Engineering phages towards Pseudomonas aeruginosa detection and control

Universidade do Minho Escola de Engenharia Maria João Caetano da Costa Engineering phages towards Pseudomonas aeruginosa detection and control October 2022 Engineering phages towards Pseudomonas aeruginosa detection and control Maria João Caetano da Costa UMinho | 2022 Universidade do Minho Escola de Engenharia October 2022 Maria João Caetano da Costa Engineering phages towards Pseudomonas aeruginosa detection and control Master’s Thesis Master’s degree in Biotechnology Work supervised by Doctor Diana Priscila Penso Pires Doctor Sílvio Roberto Branco dos Santos ii Nome: Maria João Caetano da Costa Endereço eletrónico: [email protected] Título da dissertação: Engineering phages towards Pseudomonas aeruginosa detection and control Orientadores: Doutora Diana Priscila Penso Pires Doutor Sílvio Roberto Branco dos Santos Ano de conclusão: 2022 Mestrado em Biotecnologia DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho Atribuição-NãoComercial-SemDerivações CC BY-NC-ND https://creativecommons.org/licenses/by-nc-nd/4.0/ iii AGRADECIMENTOS No final deste percurso tão intenso e desafiante, não podia deixar de expressar o meu agradecimento a todos os que me acompanharam e apoiaram durante toda esta etapa profissional e pessoal que chega agora ao fim. Primeiramente gostaria de agradecer à Doutora Diana Priscila Pires e Doutor Sílvio Santos, orientadores da minha dissertação de mestrado, por me receberem tão bem neste projeto. Sou uma privilegiada por toda a experiência e formação que me proporcionaram. Agradeço a presença constante, dedicação, paciência, confiança e por serem incansáveis neste trabalho. Todo o vosso apoio, profissionalismo, excelência e rigor científico alargaram os meus horizontes ao longo desta jornada e tornaram-me preparada para novos desafios. Ao grupo do LPhage, agradeço por me terem recebido tão bem neste laboratório. Obrigada pela vossa companhia, disponibilidade e transmissão de conhecimento sempre de forma tão atenciosa. Foi um prazer trabalhar convosco e sem vocês não seria o mesmo. Toda a vossa boa disposição, carinho e ajuda contribuíram para que tudo isto se tornasse possível. Obrigada aos amigos incríveis que tenho. Agradeço terem cruzado o meu caminho, desde Marco de Canaveses, Vila Real ou Braga, pela vossa amizade incondicional, companheirismo, motivação e boa disposição capazes de transformar uma lágrima num sorriso. Tornaram este percurso mais fácil!! Ao Bruno, obrigada pelo apoio incansável nos momentos mais difíceis, por teres sempre uma palavra de conforto, pelo carinho e por toda a cumplicidade. Obrigada por estares sempre presente, acreditares e me fazeres acreditar que tudo isto seria possível. Por último, quero agradecer aos meus pais por tornarem todo este percurso possível, apoiarem em todos os momentos e estarem sempre presentes. O maior agradecimento será sempre para vós que me permitem, todos os dias, lutar pelos meus objetivos. Como não podia deixar de ser, quero também agradecer aos meus irmãos, Flávia e Marco! Apesar de me roubarem os panados e teimarem em contrariar comigo, sei que torcem por mim. Aos meus avós, que sempre tiveram fé nas minhas conquistas, um abracinho especial. Este trabalho foi financiado por fundos nacionais através da FCT – Fundação para a Ciência e a Tecnologia, I.P., no âmbito do projeto “PhageShaper – uma plataforma eficiente para editar fagos de P. aeruginosa para o controlo de doenças infecciosas” com a referência EXPL/EMD-EMD/1142/2021. Obrigado! iv STATEMENT OF INTEGRITY I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho. v SUMÁRIO A Pseudomonas aeruginosa é uma bactéria Gram-negativa que prospera numa variedade de ambientes. Esta bactéria patogénica é um dos microrganismos mais frequentemente isolados do trato respiratório de pacientes em estado crítico e imunocomprometido. Para além disso, o seu frequente envolvimento numa ampla gama de doenças e a sua baixa suscetibilidade a uma ampla gama de antibióticos, torna P. aeruginosa um sério desafio terapêutico, que muitas vezes resulta em internamentos prolongados, aumento dos custos médicos e altas taxas de mortalidade. Face a isto, o desenvolvimento de abordagens alternativas ao uso destes antimicrobianos é de extrema importância e os bacteriófagos têm um elevado potencial no controlo de doenças bacterianas, mas geralmente exibem um espetro de ação limitado. Através da utilização de ferramentas de engenharia de fagos, é possível produzir fagos quiméricos com características desejáveis de forma a melhorar a deteção e/ou controlo de estirpes bacterianas num contexto clínico. Além disso, os fagos modificados podem codificar vários genes repórter, substituindo assim os métodos de cultura convencionais. O objetivo deste projeto assenta na engenharia do genoma de fagos de P. aeruginosa para melhorar as suas funcionalidades, assim como aumentar o seu espetro de ação para uma ampla gama de bactérias hospedeiras e obter uma ferramenta promissora para o diagnóstico e tratamento de pacientes com infeções resistentes a antibióticos. O primeiro passo deste trabalho consistiu em avaliar o potencial de um fago repórter previamente construído, contendo o gene da NanoLuc luciferase (PE3Δgp1–gp12:Nluc) para detetar células de P. aeruginosa . O limite de deteção deste fago repórter variou entre 620 e 9000 UFC/mL em apenas 7 h, sendo o limite de deteção mais baixo alcançado para a estirpe hospedeira do fago. Posto isto, este sistema de deteção baseado em fago constitui uma alternativa promissora aos métodos de cultura, já que permite um diagnóstico mais rápido. A fim de aumentar o espetro lítico deste fago, foi realizada uma análise genómica para os fagos de Pseudomonas phiIBB-PAA2 e vB_PaeP_PE3. Desta forma, foram identificadas e selecionadas potenciais Tail Fiber Proteins (TFPs). Sete proteínas codificadas nos genomas dos fagos foram selecionadas e de seguida clonadas, expressas e purificadas, mas apenas uma (pGFP_A2gp55) foi capaz de se ligar a células de P. aeruginosa PAO1. Com base nestes ensaios, foi usada uma ferramenta de engenharia de fagos baseada em levedura para inserir com sucesso a TFP funcional ( gp 55) do fago A2 no genoma do fago PE3Δgp1–gp12:Nluc. Ainda assim, este método não permitiu aumentar o espetro de hospedeiros do fago. Palavras-chave: Pseudomonas aeruginosa , resistência antibiótica, bacteriófagos, engenharia de fagos, fagos quiméricos, deteção de patógenos, controlo de patógenos, limite de deteção. vi ABSTRACT Pseudomonas aeruginosa is a Gram-negative bacterium that thrives in a variety of environments. This bacterial pathogen is one of the most common microrganims frequently isolated from the respiratory tract of critically ill and immunocompromised pacients. In addition, its frequent involvement in a wide range of illnesses and its low susceptibility to a wide range of antibiotics, makes P. aeruginosa a serious therapeutic challenge, which often results in prolonged hospital stays, increased medical costs, and high mortality rates. Given this, the development of alternative approaches to the use of these antimicrobials is extremely important and bacteriophages have a tremendous potential against bacterial diseases but they usually exhibit a limited host range. Taking advantage of phage-engineering tools, it is possible to assemble chimeric phages with desirable features in order to improve the detection and/or control bacterial strains in clinical settings. In addition, engineered phages can encode numerous reporter genes, therefore replacing the conventional culture methods. The aim of this project relies on engineering the genome of P. aeruginosa phages to improve its performance by expanding their host range, in order to get a promising tool for the diagnosis and treatment of patients with antibiotic-resistant infections. This research's initial step was to evaluate how well a previously built reporter phage (PE3gp1-gp12:Nluc) could identify P. aeruginosa cells. The lowest detection limit for the phage host strain P. aeruginosa PAO1 was reached by this reporter phage, whose detection limit ranged from 620 to 9000 CFU/mL in only 7 hours. Nevertheless, because it enables quicker diagnosis, this phage-based detection technology is a possible replacement for culture approaches. To increase the host range of this phage, a genomic analysis was performed for the Pseudomonas phages phiIBB-PAA2 and vB_PaeP_PE3. This method allowed for the identification and selection of prospective Tail Fiber Proteins (TFPs). Seven selected proteins encoded in phage genomes were then cloned, expressed and purified, but only one (pGFP_A2gp55) was capable of binding to P. aeruginosa PAO1 cells. Based on these assays, the yeast-based phage-engineering tool was used to successfully insert the functional TFP ( gp 55) from A2 phage on PE3Δgp1–gp12:Nluc phage genome. However, this approach was unable to broaden the range of phage hosts. Keywords: Pseudomonas aeruginosa , antibiotic resistance, bacteriophages, phage-engineering, chimeric phages, pathogen detection, pathogen control, limit of detection. vii TABLE OF CONTENTS Agradecimentos ................................................................................................................................. iii Sumário .............................................................................................................................................. v Abstract ............................................................................................................................................. vi List of abbreviations............................................................................................................................ ix List of figures ..................................................................................................................................... xi List of tables ...................................................................................................................................... xiv 1. Introduction ................................................................................................................................ 2 1.1. Overview of Pseudomonas aeruginosa clinical impact .......................................................... 2 1.2. Diagnostic methods for detection of Pseudomonas aeruginosa in clinical settings ................. 4 1.3. Bacteriophages ................................................................................................................... 7 1.3.1. Definition and infection cycles .............................................................................................. 7 1.3.2. Advantages and limitations of phages .................................................................................. 8 1.3.3. Diagnosis of pathogens based on phages ........................................................................... 10 1.3.4. Phage-engineering techniques ........................................................................................... 11 1.4. Project aims ...................................................................................................................... 13 2. Materials and methods ............................................................................................................. 16 2.1. Strains, plasmids and culture conditions ............................................................................ 16 2.2. Sensitivity tests for detection of P. aeruginosa .................................................................... 17 2.3. Evaluation of lytic spectra and efficiency of plating ............................................................. 18 2.4. Cloning and functional analysis of potential TFPs ............................................................... 18 2.4.1. Gene amplification ............................................................................................................ 19 2.4.2. Cloning ............................................................................................................................. 