mic oo ganisms
A icle
The Fish Pa hogen Vib io o dalii Unde I on
Dep i a ion P oduces he Side opho e Piscibac in
Pamela Ruiz 1,2, Miguel Balado 3, Juan Ca los Fuen es-Mon e e de 4, Alicia E. To anzo 3,
Jaime Rod íguez 4, Ca los Jiménez 4, Ruben A endaño-He e a 1,2,*
and Manuel L. Lemos 3,*
1Labo a o io de Pa ología de O ganismos Acuá icos y Bio ecnología Acuícola, Facul ad de Ciencias de la
Vida, Uni e sidad And és Bello, 2531015 Viña del Ma , Chile
2In e disciplina y Cen e o Aquacul u e Resea ch (INCAR), 2531015 Viña del Ma , Chile
3Depa amen o de Mic obiología y Pa asi ología, CIBUS-Facul ad de Biología and Ins i u o de Acuicul u a,
Uni e sidade de San iago de Compos ela, 15782 San iago de Compos ela, Spain
4Cen o de In es igacións Cien í icas A anzadas (CICA), Depa amen o de Química, Facul ade de Ciencias,
Uni e sidade da Co uña, 15071 A Co uña, Spain
*Co espondence: [email p o ec ed] (R.A.-H.); [email p o ec ed] (M.L.L.)
Recei ed: 31 July 2019; Accep ed: 31 Augus 2019; Published: 3 Sep embe 2019


Abs ac :
Vib io o dalii is he causa i e agen o ib iosis, mainly in salmonid ishes, and i s i ulence
mechanisms a e s ill no comple ely unde s ood. In p e ious wo ks we demons a ed ha V. o dalii
possess se e al i on up ake mechanisms based on heme u iliza ion and side opho e p oduc ion.
The aim o he p esen wo k was o con i m he p oduc ion and u iliza ion o piscibac in as a
side opho e by V. o dalii. Using gene ic analysis, iden i ica ion by pep ide mass inge p in ing (PMF)
o i on- egula ed memb ane p o eins and chemical iden i ica ion by LC-HRMS, we we e able o
clea ly demons a e ha V. o dalii p oduces piscibac in unde i on limi a ion. The syn hesis and
anspo o his side opho e is encoded by a ch omosomal gene clus e homologous o ano he one
desc ibed in V. anguilla um, which also encodes he syn hesis o piscibac in. Using
β
-galac osidase
assays we we e able o show ha wo po en ial p omo e s egula ed by i on con ol he ansc ip ion
o his gene clus e in V. o dalii. Mo eo e , biosyn he ic and anspo p o eins co esponding o
piscibac in syn hesis and up ake could be iden i ied in memb ane ac ions o V. o dalii cells g own
unde i on limi a ion. The syn hesis o piscibac in was p e iously epo ed in o he ish pa hogens
like Pho obac e ium damselae subsp. piscicida and V. anguilla um, which highligh s he impo ance o
his side opho e as a key i ulence ac o in Vib ionaceae bac e ia in ec ing poikilo he mic animals.
Keywo ds: Vib io o dalii; ish pa hogens; i on up ake; side opho es; piscibac in; anch obac in
1. In oduc ion
Vib io o dalii is a
γ
-p o eobac e ium which causes ib iosis, a hemo hagic sep icemia, in se e al
species o aquacul u ed ish, mainly salmonids [
1
]. Al hough ib iosis ou b eaks due o V. o dalii ha e
been epo ed a ound he globe, in he las 15 yea s hey eached an impo an impac in Chile, whe e
hey cause signi ican economic losses in salmonids aquacul u e [
2
,
3
]. Besides i s gene ic simila i y o
V. anguilla um [
4
,
5
], ano he impo an ish pa hogen wi h wo ldwide dis ibu ion, many aspec s o
he i ulence mechanisms o V. o dalii s ill emain unknown. While i s pa hogenici y is no co ela ed
o e y h ocy es hemagglu ina ion capaci y o bio ilm o ma ion in A lan ic salmon (Salmo sala ), he
hyd ophobic p ope ies o V. o dalii cells could play a ole in i ulence. Mo eo e , V. o dalii can e ade
he hos immune sys em and can su i e wi hin A lan ic salmon mucus, which likely acili a es
coloniza ion [
3
,
6
]. Howe e , many aspec s o i s abili y o colonize and mul iply wi hin he ish hos s
emain unclea .
Mic oo ganisms 2019,7, 313; doi:10.3390/mic oo ganisms7090313 www.mdpi.com/jou nal/mic oo ganisms
Mic oo ganisms 2019,7, 313 2 o 16
Fo mos bac e ia i on up ake abili y du ing he na u ally i on-limi ed condi ions o an in ec ion
is a key i ulence ac o essen ial o mul iplica ion wi hin he hos [
7
–
9
]. Besides he impo ance o
i on o he cell me abolism, his elemen is an impo an signal ha egula es exp ession o many
o he me abolic and i ulence unc ions in bac e ial cells [
10
]. This egula ion is usually media ed
by he ansc ip ional egula o Fu which needs Fe
2+
as co ac o o bind o he p omo e egion o
genes con olled by i on le els and p e en he binding o RNA polyme ase o DNA [
11
]. The main
mechanisms desc ibed in G am-nega i e bac e ia o ge i on om he cell su oundings a e he di ec
use o heme g oups as a sou ce o i on [
12
] and he syn hesis o side opho es, which can e icien ly
seques e he i on bound by ans e ins and o he i on-holding p o eins wi hin he hos [
9
,
13
,
14
].
The e i-side opho e is hen in e nalized h ough speci ic TonB-dependen ou e memb ane p o ein
ecep o s ha a e ene gized h ough he TonB sys em [
15
–
17
]. Bac e ial ish pa hogens a e no an
excep ion o i on equi emen s and se e al mechanisms o i on up ake, including he use o heme and
he syn hesis o side opho es, ha e been epo ed in many o hese bac e ia [18–25].
We ha e p e iously demons a ed ha V. o dalii can also use heme and hemoglobin as i on
sou ces and ha i has he abili y o p oduce side opho es [
26
]. Howe e , despi e he clea ela ionship
be ween V. o dalii i on up ake abili y and pa hogenici y, he p ecise na u e o he i on assimila ion
mechanisms emains unclea . In his p e ious wo k, om gene ic and genomic analysis, he esul s
o c oss- eeding assays, and om some o he da a in he li e a u e [
4
], we sugges ed ha V. o dalii
could likely p oduce piscibac in as a side opho e. Piscibac in was isola ed and cha ac e ized om
he ish pa hogen Pho obac e ium damselae subsp. piscicida [
23
]. In his bac e ium piscibac in syn hesis
is encoded in a pa hogenici y island ha bo ed in he pPHDP70 i ulence plasmid [
27
]. Recen in
silico genomic s udies in he Vib ionaceae amily showed ha he gene clus e encoding piscibac in
syn hesis and anspo is eally widesp ead in many species o Vib io and Pho obac e ium [
28
]. In ac ,
we ha e ecen ly demons a ed ha some s ains o V. anguilla um, a bac e ium closely ela ed o V.
o dalii, p oduces piscibac in in a empe a u e-dependen ashion, being p e e en ially exp essed a low
empe a u es. In hese condi ions piscibac in syn hesis is a key i ulence ac o o V. anguilla um [
29
].
