dona o Val di Comino; 41°43′58.7″ N, 13°49′12.2″ E; 26–29
Jun. 2017; A.R. Gonçal es and R. And ade leg. • 2 ♂♂; L’Aquila, Gioia dei Ma si, Pa co Nazionale
D’Ab uzzo Lazio e Molise; 41°51′34.0″ N, 13°46′52.1″ E; 26–29 Jun. 2017; A.R. Gonçal es and
R. And ade leg. • 19 ♂♂, 13 ♀♀; L’Aquila, Pacen o; 42°02′56.7″ N, 14°02′51.7″ E; 26–29 Jun. 2017;
A.R. Gonçal es and R. And ade leg. • 18 ♂♂, 14 ♀♀; Pesca a, San ’Eu emia a Maiella; 42°06′01.2″ N,
14°02′10.5″ E; 26–29 Jun. 2017; A.R. Gonçal es and R. And ade leg. • 13 ♂♂, 13 ♀♀; L’Aquila, O ena;
42°23′06.1″ N, 13°45′37.8″ E; 26–29 Jun. 2017; A.R. Gonçal es and R. And ade leg. • 2 ♂♂; Pesca a,
Fig. 3. Te minalia o Tachyd omia ap e ygon Plan & Deeming, 2006 om I aly, Lazio, Pos a (RBINS).
A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial lamella and
le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
17
Fa indola; 42°23′45.7″ N, 13°47′06.8″ E; 26–29 Jun. 2017; A.R. Gonçal es and R. And ade leg. •
2 ♂♂, 3 ♀♀; Lazio, Leonessa; 42°30′59.3″ N, 12°59′10.9″ E; 26–29 Jun. 2017; A.R. Gonçal es and
R. And ade leg.; ZFMK • 4 ♂♂, 3 ♀♀ (all male e minalia s udied, RBINS); Lazio, Pos a; 42°31′51.2″ N,
13°03′37.4″ E; 26–29 Jun. 2017; A.R. Gonçal es and R. And ade leg.
Desc ip ion
Female (p e iously undesc ibed)
Simila o male. Mic op e ous, wing ound, b ownish, biloba e, apical ma gin o pos e io lobe bea ing 1
long se a, an e io lobe bea ing 3 sho e se ae, lobes co e ed wi h g ey mic o ichia. Di e s om male
in ollowing: legs mainly co e ed wi h mic o ichia and egula ows o se ae; spu on mid ibia absen ;
ce cus pale b own wi h g ey mic o ichia and long se ae; a ew longe se ae on apical s e ni es.
Dis ibu ion and habi a
I aly. Cu en ly, his species is only known om he cen al Apennine Moun ains (Fig. 23). I occu s on
he edge o o es s o Fagus syl a ica L. (Fig. 24), on he lea li e and sho he baceous ege a ion,
whe e i can be abundan . I has also been ound in mixed deciduous woodland a lowe al i udes, inside
he o es , on he lea li e .
Rema ks
Despi e he sampling e o a he end o July, he species was no ound a he mixed deciduous woodland
ype locali y. Howe e , i was s ill e y abundan a highe al i udes. The ype specimen was collec ed
a he beginning o July, so by he end o he mon h, i may al eady be oo ho and d y o his species o
su i e a lowe al i udes.
Tachyd omia can ab ica Gonçal es, G oo ae & And ade sp. no .
u n:lsid:zoobank.o g:ac :1F27952E-DD08-44E5-AF55-39019FD06488
Figs 1, 4, 15I–J, 18A–B, 19H, 20C–D
Diagnosis
O e all da k. Wing dimo phic: male s enop e ous; wing wi h lobed dis al apex, no eins dis inguishable,
da k b own o mos pa , wi h black and whi e lobe; emale mic op e ous, wing biloba e, wi h 1 se a
on each lobe. Palpi, p oboscis and an ennae black; pos pedicel sub-conical, ca 1.5 imes as long as
pedicel. Legs wi h a colou pa e n o yellowish and da k b own o black; male o e ibia wi h cilia ion
o long hai like se ae. Abdomen black, e gi es and s e ni es wi h e enly dis ibu ed se ae, co e ed wi h
g ey mic o ichia. I sha es simila i ies wi h T. nig ohi a sp. no . and T. s enop e a sp. no ., bu can be
dis inguished om hese species by he da ke leg colou a ion, lobed dis al apex o male wing wi hou
any ace o apical digi a ion, sub-conical pos pedicel, and male e minalia.
E ymology
This species is named a e he Spanish Can ab ian moun ain ange, whe e i was ound.
Ma e ial examined
Holo ype
SPAIN • 1 ♂; Palencia, Río Ca ión; 42º50′34.9″ N, 4º51′16.9″ W; 14 May 2014; A.R. Gonçal es and
R. And ade leg.; RBINS.
Pa a ypes
SPAIN • 4 ♂♂, 2 ♀♀; Palencia, Río Ca ión; 42º50′34.9″ N, 4º51′16.9″ W; 14 May 2014; A.R. Gonçal es
and R. And ade leg.; RBINS.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
18
Addi ional ma e ial examined
SPAIN • 2 ♂♂ ( e minalia s udied, RBINS); León, La Pola de Go dón; 42°51′00.5″ N, 5°39′46.0″ W;
13–14 May 2014; A.R. Gonçal es and R. And ade leg. • 1 ♀ ( e minalia s udied, RBINS); León, Boca
de Hué gano 42º56′27.3″ N, 4º54′10.0″ W; 13–14 May 2014; A.R. Gonçal es and R. And ade leg.
Desc ip ion
Male
Measu eMen s. Body leng h: 2.1–2.3 mm (n = 3). Wing leng h: 0.8–0.9 mm (n = 3).
Head. Face and ons la gely glab ous, shiny black; ocella ube cle shiny an e io ly and inely pollinose
pos e io ly. 1 pai la e oclina e ocella s, same leng h as pos pedicel, no pos e io ocella s. 1 pai p oclina e
e icals, ca ¼ sho e han leng h o pos pedicel, and nume ous se ae on occipu ; no pos ocula ciliae
p esen ; mou h ma gin co e ed by g ey mic o ichia and wi h long se ulae.
an enna. Black, co e ed by g ey mic o ichia. Scape as long as wide; pedicel wice as long as wide,
wi h apical ci cle o black se ae, en als longe ; pos pedicel sub-conical, ca 1.5 imes as long as pedicel,
wi h nume ous pale se ulae longe do sally and apically; s ylus almos wice as long as scape, pedicel
and pos pedicel combined.
PalPus. Elonga e o al, abou 3 imes as long as wide. Black in g ound colou wi h g ey mic o ichia,
do sally clo hed in s ong, long sil e y-whi e and black se ae, bea ing one s ong black sub-apical se a
sligh ly sho e han palpus; less nume ous se ae p esen en ally wi h dis inc se a on en al apex.
P oboscis. Black, mos ly glab ous, se ae p esen en ally, sligh ly la ge han palpus.
Ho ax. Elonga ed, o e all black and la gely shiny, wi h long se ae black, sho ones pale. Pos p ono al
lobe, epis e num, mesopleu on and s e nopleu on almos undi e en ia ed, scu ellum sho ; no opleu on,
Fig. 4. Te minalia o Tachyd omia can ab ica Gonçal es, G oo ae & And ade sp. no ., holo ype
(RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial
lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
19
anepis e num, ka epime on, me on and pos scu ellum well de eloped. Pleu a black, o e all glab ous
wi h de ined pa ches o g ey mic o ichia: p os e num and p o ho acic epis e num pa ially, bu densely
co e ed, appea ing sub iangula in la e al iew; ka epime on, me on, scu ellum and uppe pa o
he me a ho ax hinly co e ed. Pos p ono al lobe bea ing ca 4 se ae la e ally, no do socen als, eigh
ac os ichal se ae, bise ia e, o equal leng h; no opleu on wi h 1 s ong, p ominen , se a plus 2 small
se ae; 4 small, incu a ed, p escu ella se ae; scu ellum bea ing 2 s ong, long se ae medially; 1 p e-ala
se a.
Wing. S enop e ous. Lobed dis al apex, subo al, wi h minu e digi a ion. S alk-like po ion da k b own,
dis al ⅔ o lobe black wi h basal ⅓ and digi a ion anslucid (appea ing whi e unde mos ligh condi ions)
(Fig. 20C). No eins dis inguishable. Uni o mly co e ed in mic o ichia.
legs. Fo e emu s ou and in la ed basally, mid emu less so and hind emu leas . Black wi h he
ollowing pale b own/yellowish: basal po ion o coxae, ochan e s, basal po ion o mid and hind
emo a, dis al apical su ace o o e and mid emo a, knees, basal 4/5 su ace o a some e 1 and basal
⅔ su ace o a some e 2. Legs mos ly co e ed wi h egula ows o nume ous black and pale se ulae,
excep o coxae, ochan e s and pos e o en al su ace o emo a; an e o en al su ace o coxae,
emo a (excep mos o en al su ace) and ibiae co e ed by g ey mic o ichia; coxae wi h se e al
sho , downwa d di ec ed, do sal an e oapical se ae. Femo a wi h a ew dis inc apical se ae. Fo e ibia
bea ing spa se cilia ion o hai -like se ae (sho e han maximum diame e o ibia) wi h sligh ly cu ed
ips, and ow o long, e ec , se ae p esen a i s dis al ⅓ pos e odo sal su ace. Ta some e 1 o o e a sus
wi h s ong and long ( wice a some e 1 wid h) se ae; a pos e io dis al su ace wi h ow o dis inc ,
sho , black se ae. Mid ibia wi h spu a an e o en al apex, wi h ba ely no iceable apical elonga ion,
abou as long as diame e o ibia a apex (Fig. 19H); spu has se e al dis inc se ae and, on dis al hal
ma gin, i e sho , s ou , cu ed, spinose se ae.
abdoMen. Black, uni o mly co e ed wi h g ey mic o ichia. Te gi es and s e ni es wi h e enly dis ibu ed
se ae; apical s e ni es wi h long, dis inc se ae.
e Minalia (Fig. 4). Subglobula , mos ly co e ed wi h g ey mic o ichia, da k b own. Righ su s ylus
sho wi h an e io ma gin p oduced in o sho slende p ojec ion, mos ly glab ous, wi hou mic o ichia,
bea ing s onge se ae mos ly on do sal ma gin, wi h se e al (ca 8) dis inc den icles, mos o which
agg ega ed on dis al apex. Righ epand ial lamella wi h i egula ly placed long se ae, wi h pa ch o
simila se ae on la e al su ace. Ce ci o simila leng h, bo h wi h long se ae o unequal leng h, enclosed
in epand ial lamellae. Le epand ial lamella sligh ly sho e han le ce cus, bilobed, wi h a ew long
se ulae on apical ma gin. Le su s ylus sub ec angula wi h ounded apical ma gin, 3 imes as long as
wide, dis inc i ely longe han ce cus, densely co e ed wi h g ey mic o ichia wi h equally long se ae
on apical ma gin.