22 2.4.3. Protein expression ............................................................................................................. 25 2.4.4. Protein purification ............................................................................................................ 25 2.4.5. Fluorescence microscopy .................................................................................................. 27 2.5. Genome engineering of P. aeruginosa phage vB_PaeP_PE3 .............................................. 27 2.5.1. Preparation of the PCR products for genome engineering ................................................... 28 2.5.2. Genome engineering ......................................................................................................... 30 2.5.3. Transformation of captured phage genome into P. aeruginosa cells .................................... 32 2.5.4. Phage production and sequencing ..................................................................................... 33 2.5.5. Host-range of the chimeric phages ..................................................................................... 33 xiv LIST OF TABLES Chapter 2 Table 1 - Primers used to amplify the TFPs encoding genes from philBB-PAA2A2 and vB_PaeP_PE3 phages, the respective restriction enzyme site used and their parameters. Tm represents the melting temperature. Enzyme restriction sites are underlined.…………….…..…………………………………………..…20 Table 2 - Components and quantities used for PCR with Phusion™ Plus DNA Polymerase.……………....21 Table 3 - Thermocycling conditions for a routine PCR with Phusion™ Plus DNA Polymerase ……………..21 Table 4 - Reaction components and volumes or concentrations used to digest the target genes………….22 Table 5 - Reaction components, volumes or final concentrations for the ligation of the target genes……..23 Table 6 - PCR mix components and their final concentrations for colony PCR…………………………………24 Table 7 - Primers used for colony PCR and their parameters. Tm represents the melting temperature…24 Table 8 - Thermocycling conditions for a colony PCR…………………………………………………………………24 Table 9 – SDS-PAGE components and quantities ………………..……………………………………………………26 Table 10 - Backbone, transformations (T1 and T2) and the respective DNA fragments, template, size and primers used……………………….……………………………………………………………………………………………28 Table 11 - Primers used to amplify all the PCR products for the yeast transformation. Overhangs are underlined….……………………………………………….……………………………………………………………………29 Table 12 - Components and quantities used for PCR with Xpert High Fidelity DNA Polymerase.………....30 Table 13 - Thermocycling conditions used for PCR with Xpert High Fidelity DNA Polymerase …….……..30 Table 14 - PCR mix components and concentrations for yeast colony PCR…………………………….………31 Table 15 – Primers used in yeast colony PCR and their parameters. Tm represents the melting temperature…………………………………………………………………………………………….……………….………31 Table 16 - Thermocycling conditions for a yeast colony PCR…………………………………………………….…31 Chapter 3 Table 17 - EOP against different strains of P. aeruginosa ……..………………………..…………………………..41 Table 18 - EOP of the new phage produced (T2) against different strains of P. aeruginosa ….………….…52 Supplementary material Table S1 – Bacterial strains, bacteriophages and plasmids utilized in this study…………………………….69 Table S2 - Sequence of nucleotides and amino acids of the genes used at this work……………………….73 xv Table S3 - Annotation of phage A2. For each locus_tag, the transcription start and stop position. The corresponding gene product size and putative predicted function based on the best hit and E-value obtained.………………………………………………………………………………………………………………………….76 Table S4 - Annotation of phage A2. For each locus_tag, the transcription start and stop position. The corresponding gene product size and putative predicted function based on the best hit and E-value obtained ………………………………………………………………………………………………………………………….79 Chapter 1 INTRODUCTION Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 1 – Introduction 2 1. INTRODUCTION 1.1. Overview of Pseudomonas aeruginosa clinical impact Pseudomonas aeruginosa is an ubiquitous Gram-negative bacterium belonging to the Pseudomonadaceae family that is capable of surviving in a wide range of environments (Pachori et al., 2019; Silby et al., 2011). This opportunistic bacterium can be found in water, soil and plants, infecting many different organisms, such as yeasts, plants, nematodes, insects and mammals (Pachori et al., 2019; Pereira et al., 2014). In humans, P. aeruginosa is one of the most frequent pathogens isolated from the respiratory tract of critically ill and immunocompromised patients and is considered the main cause of morbidity and mortality in patients with ventilator-associated pneumonia and cystic fibrosis (CF). P. aeruginosa is also frequently involved in many other infections, including catheter-associated infections, burn wound infections, bloodstream infections, urinary tract infections, and surgical site infections, thus constituting a real and high concern in hospital settings. Indeed, this pathogen is a major cause of nosocomial bacteraemia, with a very high (>30 %) associated mortality rate (Bassetti et al., 2018; Juan et al., 2017; Nguyen et al., 2018; Pachori et al., 2019; Pereira et al., 2014). According to the Centers for Disease Control and Prevention, (2019), in 2017 there were an estimated 32.600 cases of infections caused by P. aeruginosa in hospitalized patients and approximately 2.700 deaths in US, corresponding to $ 767M of health care costs. P. aeruginosa possesses an arsenal of several virulence factors to evade host cell defences. These virulence mechanisms include adhesins, proteases, phenazines, pyocyanin, exotoxins of the type III secretion system (T3SS), flagella or lipopolysaccharides (LPS). These virulence factors have specific roles to counteract host defences. Adhesins, for instance, participate in the initial stage of infection, allowing bacteria to adhere to host cells. Proteases, mainly alkaline protease and elastase, degrade elastin, which represents 28 % of the lung tissue. Phenazins increase intracellular oxidative stress, inhibiting mitochondrial activity and cell proliferation in neutrophils and macrophages. T3SS promotes apoptosis of eukaryotic cells and the spread of the disease through the lung (Passador et al., 1993; Pereira et al., 2014; Strateva & Mitov, 2011). Many of the P. aeruginosa virulence factors are regulated by quorum-sensing (QS), a cell-cell communicating mechanism that controls gene expression based in fluctuations on cell density. Two distinct QS systems are known in P. aeruginosa : las and rhl (Reuter et al., 2016; Strateva & Mitov, 2011). Besides the virulence factors described above, P. aeruginosa also has an innate ability to form biofilms, which can be defined as aggregates of bacteria encased in a self- Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 1 – Introduction 3 produced matrix of extracellular polymeric substances (EPS) that confers protection to the bacterial cells. Therefore, these complex structures are very difficult or even impossible to eradicate with antibiotic treatment (Ciofu & Tolker-nielsen, 2019; Moradali et al., 2017), being a huge challenge in clinical settings. P. aeruginosa resistance may be expressed by three different forms (Figure 1) to a wide range of antibiotics, such as β-lactams, aminoglycosides, quinolones and polymyxins (Bassetti et al., 2018; Heinz et al., 2019; Klockgether et al., 2011; Pachori et al., 2019). Figure 1 - Pseudomonas aeruginosa resistance mechanisms. The intrinsic resistance of P. aeruginosa includes low permeability of the outer membrane, expression of efflux pumps that expel antibiotics out of the cell, and the production of antibiotic inactivating enzymes (Breidenstein et al., 2011; Ghysels et al., 2008; Pachori et al., 2019). The acquired resistance of P. aeruginosa can be achieved by horizontal transfer of resistance genes or mutational changes (Breidenstein et al., 2011; Pachori et al., 2019). Adaptive resistance is inducible and dependent Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 1 – Introduction 4 on the continued presence of an antibiotic or another environmental stimulus. Several triggering factors are now qualified to induce this type of resistance, including antibiotics, biocides, polyamines, anaerobiosis, cations, pH and carbon sources, as well as biofilm formation. These factors modulate the expression of many genes, leading to effects on the efflux pumps, cell envelope, and enzymes. An important feature of adaptive resistance is that, once the inducing factor or condition is removed, the organism reverts to wild-type susceptibility. Adaptive resistance can also have long-term consequences. If cells are not completely eradicated, as soon as the treatment stops, growth can be observed (Breidenstein et al., 2011). This is of particular concern in clinical environments where P. aeruginosa grows as a biofilm (Breidenstein et al., 2011). The overuse and misuse of antibiotics is a growing public health concern, which can result in negative side effects and the development of drug-resistant bacterial strains (Takahashi & Tatsuma, 2014). According to Bassetti et al. (2018), infections related to Pseudomonas spp . were reported in 60 % of his studies and overall, mortality ranged from 33 to 71 % in patients with carbapenem-resistant Pseudomonas infections. In addition to mortality, resistance is also associated with increased healthcare costs (Bassetti et al., 2018). Moreover the development of new antibiotics is currently very limited and time-consuming (Pang et al., 2019). In 2017, the World Health Organization (WHO) published a global priority list of antibioticresistant bacteria that urgently require the development of new antibiotics (World Health Organization, 2017). The most critical group includes multi-resistant bacteria that pose a specific threat in hospitals, nursing homes and among patients whose care requires devices such as ventilators and blood catheters. This group includes Acinetobacter baumannii , P. aeruginosa and several Enterobacteriaceae . Thus, the discovery and development of alternative therapeutic strategies to control P. aeruginosa infections is urgent (Breidenstein et al., 2011; Chatterjee et al., 2016; Pachori et al., 2019). These new therapeutic strategies can act alone or in combination with conventional therapies, and may include QS inhibitors, iron chelation molecules, vaccine strategy, nanoparticles, antimicrobial peptides, electrochemical scaffolding and phage therapy (Pang et al., 2019). 