In he p esen wo k, we ha e cha ac e ized he gene clus e encoding he biosyn hesis and
anspo o piscibac in and demons a ed, by gene ic, p o eomic and chemical analysis, ha piscibac in
is indeed p oduced as side opho e by V. o dalii.
2. Ma e ials and Me hods
2.1. Bac e ial S ains and G ow h Condi ions
Th ee V. o dalii s ains we e used: The ype s ain ATCC 33509
T
and wo s ains, Vo-LM-13 and
Vo-LM-18, p e iously isola ed om ib iosis ou b eaks in A lan ic salmon cul u ed in Chile [
3
,
6
]. All
we e con i med as V. o dalii acco ding o he PCR p o ocol p e iously desc ibed [
30
]. All s ains we e
ou inely cul i a ed on T yp icase Soy Aga o T yp icase Soy B o h supplemen ed wi h 1% (w/ ) NaCl
(TSA-1 and TSB-1, espec i ely). Fo some expe imen s he CM9 minimal medium was also used [
31
].
S ock cul u es we e kep ozen a
−
80
◦
C in C iobilles ubes (AES Labo a o ies, Combou g, F ance) o
in TSB-1 wi h 15% ( / ) glyce ol.
2.2. RNA Ex ac ion and RT-PCR
To analyze he ansc ip ional egula ion o he gene clus e in ol ed in he biosyn hesis and
anspo o he side opho e piscibac in, a RT-PCR was pe o med wi h he p ime s lis ed in Table 1. Fo
his assay, V. o dalii Vo-LM-18 was g own in i on-limi ed (TSB-1 plus 2,2
0
-dipy idyl), i on-excess (TSB-1
plus FeCl
3
10
µ
M) and s anda d condi ions (TSB-1). To al RNA was p epa ed om cul u es a e 48 h
pos -incuba ion using TRIzol
®
eagen (Ambion-The moFishe , Wal ham, MS, USA) acco ding o he
manu ac u e ’s ins uc ions. Each RNA sample was subjec ed o ea men wi h DNase I RNase ee. To
ob ain he cDNA, 5
µ
g o al RNA and e e se ansc ip ase enzyme M-MLV (In i ogen-The moFishe ,
Wal ham, MS, USA) was used ollowing he manu ac u e ’s ins uc ions o each e e se ansc ip ion
Mic oo ganisms 2019,7, 313 3 o 16
eac ion. The PCR eac ion was p epa ed wi h he cDNA, 1 U o BioTaq DNA polyme ase (Bioline,
Memphis, TN, USA), 200
µ
M o each dNTP and 2 mM MgCl
2
, inal concen a ion. Depending on
he mel ing empe a u e (Tm) o each pai o p ime s, annealing empe a u es anged om 55 o 60
◦
C. Times o elonga ion we e selec ed based on he expec ed size o ampli ica ion (1 min
·
kb
−1
). In all
cases, he same eac ion mix u e, bu wi hou e e se ansc ip ase, was used as nega i e con ol, and
ch omosomal DNA o he Vo-LM-18 s ain was used as posi i e con ol.
Table 1. P ime s used in his wo k.
P ime s Sequence (50-30) * Ampli ied F agmen (bp)
Ampli ica ion o po en ial p omo e s
P1
P omo e 1_F
GCG
TCTAGA
CACTTTGCCACCCACCATTA
879
P omo e 1_R
GCG
GGATCC
ACGAATCGTCGTGTTGGCAT
P2
P omo e 2_F
GCG
TCTAGA
CCGCTTAGAGAAACCAACGT
1165
P omo e 2_R
GCG
GGATCC
ACGTTTCGGTAAGCGTATGG
T ansc ip ional egula ion o i p gene clus e
RT TTTGGAGATGAGTGCGACAC
PCR1
ARC1o dalii_F GATATGCGCTTTGACTGCCA 196
ARC1o dalii_R CTGTGAGACGGCATACAAGC
PCR2
F pA_o dalii_F CGGTGGTAATGCTCAAGGTG 204
F pA_o dalii_R TGGCTCGGTAGGTGTTCAAT
PCR3
I p2_o dalii_F AGCAGGCAACAAAGAGTGAG 413
I p1_o dalii_R GGGCGAATAACCAAACAAGC
*Recogni ion sequences o es ic ion enzymes a e unde lined.
2.3. Cons uc ion o lacZ T ansc ip ional Fusions and β-Galac osidase Assays
The p esence o po en ial gene p omo e s wi hin he piscibac in gene clus e o V. o dalii was
pe o med using BPROM ool [
32
]. Pu a i e Fu boxes we e de ec ed by an in silico sea ch o he
GATAAT hexame [
33
]. DNA agmen s co esponding o V. o dalii pA and a aC1 p omo e egions
(P1 and P2, espec i ely) we e ampli ied by PCR using p ime s speci ied in Table 1. The ampli ied
agmen s included he egion ups eam o he s a codon and he i s nucleo ides (ca. 50 bp) o pA
o a aC1 coding sequences. These pu a i e p omo e egions we e used o a p omo e less lacZ gene
and inse ed in o he low-copy-numbe epo e plasmid pHRP309 [
34
]. The esul ing ansc ip ional
usion cons uc s, P1::lacZ and P2::lacZ, we e mobilized om Esche ichia coli
β
3914 in o V. o dalii
Vo-LM-18 by conjuga ion. T ans o med ex-conjugan s we e selec ed on he basis on hei esis ance o
gen amicin (pHRP309 ma ke ). As a nega i e con ol, V. o dalii Vo-LM-18 wi h an emp y pHRP309
was used. To de e mine whe he po en ial p omo e s we e egula ed by i on, a o al o ou g ow h
condi ions we e es ed o each one o he ansc ip ional usions: Cells g own in CM9, cells g own
unde i on excess (CM9 plus FeCl
3
20
µ
M) and wo i on limi ing condi ions, CM9 plus 2,2
0
-dipy idyl
25 mM and CM9 plus 2,2
0
-dipy idyl 80
µ
M. All cul u es we e ca ied ou wi h agi a ion a 100 pm a
18 ◦C un il an OD600~0.1 o eco d he β-galac osidase ac i i y.