Female
Simila o male, excep o ollowing ea u es: mic op e ous, wi h wings ound, b ownish, biloba e,
bea ing 1 se a on apical ma gin o each lobe, co e ed by g ey mic o ichia (Fig. 20D); legs co e ed wi h
egula ows o se ae; spu on mid ibia absen ; ce cus pale b own wi h g ey mic o ichia and se ae; no
longe se ae on apical s e ni es.
Dis ibu ion
Spain. Cu en ly only known om he Can ab ian Moun ains.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
20
Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no .
u n:lsid:zoobank.o g:ac :1FF1B253-96ED-46A8-B8EB-1822B9789B2A
Figs 1, 5, 15E–F, 17E–F, 19D, 20A–B, 25
Diagnosis
O e all da k. Mic op e ous, wi h minu e squami o m wings in bo h sexes. Palpi, p oboscis and an ennae
black; pos pedicel lanceola e, ca 1.5 imes longe han pedicel. Legs wi h a colou pa e n o yellowish
and da k b own o black; o e ibia wi h cilia ion o long hai -like se ae. Abdomen black, co e ed wi h
g ey mic o ichia and wi h dis inc , s ong, se ae on pos e io ma gin o i s s e ni e. I sha es gene al
simila i ies wi h T. can ab ica sp. no ., T. s enop e a sp. no . T. nig ohi a sp. no . and T. lusi anica,
om which i can be mainly dis inguished by mic op e y in bo h sexes - while he males o he o he
species a e s enop e ous - and male e minalia.
E ymology
The species is named a e he dip e ologis Ma in J. Ebeje o his con ibu ion o he ad ancemen o
he knowledge on Po uguese Dip e a.
Ma e ial examined
Holo ype
PORTUGAL • 1 ♂; Ma ão, San a Ma ia de Ma ão; 39º23′49.2″ N, 7º21′51.4″ W; 14 Ma . 2015;
A.R. Gonçal es and R. And ade leg.; RBINS.
Pa a ypes
PORTUGAL • 3 ♂♂, 3 ♀♀; Ma ão, San a Ma ia de Ma ão; 39º23′49.2″ N, 7º21′51.4″ W; 14 Ma .
2015; A.R. Gonçal es and R. And ade leg.; RBINS • 2 ♂♂, 2 ♀♀; same collec ion da a as o p ecedcing;
ZFMK.
Addi ional ma e ial examined
PORTUGAL • 5 ♂♂, 1 ♀ (all male e minalia s udied, RBINS); Gou eia, Aldeias; 40º28′05.4″ N,
7º35′15.7″ W; 25 Ap . 2013; A.R. Gonçal es and R. And ade leg. • 3 ♂♂, 4 ♀♀ (all male e minalia
s udied, RBINS); A ganil, Ben ei a (Ma a da Ma ga aça); 40º12′59.6″ N, 7º55′12.5″ W; 22 Feb. 2014;
A.R. Gonçal es leg. • 10 ♂♂, 8 ♀♀; Ma ão, San a Ma ia de Ma ão; 39º23′49.2″ N, 7º21′51.4″ W;
14 Ma . 2015; A.R. Gonçal es and R. And ade leg. • 4 ♂♂, 10 ♀♀; Gua da, Gou eia, São Cosmado;
40°28′4.49″ N, 7°35′25.18″ W; 20 Ap . 2015; A.R. Gonçal es leg. • 1 ♀ ( e minalia s udied, RBINS);
Gua da, Seia, Al oco da Se a; 40°18′03.4″ N, 7°41′22.6″ W; Ap . 2015; A.R. Gonçal es leg. • 1 ♂, 2 ♀♀
(all male e minalia s udied, RBINS); Gua da, Gou eia, Aldeias (Ei as); 40°28′26.5″ N, 7°35′49.6″ W;
20 Ap . 2015; A.R. Gonçal es leg. • 3 ♂♂, 4 ♀♀; Vila Real, Lamas de Ôlo; 41º22′27.6″ N, 7º48′23.7″ W;
30 Ap . 2016; R. And ade leg. • 4 ♂♂, 4 ♀♀; Mondim de Bas o, E melo; 41º22′44.0″ N, 7º51′14.4″ W;
30 Ap . 2016; R. And ade leg. • 1 ♂, 3 ♀♀; Cas o Labo ei o; 42º00′09.3″ N, 8º10′09.6″ W; 29 May
2016; R. And ade leg. • 4 ♀♀; Viseu, Pó oa Dão; 40°33′03.9″ N, 7°57′05.6″ W; 18 Ma . 2017; J.
Almeida leg. • 1 ♂, 1 ♀; Vouzela, Campia; 40°40′53.0″ N, 8°13′18.5″ W; 21 Ma . 2017; E. Ma abu o
leg. • 3 ♂♂, 1 ♀; Gua da, Panóias de Cima; 40°29′10.2″ N, 7°13′18.4″ W; 1 Ap . 2017; A.R. Gonçal es
and R. And ade leg. • 3 ♂, 2 ♀♀; Sabugal, Sabugal; 40°20′39.9″ N, 7°04′18.6″ W; 1 Ap . 2017; A.R.
Gonçal es and R. And ade leg. • 1 ♂, 2 ♀♀; Sabugal, Quad azais; 40°18′30.6″ N, 6°59′08.7″ W; 1 Ap .
2017; A.R. Gonçal es and R. And ade leg. • 1 ♂, 5 ♀♀; Gua da, Adão; 40°27′03.0″ N, 7°09′41.8″ W;
1 Ap . 2017; A.R. Gonçal es and R. And ade leg. • 4 ♂♂, 2 ♀♀; Fa e, Felguei as; 41°31′24.0″ N,
8°06′01.2″ W; 9 Ap . 2017; R. And ade and J. Almeida leg. • 1 ♂; Fa e, T a assós; 41°30′06.4″ N,
8°10′55.6″ W; 9 Ap . 2017; R. And ade and J. Almeida leg. • 3 ♂♂, 7 ♀♀; Coimb a, Lousã, Ca a edo ;
40°04′20.9″ N, 8°13′04.2″ W; 19 Ap . 2017; A.R. Gonçal es and D. Rod igues leg.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
21
SPAIN • 10 ♂♂, 21 ♀♀ (all male e minalia s udied, RBINS); Ou ense, Viana do Bolo; 42º09′06.2″ N,
7º07′12.3″ W; 11 May 2014; A.R. Gonçal es and R. And ade leg. • 3 ♀♀ (all male e minalia s udied,
RBINS); Ou ense, O Bolo; 42º15′03.2″ N, 7º06′46.9″ W; 11 May 2014; A.R. Gonçal es and R. And ade
leg. • 8 ♂♂, 12 ♀♀; Ou ense, A Gudiña; 42º04′14.6″ N, 7º07′47.5″ W; 11 May 2014; A.R. Gonçal es
and R. And ade leg. • 1 ♂; Mos ei o de Ca boei o; 42°45′18.8″ N, 8°14′46.6″ W; 6 May 2018; A.R.
Gonçal es leg. • 3 ♂♂, 2 ♀♀; Galiza, Ou ense, Piño ; 42°31′17.3″ N, 8°00′14.3″ W; 7 May 2018; A.R.
Gonçal es leg.
Desc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
Male
Measu eMen s. Body leng h: 1.9–2.4 mm (n = 5). Wing leng h: 0.05–0.16 mm (n = 5).
Head. La e oclina e ocella s ¾ as long as pos pedicel. P oclina e e icals ca ½ as long as pos pedicel.
an enna. Pos pedicel lanceola e, ca 2 imes as long as pedicel.
Ho ax. Pos p ono al wi h ca 6 se ae la e ally, 7 ac os ichal se ae; no opleu on wi h 1 s ong, p ominen ,
se a plus 4 small se ae; scu ellum wi h 4 se ae medially, cen al pai long and hick, la e al hick bu
sho e .
Wing (Fig. 20A). Mic op e ous, co e ed by g ey mic oscopic se ulae, no se ae p esen .
Fig. 5. Te minalia o he holo ype o Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no .,
holo ype (RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le
epand ial lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
22
legs. Coxae, emo a and mos o ibia da k b own o black; ochan e s, knee, an e o en al su ace
o ibia, dis al ¼ o a some e 1, dis al hal o a some e 2 and ollowing a some es yellowish. Spa se
cilia ion o hai -like se ae on o e ibia sligh ly longe han maximum diame e o ibia.
abdoMen. Fi s e gi e wi h di e en ia ed, s ong pos e oma ginal se ae.
e Minalia (Fig. 5). Righ su s ylus co e ed wi h long se ulae, wi hou mic o ichia, bea ing s onge
se ae mos ly on do sal ma gin, wi h se e al (ca 10) dis inc den icles, ⅔ o which agg ega ed on dis al
apex. Righ ce ci wi h b oad ip, le na owing dis ally, bo h wi h long se ae o unequal leng h on apical
hal , enclosed in epand ial lamellae. Le epand ial lamella ⅔ as long as le ce cus. Le su s ylus 2
imes as long as wide, longe han ce ci, wi h sho se ae o equal leng h on apical ma gin.
Female
Simila o male, including being mic op e ous (Fig. 20B), excep o ollowing ea u es: no dis inc i e
hai s o se ae on o e emu ; spu on mid ibia absen ; ce cus pale b own wi h g ey mic o ichia and
se ae; no longe se ae on apical s e ni es.
Dis ibu ion
Po ugal and Spain. Mos ly dis ibu ed in he no hwes e n Ibe ia (No h and Cen al Po ugal and
Galicia), wi h jus one locali y sou h o he Tagus i e (San a Ma ia de Ma ão).
Tachyd omia ibe ica (A ias, 1919)
Figs 1, 6–8 16A–B, 18C–D
Piel ainia ibe ica A ias, 1919: 479 (male and emale).
Tachyd omia ibe ica Shamshe & G oo ae 2018: 425 (comb. no .).
Diagnosis
P edominan ly da k and glab ous. Wings, o any aces o i , absen . Palpi, p oboscis and an ennae
black. Pos pedicel subconical, 2 imes longe han pedicel; s ylus 2 imes as long as scape, pedicel and
pos pedicel combined. Legs wi h da k b own o black and yellow colou pa e n. Abdomen black, e gi es
and s e ni es mos ly co e ed by g ey mic o ichia and by spa se, e y sho , se ae; apical s e ni es wi h
long, dis inc , se ae.