1.2. Diagnostic methods for detection of Pseudomonas aeruginosa in clinical settings At incredibly low quantities, Pseudomonas aeruginosa can cause illnesses; just 10–100 bacilli can colonize the intestine of extremely ill or immunocompromised patients, which can result in persistent and long-term infections. Long turnaround times for diagnoses can worsen patient outcomes and raise Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 1 – Introduction 5 hospital costs (Tang et al., 2017). In addition to the development of new therapies to treat P. aeruginosa infections, it is also urgent the development of fast and accurate tools to detect P. aeruginosa in clinical settings, replacing the conventional methods that are usually laborious and time-consuming. The biological characteristics of the bacterium under specific culture conditions or the activities of bacterial molecules like oxidase, acetamidase, arginine dihydrolase, and pyocyanin are the basis for conventional Pseudomonas aeruginosa detection methods (Tang et al., 2017). Bacteria are most frequently detected by culture methods using selective and non-selective media. P. aeruginosa is easily grown in different media and these media play an important role in their detection. In blood agar, a nonselective medium, P. aeruginosa is sometimes overgrown by the commensal flora (Xu et al., 2004). Gram-negative selective media, such as McConkey agar, make the discrimination of P. aeruginosa from other respiratory pathogens and native flora more convenient. Selective media such as P. aeruginosa isolation agar or cetrimide agar were especially developed for the culture of P. aeruginosa (Tramperstranders et al., 2005; Xu et al., 2004). However, these old procedures have some significant limitations and frequently require more than 48 h for early results (Tramper-stranders et al., 2005). On the other hand, infection with P. aeruginosa can be proven both by the culture of the organism itself and by the detection of the immune response to the microorganism. The antibody test with ELISA (Enzyme-linked immunosorbent assay) demonstrated little or no interference from cross-reactive antibodies directed against other bacteria (Tramper-stranders et al., 2005). Chronic infection generally causes a high antibody response (Burns et al., 2001; Tramper-stranders et al., 2005). The polymerase chain reaction (PCR) of samples has been used for the detection of P. aeruginosa in patients with CF at an early stage and has a high sensitivity for P. aeruginosa . Serological and molecular techniques are particularly useful for initial or intermittent colonization, because chronic colonization is usually easily confirmed by culture (Tramper-stranders et al., 2005). In order to discriminate between viable and non-viable cells, reverse transcription PCR (RT-PCR) has been created. Because these tests amplify RNA, a product of ongoing cellular and metabolic activities, only recently alive organisms may be identified (Anbu et al., 2017; Young et al., 2005). Due to higher false-positive results as compared to culture and other approaches, as well as technical difficulties and costs, RT-PCRbased detection methods are not frequently employed, raising questions about their efficacy. (Jones et al., 2020; Schmelcher & Loessner, 2014). By adding fluorescent molecules to the reaction mixture, the real-time, fluorescence-based quantitative PCR (real-time qPCR) approach offers a quantitative detection through real-time monitoring Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 1 – Introduction 6 of PCR reactions and is one of the most popular nucleic acid-based molecular detection methods for pathogens at the moment. This technique allowed the detection of P. aeruginosa in CF patients more quickly. Real-Time fluorescence-based PCR was also a leading method for the detection of pathogens in respiratory tract infections and pneumonia, and it was a very sensitive, powerfully speedy, extensively applicable, and prospectively detectable instrument (Tang et al., 2017). FISH (Fluorescent In Situ Hybridization) is another technique used for bacterial detection; however, the sensitivity, percentage of target strains that are detected with FISH compared to the culture is not very high, as the microscopic detection limit depends on samples of high bacterial density. In addition, the procedure is not simple and does not discriminate between dead and live cells (Hogardt et al., 2000; Tramper-stranders et al., 2005). A novel kind of soft ionization mass spectrometry called matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) is used to map the protein spectrum of microbes. To obtain an identification, the mass spectrometry data of clinical microorganisms are compared with the common protein database of recognized bacteria. MALDI-TOF MS has becoming a fast and effective microbial identification method used in clinical diagnostics, environmental monitoring, and microbiological classification research due to its speed, accuracy, sensitivity, automation, and high throughput. This method has also been used by some researchers to identify P. aeruginosa (Tang et al., 2017). These quick procedures, nevertheless, are hindered by the need for expensive equipment, timeconsuming pre-enrichment steps, and challenging results handling and interpretation (MALDI-TOF MS) (Schmelcher & Loessner, 2014). Various biorecognition components, including antibodies, enzymes, aptamers, and nucleic acids, have been used extensively in recent years and are essential for the detection of infections in a variety of complicated matrices. Antibodies against P. aeruginosa can appear months before a culture becomes positive, and are a useful parameter for monitoring infection in patients colonized with P. aeruginosa , as titres may vary with antimicrobial treatment but these compounds are laborious and expensive to produce, have high detection limits, and frequently exhibit cross-reactivity (Costa et al., 2022; Tramperstranders et al., 2005). Bacteriophages are good candidates to replace traditional recognition molecules due to their interesting properties, including high specificity, sensitivity, stability, and ease of engineering (Costa et al., 2022). In addition, since they only multiply in viable cells, they can also discriminate between live and dead cells, are simple and affordable to produce, and exhibit high resistance to changes Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 1 – Introduction 7 in temperature and pH, chemical solvents, and proteases (Schmelcher & Loessner, 2014). These properties can improve the early detection of P. aeruginosa in clinical settings since aggressive antimicrobial therapy can prevent growth and detection of P. aeruginosa through culture methods. (Tramper-stranders et al., 2005). 1.3. Bacteriophages 1.3.1. Definition and infection cycles About 100 years ago, Félix d'Hérelle discovered the viruses of bacteria - bacteriophages (phages). Their ability to predate bacteria quickly prompted its use to treat and prevent infectious diseases in humans and animals (Lin et al., 2017; Monteiro et al., 2019). Phages are simple, yet extremely diverse, biological entities that consist of DNA or RNA encased in a protein capsid. As naturally occurring bacterial parasites, phages are unable to reproduce independently and are ultimately dependent on a bacterial host for survival (Lin et al., 2017). The infection begins with the adsorption of the phage to specific bacterial receptors located on the cell surface and this causes the genome of the phage to be ejected into the cell. The subsequent replication strategy defines the phage as strictly lytic or temperate (Figure 2) (Lin et al., 2017; Monteiro et al., 2019). Figure 2 - Bacteriophage infection cycle. Adapted from Gaydos, (2018). Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 1 – Introduction 8 Strictly lytic or virulent phages always follow a lytic life cycle in which, immediately after the genome is ejected, the expression of the phage's early genes redirects the host's metabolism to phage DNA replication and protein synthesis. Viral proteins are then assembled, and the viral genome is packaged in capsids. At the end of the lytic cycle, the production of late phage proteins, such as holins and endolysins, leads to cell lysis and release of progeny phages that will be available to start a new cycle of infection (Drulis-kawa et al., 2012; Kortright et al., 2019; Monteiro et al., 2019). Temperate phages can follow a lysogenic cycle in which they usually integrate their genome with the host chromosome, where they remain quiescent, as prophages. The prophage replicates with the bacterial chromosome and is subsequently transmitted by cell division to the daughter cells. This quiescent state can be maintained for long periods, unless the cell is exposed to an environmental stimulus that can cause the phage to be induced into a lytic cycle (Davies et al., 2016; Kortright et al., 2019; Lin et al., 2017; Monteiro et al., 2019). In addition, phages can assume a pseudolysogenic cycle, in which the phage genome is transported in host cells without propagation (lytic cycle) or replication with the cell genome (lysogenic cycle). The non-integrated phage genome is inherited by only one of the emerging descendent cells. This phenomenon is apparently caused by unfavourable growth conditions for host cells, such as severe hunger, and ends when those conditions cease; the phage then restarts its development through the lytic or lysogenic life cycle (Lin et al., 2017; Monteiro et al., 2019). 1.3.2. Advantages and limitations of phages In consequence of the global spread of antibiotic resistance, phages are becoming increasingly attractive as an alternative therapeutic approach against antibiotic-resistant bacterial infections (Pirnay et al., 2018). Theoretically, there are no bacteria that cannot be lysed by at least one phage. One of the most important characteristics of phages is their high specificity, meaning that they have the ability to kill only the pathogen that they can recognize (Principi et al., 2019).This high specificity avoids the most important problem related to the administration of antibiotics, which is their influence on the entire microbiome with the elimination of potentially beneficial bacteria (Domingo-Calap & Delgado-Martínez, 2018; Loccarrillo & Abedon, 2011). In addition to the high specificity, phages offer some other important advantages over antibiotics. One of them is that their isolation, typically from wastewater and sewage, is usually relatively easy (although it depends on the host bacteria) (Principi et al., 2019). Also, phages are Chapter 2 MATERIALS AND METHODS Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 16 2. MATERIALS AND METHODS 2.1. Strains, plasmids and culture conditions All the strains, bacteriophages and plasmids used in this work are listed in Supplementary material - Table S1. The clinical isolates were provided by the Hospital of Braga (Portugal). All bacterial strains were grown in Lysogeny Broth (LB) (Nzytech) at 37 °C under agitation (120 rpm) or in LB agar (LBA) plates, obtained by adding 12 g٠L-1 of agar (Lioflchem). All media were prepared according to the manufacturer's instructions and autoclaved before use. Due to the facility to be manipulated and the high pool of tools available for this organism, Escherichia coli was used for cloning and heterologous expression. The E. coli strain growth media were supplemented with antibiotics for selection when necessary: kanamycin (Nzytech) at 50 µg/mL and gentamicin (Nzytech) at 20 µg/mL, and the bacterial growth was determined by measuring the optical density at 600nm (OD600nm) in 96-well plates (Orange Scientifc) using a Multiskan™ FC Microplate Photometer (ThermoFisher Scientifc). Chemically competent (QC) cells were prepared for the following strains: E. coli Arctic Express (AE)(DE3), C43 (DE3) and BL21 (DE3). For this, the E. coli strain was grown overnight at 37 °C, 120 rpm in 10 mL of LB. This culture was diluted 1:100 in fresh LB and incubated at 37 °C, 120 rpm for 1 h 30 min. Following centrifugation (3300 ×g, 4 °C, 10 min), the cells were collected, resuspended in half of the initial volume of ice-cold 0.1 M CaCl2, and stored on ice for 30 min. After a second centrifugation (3300 ×g, 4 °C, 10 min), the pellet was resuspended in 1/10 of the initial volume of ice-cold 0.1 M CaCl2. Finally, another centrifugation (3300 ×g, 4 °C, 10 min) was carried and the pellet resuspended in 1 mL of ice-cold 0.1 M CaCl2 and aliquots of 50 µL were made and stored at -80 °C until use. Transformant AE cells were inoculated in LB broth supplemented with Kanamycin and gentamicin, at 16 °C, 160 rpm while C43 and BL21 cells were inoculated in LB broth supplemented only with kanamycin. C43 cells were cultured at 21 °C and 160 rpm and BL21 cells were cultured on the same conditions as AE. The constructions of the recombinant plasmids were predicted using the SnapGene™ 1.1.3 version Software. All bacteria (with or without the correct constructs) were stored at -20 °C in LB broth supplemented with 20 % glycerol (v/v). The Saccharomyces cerevisiae BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) and the yeast centromere vector pRS415 (ATCC 87520) with LEU2 marker were obtained from laboratory stocks. S. cerevisiae BY4741 was cultured in YPD (1 % (w/v) Bacto Yeast Extract, 2 % (w/v) Bacto Peptone and Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 17 2 % dextrose (w/v)) or YPD agar at 30 °C. All clones (yeast transformants) with the proper gene size were stored at -20 °C in SD-Leu [0.67 % Yeast Nitogen Base (YNB), 0.069 % CSM-Leu, 2 % dextrose] supplemented with 20 % glycerol (v/v). 