The ansc ip ional ac i i y was de e mined by measu ing he
β
-galac osidase ac i i y o usions
P1::lacZ and P2::lacZ ollowing he me hod desc ibed by Mille [
35
]. Volumes o 0.1 and 0.5 mL,
espec i ely, we e used. Bo h we e b ough o a inal olume o 1 mL wi h bu e Z (Na
2
HPO
4
2H
2
O
Mic oo ganisms 2019,7, 313 4 o 16
60 mM; NaH
2
PO
4·
H
2
O 40 mM; KCl 10 mM; MgSO
4
7H
2
O 1 mM and
β
-me cap oe hanol 50 mM;
pH 7.0). To his mix u e 20
µ
L o chlo o o m and 10
µ
L o a solu ion o 0.1% SDS we e added and
he inal solu ion was incuba ed a 37
◦
C o 5 min. The eac ion was ini ia ed by adding 0.2 mL
o o ho-ni ophenyl-
β
-galac oside (ONPG; 4 mg
·
mL
−1
in Z bu e ). The eac ion was s opped wi h
0.5 mL o 1 M Na
2
CO
3
when a colo change o yellow was gene a ed. Finally, A
420
was measu ed in a
UV-VIS spec opho ome e (Hi achi U2000, Tokyo, Japan).
2.4. Analysis o Ou e Memb ane P o eins (OMP) P o ile o V. o dalii
OMPs we e ob ained om V. o dalii s ains ATCC 33509
T
, Vo-LM-18, and Vo-LM-13 g own unde
i on excess (TSB-1) and i on limi a ion (TSB-1 +2,2
0
-dipy idyl, using a concen a ion hal o he speci ic
MIC o each s ain). Each s ain was cul u ed in 500 mL o TSB-1 o TSB-1 +2,2
0
-dipy idyl a 18
◦
C o
48 h. A e incuba ion, he media we e cen i uged a 10,000
×
g o 10 min a 4
◦
C. The cell pelle s
we e esuspended in 3 mL o a solu ion con aining 10 mM T is-HCl (pH 8.0), 0.3% NaCl and 1% o a
p o ease inhibi o cock ail (Sigma-Ald ich, S . Louis, MO, USA). The suspension was hen sonica ed
h ee imes wi h a B anson 250 Soni ie (60 W pulses o 30 s, 30 s in e als in ice). A e 1–2 min o
cen i uga ion o elimina e cell deb is, supe na an s we e cen i uged a 17,000
×
g o 60 min a 4
◦
C.
The pelle s ob ained con ained o al cell memb anes.
Ou e memb ane ac ions we e ob ained as p e iously desc ibed [
36
,
37
]. B ie ly, he o al
memb ane pelle s we e esuspended in a solu ion con aining 20 mM T is-HCl (pH 8.0), 3% (w/ )
sodium lau yl sa cosina e (Sigma-Ald ich, S . Louis, MO, USA) and 1% p o ease inhibi o cock ail
(Sigma-Ald ich, S . Louis, MO, USA). The suspension was incuba ed a oom empe a u e o 20 min
o dissol e he inne memb ane. Ou e memb anes we e pelle ed by 100,000
×
gul acen i uga ion
o 60 min a 4
◦
C and washed wice wi h dis illed wa e . P o ein concen a ion was de e mined using
he BCA Assay Ki (The mo Scien i ic, Wal ham, MS, USA), and samples we e kep a
−
20
◦
C un il use.
I on- egula ed OMP (IROMP) p o iles we e compa ed o each V. o dalii s ain be ween cells
g own wi h o wi hou i on limi a ion. Each ex ac (20
µ
g) was mixed wi h he SDS-PAGE sample
bu e , hea ed a 95
◦
C o 5 min, and sepa a ed by SDS-PAGE wi h 7.5% (w/ ) ac ylamide in he
esol ing gel. Elec opho esis was pe o med in a Mini-PROTEAN 3 Cell (Bio-Rad, Po land, ME,
USA) a 120 V o 120 min. P o ein bands we e s ained wi h 0.05% Coomassie blue R (Sigma-Ald ich,
S . Louis, MO, USA) o a leas 1 h and des ained o 2 h in 10% me hanol and 10% ace ic acid.
The ela i e mobili y o each p o ein was de e mined by compa ison wi h s anda d p o ein ma ke s
(P ecision Plus P o ein S anda ds, Bio-Rad). Digi al images we e collec ed using a G:BOX Chemi XT4
Fluo escen and Chemiluminescen Imaging Sys em (Syngene, F ede ick, MD, USA) wi h GeneSys
au oma ic con ol so wa e and GeneTools analysis so wa e (Syngene, F ede ick, MD, USA). Th ee
independen sepa a ions, om wo di e en cul u es, we e pe o med o each s ain and g ow h
condi ion. Fu he analyses we e done only o p o ein bands induced o inc eased in in ensi y unde
i on-limi ed condi ions.
2.5. P o ein Iden i ica ion by Pep ide Mass Finge p in ing (PMF)
Candida e i on- egula ed bands om SDS-PAGE gels we e iden i ied by PMF, using MALDI-TOF
(Ma ix-Assis ed Lase Deso p ion/Ioniza ion Time-o -Fligh ) Mass Spec ome y analysis, as p e iously
desc ibed [
38
]. In b ie , p o ein bands o in e es we e manually excised and subjec ed o in-gel diges ion
wi h ypsin using he In-Gel Diges Zp Ki (Millipo e ES, Mad id, Spain), ollowing he manu ac u e ’s
p o ocol, o ex ac p o eins p io o mass spec ome y analysis. Be o e diges ion, he samples we e
educed wi h di hio h ei ol and alkyla ed wi h iodoace amide. P o eins we e iden i ied by PMF wi h an
Ul a lex III TOF/TOF (B uke ES, Mad id, Spain). Fo nega i e iden i ica ions, due o mixed p o eins
in a single band, a liquid ch oma og aphy ion- ap mass-spec ome e sys em wi h an amaZon speed
ETD (B uke ES, Mad id, Spain) was used. The SwissP o and NCBIn p o ein da abases we e sc eened
wi h Masco 2.3 (Ma ix Science). The iden i ied pep ides we e hen subjec ed o a BLASTP analysis
using he NCBI (Na ional Cen e o Bio echnology In o ma ion) da abase, o sea ch o homologues.
Mic oo ganisms 2019,7, 313 5 o 16
2.6. Bioin o ma ics Tools
The DNA and p o ein sequences we e analyzed using he NCBI da abases h ough he BLAST
algo i hms. The p o ein amilies da abase (P am 31.0) o EMBL-EBI (Eu opean Bioin o ma ics Ins i u e)
was used o p edic he p o ein domain o ganiza ion [
39
]. The unc ional p omo e s we e iden i ied
using he online da abase BPROM. The o ganiza ion o pu a i e domains in biosyn he ic p o eins we e
de ec ed using he PKS/NRPS da abase (h p://n ps.igs.uma yland.edu/).