Type ma e ial (los )
Holo ype
SPAIN • Huel a, Cala; 22 Feb. 1915; C. Bolí a leg.
Pa a ypes
SPAIN • se e al specimens; Sego ia, San Ra ael; (sp ing) 1917; C. Bolí a leg.
Addi ional ma e ial (los )
SPAIN • se e al specimens; Mad id, El Esco ial; C. Bolí a leg. • Cuenca, Ciudad Encan ada; J.G.
Collado leg.
Ma e ial examined
SPAIN • 12 ♂♂, 7 ♀♀ (all male e minalia s udied, RBINS); Badajoz, Ten udía; 38º03′16.17″ N,
6º20′14.7″ W; 3 Ap . 2015; A.R. Gonçal es and R. And ade leg. • 5 ♂♂, 5 ♀♀; same collec ion da a
as o p eceding; ZFMK • 8 ♂♂, 13 ♀♀ (all male e minalia s udied, RBINS); Sego ia, El Espina ;
40º42′35.3″ N, 4º14′08.3″ W; 1 Ap . 2015; A.R. Gonçal es and R. And ade leg. • 3 ♂♂, 4 ♀♀ (all
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
23
male e minalia s udied, RBINS); Mad id, Mon ejo de la Sie a, P ádena del Rincón; 41°03′03.6″ N,
3°31′10.8″ W; 23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 3 ♂♂; Mad id, Mon ejo de la Sie a,
P ádena del Rincón; 41°02′40.8″ N, 3°29′28.7″ W; 23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. •
3 ♂♂, 9 ♀♀; Mad id, A oyo de la Fuen ecilla (La Hi uela); 41°04′18.0″ N, 3°27′28.2″ W; 23 Ap . 2017;
A.R. Gonçal es and P. Ál a ez leg. • 2 ♂♂, 1 ♀; Mad id, La Hi uela; 41°04′59.3″ N, 3°25′45.3″ W;
23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 2 ♂♂, 1 ♀; Guadalaja a, El Ca doso de la Sie a;
41°05′46.2″ N, 3°28′56.1″ W; 23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 6 ♂♂, 9 ♀♀; Mad id,
Pinilla de Bui ago; 40°57′02.0″ N, 3°43′11.6″ W; 24 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. •
3 ♂♂, 2 ♀♀; Mad id, Mi a lo es de la Sie a; 40°50′24.4″ N, 3°48′24.4″ W; 24 Ap . 2017; P. Ál a ez
leg. • 4 ♂♂, 5 ♀♀; Mad id, Rasca ía, Calle del Aguilón; 40°52′35.6″ N, 3°50′44.0″ W; 24 Ap . 2017;
A.R. Gonçal es and P. Ál a ez leg. • 5 ♂♂, 2 ♀♀; Mad id, Lozoya; 40°58′07.9″ N, 3°48′01.6″ W; 24
Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 3 ♂♂, 5 ♀♀; Mad id, Mi a lo es de la Sie a (Fuen e
del Cu a); 40°48′51.1″ N, 3°47′02.2″ W; 7 May 2017; P. Ál a ez leg. • 5 ♂♂, 3 ♀♀; Mad id, Mi a lo es
de la Sie a (Fuen e del Cu a); 40°49′19.2″ N, 3°47′21.5″ W; 7 May 2017; P. Ál a ez leg.
PORTUGAL • 1 ♂, 2 ♀♀ (all male e minalia s udied, RBINS); Po o de Mós, A imal; 39º31′54.6″ N,
8º52′20.7″ W; 9 Ma . 2014; A.R. Gonçal es leg. • 1 ♂; Lei ia, Pombal, Cumiei a; 39°53′33.5″ N,
8°35′53.6″ W; 18 Feb. 2017; S. Hen iques leg.; NHMUK • 10 ♂♂, 12 ♀♀ (all male e minalia s udied,
RBINS); Po o de Mós, A imal; 39º31′54.6″ N, 8º52′20.7″ W; 11 Ma . 2017; A.R. Gonçal es and F.
Ba os leg. • 4 ♂♂, 5 ♀♀; Lei ia, Pombal, Cumiei a; 39°53′33.5″ N, 8°35′53.6″ W; 18 Ma . 2017; A.R.
Gonçal es and J. Rose e leg. • 3 ♂♂, 7 ♀♀; Po o de Mós, A imal; 39º31′54.6″ N, 8º52′20.7″ W; 8
Ap . 2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg. • 15 ♂♂, 13 ♀♀; Po o de Mós, A imal;
39º31′54.6″ N, 8º52′20.7″ W; 16 Ap . 2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg. • 4 ♂♂,
6 ♀♀; Po o de Mós; 39°31′56.53″ N, 8°52′17.86″ W; 16 Ap . 2018; A.R. Gonçal es, S. Ma ins and
F. Ba os leg. • 1 ♂; Po o de Mós; 39°33′52.41″ N, 8°49′13.07″ W; 16 Ap . 2018; A.R. Gonçal es,
S. Ma ins and F. Ba os leg. • 2 ♂♂, 3 ♀♀; Po o de Mós; 39°32′20.18″ N, 8°49′22.41″ W; 16 Ap .
2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg. • 2 ♂♂, 2 ♀♀; Po o de Mós; 39°30′37.37″ N,
Fig. 6. Te minalia o Tachyd omia ibe ica (A ias, 1919) om Spain, Mad id (RBINS). A. Righ su s ylus
and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial lamella and le su s ylus.
D. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
24
8°50′3.13″ W; 16 Ap . 2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg. • 1 ♂, 2 ♀♀; Po o de Mós;
39°26′16.57″ N, 8°55′6.93″ W; 16 Ap . 2018; A.R. Gonçal es, S. Ma ins and F. Ba os leg.
Redesc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
Male
Measu eMen s. Body leng h: 1.9–2.5 mm (n = 5).
Head. Ocella ube cle glab ous, shiny black. La e oclina e ocella s ca ½ smalle han leng h o
pos pedicel. P oclina e e icals ca ⅔ sho e han leng h o pos pedicel.
an enna. Pos pedicel 2 imes as long as pedicel.
PalPus. Less nume ous se ae p esen en ally wi h a ew dis inc se ae.
Ho ax. Scu ellum almos undis inguishable and pos scu ellum poo ly de eloped. Pos p ono al lobe
wi h ca 8 se ae la e ally, ca 8 ac os ichal se ae, i egula bise ia e, o equal leng h, and 6 simila o he
se ae placed i egula ly; no opleu on wi h 2 se ae; 2 se ae nea meso ho acic spi acle; 2 long, incu a ed
p escu ella se ae; scu ella se ae absen .
Wing. Absen .
legs. Da k b own o black wi h ollowing yellow: ochan e s, apical hal o o e and mid emo a, do sal
su ace and basal ⅓ o o e and mid ibiae, mos o a some es 1 and 2, excep o black apical ma gin.
Cilia ion o hai -like se ae absen om o e ibia. Spu absen .
Fig. 7. Te minalia o Tachyd omia ibe ica (A ias, 1919) om Spain, Sego ia, El Espina (Cen al
Sys em) (RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le
epand ial lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
25
legs. O e all yellow, excep o ollowing b own o black po ions: pos e odo sal su ace o coxae,
apical ¼ do sal su ace, pos e io and an e io su aces o hind emu , mos o hind ibia, a some e 5 o
o e and mid-legs, dis al apex o a some es 1 and 2, dis al ⅓ o a some e 3, dis al ¾ o a some es 4
and 5. Mid ibia an e o en al apical spu p oduced in o dis inc and long apical elonga ion (Fig. 19B),
longe han diame e o ibia a apex; mos ly glab ous en ally bu do sally co e ed by mic o ichia,
wi h a ew dis inc se ae and, on basal hal ma gin, 3 sho , s ou , cu ed se ae. Elonga ion mos ly
glab ous, wi h a ew se ae a ising ma ginally and apically.
e Minalia (Fig. 11). Righ epand ial lamella wi h long, e ec se ae mos ly on apical hal . Righ su s ylus
bi u ca ed in o sho p ojec ion and e y long and slende p ojec ion; mos ly glab ous bu wi h long,
cu ed la e al se ae and 2 den icle-like se ae a dis al ma gin o longe p ojec ion; sho p ojec ion wi h
simila se ae a dis al ma gin. Righ ce cus sligh ly longe han le , bo h enclosed in epand ial lamellae.
Le epand ial lamella as long as le ce cus. Le su s ylus subcylind ical, na owing p oxima ely,
4 imes as long as wide, as long as igh ce cus, wi h se ae on la e al ma gins and apical ⅓.
Female
Simila o male, excep o ollowing ea u es: s enop e ous (leng h o wing (n = 2): 0.7–0.8 mm), wi h
e y minu e lobed apex, s alk-like po ion yellowish wi h lobe ligh b own, co e ed by g ey mic o ichia
(Fig. 21C); legs co e ed wi h egula ows o se ae, wi h dis inc ci cle o se ae on o e emu and
an e oapical se ae on coxae, bu no o he dis inc i e hai s o se ae; spu on mid ibia absen ; ce cus pale
b own wi h g ey mic o ichia and se ae.
Va iabili y
The e is a a iabili y in he shape o he wing lobe in males be ween he popula ions sampled in he
F ench Py enees compa ed wi h hose om Spain. In he o me , he lobed apex is dis inc i ely la ge
and co di o m, while in he la e he lobed apex is compa a i ely smalle and o al.
Fig. 11. Te minalia o he opo ype o Tachyd omia pandellei (Séguy, 1941) om F ance, Hau es-Py énées,
A ens-Ma sous, lec o ype (RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h
ce ci. C. Le epand ial lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
32
Dis ibu ion
Spain and F ance. I is known om he F ench Py enees and a ew locali ies in he no he n Spanish
p o ince o Bu gos and he Basque Coun y.
Tachyd omia piel aini (Gil Collado, 1936)
Figs 1, 12, 16E–F, 18G–H, 19C, 21B–C
A iasella piel aini Gil Collado, 1936: 191.
Tachyd omia piel aini – Shamshe & G oo ae 2018: 425 (comb. no .).