2.2. Sensitivity tests for detection of P. aeruginosa The sensitivity of a previously assembled reporter phage (designated as PE3Δgp1–gp12:Nluc) was assessed here to determine the detection limit of the phage. This phage consists in the PE3Δgp1– gp12 phage with the Nanoluc reporter gene, which was inserted after the endolysin gene. Cultures of P. aeruginosa PAO1 grown overnight in LB medium were nine-fold serially diluted and infected with 105 PFU/mL of the reporter phage PE3Δgp1–gp12:Nluc. Bacterial counts from each dilution were determined by plating on LB agar prior to infection. Infected cultures (50 µL) were incubated at 37 °C with agitation (120 rpm) and bioluminescence was quantified at time 0 and every hour, during a period of 7 hours, in eppendorf tubes using a Ultrasensitive Single Tube Luminometer (Promega) after the addition of Nano-Glo® Luciferase (Promega) reagent according to the manufacturer’s instructions. Figure 3 shows the procedure of the sensitivity tests in a schematic way. Figure 3 - Procedure followed for the sensitivity tests, for the detection of P. aeruginosa . In non-enrichment experiments, the bacterial cultures were infected with phage immediately after dilutions, and the luminescence signal (RLUs) was tracked over time (maximum of 7 h). In enrichment Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 18 assays, the dilutions of the bacterial culture were incubated at 37°C for three hours before being infected with phage for 4 hours. The methodology was repeated for some clinical strains of P. aeruginosa (5, 6, 16, 21, 23, 27, A65, 065, 092 and PA14 – listed in Supplementary material - Table S1) and for clinical strains of E. coli (A51), Klebsiella pneumoniae (A36, A57), Staphylococcus aureus (A1, A9, A39), Enterococcus faecalis (A74), and Enterococcus faecium (A78), also listed in Supplementary material - Table S1. 2.3. Evaluation of lytic spectra and efficiency of plating To evaluate the lytic spectrum of phages, one drop (5 µL) of each phage sample was added to the bacterial lawns and incubated overnight at 37 °C. The bacterial lawns were prepared by mixing 100 µL of bacterial suspensions with 3-5 mL of LB soft agar (LB with 0.6 % (w/v) of agar) into a LBA plate. After incubation, the host range was determined by visualizing the presence of lysis zones, suggesting the phage's ability to infect the host (Pires et al., 2021; Ribeiro et al., 2019). If a lysis zone was observed in the spot test, then the efficiency of plating (EOP) of the respective phage was assessed by plating serial dilutions of the phage stock on the bacterial lawns that previously showed a lysis zone. After overnight incubation at 37 °C, the resulting Plaque forming units (PFU’s) were counted. The EOP (average PFU on target bacteria / average PFU on host bacteria) was then determined (Table 17). When the ratio was 0.5 or higher, meaning that the infection on the target bacteria produced at least 50 % of the PFU reported for the primary host, the average EOP value for a certain phage-bacterium combination was classed as "High production". EOP values between 0.001 and 0.1 were categorized as "Low production" efficiency, while values greater than 0.1 but less than 0.5 were classified as "Medium production" efficiency. An EOP of 0.001 or less was considered inefficient (Mirzaei & Nilsson, 2015). Based on the analysis of the lytic spectra, 2 phages with complementary host ranges were selected for the next tasks. 2.4. Cloning and functional analysis of potential TFPs Tail fiber proteins identified during the genome analysis were selected based on the existence of homologs deposited in the NCBI database of non-redundant proteins identified through BLASTp and also on homologs to the predicted structure using HHpred. In addition, the predicted functional domains, the Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 19 molecular weight, and the isoelectric point of the proteins were identified and calculated using bioinformatics analysis tools (Costa et al., 2020; Santos et al., 2020). 2.4.1. Gene amplification Seven different genes were selected (nucleotide and amino acidic sequence of the selected genes are available in Supplementary material – Table S2). Primers containing specific restriction cloning sites were designed to amplify the genes encoding the recombinant proteins and to insert them into the pGFP plasmid. This plasmid consists in a construction of the commercial plasmid pET28a(+) (Novagen’s), that carries the T7 promoter, a 6× His-tag N-terminal, a kanamycin resistant marker and a lac promoter, with the synthetic construct aceGFP ( Aequora coerulescens Green Fluorescent Protein gene. GenBank: AY233272.1) inserted in the multiple cloning site (MCS) between the Nde I and BamH I restriction enzymes sites (Figure 4) (Costa et al., 2020). aceGFP is a commonly used tool in molecular biology, medicine and cell biology, as it can be used as biological marker. Furthermore, fusion of aceGFP to a protein does not usually change the function or location of the protein and combines a number of advantageous traits, including high stability, minimal toxicity, and the ability to induce fluorescence when excited at a proper wavelength, eliminating the need for a substrate as is necessary for luciferases (Schmelcher & Loessner, 2014). Figure 4 – General features of pGFP vector, used for cloning and expression of the TFP genes. pGFP vector contains the same features as pET28a+ (Novagen) with the addition of the aceGFP gene. Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 20 The TFP genes were inserted between the Sac I and Xho I restriction sites since these enzymes do not cut the TFP coding sequences as predicted with SnapGene™ 1.1.3. The use of two different restriction enzymes was used to prevent the plasmid from recirculating cleavage and to ensure the insertion of the TFP gene in the correct direction. The primers (Table 1) were designed to include at the 5' end the enzyme restriction sites (underlined) and some nucleotides that were added to optimize enzyme activity (CG repeats). SnapGene™ 1.1.3 was used to determine some parameters as the melting temperature (Tm) and the GC content. Table 1 - Primers used to amplify the TFPs encoding genes from phiIBB-PAA2 and vB_PaeP_PE3 phages, the respective restriction enzyme site used and their parameters. Tm represents the melting temperature. Enzyme restriction sites are underlined Gene Sequence (5’→3’) Enzyme Tm (°C) GC content.(%) A2gp53 Fw: GCCGCCGAGCTCATGAGTCAAAAGTACAGCCCTTCG Sac I 56 46 Rv: CCGCCGCTCGAGTCATGGAGTCACCACCAGGG Xho I 56 60 A2gp55 Fw: GCCGCCGAGCTCATGGGTCTTGAGGTCGCAAC Sac I 54 55 Rv: CCGCCGCTCGAGTCAGTTCTTAATGATGAAGAACACAG Xho I 53 35 PE3gp39 Fw: GCCGCCGAGCTCATGCTACTACTCGACGCAGTG Sac I 69 64 Rv: CCGCCGCTCGAGTCAGGTCCTCAAGCTGCGC Xho I 72 71 PE3gp44 Fw: GCCGCCGAGCTCGTGGCTCGGTTCAAGAATCC Sac I 54 55 Rv: CCGCCGCTCGAGTTATTCGTCCTCCATGGCCC Xho I 54 55 PE3gp45 Fw: GCCGCCGAGCTCATGCGCGGCATTATCGCGG Sac I 55 63 Rv: CCGCCGCTCGAGTTAAACATTTTTCAGCTCCGCCTG Xho I 54 42 PE3gp46 Fw: GCCGCCGAGCTCATGTTTAAGACCGAAGTAAAGGGACG Sac I 56 42 Rv: CCGCCGCTCGAGTTATGCCCTCGCCACCGTAAAC Xho I 57 55 PE3gp47 Fw: GCCGCCGAGCTCATGGCACTGATCTACGACTTCAAC Sac I 56 46 Rv: CCGCCGCTCGAGTTACATGTGCCCTCTGAATTGGAC Xho I 56 46 DNA fragments were amplified with Phusion™ Plus DNA Polymerase (ThermoFisher Scientific) that has proof reading activity in order to reduce the insertion of incorrect nucleotides, using phage phiIBBPAA2 (short name A2) as template DNA for genes 53 and 55, and phage vB_PaeP_PE3 (short name PE3) as template DNA for genes 39, 44, 45, 46 and 47. The PCR mix components were adjusted Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 21 according to the manufacturer's instructions (Table 2) and the PCR amplification was performed on a T100™ Thermal Cycler (BioRad). Table 2 - Components and quantities used for PCR with Phusion™ Plus DNA Polymerase Components Concentration Phusion Plus DNA Polymerase 0.02 U/µL 5× Phusion Plus Buffer 1× dNTP mix (10mM) 200 µM Primers 0.5 µM Template DNA 0.9 ng/µL Water, nuclease free to 50 µL The thermocycling conditions for the PCR are shown in Table 3. Table 3 - Thermocycling conditions for a routine PCR with Phusion™ Plus DNA Polymerase Step Temperature Time Initial Denaturation 98 °C 5 min 25-35 Cycles 98 °C 10 sec 55 °C or 60 °C 10 sec 72 °C 15-30 sec/Kb Final Extension 72 °C 5 min Hold 12 °C Confirmation of PCR products was performed through agarose gel electrophoresis. The gels contained 1 % (w/v) agarose (Nzytech) dissolved in 1× TAE buffer (1 mM ethylenediamine tetraacetic acid (EDTA); 40 mM Tris base; 20 mM acetic acid) and were stained with GreenSafe Premium (Nzytech). The 1 Kb GRS Ladder DNA (Grisp) was used as a marker. Electrophoresis was performed in 1× TAE buffer at 100 V for 40 min in a PerfectBlue gel system (VWR) and the gels were visualized using a ChemiDoc™ XRS (BioRad) equipment with Image Lab™ 5.1 software (BioRad). Then, the PCR products were purified using the DNA Clean and Concentrator kit (Zymo Research) and the DNA concentration of the amplified Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 22 fragments was determined using the NanoDrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific). 2.4.2. Cloning Plasmid and PCR products were digested with two FastDigest Restriction Enzymes Sac I and Xho I (ThermoFisher Scientific), creating sticky ends complementary between the vector and the insert. The reaction components were adjusted according to the manufacturer's instructions and are shown in Table 4. Digestions were performed at 37 °C for 2 h and inactivated in a HeatBlock (VWR) at 82 °C for 6 min. Table 4 - Reaction components and volumes or concentrations used to digest the target genes Components Volume 10× FD Buffer 2 µL DNA insert or DNA plasmid 200 ng or 1000 ng SacI FD 1 µL XhoI FD 1 µL Water, nuclease free to 20 µL Digested products were cleaned with the DNA Clean and Concentrator Kit (Zymo Research) according to the manufacturer’s instructions and DNA concentration determined using the NanoDrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific). After digestion, the genes were inserted into pGFP (to fuse them with the upstream aceGFP) using the T4 DNA Ligase (ThermoFisher Scientific), according to the manufacturer's instructions (Table 5), to ligate DNA fragments with cohesive ends, obtaining different constructs. The ligation mixture was incubated at room temperature for 2 h and the reaction stopped by a subsequent incubation at 72 °C for 6 min. To reduce background (non-digested pGFP), a subsequent digestion step was performed with 0.5 µL of Sal I (ThermoFisher Scientific) and 1 µL of the respective buffer (ThermoFisher Scientific), followed by incubation at 37 °C for 45 min. The Sal I enzyme was further inactivated at 80 °C for 5 min. Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 23 Table 5 - Reaction components, volumes or final concentrations for the ligation of the target genes Components Volume Linear vector DNA (plasmid) 20-100 ng Insert DNA (gene) 1:1 to 5:1 molar ratio over vector 10× T4 DNA Ligase Buffer 2 µL T4 DNA Ligase 1 Weiss U Water, nuclease free to 20 µL The primer design, gene amplifications, digestions and ligations were all simulated in silico using the SnapGene™ 1.1.3 version Software. The recombinant plasmids pGFP_A2gp53, pGFP_A2gp55, pGFP_PE3gp39, pGFP_PE3gp44, pGFP_PE3gp45, pGFP_PE3gp46 and pGFP_PE3gp47 consist in the insertion of the putative TFP encoding genes gp53 and gp55 , from phiIBB-PAA2 phage, and gp 39, gp 44, gp 45 , gp 46 and gp 47, from vB_PaeP_PE3 phage, in the pGFP plasmid. These plasmids were transformed into competent E. coli AE (DE3) cells by heat shock. Briefly, for the transformation of the plasmids, 5 µL of ligation was mixed gently with an aliquot of chemically competent cells. After 20-30 min on ice, a heat shock was performed: 50 sec at 42 °C and 2 min on ice. Then, 300 µL of SOC (Super Optimal broth with Catabolite repression) was added to the tube and the cells were allowed to recover for 1 h 30 min at 37 °C. Then, the suspension was spread on LB agar petri dishes containing kanamycin (50 µg/mL) and gentamicin (20 µg/mL) for QC AE (DE3) cells. The plates were incubated overnight at 37 °C and checked for the presence of transformed colonies. The resulting transformed colonies were subjected to colony PCR to assess correct assembly (cells that incorporated the recombinant vector) before the confirmation by Sanger sequencing. Colonies were randomly selected and resuspended in 25 µL of LB broth with the corresponding antibiotic(s) to be used as a template in the PCR reaction. The PCR reaction was performed using the Xpert Fast Hotstart Mastermix (2×) (Grisp) where the T7 primers were added and the reaction was adjusted according to the manufacturer's recommendations (Table 6). Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 24 Table 6 - PCR mix components and their final concentrations for colony PCR Components Concentration Xpert Fast Hotstart Mastermix (2×) with dye (Grisp) 1× T7 Forward primer 0.4 µM T7 Reverse primer 0.4 µM Template DNA 1-250 ng Water, nuclease free to 6 µL T7 Mastermix (2×) with dye (Grisp) consists on the Xpert Fast Hotstart, supplied as a convenient 2× mastermix and which includes an electrophoresis inert tracking dye, containing all components necessary for fast PCR and the T7 forward and reverse primers (specific for the pGFP plasmid, showed on Table 7). Table 7 - Primers used for colony PCR and their parameters. Tm represents the melting temperature Primer Sequence (5’→3’) Size (bp) Tm (ºC) GC content (%) T7 forward TAATACGACTCACTATAGGG 20 47.7 40 T7 reverse GCTAGTTATTGCTCAGCGG 19 51.1 53 PCR amplification was performed in a DNA thermocycler (T100™ Thermal Cycler (BioRad)) and the PCR protocol is described in Table 8. Table 8 - Thermocycling conditions for a colony PCR Step Temperature Time Initial Denaturation 95 °C 5 min 35 Cycles 95 °C 15 sec 49 °C 15 sec 72 °C 30 sec Final Extension 72 °C 5 min Hold 12 °C Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 31 Lithium Acetate, and 50 µL 2 mg/mL salmon sperm DNA). After 45 min of incubation at 42 °C, the mixture was centrifuged (13000 ×g, RT, 30 sec), resuspended in 1 mL of YPD and incubated at 30 °C for 2-3 hours with 120 rpm of agitation. The yeast transformants were then selected on synthetic defined medium with leucine dropout (SD-Leu) [0.67 % Yeast Nitogen Base (YNB), 0.069 % CSM-Leu, 2 % dextrose] agar plates incubated at 30 °C for 3 days. After, yeast colony PCR was performed to confirm the correct assembly of the fragments. For this, randomly chosen colonies were resuspended in 10 µL of 0.02 M NaOH and heated at 99 °C for 10 min. The supernatant was then used as template for the PCR reaction with DreamTaq™ DNA polymerase (ThermoFisher Scientific) following the manufacturer's instructions (Table 14). The primers used in yeast colony PCR for both transformations are listed in Table 15 and the PCR conditions are detailed in Table 16. All the PCR reactions were carried out in a DNA thermocycler (T100™ Thermal Cycler (BioRad)). Table 14 - PCR mix components and concentrations for yeast colony PCR Components Concentration DreamTaq™ Green PCR Master Mix (2×) 25 µL Forward primer 0.5 µM Reverse primer 0.5 µM Template DNA 3 µL Water, nuclease free to 50 µL Table 15 – Primers used in yeast colony PCR and their parameters. Tm represents the melting temperature Primer Sequence (5’→3’) Tm (°C) GC content.(%) P15 Fw: GCACCTTCCGGCTGATCC 59 67 P16 Rv: GCAGAAGTCCAGCACGTCG 59 63 Table 16 - Thermocycling conditions for a yeast colony PCR Step Temperature Time Initial Denaturation 95 °C 3 min 30 Cycles 95 °C 30 sec Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 32 55 °C 30 sec 72 °C 1 min/Kb Final Extension 72 °C 10 min Hold 4 °C The PCR products from yeast colony PCRs were run on a 1 % (w/v) agarose gel. The positive transformants that showed the correct assembly were inoculated in SD-Leu liquid medium for 24 h at 30 °C. Then, the YAC-Phage DNA was extracted from yeast cells using the QIAprep Spin Miniprep Kit (Qiagen) combined with zymolyase® 20T (Grisp) following a previously described protocol (Ando et al., 2015) and the DNA concentration was determined using the NanoDrop™ One Microvolume UV-Vis Spectrophotometer (ThermoFisher Scientific). 2.5.3. Transformation of captured phage genome into P. aeruginosa cells The preparation of electrocompetent P. aeruginosa PAO1 cells was performed according to a method previously described by Choi et al., (2006) with minor modifications. Briefly, 6 mL of an overnightgrown culture were distributed by 4 microcentrifuge tubes and centrifuged (16000 ×g, RT, 1 min). Each pellet was then washed twice with 1 mL of 300 mM sucrose. For each transformation, the 4 bacterial pellets were resuspended in a total of 100 µL of 300 mM sucrose and mixed with the extracted DNA (YAC-phage DNA) (Pires et al., 2021). This mixture was then transferred into a 2 mm gap electroporation cuvette, a pulse (25 µF, 200 Ω, 2.5 kV) was applied using an E. coli Pulser™ Transformation Apparatus (BioRad) and 900 µL of LB medium was added to recover the cells. Before performing plaque formation experiments, the cellular suspension was transferred to a tube and incubated at 37 °C for 2-4 hours with 120 rpm of agitation (Pires et al., 2021). About 300 µL of the cellular suspension produced by YAC-phage DNA electroporation were combined with 3 mL of LB soft agar and plated in LBA plate in order to recover the chimeric phages. The plates were examined to see if any phage plaques were present after overnight incubation at 37 °C (Pires et al., 2021). Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 2 – Materials and Methods 33 2.5.4. Phage production and sequencing When phage plaques were recovered after the electroporation of the YAC-phage DNA, the recombinant phages were then propagated to high titers. Briefly, a single phage plaque was picked and eluted in 50 µL of SM buffer. Then, this solution was used to infect 15 mL of a P. aeruginosa PAO1 logphase culture. After incubation for 8 h at 37 °C, this suspension was centrifuged (9000 ×g, 4 °C, 10 min) and the supernatant was collected, filtered (0.22 µm) and kept at 4 °C until further use (Pires et al., 2017). Finally, the phage titre was evaluated by PFU’s counting. The phage stock solution was serially diluted in SM buffer and 10 µL of each dilution were plated into the bacterial lawns. The plates were incubated overnight at 37 °C and the PFU’s were then counted. The correct insertion of the gene encoding the TFP on the chimeric phages was confirmed by PCR, with the primers used on yeast colony PCR and after product cleaning, by Sanger sequencing. 2.5.5. Host-range of the chimeric phages The host-range of the chimeric phages was evaluated against the clinical strains of P. aeruginosa to compare to the wild-type phage. This was performed as described in section 2.3. In the cases where lysis was seen, phage suspensions were serially diluted and the dilutions were plated on the bacterial lawns to look for potential cases of lysis from without. Chapter 3 RESULTS AND DISCUSSION Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 35 3. RESULTS AND DISCUSSION 3.1. Fast and sensitive detection of P. aeruginosa using reporter phages Rapid and sensitive methods are highly needed for the specific detection of P. aeruginosa, namely in clinical settings. An accurate identification of the pathogen allows a rapid implementation of the appropriate treatment, reducing the severity of infection and also the associated costs. The PE3Δgp1– gp12:Nluc reporter phage carrying the Nluc gene was previously assembled using the yeast-based phageengineering platform at the research group and here, this phage was explored to assess its sensitivity and specificity to detect P. aeruginosa cells and evaluate the detection limit. The sensitivity of this reporter phage system was quantified by infecting serial dilutions of host cells with the phage at 105 PFU/mL and quantifying the light-emitting RLUs (Relative light units) for 7 h. Figure 6 shows the dispersion graph referring to the RLUs over time, for assays without enrichment. Figure 6 - Relative light units (RLUs) over time, without sample enrichment. Error bars represent standard deviations from 3 independent experiments. The bar graph referring to the RLUs over time, for assays without enrichment, is represented in Figure 7. 200 2000 20000 200000 2000000 20000000 200000000 012345678 Relative Light Units (RLUs) Time (h) 5.4x10^9 CFU/mL PAO1 (PAO1 only) PE3Δgp1–gp12:Nluc (phage only) 5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 36 Figure 7 - Graphic representation of bars corresponding to different concentrations of bacteria infected with the reporter phage, without sample enrichment, of relative light units at time 0 h and 7 h. Error bars represent standard deviations from 3 independent experiments. According to the results from Figure 7, the detection limit of phage PE3Δgp1–gp12:Nluc was 5.4×102 CFU/mL but to try to improve this limit of detection, an additional test was carried out. P. aeruginosa PAO1 was enriched before phage addition by incubating the bacterial dilutions at 37 ºC for 3 h. After adding the phage, the infection was tracked for 4 h in order to keep the total time of the experiment 7 h, similarly to the assays without enrichment. The results obtained for the dispersion graph referring to the RLUs over time, for assays with enrichment are represented in Figure 8. Figure 8 - Relative light units (RLUs) over time, with sample enrichment. Error bars represent standard deviations from 3 independent experiments. 200 2000 20000 200000 2000000 20000000 200000000 0 7 Relative Light Units (RLUs) Time (h) 5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 200 2000 20000 200000 2000000 20000000 200000000 0 1 2 3 4 5 Relative Light Units (RLUs) Time (h) 5.4x10^9 CFU/mL PAO1 (PAO1 only) PE3Δgp1–gp12:Nluc (phage only) 5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 37 The bar graph referring to the RLUs over time, for assays with enrichment, is represented in Figure 9. Figure 9 - Graphic representation of bars, corresponding to different concentrations of bacteria infected with the reporter phage, with enrichment, of relative light units over time. Error bars represent standard deviations from 3 independent experiments. The detection limit is defined as the minimum number of bacteria needed to produce a signal that is distinguishable from the background. The minimum CFU number detectable by the PE3Δgp1– gp12:Nluc phage was 540 per mL for both experiments (with and without enrichment). Although the enrichment step of 3 h led to a higher luminescence signal without compromising the total time of the method, the limit of detection was the same and thus, this step can be skipped as the protocol without enrichment is simpler and easier to perform. Based on this, all the subsequent experiments were performed without the enrichment step. Detection assays with the reporter phage were optimized and repeated in triplicate for the host strain PAO1 and the results measured after 7 h are represented in Figure 10. 