2.7. De ec ion o Side opho e Piscibac in
Piscibac in was de ec ed as p e iously desc ibed [
23
] wi h sligh modi ica ions as ollows: 1 L
o cell- ee cul u e b o h o s ain Vo-LM-18 was concen a ed unde acuum (39
◦
C) un il 300 mL.
Then, 150 mL we e ans e ed o a la -bo om lask p o ided wi h a magne ic s i ba and 750
µ
L
o a solu ion o GaB
3
in H
2
O (12 mg/mL) we e added d opwise o e 5 min and gen ly s i ed o
ano he 10 min. This solu ion was s o ed a 4
◦
C du ing 24 h. An aliquo o he solu ion con aining
piscibac in-Ga(III) complex (75 mL) was submi ed o Solid Phase Ex ac ion (SPE) h ough an OASIS
®
(Wa e s, Ce danyola del Vall
è
s, Spain) ca idge (35 cm
3
, 6 g) using an ex ac ion acuum mani old
(0.2 ba ) and elu ed wi h 30 mL o he ollowing mix u es o H
2
O and CH
3
CN: 1:0; 1:3; 1:1; 0:1. F ac ions
we e d ied ou unde educed p essu e and subjec ed o LC-HRMS analysis using an A lan is dC18
(100 mm
×
4.6 mm, 5
µ
m) column (Wa e s) a a low a e o 1 mL/min. Sepa a ion, wi h a sample
injec ion olume o 20
µ
L, was achie ed by a 35 min g adien om 10% o 100% o CH
3
CN in H
2
O,
hen a 5 min isoc a ic s ep o 100% CH
3
CN. LC-ESI(+)-HRMS analysis o he ac ion elu ed wi h he
mix u e H
2
O/CH
3
CN 1:1, named as L3, showed a peak a 12.06 min ha displayed he cha ac e is ic
iso opic clus e o piscibac in-Ga(III) complex a m/z518.9928/521.9913.
Resul s a e epo ed ollowing he iden i ica ion equi emen s o MS echniques
SANTE/11945/2015. Since i was possible de ec bo h ions a signi ican in ensi y, he di e ence
be ween he calcula ed and he de ec ed exac mass o piscibac in-Ga(III) complex in ppm (
∆
m/z) and
he iso opic a io abundance e o (
δ
RIA) o M +1/M could be ob ained using he Fo mulas (1) and (2).
The quali y o he spec al in o ma ion was achie ed by na owing he de ec ion m/z ange a ound he
compound o in e es o 350–600 dal on measu ed in a LTQ-O bi ap, which is in ag eemen wi h he
small alues δRIA ound.
Fo mula (1)—SI: Mass accu acy:
∆m
z=





m measu ed −m heo e ical
m heo e ical ×106ppm





. (1)
Fo mula (2)—SI: Iso opic ion abundance a io e o (δRIA):
δRIA(%)=






100 ×
RIAexp −RIA heo
RIA heo






. (2)
P esence o he side opho e anch obac in in he same cell- ee cul u e supe na an s was also
de ec ed using he me hodology p e iously desc ibed [19,29].
2.8. S a is ical Analysis
Da a om all assays we e s a is ically analyzed using analysis o a iance (ANOVA). Signi ican
di e ences we e es ablished as p<0.05.
3. Resul s
3.1. Cha ac e iza ion o he V. o dalii Gene Clus e Encoding a Piscibac in-Like Side opho e
An in silico analysis o he genome o V. o dalii ATCC 33509 shows he p esence o a gene clus e
homologous o he piscibac in clus e (i p
ang
) desc ibed in he ch omosome II o V. anguilla um RV22 [
29
].

Mic oo ganisms 2019,7, 313 6 o 16
Bo h clus e s show a high deg ee o syn eny and a simila i y be ween 96% and 98% a he amino
acid le el (Figu e 1). This genomic island includes he 11 genes (i p genes) p e iously iden i ied as
pa o he plasmid encoding piscibac in in P. damselae subsp. piscicida [
27
] (Figu e 1). An in silico
sea ch in GenBank, and p e iously published wo ks [
28
], show he p esence o homologous gene
clus e s in se e al membe s o he Vib ionaceae amily, such as V. chole ae,V. mimicus,V. co alliily icus,
V. anguilla um o Pho obac e ium p o undum. I is no ewo hy ha his gene clus e exhibi s abou a 40%
simila i y wi h he genes o he HPI pa hogenici y island (encoding he syn hesis o he side opho e
ye siniabac in) o Ye sinia spp. and i was epo ed as a key i ulence ac o o P. damselae subsp.
piscicida [27,40].
Mic oo ganisms 2019, 7, x FOR PEER REVIEW 6 o 15
sea ch in GenBank, and p e iously published wo ks [28], show he p esence o homologous gene
clus e s in se e al membe s o he Vib ionaceae amily, such as V. chole ae, V. mimicus, V.
co alliily icus, V. anguilla um o Pho obac e ium p o undum. I is no ewo hy ha his gene clus e
exhibi s abou a 40% simila i y wi h he genes o he HPI pa hogenici y island (encoding he
syn hesis o he side opho e ye siniabac in) o Ye sinia spp. and i was epo ed as a key i ulence
ac o o P. damselae subsp. piscicida [27,40].
Figu e 1. Compa a i e analysis o he Vib io o dalii ATCC 33509T i p gene clus e wi h he
homologous ch omosomal egion o V. anguilla um RV22 and wi h he homologous sequence om
plasmid pPHDP70 om P. damselae subsp. piscicida. Biosyn he ic and egula o y genes a e depic ed
in blue and he gene encoding he ou e memb ane ecep o (F pA) in g een. O he genes and sho
ORFs a e shown in clea g een and o ange colo s. G ey blocks indica e pe cen ages o simila i y in
he p o eins sequence. The GenBank accession numbe s and he nucleo ide posi ions in e al a e
indica ed below he name o each species.
Piscibac in is syn he ized by NRPS- ype (non- ibosomal pep ide syn he ases) enzymes encoded
by i p1 and i p2 genes [23]. The bioin o ma ic analysis o he esul ing p o eins I p1 and I p2 o V.
o dalii showed ha he ca aly ic domains p esen in hese enzymes a e almos iden ical, wi h a
simila i y in he amino acid sequence o 99%, o hei coun e pa s encoded by i pang clus e o V.
anguilla um RV22 [29] (Figu e 2). Thus, he esul ing side opho e encoded by he i p clus e o V.
o dalii should be also piscibac in.