Diagnosis
Shiny black wi h dis inc yellow pa s. Wing dimo phic: male s enop e ous; wing wi h o al apex; s alk-
like p ocess yellow o ligh b own; lobed apex wi h hyaline cells, eins and dis al ma gin black; emale
s enop e ous, s alk-like po ion yellowish wi h minu e lobed apex pale b own. P oboscis and an ennae
black; palpi yellow; pos pedicel oundish, app oxima ely as long as pedicel. Legs o e all yellow only
wi h he dis al a some es black. Abdomen black, e gi es and s e ni es o e all co e ed wi h se ae; g ey
mic o ichia p esen a las apical e gi e and mos s e ni es, esul ing in shiny appea ance o do sal
su ace.
Type ma e ial (no examined, los )
SPAIN • 1 ♀; As u ias, Po a de Enol; C. Bolí a leg.
Addi ional ma e ial examined
SPAIN • 3 ♂♂, 3 ♀♀; As u ias, Cangas de Onís, Co adonga; 43°18′42.4″ N, 5°03′28.0″ W; 26. Ap .
2011; R. And ade leg. • 2 ♂♂, 2 ♀♀; same collec ion da a as o p eceding; ZFMK • 2 ♂♂, 4 ♀♀ (all
male e minalia s udied, RBINS); As u ias, Cangas de Onís; 43º21′14.6″ N, 5º07′25.9″ W; 9 Ap . 2016;
A.R. Gonçal es leg.
Redesc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
Male (p e iously undesc ibed)
Measu eMen s. Body leng h: 2.6–2.9 mm (n = 5). Wing leng h: 0.9–1.1 mm (n = 5).
Head. Ocella ube cle glab ous. La e oclina e ocella s 2 imes as long as pos pedicel. P oclina e
e icals 1.8 imes as long as pos pedicel.
an enna. Yellow. Pos pedicel oundish, as long as wide and, app oxima ely as long as pedicel; s ylus
almos 4 imes as long as scape, pedicel and pos pedicel combined.
PalPus. Abou 4 imes as long as wide. Yellow in g ound colou .
Ho ax. Pos p ono al lobe, no opleu on, epis e num, anepis e num, s e nopleu on, ka epime on and
me on weakly di e en ia ed. Scu ellum sho , pos scu ellum longe and me ano um well de eloped.
P os e num and basal hal o epis e num densely co e ed by g ey mic o ichia. Pos p ono al lobe
bea ing 7 se ae la e ally, 5 ac os ichal se ae, i egula ly placed; no opleu on wi h 1 s ong, p ominen ,
e y long se a, plus 3 smalle ones
Wing (Fig. 21B). Lobed apex o al. S alk-like po ion igid, yellow o ligh b own; lobed apex wi h
hyaline cells, eins and dis al ma gin black. Vena ion e y educed (cos al, longi udinal and c oss eins
dis inguishable), o ming 4 cells.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
33
legs. O e all yellow, wi h he ollowing b own o black: do sal s ip on o e and mid emo a, pos e io
coxae, a some e 5 o o e and mid-legs, apical po ions o a some es 2 and 3, a some es 4 and 5 o
hind leg. Mid ochan e wi h se e al black an e o en al ma ginal se ae. Mid emu wi h small oundish
pos e o en al p ojec ion on basal su ace wi h se e al black den icle-like se ae and ca 3 black se ae.
Mid ibia an e o en al apical spu p oduced in o dis inc , long elonga ion (Fig. 19C); sligh ly longe
han diame e o ibia a apex. Spu co e ed wi h mic o ichia and > 10 sho , blun den icle-like se ae;
addi ionally, wi h 6 longe , s ou , cu ed se ae along la e al ma gin. Elonga ion mos ly glab ous wi h a
ew se ae a ising ma ginally and apically.
abdoMen. Shiny black, wi h g ey mic o ichia co e ing only las e gi e and almos all s e ni es, excep
o s e ni es 1 and 2. Te gi es and s e ni es o e all co e ed wi h se ae, excep o do sal su ace o all
e gi es and mos o s e ni e 1 (dis al ma gin wi h a ew se ae); apical s e ni e and e gi e wi h longe
se ae.
e Minalia (Fig. 12). Righ su s ylus sho wi h i egula ma gins, na owing dis ally, bea ing long
se ae, wi h se e al (ca 8) dis inc den icle-like se ae agg ega ed on dis al ma gin. Righ ce cus longe
han le . Righ ce cus wi h se ae on apical ⅓; le ce cus wi h se ae o unequal leng hs on apical hal
and 2 long apical se ae. Le epand ial lamella ⅓ sho e han le ce cus, wi h se ae o simila leng h on
apical hal o en al su ace and on apex o do sal ma gin. Le su s ylus longe han igh ce cus, wi h
e y long se ae on la e al and apical ma gins.
Female
Simila o male, excep o ollowing ea u es: s enop e ous (leng h o wing (n = 2): 0.7–0.8 mm), wi h
e y minu e lobed apex, s alk-like po ion yellowish wi h lobe ligh b own, co e ed by g ey mic o ichia
(Fig. 21C); legs co e ed wi h egula ows o se ae, wi h dis inc ci cle o se ae on o e emu and
an e oapical se ae on coxae; wi hou o he dis inc i e hai s o se ae; spu s on mid ibia absen ; ce cus
pale b own wi h g ey mic o ichia and se ae.
Fig. 12. Te minalia o Tachyd omia piel aini (Gil Collado, 1936) om Spain, As u ias, Co adonga
(RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial
lamella and le su s ylus. D. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
34
Dis ibu ion
Spain. Only known om he Picos de Eu opa moun ain ange.
Tachyd omia semiap e a (Gil Collado, 1923)
Figs 1, 13, 16C–D, 18E–F, 19E–F, 21D–E
A iasella semiap e a Gil Collado, 1923: 150 (male and emale).
Tachyd omia semiap e a – Shamshe & G oo ae 2018: 425 (comb. no .).
Diagnosis
O e all da k species wi h dis inc yellow pa s. Wing dimo phic: male s enop e ous; oblong apex; s alk-
like po ion ligh b own wi h dis inc black spo on lobed apex; emale mic op e ous, wi h wing ound,
b ownish. Palpi, p oboscis and an ennae black; pos pedicel oundish, app oxima ely as long as pedicel.
Legs wi h colou pa e n o yellowish and da k b own o black. Male legs wi h ollowing ea u es:
o e ibia black, s ou and in la ed; mid ibia bea ing wo p ojec ions and ow o i e spinose se ae on
pos e o en al basal su ace. Abdomen black, o e all co e ed wi h mic o ichia and spa se se ae; wo
apical s e ni es wi h long se ae.
Type ma e ial (no examined, los )
SPAIN • ca 20 specimens; Á ila, Valle de I uelas; May 1919; C. Bolí a leg.
Addi ional ma e ial (no examined, los )
SPAIN • Ciudad Real, Na as de Es ena; C. Bolí a leg. • Mad id, El Esco ial; C. Bolí a leg.
Ma e ial examined
Topo ype
SPAIN • 3 ♂♂, 16 ♀♀; Á ila, El Ba aco; 40º23′08.4″ N, 4º34′05.7″ W; 13 Ap . 2016; A.R. Gonçal es
and R. And ade leg.; RBINS.
Addi ional ma e ial
PORTUGAL • 2 ♂♂, 1 ♀; Mi anda do Dou o; 41°33′25.9″ N, 6°15′43.3″ W; 3 May 2015; A.R.
Gonçal es leg. • 3 ♂♂, 9 ♀♀ (all male e minalia s udied, RBINS); B agança, Cas elos; 41º50′22.1″ N,
6º53′24.2″ W; 10 May 2015; A.R. Gonçal es and R. And ade leg. • 8 ♂♂, 5 ♀♀; Ca azeda de Ansiães,
Fon elonga; 41º14′16.2″ N, 7º14′57.6″ W; 1 May 2016; R. And ade leg. • 5 ♂♂, 5 ♀♀; same collec ion
da a as o p eceding; ZFMK.
SPAIN • 10 ♂♂, 11 ♀♀ (all male e minalia s udied, RBINS); Zamo a, Alcañices; 41º41′26.9″ N,
6º21′45.1″ W; 11 May 2015; A.R. Gonçal es and R. And ade leg. • 4 ♂♂, 6 ♀♀; Toledo, Los Na alucillos;
39º36′02.0″ N, 4º42′07.0″ W; 15 Ap . 2016; A.R. Gonçal es and R. And ade leg. • 7 ♂♂, 1 ♀; Toledo,
Los Na alucillos; 39º34′25.0″ N, 4º44′57.0″ W; 15 Ap . 2016; A.R. Gonçal es and R. And ade leg. •
5 ♂♂, 4 ♀♀; Guadalaja a, El Ca doso de la Sie a; 41°05′46.2″ N, 3°28′56.1″ W; 23 Ap . 2017; A.R.
Gonçal es and P. Ál a ez leg. • 4 ♂♂, 3 ♀♀; Guadalaja a, El Ca doso de la Sie a (Río Be bellido);
41°06′22.6″ N, 3°24′59.7″ W; 23 Ap . 2017; A.R. Gonçal es and P. Ál a ez leg. • 5 ♂♂, 2 ♀♀;
Salamanca, La Albe ca; 40º29′04.0″ N, 6º05′10.2″ W; 25 Ap . 2017; A.R. Gonçal es leg. • 9 ♂♂, 6 ♀♀;
Mad id, Bus a iejo; 40°50′29.8″ N, 3°45′59.1″ W; 21 May 2017; P. Ál a ez leg. • 17 ♂♂, 23 ♀♀;
Cáce es, Alía; 39°30′40.3″ N, 5°20′47.7″ W; 23 Ap . 2018; P. Ál a ez leg. • 3 ♂♂, 5 ♀♀; Cáce es,
Be zocana; 39°24′55.6″ N, 5°25′10.3″ W; 23 Ap . 2018; A.R. Gonçal es and P. Ál a ez leg.
Redesc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
35
Male
Measu eMen s. Body leng h: 2.4–2.8 mm (n = 5). Wing leng h: 1.2–1.3 mm (n = 5).
Head. La e oclina e ocella s 2.5 imes as long as pos pedicel. P oclina e e icals 2 imes as long as
pos pedicel.
an enna. Ligh b own. Pos pedicel oundish, as long as wide; s ylus mo e han 4 imes as long as scape,
pedicel and pos pedicel combined.
Ho ax. Wi h e y long black se ae. Well-dis inguished scle i es, wi h clea sepa a ion be ween
anepis e num and anepime on; pos p ono al lobe e y la ge; scu ellum and me ano um well de eloped,
pos scu ellum poo ly de eloped. P os e num and epis e num densely co e ed by g ey mic o ichia.