200 2000 20000 200000 2000000 20000000 200000000 0 4 Relative Light Units (RLUs) Time (h) 5.4x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 5.4x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 38 Figure 10 - Bioluminescence output (RLUs) of serial dilutions of host strain infected with the reporter phage PE3gp1-gp12:Nluc with 105 PFU/mL and respective controls. Error bars represent standard deviations from 3 independent experiments. According to Figure 10, it is possible to observe that the PE3Δgp1–gp12:Nluc reporter phage reliably detects 620 CFU/mL of the host strain. This was accomplished within 7 hours, which is 41 hours less time than the conventional selective plating techniques (Tramper-stranders et al., 2005). Currently, reporter phages are mostly focused on the food industry. To build a reporter phage for the detection and differentiation of live Listeria cells, which cause a serious foodborne illness, Meile et al., (2020) used CRISPR-Cas-assisted phage editing. In less than 24 hours, the NLuc-based phage, A511::nlucCPS, can identify one CFU of L. monocytogenes in 25 g of artificially contaminated milk, cold cuts, and lettuce. More recently, Erickson et al., (2021) used homologous recombination to create a recombinant form of LPJP1 that encodes the NanoLuc luciferase. Within four hours, this luciferase reporter phage detected 100 stationary phase colony forming units of both L. grayi subspecies. Hinkley et al., (2018) genetically altered a T7 coliphage to express NanoLuc using homologous recombination and the use of microcrystalline cellulose to concentrate the fusion reporter was then shown to enable the detection of a maximum of 10 CFU/mL E. coli within three hours. Also, the limit of detection for the reporter phages created by Nguyen et al., (2020) using homologous recombination was 10-100 CFU per mL in Salmonella culture within two hours. In food matrix tests, a combination of engineered phages successfully identified 1 CFU in either 100 g of powdered infant formula with a 16 h enrichment or 25 g of ground turkey with a 7 h enrichment. 100 1000 10000 100000 1000000 10000000 100000000 1000000000 0 7 Relative Light Units (RLUs) Time (h) Without Enrichment 6,2x10^9 CFU/mL PAO1 (PAO1 only) PE3Δgp1–gp12:Nluc (phage only) 6,2x10^8 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^7 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^6 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^5 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^4 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^3 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^2 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^1 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc 6,2x10^0 CFU/mL PAO1 + PE3Δgp1–gp12:Nluc Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 39 Here, as the phage is specific for P. aeruginosa species, clinical isolates known to be sensitive to phage PE3Δgp1–gp12:Nluc were also tested (strains 5, 6, 16, 21, 23, 27 A65, 065 and 092) to assess the detection limit in other bacterial strains rather than the host. Beyond that, the methodology was also repeated for clinical strains of E. coli (A51), Klebsiella pneumoniae (A36 and A57), Staphylococcus aureus (A1, A9 and A39), Enterococcus faecalis , Enterococcus faecium (A74 and A78 respectively) and P. aeruginosa PA14. The Figure 11 shows the RLUs emitted after seven hours of phage infection of each bacterial strain above mentioned. Figure 11 - Bioluminescence output (RLUs) of different clinical strains infected with PE3Δgp1-gp12:Nluc phage (105 PFU/mL) for 7 h . (A) P. aeruginosa strains that are sensitive to phage; (B) clinical strains that are not infected by the phage (chosen as negative controls). As observed in Figure 11 (A), phage PE3Δgp1-gp12:Nluc was unable to detect five (16, 23, 27, 065 and 092) out of the nine clinical strains of P. aeruginosa . All these 9 strains are sensitive to the phage, which was observed though determination of the lytic spectra and EOP (Table 17). This is unexpected, according to EOP results most phage—bacterium combination was classified as a medium production and therefore, all strains were supposed to be detected. Since this phage is specific for P. aeruginosa , as expected, all other species tested did not show any luminescence, and in this case there were no false positives, as can be seen in Figure 11 (B). Among the 4 clinical strains that the reporter phage was capable to detect, the detection limit is represented in Figure 12. Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 40 Figure 12 – Concentration (CFU/mL) of artificially infected samples. Samples were incubated with 105 PFU/mL of PE3gp1-gp12:Nluc phage. The minimum CFU number detectable by the PE3Δgp1–gp12:Nluc phage for those strains is in the range of 103 CFU per mL, which is approximately ten times higher than the minimum concentration obtained for the host strain PAO1. It would be interesting to test the phage in more clinical strains rather than just a few, as this severely restricts the ability to make reliable conclusions about this technique. The subsequent stage will also involve running these detection assays in real samples from patients like blood, urine, or other fluids. In conclusion, the P. aeruginosa reporter phage was capable of reliably detect 620 CFU in 1 mL of samples contaminated with PAO1 in less than 8 h, thus overcoming the major limitation of the currently used detection methods, which is time-consuming. On the other hand, this technique was not capable of detecting all the strains known to be sensitive to the phage, which is an issue. This implies, and hence supports, the requirement of phage-engineering work to expand the host range of the phage and a possible approach may be the cloning of additional TFPs from other phages with complementary host ranges. 3.2. Determination of the host range and efficiency of plating Seven phages (PE1, A2, DP1, PA14G, PA14-20, PE3 and PE3Δgp1–gp12:Nluc) were tested against a panel of 52 P. aeruginosa clinical strains by spot test in order to evaluate the lytic spectra of each phage. Table 17 shows the host range of each phage, where LFW means lysis from without. This is 1,00E+02 1,00E+03 1,00E+04 1,00E+05 1,00E+06 1,00E+07 1,00E+08 1,00E+09 Concentrtation of the infected strain (CFU/mL) Limit of phage detection in clinical strains of P. aeruginosa, for an infection period of 7 h Strain 5 Strain 6 Strain 21 Strain A65 Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 47 The results obtained from the SDS-PAGE gel are shown in Figure 17. Figure 17 - SDS-PAGE with results of the purified proteins, expressed in AE cells. (1) pGFP_PE3gp39 1st elution, (2) pGFP_PE3gp39 pellet, (3) pGFP_PE3gp44 1st elution, (4) pGFP_PE3gp44 pellet, (5) pGFP_PE3gp45 1st elution, (6) pGFP_PE3gp45 pellet, (7) pGFP_PE3gp46 1st elution, (8) pGFP_PE3gp46 pellet, (9) pGFP_PE3gp47 1st elution, (10) pGFP_PE3gp47 pellet, (11) pGFP_A2gp53 1st elution, (12) pGFP_A2gp53 pellet, (L1) NZYColour Protein Marker II (Nzytech), (13) pGFP_A2gp55 1st elution and (L2) PageRuler™ Broad Range Unstained Protein Ladder The molecular weight is expressed in KDa. In addition to TFP expression by SDS-PAGE, the expression was also detectable by the colour of the cultures after expression, which showed strong green staining due to the presence of the aceGFP fusion protein. All the proteins transformed in AE (DE3) cells were shown to have the expected size but the pGFP_PE3gp46 protein showed a larger band close to 27 KDa, corresponding to aceGFP expression. This may indicate that some processing of the recombinant protein may have occurred, with cleavage of the fused protein. In cases where a stronger band appears in the pellet of the purified protein, a solubilization of the pellet was performed for further analysis. The presence of insoluble protein is typically caused by improper protein folding, which causes the protein to become inactive and expressed in inclusion bodies (Agilent Technologies, 2015). The pelleted protein was washed using a buffer containing the surfactant Triton X-100 and then protein was solubilized using urea. Although it was possible to solubilize the proteins, on the day after, the protein lost stability and precipitated again. Then, a functional analysis of the TFPs was performed by epifluorescence. The amount of protein elution to be used in each reaction was estimated through the intensity of the colour (green) of the elution and the results of SDS-PAGE analysis of the expression. After observation under the microscope, protein pGFP_A2gp55 was the only one that demonstrated binding ability to P. aeruginosa PAO1 cells (Figure 18). Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 48 pGFP_PE3gp45 pGFP_PE3gp55 Figure 18 - Fluorescence microscopy assays for protein function analysis. On the first row, it is possible to observe the images without a filter and in the second, with the FITC filter, sensitive to green fluorescence. A negative example is shown in the first column, such as the pGFP_PE3gp45 protein and in the second column the only expressed protein that was able to bind P. aeruginosa PAO1, pGFP_PE3gp55. Even though the remaining proteins were well expressed and showed a green, fluorescent colour, they were not able to bind to bacterial cells. After that, the expression of the proteins was repeated in different cells. E. coli C43 (DE3) contains genetic mutations that reduces the activity of T7 RNA Polymerase, thus preventing cell death by overexpression of recombinant toxic protein (Lucigen Corporation, 2018) and the E. coli BL21 (DE3) contains several genetic mutations and is widely used in order to obtain high yields of protein production. However, despite being well expressed, none of them showed binding capacity to P. aeruginosa PAO1, besides pGFP_A2gp55 protein. There are different reasons to explain that. An incorrect folding of the protein may result in an inadequate exposure of the protein domain responsible for host recognition or even in a non-functional receptor binding protein. Moreover, it is possible that these proteins require the presence of other phage proteins to acquire the functional structure (usually trimerization) (North et al., 2019). Another hypothesis is that the proteins under study are not truly host recognition or binding proteins, even knowing that they are homolog to other identified receptor binding proteins in the NCBI database. The fact is that the majority of annotated phage receptor binding proteins deposited in the NCBI database were not validated Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 49 through functional assays and thus, they might not be able to recognize and bind to the phage bacterial hosts, leading to an erroneous selection of receptor binding proteins. Considering the experimentally validated ability of pGFP_A2gp55 to bind PAO1 cells, homologous proteins were searched for cloning with the intention of performing a gene exchange between phages A2 and PE3, but none it was found. This impaired swapping homologous genes, but still enabled the addition of this protein to phage PE3 in order to express an additional receptor binding protein that could expand its host range. 