Figu e 2. Rep esen a ion o he ca aly ic domains p edic ed in I p1 and I p2 enzymes o
Pho obac e ium damselae subsp. piscicida, V. o dalii ATCC 33509T and V. anguilla um RV22. Analysis o
domains was pe o med using he PKS/NRPS da abase (h p://n ps.igs.uma yland.edu/).
Abb e ia ions: AT, acyl ans e ase; Cy, cycliza ion; KS, ke oacil syn hase; KR, ke o educ ase; PP,
pep idyl-ca ie p o ein; TE, hioes e ase. Do ed boxes highligh he main di e ences.
Figu e 1.
Compa a i e analysis o he Vib io o dalii ATCC 33509
T
i p gene clus e wi h he homologous
ch omosomal egion o V. anguilla um RV22 and wi h he homologous sequence om plasmid pPHDP70
om P. damselae subsp. piscicida. Biosyn he ic and egula o y genes a e depic ed in blue and he gene
encoding he ou e memb ane ecep o (F pA) in g een. O he genes and sho ORFs a e shown in
clea g een and o ange colo s. G ey blocks indica e pe cen ages o simila i y in he p o eins sequence.
The GenBank accession numbe s and he nucleo ide posi ions in e al a e indica ed below he name o
each species.
Piscibac in is syn he ized by NRPS- ype (non- ibosomal pep ide syn he ases) enzymes encoded
by i p1 and i p2 genes [
23
]. The bioin o ma ic analysis o he esul ing p o eins I p1 and I p2 o V. o dalii
showed ha he ca aly ic domains p esen in hese enzymes a e almos iden ical, wi h a simila i y
in he amino acid sequence o 99%, o hei coun e pa s encoded by i p
ang
clus e o V. anguilla um
RV22 [
29
] (Figu e 2). Thus, he esul ing side opho e encoded by he i p clus e o V. o dalii should be
also piscibac in.
Like in V. anguilla um, he i p clus e genes o V. o dalii encode mos unc ions needed o
piscibac in syn hesis and u iliza ion, al hough an en D homologue is absen in his gene clus e
when compa ed o he P. damselae subsp. piscicida i p clus e (Figu e 1). The en D gene encodes
a 4’-phosphopan e heinyl ans e ase ha is equi ed o ac i a e he pep ide syn hesis domains o
non- ibosomal pep ide syn he ases (NRPS) [
41
] and i is essen ial o piscibac in biosyn hesis [
23
].
Howe e , a homologue o his gene is p esen in he genome o V. o dalii as pa o he ab gene clus e ,
encoding he side opho e anch obac in [
4
,
26
]. This en D homologue could p o ide in ans he
unc ion o a 4’-phosphopan e heinyl ans e ase necessa y o piscibac in biosyn hesis in V. o dalii. We
ha e p e iously shown ha al hough anch obac in could be syn he ized by V. o dalii, i canno be
used as side opho e since he ABC anspo e s necessa y o e ic anch obac in in e naliza ion a e
no p esen in he genome o V. o dalii [26].
Mic oo ganisms 2019,7, 313 7 o 16
Mic oo ganisms 2019, 7, x FOR PEER REVIEW 6 o 15
sea ch in GenBank, and p e iously published wo ks [28], show he p esence o homologous gene
clus e s in se e al membe s o he Vib ionaceae amily, such as V. chole ae, V. mimicus, V.
co alliily icus, V. anguilla um o Pho obac e ium p o undum. I is no ewo hy ha his gene clus e
exhibi s abou a 40% simila i y wi h he genes o he HPI pa hogenici y island (encoding he
syn hesis o he side opho e ye siniabac in) o Ye sinia spp. and i was epo ed as a key i ulence
ac o o P. damselae subsp. piscicida [27,40].
Figu e 1. Compa a i e analysis o he Vib io o dalii ATCC 33509T i p gene clus e wi h he
homologous ch omosomal egion o V. anguilla um RV22 and wi h he homologous sequence om
plasmid pPHDP70 om P. damselae subsp. piscicida. Biosyn he ic and egula o y genes a e depic ed
in blue and he gene encoding he ou e memb ane ecep o (F pA) in g een. O he genes and sho
ORFs a e shown in clea g een and o ange colo s. G ey blocks indica e pe cen ages o simila i y in
he p o eins sequence. The GenBank accession numbe s and he nucleo ide posi ions in e al a e
indica ed below he name o each species.
Piscibac in is syn he ized by NRPS- ype (non- ibosomal pep ide syn he ases) enzymes encoded
by i p1 and i p2 genes [23]. The bioin o ma ic analysis o he esul ing p o eins I p1 and I p2 o V.
o dalii showed ha he ca aly ic domains p esen in hese enzymes a e almos iden ical, wi h a
simila i y in he amino acid sequence o 99%, o hei coun e pa s encoded by i pang clus e o V.
anguilla um RV22 [29] (Figu e 2). Thus, he esul ing side opho e encoded by he i p clus e o V.
o dalii should be also piscibac in.
Figu e 2. Rep esen a ion o he ca aly ic domains p edic ed in I p1 and I p2 enzymes o
Pho obac e ium damselae subsp. piscicida, V. o dalii ATCC 33509T and V. anguilla um RV22. Analysis o
domains was pe o med using he PKS/NRPS da abase (h p://n ps.igs.uma yland.edu/).
Abb e ia ions: AT, acyl ans e ase; Cy, cycliza ion; KS, ke oacil syn hase; KR, ke o educ ase; PP,
pep idyl-ca ie p o ein; TE, hioes e ase. Do ed boxes highligh he main di e ences.
Figu e 2.
Rep esen a ion o he ca aly ic domains p edic ed in I p1 and I p2 enzymes o Pho obac e ium
damselae subsp. piscicida,V. o dalii ATCC 33509
T
and V. anguilla um RV22. Analysis o domains
was pe o med using he PKS/NRPS da abase (h p://n ps.igs.uma yland.edu/). Abb e ia ions: AT,
acyl ans e ase; Cy, cycliza ion; KS, ke oacil syn hase; KR, ke o educ ase; PP, pep idyl-ca ie p o ein;
TE, hioes e ase. Do ed boxes highligh he main di e ences.