Pos p ono al lobe wi h 5 se ae la e ally, mesono um wi h 6 sca e ed se ae o equal leng h; 5 se ae
nea ala egion; no opleu on wi h 1 s ong, p ominen , e y long se a; 2 se ae nea pos e io ma gin o
pos p ono al lobe; scu ellum wi h 2 s ong, long se ae medially.
Wing (Fig. 21D). Lobed apex oblong, wi hou digi a ion. S alk-like p ocess e y lexible, ligh b own
wi h dis inc black spo on lobed apex. Vena ion e y educed (cos al, longi udinal and c oss eins
dis inguishable), o ming 4 cells.
legs. Fo e ibia s ou and in la ed dis ally. O e all da k b own o black, ollowing po ions yellow:
ochan e s, an e io apical hal and apex o o e and mid ibiae, do sal s ip and apical hal o o e and
mid ibiae, o e and mid a some es 1, 2, 3, basal ⅔ 4, hind a some es 1 and 2. Fo e ibia wi h ows o
long, e ec se ae; mid ibia bea ing ow o 5 s ong, spine-like pos e o en al basal se ae. Mid ibia wi h
2 an e o en al apical p ojec ions (Fig. 19E–F): 1 sligh ly sho e han diame e o ibia a apex; clo hed
in mic o ichia, se e al dis inc se ae and 2 sho , s ou , cu ed spinose se ae on ma gin o dis al hal ;
second p ojec ion as long as diame e o ibia a apex wi h a ew long se ae.
Fig. 13. Te minalia o Tachyd omia semiap e a (Gil Collado, 1923) (RBINS). A. Righ su s ylus and
igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial lamella and le su s ylus. D. Righ
su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
36
e Minalia (Fig. 13). Righ epand ial lamella wi h long, e ec se ae on apical hal . Righ su s ylus
sho , na owing dis ally, wi h spa se mic o ichia, bea ing long, i egula ly cu ed se ae, wi h se e al
(ca 6) dis inc den icle-like se ae, agg ega ed on dis al ma gin. Righ ce cus wi h se ae on apical hal
and dis inc apical se a; le ce cus wi h apical se ae o unequal leng hs. Righ ce cus longe han le ,
bo h enclosed in epand ial lamellae. Le epand ial lamella sho e han le ce cus, deeply bilobed.
Le su s ylus 1.5 imes as long as wide, app oxima ely as long as igh ce cus, wi h e y long se ae,
la e oclina e, acing inwa ds.
Female
Simila o male, excep o ollowing ea u es: mic op e ous, wi h wing ound, b ownish, bea ing 1
long se a and 1 sho se a on apical ma gin, co e ed by g ey mic o ichia (Fig. 21E); legs co e ed wi h
egula ows o se ae, wi h dis inc apical se ae on o e emu and an e oapical se ae on coxae; wi hou
o he dis inc i e se ae; spu s on mid ibia absen ; ce cus pale b own wi h g ey mic o ichia and se ae.
Dis ibu ion
Spain and Po ugal. I is known om se e al locali ies along he Ibe ian Cen al Sys em, and om
he Mon es de Toledo moun ain ange, he no heas o Po ugal and om one locali y in he Spanish
p o ince o Zamo a nea he bo de wi h Po ugal.
Tachyd omia s enop e a Gonçal es, G oo ae & And ade sp. no .
u n:lsid:zoobank.o g:ac :AB1CBE5D-22D9-4153-9EE5-FA711157B977
Figs 1, 14, 15G–H, 17G–H, 19G, 21F–G
Diagnosis
O e all e y da k. Wing dimo phic: male s enop e ous; wing wi h sligh ly lobed dis al apex, da k o
mos pa and lobe black and whi e; emale mic op e ous, wing biloba e. Palpi, p oboscis and an ennae
black; pos pedicel lanceola e, ca 1.5 imes as long as pedicel. Legs almos comple ely black. Abdomen
black, e gi es mos ly glab ous and wi hou g ey mic o ichia.
E ymology
The name o his species means ‘na ow wing’ and de i es om he combina ion o wo G eek wo ds:
he p e ix s eno- (s enos), meaning ‘na ow’, wi h he su ix -p e a (p e á), meaning ‘wing’. Hence, he
name e lec s he e y na ow lobed dis al apex o he male wing.
Type ma e ial examined
Holo ype
PORTUGAL • 1 ♂; Gou eia, São Ped o; 40°29′10.9″ N, 7°34′38.5″ W; 25 Ap . 2013; A.R. Gonçal es
and R. And ade leg.; RBINS.
Pa a ypes
PORTUGAL • 1 ♂♂, 5 ♀♀; Gou eia, São Ped o; 40°29′10.9″ N, 7°34′38.5″ W; 25 Ap . 2013; A.R.
Gonçal es and R. And ade leg.; RBINS • 5 ♂♂, 5 ♀♀; Gua da, Panóias de Cima; 40°29′10.2″ N,
7°13′18.4″ W; 1 Ap . 2017; A.R. Gonçal es and R. And ade leg.; RBINS.
Addi ional examined ma e ial
PORTUGAL • 1 ♀; Man eigas, São Ped o; 40º19′07.0″ N, 7º34′37.4″ W; 25 Ap . 2013; A.R. Gonçal es
leg. • 2 ♂♂, 9 ♀♀; Gou eia, São Ped o; 40°29′10.9″ N, 7°34′38.5″ W; 25 Ap . 2013; A.R. Gonçal es
and R. And ade leg. • 3 ♂♂, 1 ♀; Gua da, Panóias de Cima; 40°29′10.2″ N, 7°13′18.4″ W; 1 Ap . 2017;
A.R. Gonçal es and R. And ade leg. • 5 ♂♂, 5 ♀♀; same collec ion da a as o p eceding; ZFMK •
4 ♂♂, 1 ♀; Gua da, Adão; 40°27′03.0″ N, 7°09′41.8″ W; A.R. Gonçal es and R. And ade leg. • 3 ♂♂,
4 ♀♀; Sabugal, Quad azais; 40°18′30.6″ N, 6°59′08.7″ W; 1 Ap . 2017; A.R. Gonçal es and R. And ade
leg. • 1 ♂, 1 ♀; Sabugal, Seixo do Côa; 40°24′48.0″ N, 7°01′07.6″ W; 1 Ap . 2017; A.R. Gonçal es
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
37
and R. And ade leg. • 1 ♂, 4 ♀♀; Sabugal, Fóios; 40°17′43.3″ N, 6°52′38.9″ W; 1 Ap . 2017; A.R.
Gonçal es and R. And ade leg.
Desc ip ion
Simila o Tachyd omia can ab ica sp. no . excep o he ollowing:
Male
Measu eMen s. Body leng h: 2.1–2.8 mm (n = 5). Wing leng h: 0.8 mm–0.9 mm (n = 5).
Head. La e oclina e ocella s same leng h as pos pedicel. P oclina e e icals ca ¾ as long as pos pedicel.
an enna. Pos pedicel lanceola e, ca 2 imes as long as pedicel.
Ho ax. Pos p ono al lobe bea ing ca 7 se ae la e ally, ca 6 ac os ichal se ae, sca e ed; no opleu on wi h
1 s ong, p ominen se a; 6 small se ae nea meso ho acic spi acle.
Wing. Sligh ly lobed dis al apex, wi hou digi a ion (Fig. 21F).
legs. O e all black; en al and do sal pos e io su ace o coxae, ochan e , basal 0.1 en al su ace
o emo a and knees, pale . Fo e ibia bea ing spa se cilia ion o hai -like se ae sligh ly longe han
maximum diame e o ibia. Mid ibia an e o en al apical spu wi h 4 sho , s ou , cu ed spinose se ae
on dis al hal ma gin.
abdoMen. Te gi es wi h g ey mic o ichia only on an e io ma gin o e gi e 1 and nea spi acles;
s e ni es o e all co e ed by g ey mic o ichia. Te gi es wi h ew and sca e ed se ae, mos ly p esen on
pos e oma ginal su ace and nea spi acles; s e ni es wi h e enly dis ibu ed se ae; apical s e ni es wi h
long, dis inc se ae.
Fig. 14. Te minalia o Tachyd omia s enop e a Gonçal es, G oo ae & And ade sp. no ., holo ype
(RBINS). A. Righ su s ylus and igh epand ial lamella. B. Epand ium wi h ce ci. C. Le epand ial
lamella and le su s ylus. D–E. Righ su s ylus. Scale ba : 0.1 mm.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
38
Fig. 15. Habi us o li e specimens o he Ibe ian an -like Tachyd omia Meigen, 1803. Males a e pic u ed
in he le column, emales in he igh . A–B. T. lusi anica (G oo ae , Shamshe & And ade, 2009).
C–D. T. nig ohi a Gonçal es, G oo ae & And ade sp. no . E–F. T. ebeje i Gonçal es, G oo ae &
And ade sp. no . G–H. T. s enop e a Gonçal es, G oo ae & And ade sp. no . I–J. T. can ab ica
Gonçal es, G oo ae & And ade sp. no .
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
39
Fig. 16. Habi us o li e specimens o he Ibe ian an -like Tachyd omia Meigen, 1803 and he I alian
ligh less Tachyd omia. Males a e pic u ed in he le column, emales in he igh . A–B. T. ibe ica (A ias,
1919). C–D. T. semiap e a (Gil Collado, 1923). E–F. T. piel aini (Gil Collado, 1936). G–H. T. pandellei
(Séguy, 1941). I–J. T. ap e ygon Plan & Deeming, 2006 (I aly).
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
40
Fig. 17. Moun ed specimens o he Ibe ian an -like Tachyd omia Meigen, 1803. Males a e pic u ed
in he le column, emales in he igh . A–B. T. lusi anica (G oo ae , Shamshe & And ade, 2009).
C–D. T. nig ohi a Gonçal es, G oo ae & And ade sp. no . E–F. T. ebeje i Gonçal es, G oo ae &
And ade sp. no . G–H. T. s enop e a Gonçal es, G oo ae & And ade sp. no . Scale ba s: 1 mm.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
41
a emp . Ins an ly, he male places his o elegs abo e he emale’s eye le el, while he mid legs a e
placed in he emale’s wais in an a emp o g ab i . A he beginning o he copula, he male mo es
his o elegs sideways a he emale’s eye le el, while, wi h his pos e io legs, ubs his own las e gi e
and wi ches i . The mo emen o he o elegs is e y simila o he mo emen o he wings desc ibed
in T. lusi anica by And ade (2011). When hei geni alia seem o be locked, he male keeps himsel
e y s ill, always wi h his o elegs abo e he emale’s eye le el. The emale hen may mo e a ound,
some imes e y as , while keeping he p ey wi h he male on op. F equen ly, he male o T. ibe ica le s
himsel be ca ied a ound by he emale in a ail- o- ail posi ion. When he specimens disconnec , bo h
indi iduals usually igh igo ously o he p ey.