3.2. T ansc ip ional Analysis and I on Regula ion o he I p Gene Clus e o V. o dalii
To es i i p genes o V. o dalii we e exp essed, se e al RT-PCR ( e e se- ansc ip ase PCR)
eac ions we e pe o med. The esul s showed ha he i p gene clus e is ansc ibed as a polycis onic
mRNA ha includes a aC1,a aC2, pA,i p1-5,i p8 and i p9 genes (Figu e 3). The e o e, all genes
pu a i ely encoding he syn hesis, egula ion and anspo o piscibac in could be co- ansc ibed om
he p omo e P2 loca ed ups eam o a aC1 (Figu e 3a). An iden ical esul was ound o he pisciba in
i p
ang
clus e desc ibed in V. anguilla um RV22 [
29
]. This p omo e con ains a pu a i e Fu box ha
would indica e ha i s ac i i y is egula ed by he ansc ip ional egula o Fu in an i on-dependen
ashion [
33
]. An addi ional p omo e P1, also con aining a pu a i e Fu box, was loca ed ups eam
o pA (Figu e 3a). The pA gene would encode he p esump i e e i-piscibac in ou e memb ane
ecep o while a aC1 would encode a pu a i e A aC- ype ansc ip ional egula o . The eby, e en
hough i p genes can be ansc ibed mainly om he p omo e ups eam o a aC1, he exis ence o
addi ional ac i e p omo e s canno be uled ou .
In o de o analyze he exp ession le els o he i p pu a i e p omo e s P1 and P2, DNA agmen s
o ca. 700 nucleo ides ups eam o pA and a aC1 genes (Figu e 3a) we e cloned in o he plasmid
pHRP309 ups eam o a p omo e less lacZ gene. Resul ing plasmids we e mobilized in o V. o dalii
Vo-LM-18 and he ansc ip ion le els o lacZ we e measu ed by de e mining
β
-galac osidase ac i i y
unde di e en condi ions o i on a ailabili y (Figu e 4). The use o he P pA (P1) and Pa aC1 (P2)
p esump i e p omo e s p oduced signi ican
β
-galac osidase ac i i y when cells we e cul u ed unde a
s ong i on limi a ion (CM9 medium plus 2,2
0
-dipy idyl 80
µ
M). Unde i on excess condi ions (CM9 o
CM9 plus FeCl
3
25
µ
M) he
β
-galac osidase ac i i y o he P2 p omo e was 75% o he P1 p omo e
(Figu e 4), sugges ing a highe basal ac i i y o his p omo e . Howe e , unde s ong i on limi a ion,
he P2 p omo e seems o be 10% mo e ac i e han P1, sugges ing a igh e con ol by i on le els.
These esul s demons a e ha he wo p omo e sequences could se e as ansc ip ional s a s o he
whole i p ope on, and ha bo h o hem a e s ongly egula ed by i on le els wi h sligh a ia ions
be ween hem.
Mic oo ganisms 2019,7, 313 8 o 16
Mic oo ganisms 2019, 7, x FOR PEER REVIEW 7 o 15
Like in V. anguilla um, he i p clus e genes o V. o dalii encode mos unc ions needed o
piscibac in syn hesis and u iliza ion, al hough an en D homologue is absen in his gene clus e when
compa ed o he P. damselae subsp. piscicida i p clus e (Figu e 1). The en D gene encodes a
4’-phosphopan e heinyl ans e ase ha is equi ed o ac i a e he pep ide syn hesis domains o
non- ibosomal pep ide syn he ases (NRPS) [41] and i is essen ial o piscibac in biosyn hesis [23].
Howe e , a homologue o his gene is p esen in he genome o V. o dalii as pa o he ab gene
clus e , encoding he side opho e anch obac in [4,26]. This en D homologue could p o ide in ans
he unc ion o a 4’-phosphopan e heinyl ans e ase necessa y o piscibac in biosyn hesis in V.
o dalii. We ha e p e iously shown ha al hough anch obac in could be syn he ized by V. o dalii, i
canno be used as side opho e since he ABC anspo e s necessa y o e ic anch obac in
in e naliza ion a e no p esen in he genome o V. o dalii [26].
3.2. T ansc ip ional Analysis and I on Regula ion o he I p Gene Clus e o V. o dalii
To es i i p genes o V. o dalii we e exp essed, se e al RT-PCR ( e e se- ansc ip ase PCR)
eac ions we e pe o med. The esul s showed ha he i p gene clus e is ansc ibed as a
polycis onic mRNA ha includes a aC1, a aC2, pA, i p1-5, i p8 and i p9 genes (Figu e 3). The e o e,
all genes pu a i ely encoding he syn hesis, egula ion and anspo o piscibac in could be
co- ansc ibed om he p omo e P2 loca ed ups eam o a aC1 (Figu e 3a). An iden ical esul was
ound o he pisciba in i pang clus e desc ibed in V. anguilla um RV22 [29]. This p omo e con ains a
pu a i e Fu box ha would indica e ha i s ac i i y is egula ed by he ansc ip ional egula o Fu
in an i on-dependen ashion [33]. An addi ional p omo e P1, also con aining a pu a i e Fu box,
was loca ed ups eam o pA (Figu e 3a). The pA gene would encode he p esump i e
e i-piscibac in ou e memb ane ecep o while a aC1 would encode a pu a i e A aC- ype
ansc ip ional egula o . The eby, e en hough i p genes can be ansc ibed mainly om he
p omo e ups eam o a aC1, he exis ence o addi ional ac i e p omo e s canno be uled ou .
Figu e 3. T ansc ip ional o ganiza ion o he gene clus e pu a i ely encoding biosyn hesis and
anspo o side opho e piscibac in in V o dalii. (a) The p edic ed gene unc ions a e: biosyn hesis,
genes i p1, i p2, i p3, i p4, i p5 and i p9; ou e memb ane ecep o , pA; ansc ip ional egula o s,
a aC1 and a aC2; and inne memb ane expo e o pu a i e side opho e, i p8. P edic ed p omo e s P1
and P2 con aining Fu boxes a e indica ed by ed do s. RT deno es he loca ion o p ime used in
e o ansc ip ase eac ion while PCR 1, PCR 2 and PCR 3 indica e loca ion o p ime s o de ec ion
o cDNA om piscibac in gene clus e . (b) esul s o h ee RT-PCR eac ions designed o analyze he
ansc ip ion o he i p gene clus e . P ime ma ked as RT, a ge ed o he 3′-end o i p5 gene, was
used o ob ain a cDNA ha spanned om i p5 o a aC1. This cDNA was hen used as empla e o
h ee PCR eac ions a ge ed wi hin a aC1 (RT-PCR1), pA (RT-PCR2) and be ween i p2 3’-end and
i p1 5’-end (RT-PCR3). M, size ma ke om 100 o 1000 bp. Nega i e con ols (-) a e RT-PCR
(a)
(b)
Figu e 3.
T ansc ip ional o ganiza ion o he gene clus e pu a i ely encoding biosyn hesis and
anspo o side opho e piscibac in in V. o dalii. (
a
) The p edic ed gene unc ions a e: biosyn hesis,
genes i p1,i p2,i p3,i p4,i p5 and i p9; ou e memb ane ecep o , pA; ansc ip ional egula o s,
a aC1 and a aC2; and inne memb ane expo e o pu a i e side opho e, i p8. P edic ed p omo e s
P1 and P2 con aining Fu boxes a e indica ed by ed do s. RT deno es he loca ion o p ime used in
e o ansc ip ase eac ion while PCR 1, PCR 2 and PCR 3 indica e loca ion o p ime s o de ec ion
o cDNA om piscibac in gene clus e . (
b
) esul s o h ee RT-PCR eac ions designed o analyze he
ansc ip ion o he i p gene clus e . P ime ma ked as RT, a ge ed o he 3
0
-end o i p5 gene, was
used o ob ain a cDNA ha spanned om i p5 o a aC1. This cDNA was hen used as empla e o
h ee PCR eac ions a ge ed wi hin a aC1 (RT-PCR1), pA (RT-PCR2) and be ween i p2 3’-end and
i p1 5’-end (RT-PCR3). M, size ma ke om 100 o 1000 bp. Nega i e con ols (-) a e RT-PCR eac ions
lacking e e se ansc ip ase. Posi i e con ols (+) a e PCR eac ions using ch omosomal DNA as
empla e, +Fe: RT-PCR pe o med wi h cells g own unde i on excess (TSB-1 +FeCl
3
20
µ
M); -Fe:
RT-PCR pe o med wi h cells g own unde i on limi a ion (TSB-1 +2,20-dipy idyl 60 µM).
Mic oo ganisms 2019, 7, x FOR PEER REVIEW 8 o 15
eac ions lacking e e se ansc ip ase. Posi i e con ols (+) a e PCR eac ions using ch omosomal
DNA as empla e, +Fe: RT-PCR pe o med wi h cells g own unde i on excess (TSB-1 + FeCl3 20 µM);
-Fe: RT-PCR pe o med wi h cells g own unde i on limi a ion (TSB-1 + 2,2’-dipy idyl 60 µM).
In o de o analyze he exp ession le els o he i p
pu a i e p omo e s P1 and P2, DNA
agmen s o ca. 700 nucleo ides ups eam o pA and a aC1 genes (Figu e 3a) we e cloned in o he
plasmid pHRP309 ups eam o a p omo e less lacZ gene. Resul ing plasmids we e mobilized in o V.
o dalii Vo-LM-18 and he ansc ip ion le els o lacZ we e measu ed by de e mining β-galac osidase
ac i i y unde di e en condi ions o i on a ailabili y (Figu e 4). The use o he P pA (P1) and
Pa aC1 (P2) p esump i e p omo e s p oduced signi ican β-galac osidase ac i i y when cells we e
cul u ed unde a s ong i on limi a ion (CM9 medium plus 2,2’-dipy idyl 80 µM). Unde i on excess
condi ions (CM9 o CM9 plus FeCl
3
25 µM) he β-galac osidase ac i i y o he P2 p omo e was 75%
o he P1 p omo e (Figu e 4), sugges ing a highe basal ac i i y o his p omo e . Howe e , unde
s ong i on limi a ion, he P2 p omo e seems o be 10% mo e ac i e han P1, sugges ing a igh e
con ol by i on le els. These esul s demons a e ha he wo p omo e sequences could se e as
ansc ip ional s a s o he whole i p ope on, and ha bo h o hem a e s ongly egula ed by i on
le els wi h sligh a ia ions be ween hem.
Figu e 4. T ansc ip ional ac i i y (β-galac osidase uni s) o lacZ usions o P1 and P2 po en ial
p omo e s o V o dalii. β-galac osidase ac i i ies o p omo e P1::lacZ and p omo e P2::lacZ we e
measu ed in cells cul u ed in CM9 minimal medium, CM9 supplemen ed wi h 20 µM FeCl
3
, as an
i on excess condi ion, and in wo i on-limi ing condi ions: CM9 wi h 2,2’-dipy idyl 25 µM and CM9
wi h 2,2’-dipy idyl 80 µM. Th ee independen expe imen s we e pe o med in iplica e. Ba s
ep esen a e age alues wi h s anda d de ia ions indica ed by e o ba s. The da a we e analyzed
using ANOVA signi icance es (* p < 0.05).
3.3. Analysis o I on-Regula ed Ou e Memb ane P o eins
In G am-nega i e bac e ia some o he ou e memb ane p o eins (OMP) a e in ol ed in i on
up ake mechanisms, and mos o hem a e egula ed by i on. Thus, in o de o de ec he exp ession
o OMPs in ol ed in side opho e syn hesis and anspo in V. o dalii we in es iga ed by SDS-PAGE
he changes in he OMP p o iles when cells we e cul u ed unde i on excess o unde i on limi a ion.
Some o hese p o eins could hen be iden i ied by PMF. As shown in Figu e 5, clea changes in he
OMP p o ile could be de ec ed in h ee ep esen a i e s ains o V. o dalii when cells we e cul u ed
unde i on dep i a ion ( he s ains we e cul u ed in TSB-1 plus hal he MIC o he i on chela o
2,2′-dipy idyl). Fi e main bands (Table 2) could be iden i ied as p o eins clea ly egula ed by i on
Figu e 4.
T ansc ip ional ac i i y (
β
-galac osidase uni s) o lacZ usions o P1 and P2 po en ial p omo e s
o V. o dalii.
β
-galac osidase ac i i ies o p omo e P1::lacZ and p omo e P2::lacZ we e measu ed in cells
cul u ed in CM9 minimal medium, CM9 supplemen ed wi h 20
µ
M FeCl
3
, as an i on excess condi ion,
and in wo i on-limi ing condi ions: CM9 wi h 2,2
0
-dipy idyl 25
µ
M and CM9 wi h 2,2
0
-dipy idyl
80
µ
M. Th ee independen expe imen s we e pe o med in iplica e. Ba s ep esen a e age alues
wi h s anda d de ia ions indica ed by e o ba s. The da a we e analyzed using ANOVA signi icance
es (* p<0.05).
Mic oo ganisms 2019,7, 313 9 o 16
3.3. Analysis o I on-Regula ed Ou e Memb ane P o eins
In G am-nega i e bac e ia some o he ou e memb ane p o eins (OMP) a e in ol ed in i on
up ake mechanisms, and mos o hem a e egula ed by i on. Thus, in o de o de ec he exp ession o
OMPs in ol ed in side opho e syn hesis and anspo in V. o dalii we in es iga ed by SDS-PAGE he
changes in he OMP p o iles when cells we e cul u ed unde i on excess o unde i on limi a ion. Some
o hese p o eins could hen be iden i ied by PMF. As shown in Figu e 5, clea changes in he OMP
p o ile could be de ec ed in h ee ep esen a i e s ains o V. o dalii when cells we e cul u ed unde i on
dep i a ion ( he s ains we e cul u ed in TSB-1 plus hal he MIC o he i on chela o 2,2
0
-dipy idyl).