Discussion
Phylogene ic ela ionships and sys ema ics
The phylogene ic ela ionships wi hin Tachyd omiinae ha e been s udied p e iously, bu mos ly a he
ibe and gene ic le el (e.g., Nagy e al. 2013) wi h he speci ic di e si y wi hin he genus ye o be
s udied in u he de ail. This is he i s ime ha all he Ibe ian and I alian an -like species ha e been
sequenced, and hei phylogene ic ela ionship as well as he e olu iona y ela ionships be ween e e y
an -like species and he genus Tachyd omia analysed.
The in e ed phylogene ic posi ion o he ype species o A iasella as sis e axon o he emaining
A iasella species and Piel ainia suppo s he conclusion by Shamshe & G oo ae (2018) ha he
absence o unc ional wings has no phylogene ic alue a gene ic le el. The placemen o he wo gene a
wi hin he clade o Tachyd omia co obo a es hei synonymy unde Tachyd omia.
Fig. 24. Fo es o Fagus syl a ica L. in he Apennine Moun ains, whe e Tachyd omia ap e ygon Plan &
Deeming, 2006 can be ound.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
48
The Ibe ian an -like species o Tachyd omia o m an e olu iona y closely ela ed g oup and he in e ed
phylogene ic ela ionships a e in acco dance wi h he mo phological cha ac e s. Hence, T. semiap e a is
esol ed as he sis e axon o all o he Ibe ian species as i s peculia mo phology sugges s. This axon
possesses a combina ion o cha ac e s in he male (i.e., wo p ojec ions on mid ibia, lack o cilia ion
o long hai like se ae on he o e ibia, oundish pos pedicel and lexible wing) ha a e no ound in
any o he species. A spu -like s uc u e (Fig. 19) on he mid ibia o he male is p esen in all Ibe ian
and I alian species, apa om T. ibe ica, which comple ely lacks i . As desc ibed in he mo phological
analysis, his s uc u e is, o mos species, composed o a basal sec ion bea ing den icles and a side
p ojec ion. In he case o T. semiap e a, he basal sec ion and p ojec ion a e o ally sepa a ed o , a leas ,
hei sepa a ion is much deepe han in o he species. To ou knowledge, his is he only case in he
genus Tachyd omia whe e his deep o o al sepa a ion occu s. Fu he mo e, his s uc u e likely has a
e olu iona y ele ance, as he males o he species in which ma ing was obse ed, g ab he emales by
using he mid legs.
Tachyd omia ibe ica is a species ha lacks many o he cha ac e s wi h axonomic ele ance ound in
o he species as i is ap e ous in bo h sexes, does no ha e spu -like s uc u es o cha ac e is ic se ae
(e.g., cilia ion o long hai -like se ae on he o e ibia). Some di e ences a he e minalia, mainly
conce ning he igh su s ylus, we e ound among h ee geog aphically dis an popula ions. Howe e ,
hese di e ences a e o deg ee a he han ega ding he basic o m and ha e less axonomic ele ance.
Fig. 25. Habi a o Tachyd omia ebeje i Gonçal es, G oo ae & And ade sp. no . in a o es o Que cus
py enaica Willd. in Po ugal, A ganil, Ben ei a (Ma a da Ma ga aça), a egion unde submedi e anean
in luence.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
49
Addi ionally, he specimens sequenced a e s ill e y much ela ed as eco e ed in he phylogene ic
analysis, whe e hey a e sepa a ed by sho b anches.
Fu he mo e, and e en hough we conduc ed a o al e idence phylogene ic analysis, i seems ele an
o commen on he COI p-di e gences as his gene is o en used o dis inguish species, despi e some
ecognized issues (e.g., Meie e al. 2006). While he gene ic di e si y a species le el wi hin Hybo idae
emains sca cely s udied, la ge in aspeci ic COI p-di e gences a e no uncommon in Hybo idae (see
Nagy e al. 2013). In he men ioned s udy, o example, an in aspeci ic di e gence o up o 5.48% was
ound wi hin he s udied Tachyd omia. In he speci ic case o T. ibe ica, he high di e gence ound a
in e popula ional le el (4–5%) may be ep esen a i e o ica iance p ocesses, especially as no signi ican
mo phological o ecological di e ences we e ound o subs an ia e he sepa a ion o he popula ions as
dis inc species.
Conce ning he sis e -species T. piel aini and T. pandellei, hese wo species a e mo phologically simila
bu wi h e y clea di e ences ha allow o a s aigh o wa d species sepa a ion. In his case, he wo
mo e ele an cha ac e s a e pe haps he wing pa e n and shape as well as he e minalia (in males),
which a e e y di e en . These mo phological di e ences a e highly cong uen wi h he molecula da a,
as hese species a e sepa a ed by ela i ely long b anches in he in e ed phylogene ic ee.
The ou newly desc ibed species all belong o he same clus e whe e T. lusi anica was esol ed. Wi h
he excep ion o he mic op e ous T. ebeje i sp. no ., he male wing, in his species clus e , is s enop e ous
wi h his lobed ip di ided in o a whi e/ anspa en basal po ion and black dis ally, bu i is in T. lusi anica
whe e i p esen s a mo e ema kable shape by bea ing a dis al p ojec ion. Tachyd omia nig ohi a
sp. no . was in e ed as a sis e axon o T. lusi anica and his pai has less mo phological di e ences
in compa ison wi h, o example, T. piel aini and T. pandellei. The e is no enough phylogene ic signal
in he s udied molecula ma ke s o ully esol e he ela ionships be ween T. s enop e a sp. no .,
T. can ab ica sp. no . and T. ebeje i sp. no ., which may be a esul om a apid specia ion p ocess.
Rega ding he placemen o he Ibe ian an -like species wi hin he species g oups p e iously de ined o
Tachyd omia, i is possible o associa e hem mo e closely wi h he a ogans species g oup, al hough
his associa ion is unce ain due o he lack o de eloped wings and o he mo phological cha ac e is ics
which do no i in o he g oup de ini ion, such as he sho e s ylus and/o he la ge and globula male
geni alia. The o e all mo phology – despi e he lack o de eloped wings – places he I alian Tachyd omia
ap e ygon wi hin he e icola species g oup, as sugges ed by Plan & Deeming (2006). Howe e , he
molecula da a clea ly places i as being mo e closely ela ed o he a ogans species g oup. The e o e,
u he molecula s udies a e necessa y o unde s and he phylogene ic ela ionships o T. ap e ygon and
he monophyly o he sugges ed Tachyd omia species g oups based on mo phological da a.
Conce ning he sligh di e ences o he suppo alues be ween he immed and non immed da ase s,
we assume ha bo h RECs and RSCs ha e some e ec on he b anch suppo alues, no on he opology
as p ima ily hough . In ou esul s, he in e ed opology using he immed e sion o he 28S alignmen
ecei es, o e all, sligh ly lowe suppo alues han he non- immed, indica ing ha he ambiguous
egions o he 28S gene p o ides some suppo o he bes ee.
A hypo hesis on he e olu ion o hese species can be p oposed based on he eco e ed phylogene ic
ela ionships and knowledge abou he beha iou and habi a . While he di e gence e en s a e no da ed,
he sho in e nodes in he clus e o he Ibe ian Tachyd omia may e y well e lec a apid succession
o spli ing p ocesses. I is possible ha geog aphically sepa a ed popula ions adap ed di e en ly o
simila ecological condi ions, hence simul aneously e ol ing di e en sexual signalling s a egies.
Thus, di e ences may ha e a isen ollowing ica iance p ocesses and now hese species show dis inc
beha iou s and li e his o ies, which may block he gene low be ween hem in sympa y.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
50
Wing educ ion/modi ica ion in Tachyd omia and i s e olu iona y signi icance
As men ioned be o e, he lack o unc ional wings is a common phenomenon in Dip e a and se e al
hypo heses o ligh lessness in insec s ha e been discussed, including habi a pe sis ence and c yp ic
beha iou s (Hackman 1964). Ro (1990) concluded ha he loss o wings is common in spa ially
and empo ally homogeneous en i onmen s and ha he e is conside able e idence o an inc ease
in ligh lessness wi h al i ude. The Ibe ian an -like species a e mos ly p esen on moun ains and in
deciduous o es s, which a e known o be s able habi a s (Ro 1990), hei mic ohabi a being es ic ed
o he lea li e . O e all, he e olu ion o ligh lessness in Tachyd omia is cu en ly known om 13
species (including he Ibe ian and I alian axa), ou o some 100 desc ibed species. I is expec ed ha
mo e cases may be disco e ed, especially i ield wo k is ca ied ou a high al i ude in empe a e cold
en i onmen s. Rega ding he e olu ion o he wings in he Ibe ian an -like Tachyd omia, we hypo hesize
ha wo p ocesses may ha e aken place: one is he wing educ ion i sel , which may happen in bo h
sexes, and ano he is he wing modi ica ion wi h a sexual signalling unc ion, which only happens in he
male. The e o e, in some species only wing educ ion o di e en deg ees occu ed, om he s enop e ous
species o he ap e ous, wi h he mic op e ous inbe ween. In ce ain cases, he emale is s enop e ous
wi hou a dis inc lobed ip on i s wing, while he male wing has a e y dis inc and la ge lobed ip (see:
Tachyd omia piel aini, Tachyd omia pandellei, Fig. 21A–C). Howe e , mo e commonly, a mo e dis inc
sexual dimo phism is p esen , whe e he emale is mic op e ous and he male is s enop e ous.
I is in e es ing ha he sexual signalling p ocess does no happen he same way in all species, as obse ed
in he ma ing beha iou o T. semiap e a. Con a y o T. lusi anica, he male o his species does no
wa e i s wings du ing copula, no do he wings seem o ha e any o he unc ion. Mo eo e , i s wings
a e much less igid han he ones o all he emaining ela ed species, so i is possible ha he s i ness
o he s alk-like po ion o he wing is an impo an pa o he wing modi ica ion p ocess, making hem
easie o wa e. Hence, while he wings o he s enop e ous species may look simila a i s glance, hey
ac ually di e in hei mo phology and migh ha e di e en unc ions.
In T. semiap e a only a p ocess o wing educ ion seems o be aking place. None heless, his species has
a e y dis inc ea u e, which has he same signalling unc ion as ha o he wing in T. lusi anica. I s o e
ibia – which is black, s ou and in la ed – is wa ed in on o he emale’s eyes du ing copula. A simila
signalling me hod is used by T. ibe ica (wa ing he o elegs) bu his species, ins ead o a modi ied ibia,
simply has a yellow and black o eleg. Fu he mo e, bo h species lack he cilia ion o hai -like se ae on
he male o eleg, p esen in T. lusi anica, whose o elegs we e obse ed o in e wine wi h hose o he
emale (And ade 2011). This beha iou was no obse ed in T. semiap e a o T. ibe ica.
Taking all in o ma ion in o accoun , a leas in he case o T. lusi anica, wing educ ion seems o be
coupled wi h an impo an modi ica ion o sexual ele ance, and i appea s ha bo h ecological and
sexual p essu es a e d i ing i s e olu ion. Simila si ua ions a e likely o be p esen in he o he species
ha show a dis inc sexual dimo phism in he wing mo phology, bu his emains o be es ed.
Rema ks on he habi a and dis ibu ion wi h implica ions on conse a ion
As p e iously men ioned, he an -like species o Tachyd omia occu in egions o empe a e and sub-
medi e anean bioclima ic in luence. In hese bioclima es, he po en ial na u al ege a ion is composed
o b oad-lea ed deciduous o ma cescen species and, o en, he o es s a e domina ed by oak ees, such
as Que cus obu L. and Que cus py enaica Willd (Fig. 25) (Cos a e al. 2005). A highe al i ude, he
oak ees a e subs i u ed by Fagus syl a ica L., a deciduous ee ha o ms monospeci ic s ands wi h a
closed canopy, which blocks he pene a ion o sunligh and c ea es e y shaded en i onmen s (Cos a
e al. 2005). The soil o hese deciduous and ma cescen o es s ends o ha e a deep laye o lea li e .
This laye o lea li e , wi h some deg ee o ligh pene a ion, high humidi y and ich in o ganic ma e ,
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
51
is he ypical mic ohabi a whe e an -like Tachyd omia can be ound. Wi h he excep ion o he species
occu ing a high al i ude, he adul s o Ibe ian an -like Tachyd omia become ac i e a he beginning o
he sp ing, when he ees a e s ill wi hou lea es, and he sunligh can di ec ly each he g ound. The
lies can hen be ound bo h inside he o es and along he o es edge.
Tachyd omia pandellei and T. piel aini o en occu in habi a s whe e he o es is o en domina ed by
Fagus syl a ica, and hey p obably only li e along he edge o he o es because i p o ides he p esence
o lea li e combined wi h highe ligh pene a ion han mic ohabi a s unde dense canopy. The lea
li e i sel is a humid, s able en i onmen and likely o e s shel e om p eda o s and he wea he
elemen s (e.g., wind, ain). I is also he habi a o p ey, as hese species mainly eed on sap ophilous
lies ha a e dependen on o ganic ma e .
In gene al, a a mac oclima ic scale, he an -like species o Tachyd omia seem o ha e ela i ely simila
ecological equi emen s and some species do co-occu in he same habi a s (Fig. 2). This is, o example,
he case o T. semiap e a, which co-occu s wi h T. ebeje i sp. no ., T. nig ohi a sp. no . and T. ibe ica.
Howe e , T. semiap e a seems o become ac i e la e in he yea han T. ebeje i sp. no . and T. nig ohi a
sp. no ., and does no o e lap a a empo al scale wi h T. ebeje i sp. no . in he same habi a s. We suspec
ha u he ieldwo k likely will inc ease he geog aphic anges epo ed o mos species, especially o
T. semiap e a, T. can ab ica sp. no ., T. pandellei and T. piel aini. Howe e , gi en he p e ious sampling
e o s, T. s enop e a sp. no . and T. nig ohi a sp. no . appea o be genuinely es ic ed o a smalle
a ea o occu ence.
Mos popula ions o he Ibe ian an -like Tachyd omia exis in highly agmen ed landscapes gi en
hei occu ence in empe a e and humid o es ed habi a s. This is especially ue o he species wi h
popula ions in he sou he n hal o he Ibe ian Peninsula, whe e hey a e ci cumsc ibed o small sub-
medi e anean bioclima ic islands su ounded by a d y and ho en i onmen . This is he case o he
sou he nmos popula ions o T. ibe ica, T. semiap e a and T. ebeje i sp. no ., bu e en he popula ions
in he no he n egions occu in agmen ed habi a s. The habi a agmen a ion is o en caused by
dis u bances o an h opogenic o igin, such as he a i icializa ion o he land, ag icul u al in ensi ica ion,
subs i u ion o he na u al ege a ion by monocul u es and in asi e species, as well as induced i es. The
clima e is also expec ed o become wa me , g ea ly educing he a ea occupied by empe a e and sub-
medi e anean ees, as Que qus obu and Q. py enaica (Beni o Ga zón e al. 2008). Clima e change,
coupled wi h habi a agmen a ion, will almos ce ainly impe il he conse a ion o he Ibe ian an -like
species o Tachyd omia.
Acknowledgemen s
The au ho s would like o hank e e yone who has p o ided us wi h e y impo an help inding
sui able a eas o p ospec , o suppo du ing ield wo k and / o by collec ing specimens, namely: Piluca
Ál a ez, Ra ael Ob egón, F ancisco Ba os, Sam Ma ins, Ped o And ade, Diana Rod igues, Isaías
Fe ei a, Ca los Sil a, Jo ge Almeida, Ád ia Mi alles, Ca los Vila-Viçosa, Edua do Ma abu o, Ma in J.
Ebeje , Ruud an de Weele, Alice Abela, Nigel Jones, Jo ge Rose e and Sé gio Hen iques. We would
also like o hank Edua do Ma abu o o p o iding suppo on s udying he e olu ion, conse a ion
and axonomy o hese species. We would like o hank Telmo Ma ins o his i al help wi h ob aining
he SEM images (imaging and analysis done a he Facul y o Sciences o he Uni e si y o Lisbon’s
Mic oscopy Facili y, a node o he Po uguese Pla o m o BioImaging, e e ence PPBI-POCI-01-0145-
FEDER-022122). A special g a i ude is due o Claudia E zbaue o eaching and helping he i s au ho
in he labo a o y. We would also like o hank he e iewe s o hei impo an commen s o highly
imp o e he manusc ip . Pa o he ieldwo k was suppo ed by he Sys ema ics Resea ch Fund om
he Sys ema ics Associa ion and he Linnean Socie y o London.
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
52
Re e ences
And ade R. 2011. Obse a ions on he beha iou o A iasella lusi anica, G oo ae e al., 2009 (Dip e a,
Hybo idae, Tachyd omiinae) om Po ugal. Bulle in de la Socié é oyale belge d’En omologie 147:
241–250.
A ias J. 1919. Desc ipción p elimina de un nue o Émpido de España. Bole in de la Real Sociedad
Española de His o ia Na u al 19: 479–481.
Beni o Ga zón M., Sánchez de Dios R. & Sainz Olle o H. 2008. E ec s o clima e change on he dis ibu ion
o Ibe ian ee species. Applied Vege a ion Science 11: 169 178. h ps://doi.o g/10.3170/2008-7-18348
Be one M.A., Cou ney G.W. & Wiegmann B.M. 2008. Phylogene ics and empo al di e si ica ion o
he ea lies ue lies (Insec a: Dip e a) based on mul iple nuclea genes. Sys ema ic En omology 33 (4):
668–687. h ps://doi.o g/10.1111/j.1365-3113.2008.00437.x
Ch ála M. 1970. Re ision o Palaea c ic species o he genus Tachyd omia Meig. (= Tachis a Loew)
(Dip e a, Empididae). Ac a En omologica Musei Na ionalis P agae 38 (1969): 415–524.
Ch ála M. 1975. The Tachyd omiinae (Dip . Empididae) o Fennoscandia and Denma k. Fauna
En omologica Scandina ica 3: 1–336.
Cos a M., Mo la C. & Sainz H. 2005. Los Bosques Ibé icos: Una In e p e ación Geobo ánica. 4 h edi ion.
Edi o ial Plane a, Ba celona.
Cumming J.M. & Wood D.M. 2017. Adul mo phology and e minology. In: Ki k-Sp iggs A. & Sinclai
B.J. (eds) Manual o A o opical Dip e a 1: 112. Sou h A ican Na ional Biodi e si y Ins i u e, Cape
Town
Da iba D., Taboada G.L., Doallo R. & Posada D. 2012. jModelTes 2: mo e models, new heu is ics and
pa allel compu ing. Na u e Me hods 9: 772. h ps://doi.o g/10.1038/nme h.2109
Folme O., Black M., Hoeh W., Lu z R. & V ijenhoek R. 1994. DNA p ime s o ampli ica ion o
mi ochond ial cy och ome c oxidase subuni I om di e se me azoan in e eb a es. Molecula Ma ine
Biology and Bio echnology 3: 294–299.
Gibson J.F., Kelso S., Jackson M.D., Ki s J.H., Mi anda G.F. & Ske ing on J.H. 2011. Dip e a-speci ic
polyme ase chain eac ion ampli ica ion p ime s o use in molecula phylogene ic esea ch. Annals o
he En omological Socie y o Ame ica 104 (5): 976–997. h ps://doi.o g/10.1603/AN10153
Gil J. 1923. Es udio de un nue o Taquid omino de España. Bole ín de la Real Sociedad Española de
His o ia Na u al 1923: 150–154.
Gil J. 1936. Una nue a especie del géne o A iasella Gil, con b e es conside aciónes sob e la educcion
del ó ax en los Taquid ominos áp e os. Eos (Re is a Española de En omologia) 11 (3): 191–201.
G oo ae P. & Shamshe I. 2008. No es on he halobion genus Che sod omia (Dip e a: Hybo idae)
om Tunisia wi h he desc ip ion o a new b achyp e ous species and no es on b achyp e y in empidoids.
Bulle in de la Socié é oyale belge d’En omologie 144: 57–63.
G oo ae P., Shamshe I. & And ade R. 2009. Desc ip ion o a new b achyp e ous A iasella Gil
(Dip e a, Hybo idae, Tachyd omiinae) om Po ugal. Bulle in de la Socié é oyale belge d’En omologie
145: 45–48.
Hackman W. 1964. On educ ion and loss o wings in Dip e a. No ulae En omologicae 44: 73–93.
Huelsenbeck J.P. & Ronquis F. 2001. M Bayes: Bayesian in e ence o phylogene ic ees. Bioin o ma ics
17: 754–755. h ps://doi.o g/10.1093/bioin o ma ics/17.8.754
Jemu. 2011. D1.F . A ailable om h p://jemu.myspecies.in o/d1 [accessed 20 Sep. 2017].