Fi e main bands (Table 2) could be iden i ied as p o eins clea ly egula ed by i on since all hem we e
p esen only in memb ane ac ions o cells g own unde i on-limi ing condi ions. Th ee o hese
p o eins we e high-molecula weigh p o eins ha we e unequi ocally iden i ied by PMF as VabF (311
kDa band ma ked as I in Figu e 5), I p1 (270 kDa band ma ked as II in Figu e 5) and I p2 (224 kDa band
ma ked as III in Figu e 5). These h ee p o eins co espond o NRPS enzymes in ol ed in anch obac in
(VabF) and piscibac in (I p1 and I p2) side opho e syn hesis. Al hough NRPSs a e cy osolic enzymes,
i has been epo ed ha some o hem can o m memb ane-bound mul i-enzyma ic complexes, called
side osomes, on he inne lea le o he cy oplasmic memb ane [
42
,
43
], which could explain hei
de ec ion in V. o dalii memb ane ac ions. P o ein I showed 98% iden i y o VabF, a NRPS o V.
anguilla um in ol ed in anch obac in biosyn hesis. P o eins II and III clea ly co espond wi h I p1 and
I p2, he wo NRPS in ol ed in he syn hesis o piscibac in in P. damselae subsp. piscicida [
23
,
27
] (wi h
simila i ies o 70% and 68%, espec i ely) and in V. anguilla um [
29
] (bo h p o eins wi h simila i ies
o 98%).
Mic oo ganisms 2019, 7, x FOR PEER REVIEW 9 o 15
since all hem we e p esen only in memb ane ac ions o cells g own unde i on-limi ing
condi ions. Th ee o hese p o eins we e high-molecula weigh p o eins ha we e unequi ocally
iden i ied by
PMF as VabF (311 kDa band ma ked as I in Figu e 5), I p1 (270 kDa band ma ked as II
in Figu e 5) and I p2 (224 kDa band ma ked as III in Figu e 5). These h ee p o eins co espond o
NRPS enzymes in ol ed in anch obac in (VabF) and piscibac in (I p1 and I p2) side opho e
syn hesis. Al hough NRPSs a e cy osolic enzymes, i has been epo ed ha some o hem can o m
memb ane-bound mul i-enzyma ic complexes, called side osomes, on he inne lea le o he
cy oplasmic memb ane [42,43], which could explain hei de ec ion in V. o dalii memb ane ac ions.
P o ein I showed 98% iden i y o VabF, a NRPS o V. anguilla um in ol ed in anch obac in
biosyn hesis. P o eins II and III clea ly co espond wi h I p1 and I p2, he wo NRPS in ol ed in he
syn hesis o piscibac in in P. damselae subsp. piscicida [23,27] (wi h simila i ies o 70% and 68%,
espec i ely) and in V. anguilla um [29] (bo h p o eins wi h simila i ies o 98%).
Figu e 5. Rep esen a i e SDS-PAGE gel showing ou e memb ane p o ein (OMP) p o iles o V. o dalii
s ains unde i on- ich and i on-limi ed condi ions. MW: Molecula weigh ma ke ; 1: ATCC 33509
T
unde i on-excess condi ions; 2: ATCC 33509
T
unde i on-limi a ion (TSB-1 + 2,2′-dipy idyl 45 µM); 3:
Vo-LM-13 unde i on-excess, 4: Vo-LM-13 unde i on-limi a ion (TSB-1 + 2,2′-dipy idyl 90 µM); 5:
Vo-LM-18 unde i on-excess; and 6: Vo-LM-18 unde i on-limi a ion (TSB-1 + 2,2′-dipy idyl 60 µM).
*: P o eins exp essed only unde i on limi a ion and iden i ied by PMF as ollows: I, VabF
( anch obac in syn hesis); II, I p1; III, I p2 (piscibac in syn hesis); IV, Hu S (heme ecep o ); V, F pA
(piscibac in ecep o ).
Table 2. Iden i ica ion by pep ide mass inge p in ing (PMF) o i e p o eins di e en ially exp essed
unde i on limi a ion in SDS-PAGE gel showed in Figu e 5.
Band in
Gel (Figu e
5)
Es ima ed
Size
(kDa)
Closes Homologues Accession No. Simila i y
(%)
Band I 311 VabF, V. anguilla um CAJ45639.1 98
Band II 270 I p1, V. anguilla um WP_019281879.1 98
I p1, P. damselae subsp. piscicida AKQ52532.1 70
Band III 224 I p2, V. anguilla um WP_019281878.1 98
I p2, P. damselae subsp. piscicida AKQ52531.1 68
Band IV 79 Hu S, V. anguilla um CAJ14788.1 99
Band V 71 F pA, V. anguilla um WP_019281876.1 96
Figu e 5.
Rep esen a i e SDS-PAGE gel showing ou e memb ane p o ein (OMP) p o iles o V.
o dalii s ains unde i on- ich and i on-limi ed condi ions. MW: Molecula weigh ma ke ; 1: ATCC
33509
T
unde i on-excess condi ions; 2: ATCC 33509
T
unde i on-limi a ion (TSB-1 +2,2
0
-dipy idyl
45
µ
M); 3: Vo-LM-13 unde i on-excess, 4: Vo-LM-13 unde i on-limi a ion (TSB-1 +2,2
0
-dipy idyl
90
µ
M); 5: Vo-LM-18 unde i on-excess; and 6: Vo-LM-18 unde i on-limi a ion (TSB-1 +2,2
0
-dipy idyl
60
µ
M). *: P o eins exp essed only unde i on limi a ion and iden i ied by PMF as ollows: I, VabF
( anch obac in syn hesis); II, I p1; III, I p2 (piscibac in syn hesis); IV, Hu S (heme ecep o ); V, F pA
(piscibac in ecep o ).
Mic oo ganisms 2019,7, 313 16 o 16
51.
Ac is, L.A.; Tolmasky, M.E.; C osa, J.H. Vib iosis. In Fish Diseases and Diso de s; Woo, P.T.K., B uno, D.W.,
Eds.; CAB In e na ional: London, UK, 2011; Volume 3, pp. 570–604.
52.
Naka, H.; Lopez, C.S.; C osa, J.H. Reac i a ion o he anch obac in side opho e sys em o Vib io anguilla um
by emo al o a ch omosomal inse ion sequence o igina ed in plasmid pJM1 encoding he anguibac in
side opho e sys em. En i on. Mic obiol. 2008,10, 265–277. [C ossRe ] [PubMed]
©
2019 by he au ho s. Licensee MDPI, Basel, Swi ze land. This a icle is an open access
a icle dis ibu ed unde he e ms and condi ions o he C ea i e Commons A ibu ion
(CC BY) license (h p://c ea i ecommons.o g/licenses/by/4.0/).