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
53
Ka oh K. & S andley D.M. 2013. MAFFT mul iple sequence alignmen so wa e e sion 7: imp o emen s
in pe o mance and usabili y. Molecula Biology and E olu ion 30 (4): 772–780.
h ps://doi.o g/10.1093/molbe /ms 010
Ka oh K., Kuma K., Toh H. & Miya a T. 2005. MAFFT e sion 5: imp o emen in accu acy o mul iple
sequence alignmen . Nucleic Acids Resea ch 33 (2): 511–518. h ps://doi.o g/10.1093/na /gki198
Ka oh K., Asimenos G. & Toh H. 2009. Mul iple alignmen o DNA sequences wi h MAFFT. In:
Posada D. (ed.) Bioin o ma ics o DNA Sequence Analysis. Me hods in Molecula Biology 537: 39–64.
h ps://doi.o g/10.1007/978-1-59745-251-9_3
Kje K.M. 1995. Use o RNA seconda y s uc u e in phylogene ic s udies o iden i y homologous
posi ions: an example o alignmen and da a p esen a ion om he ogs. Molecula Phylogene ics and
E olu ion 4 (3): 314–330. h ps://doi.o g/10.1006/mpe .1995.1028
Kje K.M., Roshan U. & Gillepie J.G. 2009. S uc u al and e olu iona y conside a ions o mul iple
sequence alignmen o RNA, and he challenges o Algo i hms ha igno e hem. In: Rosenbe g
M.S. (ed.) Sequence Alignmen : Me hods, Models, Concep s, and S a egies: 105–150. Uni e si y o
Cali o nia P ess, USA.
Kuma S., S eche G. & Tamu a K. 2016. MEGA7: Molecula E olu iona y Gene ics Analysis Ve sion
7.0 o Bigge Da ase s. Molecula Biology and E olu ion 33: 1870–1874.
h ps://doi.o g/10.1093/molbe /msw054
Meie R., Shiyang K., Vaidya G. & Ng P.K.L. 2006. DNA ba coding and axonomy in Dip e a: a
ale o high in aspeci ic a iabili y and low iden i ica ion success. Sys ema ic Biology 55: 715–728.
h ps://doi.o g/10.1080/10635150600969864
Mille M.A., P ei e W. & Schwa z T. 2010. C ea ing he CIPRES Science Ga eway o in e ence o
la ge phylogene ic ees. In: P oceedings o he Ga eway Compu ing En i onmen s Wo kshop (GCE):
1–8. New O leans.
Nagy Z.T., Sone G., Mo elmans J., Vandewynkel C. & G oo ae P. 2013. Using DNA ba codes
o assessing di e si y in he amily Hybo idae (Dip e a, Empidoidea). ZooKeys 365: 263–278.
h ps://doi.o g/10.3897/zookeys.365.6070
NCBI Resou ce Coo dina o s. 2016. Da abase esou ces o he Na ional Cen e o Bio echnology
In o ma ion. Nucleic Acids Resea ch 44 (D1): D7–D19. h ps://doi.o g/10.1093/na /gk 1290
Plan A.R. & Deeming J.C. 2006. An ap e ous species o Tachyd omia Meigen, 1803 (Dip e a: Hybo idae)
om I aly. An In e na ional Jou nal o Dip e ological Resea ch 17 (1): 13–16.
Posada D. & Buckley T. 2004. Model selec ion and model a e aging in phylogene ics: ad an ages o
Akaike in o ma ion c i e ion and Bayesian app oaches o e likelihood a io es s. Sys ema ic Biology
53 (5): 793–808. h ps://doi.o g/10.1080/10635150490522304
Rambau A. 2009. FigT ee: T ee Figu e D awing Tool. Ve sion 1.3.1.
A ailable om h p:// ee.bio.ed.ac.uk/so wa e/ ig ee/ [accessed 30 No . 2020].
Regie J.C., Shul z J.W., Ganley A.R., Hussey A., Shi D., Ball B., Zwick A., S ajich J.E., Cummings
M.P., Ma in J.W. & Cunningham C.W. 2008. Resol ing a h opod phylogeny: Explo ing phylogene ic
signal wi hin 4 kb o p o ein-coding nuclea gene sequence. Sys ema ic Biology 57: 920–938.
h ps://doi.o g/10.1080/10635150802570791
Ro D.A. 1990. The e olu ion o ligh lessness in insec s. Ecological Monog aphs 60: 389–421.
h ps://doi.o g/10.2307/1943013
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
54
Roháček J. 2012. Wing polymo phism in Eu opean species o Sphae oce idae (Dip e a). Ac a
En omologica Musei Na ionalis P agae 52 (2): 535–558.
Ronquis F. & Huelsenbeck J.P. 2003. M Bayes 3: Bayesian phylogene ic in e ence unde mixed models.
Bioin o ma ics 19: 1572–1574. h ps://doi.o g/10.1093/bioin o ma ics/b g180
Séguy E. 1941. É ude su un nou eau Co yné ine des Py énées. Bulle in de la Socié é en omologique
de F ance 46: 4–6.
Shamshe I.V. & G oo ae P. 2018. P oposed changes in sys ema ics and s a us o some gene a o
Tachyd omiini (Dip e a: Hybo idae: Tachyd omiinae), wi h desc ip ion o a new species o Tachypeza
Meigen om Canada and USA. Russian En omological Jou nal 27 (4): 425–434.
h ps://doi.o g/10.15298/ usen j.27.4.10
Simon C., F a i F., Beckenbach A., C espi B.J., Liu H. & Flook P. 1994. E olu ion, weigh ing, and
phylogene ic u ili y o mi ochond ial gene sequences and a compila ion o conse ed polyme ase chain
eac ion p ime s. Annals o he En omological Socie y o Ame ica 87: 651–701.
h ps://doi.o g/10.1093/aesa/87.6.651
Sinclai B. & Cumming J. 2006. The mo phology, highe -le el phylogeny and classi ica ion o he
Empidoidea (Dip e a). Zoo axa 1180: 1–172. h ps://doi.o g/10.11646/zoo axa.1180.1.1
S a k A. & Doczkal D. 2017. Tachyd omia wend i spec. no . (Dip e a, Empidoidea, Hybo idae) om
i e beds a he No he n slope o he Alps and i s o elands in Ge many. Mau i iana (Al enbu g) 34:
481– 498.
Su K., Ku y S. & Meie R., 2008. Mo phology e sus molecules: he phylogene ic ela ionships o
Sepsidae (Dip e a: Cyclo hapha) based on mo phology and DNA sequence da a om en genes.
Cladis ics 24 (6): 902–916.
Wahlbe g E. & Johanson K.A. 2018. Molecula phylogene ics e eals no el ela ionships wi hin
Empidoidea (Dip e a). Sys ema ic En omology 43: 610–636. h ps://doi.o g/10.1111/syen.12297
Zwickl D.J. 2006. Gene ic Algo i hm App oaches o he Phylogene ic Analysis o la ge biological
Sequence Da ase s unde he Maximum Likelihood C i e ion. PhD hesis, The Uni e si y o Texas,
Aus in, USA.
Manusc ip ecei ed: 23 No embe 2019
Manusc ip accep ed: 9 No embe 2020
Published on: 25 Janua y 2021
Topic edi o : Nes ine Akka i
Sec ion edi o : To bjø n Ek em
Desk edi o : K is iaan Hoedemake s
P in ed e sions o all pape s a e also deposi ed in he lib a ies o he ins i u es ha a e membe s o
he EJT conso ium: Muséum na ional d’his oi e na u elle, Pa is, F ance; Meise Bo anic Ga den,
Belgium; Royal Museum o Cen al A ica, Te u en, Belgium; Royal Belgian Ins i u e o Na u al
Sciences, B ussels, Belgium; Na u al His o y Museum o Denma k, Copenhagen, Denma k; Na u alis
Biodi e si y Cen e , Leiden, he Ne he lands; Museo Nacional de Ciencias Na u ales-CSIC, Mad id,
Spain; Real Ja dín Bo ánico de Mad id CSIC, Spain; Zoological Resea ch Museum Alexande Koenig,
Bonn, Ge many; Na ional Museum, P ague, Czech Republic.
GONÇALVES A.R. e al., Re ision o Ibe ian and I alian an -like Tachyd omia
55
Supplemen a y ma e ial:
Supp. ile 1: Fig.1. Maximum-likelihood ee based on he combined da ase (COI, immed 28S, 12S,
AATS and PGD) using Ga li e . 2.01.1067 and he s uc u al alignmen o 28S. Boo s ap suppo
alues a e depic ed a he nodes (only > 50 o > 0.5, espec i ely). BS = Boo s ap suppo alues.
A g eyscale is used o highligh he ing oup, whe e he da kes shade o g ey highligh s he Ibe ian
ligh less an -like Tachyd omia species, ollowed by a ligh e shade which includes T. ap e ygon, hence
ep esen ing all he ligh less species occu ing in sou he n Eu ope and, inally, he ligh e shade co e s
all Tachyd omia analysed, including he mac op e ous species assigned o di e en species-g oups
sensu Ch ála (1970).
Fig. 2. Bayesian In e ence ee based on he combined da ase (COI, immed 28S, 12S, AATS and PGD)
using M Bayes e . 3.2.6 and he s uc u al alignmen o 28S. Bayesian pos e io p obabili ies a e
depic ed a he nodes (only > 50 o > 0.5, espec i ely). PP = Bayesian pos e io p obabili ies. A g eyscale
is used o highligh he ing oup, whe e he da kes shade o g ey highligh s he Ibe ian ligh less an -like
Tachyd omia species, ollowed by a ligh e shade which includes T. ap e ygon, hence ep esen ing all
he ligh ess species occu ing in sou he n Eu ope and, inally, he ligh e shade co e s all Tachyd omia
analysed, including he mac op e ous species assigned o di e en species-g oups sensu Ch ála (1970).
h ps://doi.o g/10.5852/ej .2021.732.1213.3459
Supp. ile 2: S uc u al alignmen o 28S be o e imming. h ps://doi.o g/10.5852/ej .2021.732.1213.3461
Supp. ile 3: S uc u al alignmen o 28S a e imming. h ps://doi.o g/10.5852/ej .2021.732.1213.3463
Supp. ile 4: Full alignmen o all sequences included in his s udy, con aining he non- immed 28S.
h ps://doi.o g/10.5852/ej .2021.732.1213.3465
Supp. ile 5: Full alignmen o all sequences included in his s udy, con aining he immed 28S.
h ps://doi.o g/10.5852/ej .2021.732.1213.3467
Eu opean Jou nal o Taxonomy 732: 1–56 (2021)
56