3.4. Expanding the host range of P. aeruginosa phages by genome engineering According to the fluorescence microscopy assays, only pGFP_A2gp55 protein was binding to the host cells, which corresponds to gp 55 from A2 phage. Therefore, this gene was selected to be cloned between gp 46 and gp 47 genes from PE3 phage that also encode TFPs. Since the addition of new genes may require extra space in phage genomes, the phage PE3Δgp1–gp12 was used here as template for the introduction of the new gene as this phage is a variant of phage PE3 with a reduced genome and was previously shown to be functional and to have similar efficacy against the host cells (Pires et al., 2021). The assembly of the new chimeric phage was accomplished using the yeast-based phageengineering platform, which has been already used to efficiently manipulate the genomes of E. coli , Klebsiella and P. aeruginosa phages (Ando et al., 2015; Pires et al., 2021). In S. cerevisiae , homologous recombination is particularly effective due to the native gap repair system that facilitates the assembly of DNA fragments that share short homology regions, and phage genomes may be kept stable and are not hazardous to yeast. Since this method involves removing the phage genome from yeast and introducing it into the bacterial host to generate functional phage particles, its efficacy is constrained by the rate at which bacteria may undergo transformation (Pires et al., 2016). In this work, 2 different constructs were tried: i) cloning of TFP in phage PE3Δgp1–gp12 without Nluc gene (transformation 1 - T1); and ii) cloning of TFP in phage PE3Δgp1–gp12:Nluc (transformation 2 - T2). To assemble the chimeric phages, the entire phage genome of PE3Δgp1–gp12 phage was amplified by PCR in overlapping fragments using specific sets of primers (Table 10). For each transformation, seven PCR products spanning the phage genome, the gene gp55 from phage A2 to be cloned and the linearized YAC carrying homologous “arms” with the extremities of phage genome were Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 50 transformed into yeast cells where the recombination occurs because of the gap repair system that connects each fragment to the subsequent, resulting in a full phage genome captured in the YAC.The PCR amplification of all the DNA fragments was confirmed on a 1 % (w/v) agarose gel and the results are shown in Figure 19. Figure 19 - Gel electrophoresis with results of the PCR amplification of each fragment. (YAC) annealing temperature: 65 °C; (F1) annealing temperature: 60 °C; (F2) annealing temperature: 60 °C; (F3) annealing temperature: 60 °C; (F4) annealing temperature: 60 °C; (F5) annealing temperature: 60 °C; (F6) annealing temperature: 65 °C; (F7) annealing temperature: 65 °C and (L) 1 Kb GRS Ladder DNA (Grisp). The sequence length is expressed in bp. As observed in Figure 19, all the PCR products have the expected sizes to be used in the yeast transformation. After transformation, it was possible to recover several transformants for each transformation (T1 and T2) after plating on selective media, while no colonies were observed for the negative control (transformation only with the linearized YAC). To assess if the phage genomes were correctly assembled in the YAC, the yeast transformants were screened by yeast colony PCR using a set of primers placed upstream and downstream of the gene insertion sites (Table 15). The products of each yeast colony PCR were visualized on a 1 % (w/v) electrophoresis agarose gel, as shown in Figure 20. Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 51 Figure 20 - Gel electrophoresis showing the amplification of one correct transformant for each yeast transformation. (C) control – original sequence, and (L) 1 Kb GRS Ladder DNA (Grisp). The DNA sizes presented include the size of the original sequence plus an additional 648 bp correspondent to the amplification of the gp 55 from A2 phage. Figure 20 shows bands with the expected sizes of amplification for each transformation (T1: 1108 bp; T2 1108 bp; Control: 460 bp), which confirms that gp55 from phage A2 was successfully cloned into PE3Δgp1–gp12 phage for T1 and PE3Δgp1–gp12:Nluc phage for T2. These positive yeast clones were then used for yeast DNA extraction in order to recover the YAC-phage DNA. After DNA extraction from yeast cells, 500 ng of the constructs (YAC-phage DNA) were transformed into the P. aeruginosa PAO1 host, which allows phage genes to be transcribed and produce functional phages in case the gene insertion does not alter the viability of the phage. In this step, the transformation was via electroporation due to the superior efficacy compared to the heat-shock approach (Yoshida & Sato, 2009). In fact, phage plaques were observed after plating, but only for T2 even after three attempts. In order to recover plaques from T1, it would probably be essential to do some optimizations of the DNA concentration to be electroporated or incubation time after electroporation. Since phage plaques were obtained for T2, the work proceeded with this newly engineered phage as this was the phage already carrying the Nluc gene that can be used for detection. The resulting phage plaques obtained from electroporation were picked and the recombinant phage was produced and checked by PCR using the set of primers described above. The electrophoresis gel and the Sanger sequencing revealed that the Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 52 insertion of the TFP from phage A2 into the genome of phage PE3Δgp1–gp12 was successfully done (Figure 21). Figure 21 – Wild-type phage versus chimeric phage. (1) PE3 phage; (2) PCR-based confirmation of the insertion of A2 gp 55 in the genome of phage PE3Δgp1–gp12:Nluc and (L) 1 Kb GRS Ladder DNA (Grisp). The sequence length is expressed in bp. After propagation of recombinant phage and confirmation of the correct assembly, a new analysis of the host range was performed to understand if the addition of a new TFP did actually result in the ability of the engineered phage to target a wider range of strains compared to wild-type phage. This would be a great advantage as currently, the most popular method for achieving a wider host range is the combination of multiple phages with various host ranges into a single cocktail, which is always a timeconsuming process. The host range of the four phages A2, PE3 WT, PE3Δgp1–gp12:Nluc and T2 were tested against a panel of 52 P. aeruginosa clinical strains by spot test. Table 18 shows the results of the lytic spectra. Table 18 - EOP of the A2, PE3 WT, PE3Δgp1–gp12:Nluc and recombinant T2 phages against different strains of P. aeruginosa Phage Strain A2 PE3 PE3Δgp1 – gp12:Nluc T2 1 0.5 - - LFW 2 - - - - Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 53 3 <0.001 - - - 4 LFW - - LFW 5 0.4 0.3 0.4 0.1 6 0.4 0.6 0.4 0.004 7 <0.001 - - - 8 LFW LFW LFW LFW 9 LFW - - LFW 10 - - - - 11 - 0.3 LFW LFW 12 LFW 0.3 LFW LFW 14 - - - - 15 LFW - - - 16 0.1 0.3 0.4 LFW 17 - 0.1 LFW LFW 18 0.005 - - LFW 19 - - - - 20 0.006 LFW - LFW 21 0.4 0.3 0.004 0.005 22 0.1 - - LFW 23 LFW 0.3 0.8 <0.001 24 - - - - 25 0.5 - - LFW 26 - LFW LFW LFW 27 0.1 0.4 LFW LFW 28 0.2 <0.001 LFW LFW 29 0.1 LFW LFW LFW A22 0.2 LFW LFW LFW A63 - - - - A64 LFW LFW LFW LFW Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 54 A65 LFW 0.2 0.4 LFW A66 LFW LFW LFW LFW A67 LFW LFW LFW LFW A69 LFW 0.3 LFW LFW A70 0.8 - - LFW A71 LFW - - - 052EX - LFW LFW LFW O64 LFW - - LFW O65 - 0.004 0.4 <0.001 O77 LFW - - LFW O78 0.2 0.2 LFW LFW O79 0.2 LFW LFW LFW O92 - 0.1 0.020 <0.001 144 0.5 0.5 LFW LFW 149 - - - - wzy LFW 0.4 0.1 0.006 wbpL - 0.1 0.007 LFW rmlC - - - - rmd 0.1 0.5 0.6 0.1 PAO1 1.0 1.0 1.0 1.0 PA14 - - - LFW % infection 54 51 31 23 % high productive infection 13 10 8 2 Contrary to what was expected, the recombinant phage, named T2, did not reveal a broader host range. Although it was expected that this phage would also be able to infect the P. aeruginosa strains that are infected by phage A2 leading to a 58 % infection rate, this was not observed and the engineered phage Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 3 – Results and Discussion 55 revealed a narrower host range. In fact, T2 was only able to infect 12 strains, which is even less than the number infected by the PE3gp1-gp12:Nluc phage that was used as a scaffold. So far, some studies have taken advantage of the fact that host range is connected to tail fiber composition for specific phages to show that the host ranges of phages can be changed or expanded. For instance, in order to particularly target E. coli O157:H7, Yoichi et al., (2005) genetically altered a T2 phage by replacing the long tail fiber genes with those from phage PP01. The exchange was carried out through homologous recombination. Although it had the same host range as phage PP01 and had the PP01 genes gp37 and gp38, the recombinant phage T2ppD1 was unable to infect its original host, E. coli K-12 (Yoichi et al., 2005). Lin et al., (2012) developed a hybrid T3 and T7 phage (T3/7) by replacing a portion of the T3 tail fiber gene (gp17) with that of the T7 phage. Compared to either of the T3 or T7 wild-type phages, the T3/7 recombinant phage had a wider host range and greater adsorption efficiency (Lin et al., 2012). By modularly replacing the components of the phage tail and using the yeast-based platform, Ando et al., (2015) were able to redirect E. coli phage scaffolds to target pathogenic Yersinia and Klebsiella bacteria, and Klebsiella phage scaffolds to target E. coli . Although the promising results reported in the literature, here it was not possible to increase the phage host range through the insertion of the TFP from A2 phage in the PE3Δgp1–gp12:Nluc phage genome. A possible explanation is that the phage may need the other TFPs to acquire the same spectrum as A2 phage. Additionally, Pires et al., (2021) discovered that the deletion of genes gp1 to gp12 from PE3 phage resulted in a slight reduction of the host range of the phage; hence, some of these genes may be involved in host recognition, takeover or beginning of replication, which may explain the increase of LFW. In this regard, it would be interesting to clone new TFPs without deleting genes from the phage genome as a future step. However, as this leads to an increase in the size of the phage genome, it can be a challenge due to the phage's capacity to encapsulate DNA. Although the phage genomic modification did not result in the expected outcome, it was possible to demonstrate that the yeast-based phageengineering strategy is an efficient and robust method to engineer the genomes of P. aeruginosa phages and can be easily applied in the future to perform other modifications as mentioned above that may result in host range increase (Pires et al., 2021). Chapter 4 CONCLUSIONS AND FUTURE PERSPECTIVES Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 5 – References 63 An alternative to antibiotics in the age of multi-drug resistance. World Journal of Gastrointestinal Pharmacology and Therapeutics , 8 (3), 162–173. https://doi.org/10.4292/wjgpt.v8.i3.162 Lin, T. Y., Lo, Y. H., Tseng, P. W., Chang, S. F., Lin, Y. T., & Chen, T. S. (2012). A T3 and T7 recombinant phage acquires efficient adsorption and a broader host range. PLoS ONE , 7 (2), 1–10. https://doi.org/10.1371/journal.pone.0030954 Loc-carrillo, C., & Abedon, S. T. (2011). Pros and cons of phage therapy. Bacteriophage , 1 (2), 111–114. https://doi.org/10.4161/bact.1.2.14590 Lu, T. K., & Collins, J. J. (2007). Dispersing biofilms with engineered enzymatic bacteriophage. PNAS , 104 (27), 11197–11202. https://doi.org/10.1073/pnas.0704624104 Lu, T. K., & Collins, J. J. (2009). Engineered bacteriophage targeting gene networks as adjuvants for antibiotic therapy. PNAS , 106 (12), 4629–4634. https://doi.org/10.1073/pnas.0800442106 Lucigen Corporation. (2018). OverExpress TM Chemically Competent cells . Matsuda, T., Freeman, T. A., Hilbert, D. W., Duff, M., Fuortes, M., Stapleton, P. P., & Daly, J. M. (2005). Lysis-deficient bacteriophage therapy decreases endotoxin and inflammatory mediator release and improves survival in a murine peritonitis model. Surgery , 137 (6), 639–646. https://doi.org/10.1016/j.surg.2005.02.012 Meile, S., Kilcher, S., Loessner, M. J., & Dunne, M. (2020). Reporter Phage-Based Detection of Bacterial Pathogens : Design Guidelines and Recent Developments. Viruses , 12 (944), 25. https://doi.org/doi:10.3390/v12090944 Meile, S., Sarbach, A., Du, J., Schuppler, M., Saez, C., Loessner, M. J., & Kilcher, S. (2020). Engineered reporter phages for rapid bioluminescence-based detection and differentiation of viable Listeria cells. Applied and Environmental Microbiology , 86 (11), 1–14. https://doi.org/10.1128/AEM.00442-20 Mirzaei, M. K., & Nilsson, A. S. (2015). Isolation of phages for phage therapy: A comparison of spot tests and efficiency of plating analyses for determination of host range and efficacy. PLoS ONE , 10 (3), 1–13. https://doi.org/10.1371/journal.pone.0118557 Monteiro, R., Pires, D. P., Costa, A. R., & Azeredo, J. (2019). Phage Therapy : Going Temperate ? Trends in Microbiology , 27 (4), 368–378. https://doi.org/10.1016/j.tim.2018.10.008 Moradali, M. F., Ghods, S., & Rehm, B. H. A. (2017). Pseudomonas aeruginosa Lifestyle : A Paradigm for Adaptation , Survival , and Persistence. Frontiers in Cellular and Infection Microbiology , 7 (39), 29. https://doi.org/10.3389/fcimb.2017.00039 Motlagh, A. M., Bhattacharjee, A. S., & Goel, R. (2016). Biofilm control with natural and genetically- Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 5 – References 64 modified phages. World Journal of Microbiology and Biotechnology , 32 (67), 10. https://doi.org/10.1007/s11274-016-2009-4 Nair, A., & Khairnar, K. (2019). Genetically engineered phages for therapeutics : proceed with caution. Nature Medicine , 25 (1028), 1. https://doi.org/10.1038/s41591-019-0506-3 Nguyen, L., Garcia, J., Gruenberg, K., & MacDougall, C. (2018). Multidrug-Resistant Pseudomonas Infections: Hard to Treat, But Hope on the Horizon? Current Infectious Disease Reports , 20 (8), 10. https://doi.org/10.1007/s11908-018-0629-6 Nguyen, M. M., Gil, J., Brown, M., Cesar Tondo, E., Soraya Martins de Aquino, N., Eisenberg, M., & Erickson, S. (2020). Accurate and sensitive detection of Salmonella in foods by engineered bacteriophages. Scientific Reports , 10 (1), 1–13. https://doi.org/10.1038/s41598-020-74587-8 North, O. I., Sakai, K., Yamashita, E., Nakagawa, A., Iwazaki, T., Büttner, C. R., Takeda, S., & Davidson, A. R. (2019). Phage tail fibre assembly proteins employ a modular structure to drive the correct folding of diverse fibres. Nature Microbiology , 4 (10), 1645–1653. https://doi.org/10.1038/s41564-019-0477-7 Pachori, P., Gothalwal, R., & Gandhi, P. (2019). Emergence of antibiotic resistance Pseudomonas aeruginosa in intensive care unit ; a critical review. Genes & Diseases , 6 (2), 109–119. https://doi.org/10.1016/j.gendis.2019.04.001 Pang, Z., Raudonis, R., Glick, B. R., Lin, T. J., & Cheng, Z. (2019). Antibiotic resistance in Pseudomonas aeruginosa: mechanisms and alternative therapeutic strategies. Biotechnology Advances , 37 (1), 177–192. https://doi.org/10.1016/j.biotechadv.2018.11.013 Passador, L., Cook, J. M., Gambello, M. J., Rust, L., & Iglewski, B. H. (1993). Expression of Pseudomonas aeruginosa virulence genes requires cell-to-cell communication. Science , 260 (5111), 1127–1130. https://doi.org/10.1126/science.8493556 Pereira, S. G., Rosa, A. C., Ferreira, A. S., Moreira, L. M., Proença, D. N., Morais, P. V., & Cardoso, O. (2014). Virulence factors and infection ability of Pseudomonas aeruginosa isolates from a hydropathic facility and respiratory infections. Journal of Applied Microbiology , 116 (5), 1359–1368. https://doi.org/10.1111/jam.12463 Pires, D., Melo, L., Vilas Boas, D., Sillankorva, S., & Azeredo, J. (2017). Phage therapy as an alternative or complementary strategy to prevent and control biofilm-related infections. Current Opinion in Microbiology , 39 , 48–56. https://doi.org/10.1016/j.mib.2017.09.004 Pires, D. P., Cleto, S., Sillankorva, S., Azeredo, J., & Lu, T. K. (2016). Genetically Engineered Phages: a Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 5 – References 65 Review of Advances over the Last Decade. Microbiology and Molecular Biology Reviews , 80 (3), 523– 543. https://doi.org/10.1128/mmbr.00069-15 Pires, D. P., Costa, A. R., Meneses, L., & Azeredo, J. (2020). Current challenges and future opportunities of phage therapy. FEMS Microbiology Letters , 44 (6), 684–700. https://doi.org/10.1093/femsre/fuaa017 Pires, D. P., Dötsch, A., Anderson, E. M., Hao, Y., Khursigara, C. M., Lam, J. S., Sillankorva, S., & Azeredo, J. (2017). A genotypic analysis of five P. aeruginosa strains after biofilm infection by phages targeting different cell surface receptors. Frontiers in Microbiology , 8 (1229), 1–14. https://doi.org/10.3389/fmicb.2017.01229 Pires, D. P., Kropinski, A. M., Azeredo, J., & Sillankorva, S. (2014). Complete genome sequence of the Pseudomonas aeruginosa bacteriophage phiIBB-PAA2. Genome Announcements , 2 (1), 7–8. https://doi.org/10.1128/genomeA.e01102-13 Pires, D. P., Monteiro, R., Mil-Homens, D., Fialho, A., Lu, T. K., & Azeredo, J. (2021). Designing P. aeruginosa synthetic phages with reduced genomes. Scientific Reports , 11 (1), 1–10. https://doi.org/10.1038/s41598-021-81580-2 Pirnay, J.-P., Vos, D. De, Verbeken, G., Merabishvili, M., Chanishvili, N., Vaneechoutte, M., Zizi, M., Laire, G., Lavigne, R., Huys, I., Mooter, G. Van den, Buckling, A., Debarbieux, L., Pouillot, F., Azeredo, J., Kutter, E., Dublanchet, A., Górski, A., & Adamia, R. (2011). The Phage Therapy Paradigm: Prêt-àPorter or Sur-mesure ? Pharm Res , 28 , 934–937. https://doi.org/10.1007/s11095-010-0313-5 Pirnay, J., Verbeken, G., Ceyssens, P., Huys, I., Vos, D. De, Ameloot, C., & Fauconnier, A. (2018). The Magistral Phage. Viruses , 10 (2), 1–7. https://doi.org/10.3390/v10020064 Principi, N., Silvestri, E., & Esposito, S. (2019). Advantages and Limitations of Bacteriophages for the Treatment of Bacterial Infections. Frontiers in Pharmacology , 10 (513), 1–9. https://doi.org/10.3389/fphar.2019.00513 Rahim, R., Burrows, L. L., Monteiro, M. A., Perry, M. B., & Lam, J. S. (2000). Involvement of the rml locus in core oligosaccharide and O polysaccharide assembly in Pseudomonas aeruginosa. Microbiology , 146 (11), 2803–2814. https://doi.org/10.1099/00221287-146-11-2803 Reuter, K., Steinbach, A., & Helms, V. (2016). Interfering with Bacterial Quorum Sensing. Perspectives in Medical Chemistry , 8 , 1–15. https://doi.org/10.4137/PMC.S13209 Ribeiro, H. G., Melo, L. D. R., Oliveira, H., Boon, M., Lavigne, R., Noben, J.-P., Azeredo, J., & Oliveira, A. (2019). Characterization of a new podovirus infecting Paenibacillus larvae. Scientific Reports , Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 5 – References 66 9 (20355), 1–12. https://doi.org/10.1038/s41598-019-56699-y Rocchetta, H. L., Burrows, L. L., Pacan, J. C., & Lam, J. S. (1998). Three rhamnosyltransferases responsible for assembly of the A-band D-rhamnan polysaccharide in Pseudomonas aeruginosa: A fourth transferase, WbpL, is required for the initiation of both A-band and B-band lipopolysaccharide synthesis (Molecular Mi. Molecular Microbiology , 28 (6), 1103–1119. https://doi.org/10.1046/j.1365-2958.1998.01109.x Rocchetta, H. L., Pacan, J. C., & Lam, J. S. (1998). Synthesis of the A-band polysaccharide sugar Drhamnose requires Rmd and WbpW: Identification of multiple AlgA homologues, WbpW and ORF488, in Pseudomonas aeruginosa. Molecular Microbiology , 29 (6), 1419–1434. https://doi.org/10.1046/j.1365-2958.1999.0erat.x Rohde, C., Wittmann, J., & Kutter, E. (2018). Bacteriophages: A therapy concept against multi-drugresistant bacteria. Surgical Infections , 19 (8), 737–744. https://doi.org/10.1089/sur.2018.184 Santos, S. B., Cunha, A. P., Macedo, M., Nogueira, C. L., Brandão, A., Costa, S. P., Melo, L. D. R., Azeredo, J., & Carvalho, C. M. (2020). Bacteriophage ‐ receptor binding proteins for multiplex detection of Staphylococcus and Enterococcus in blood. Biotechnology Advances , 117 , 3286–3298. https://doi.org/10.1002/bit.27489 Schmelcher, M., & Loessner, M. J. (2008). Principles of Bacterial Detection : Biosensors, Recognition Receptores and Microsystems . Schmelcher, M., & Loessner, M. J. (2014). Application of bacteriophages for detection of foodborne pathogens. Bacteriophage , 4 (e28137), 1–14. https://doi.org/10.4161/bact.28137 Silby, M. W., Winstanley, C., Godfrey, S. A. C., Levy, S. B., & Jackson, R. W. (2011). Pseudomonas genomes: Diverse and adaptable. FEMS Microbiology Reviews , 35 (4), 652–680. https://doi.org/10.1111/j.1574-6976.2011.00269.x Strateva, T., & Mitov, I. (2011). Contribution of an arsenal of virulence factors to pathogenesis of Pseudomonas aeruginosa infections. Annals of Microbiology , 61 (4), 717–732. https://doi.org/10.1007/s13213-011-0273-y Tagliaferri, T. L., Jansen, M., & Horz, H.-P. (2019). Fighting Pathogenic Bacteria on Two Fronts: Phages and Antibiotics as Combined Strategy. Frontiers in Cellular and Infection Microbiology , 9 (22), 13. https://doi.org/10.3389/fcimb.2019.00022 Takahashi, Y., & Tatsuma, T. (2014). Metal oxides and hydroxides as rechargeable materials for photocatalysts with oxidative energy storage abilities. Electrochemistry , 82 (9), 749–751. Engineering phages towards Pseudomonas aeruginosa detection and control Chapter 5 – References 67 https://doi.org/10.5796/electrochemistry.82.749 Tang, Y., Ali, Z., Zou, J., Jin, G., Zhu, J., Yang, J., & Dai, J. (2017). Detection methods for: Pseudomonas aeruginosa: History and future perspective. RSC Advances , 7 (82), 51789–51800. https://doi.org/10.1039/c7ra09064a Torres-Barceló, C. (2018). Phage Therapy Faces Evolutionary Challenges. Viruses , 10 (323), 8. https://doi.org/10.3390/v10060323 Tramper-stranders, G. A., Ent, C. K. Van Der, & Wolfs, T. F. W. (2005). Detection of Pseudomonas aeruginosa in patients with cystic fibrosis. Journal of Cystic Fibrosis , 4 (2), 37–43. https://doi.org/10.1016/j.jcf.2005.05.009 Viazis, S., Akhtar, M., Feirtag, J., Brabban, A. D., & Diez-Gonzalez, F. (2011). Isolation and characterization of lytic bacteriophages against enterohaemorrhagic Escherichia coli. Journal of Applied Microbiology , 110 (5), 1323–1331. https://doi.org/10.1111/j.1365-2672.2011.04989.x Waters, E. M., Neill, D. R., Kaman, B., Sahota, J. S., Clokie, M. R. J., Winstanley, C., & Kadioglu, A. (2017). Phage therapy is highly effective against chronic lung infections with Pseudomonas aeruginosa. Thorax , 0 (0), 2. https://doi.org/10.1136/thoraxjnl-2016-209265 World Health Organization. (2017). WHO publishes list of bacteria for which new antibiotics are urgently needed . https://www.who.int/news/item/27-02-2017-who-publishes-list-of-bacteria-for-which-newantibiotics-are-urgently-needed Xu, J., Moore, J. E., Murphy, P. G., Millar, B. C., & Elborn, S. (2004). Early detection of Pseudomonas aeruginosa – comparison of conventional versus molecular ( PCR ) detection directly from adult patients with cystic fibrosis ( CF ). Annals of Clinical Microbiology and Antimicrobials , 3 (21), 1–5. https://doi.org/10.1186/1476-0711-3-21 Yoichi, M., Abe, M., Miyanaga, K., Unno, H., & Tanji, Y. (2005). Alteration of tail fiber protein gp38 enables T2 phage to infect Escherichia coli O157:H7. Journal of Biotechnology , 115 (1), 101–107. https://doi.org/10.1016/j.jbiotec.2004.08.003 Yoshida, N., & Sato, M. (2009). Plasmid uptake by bacteria : a comparison of methods and efficiencies. Applied Microbiology and Biotechnology , 83 (5), 791–798. https://doi.org/10.1007/s00253-0092042-4 Young, J. S., Gormley, E., & Wellington, E. M. H. (2005). Molecular detection of Mycobacterium bovis and Mycobacterium bovis BCG (Pasteur) in soil. Applied and Environmental Microbiology , 71 (4), 1946–1952. https://doi.org/10.1128/AEM.71.4.1946-1952.2005 Supplementary material Engineering phages towards Pseudomonas aeruginosa detection and control Supplementary material 69 Strains, bacteriophages and plasmids used in this work can be seen in the Table S1. Table S1 - Bacterial strains, bacteriophages and plasmids used in this study Strain, bacteriophage, or plasmid Reference or source P. aeruginosa strains PAO1 German Collection of Microorganisms and Cell Cultures (DSM22644) PA14 Laboratory stock 1 Urine 2 Skin 3 Ear 4 Bronchial 5 Hemoculture 6 Urine 7 Ear 8 Urine 9 Urine 10 Urine 11 Skin ulcer 12 Expectoration 14 Urine 15 Skin ulcer 16 Skin ulcer 17 Catheter 18 Ear 19 Skin ulcer 20 Urine 21 Urine 22 Hemoculture 23 Urine Engineering phages towards Pseudomonas aeruginosa detection and control Supplementary material 70 24 Expectoration 25 Expectoration 26 Ear 27 Unknown 28 Unknown 29 Unknown A22 Unknown A63 Expectoration A64 Bronchial A65 Bronchial A66 Bronchial A67 Bronchial A69 Bronchial A70 Bronchial A71 Expectoration 052EX Expectoration O64 Hemoculture O65 Bronchial O77 Unknown O78 Unknown O79 Unknown O92 Unknown 144 Unknown 149 Unknown wzy (A+B−), deficient in O-antigen polymerase for B-band biosynthesis, produces core-plus-one O-repeat unit (de Kievit et al., 1995) wbpL (A−B−), deficient in the initial glycosyltransferase affecting both B-band Engineering phages towards Pseudomonas aeruginosa detection and control Supplementary material 71 and A-band (Rocchetta, Burrows, et al., 1998) rmlC (A−B−), defective in TDP-L-rhamnose biosynthesis, with truncated outer core (Rahim et al., 2000) rmd (A−B+), deficient in GDP-D-rhamnose biosynthesis becomes A-band minus, not affecting B-band (Rocchetta, Pacan, et al., 1998) E. coli strains Arctic express Laboratory stock C43 Laboratory stock BL21 Laboratory stock A51 Bronchial Saccharomyces cerevisiae strains BY4741 Laboratory stock Klebsiella pneumoniae strains A36 Bronchial A57 Bronchial Staphylococcus aureus strains A1 Bronchial - MRSA (Multi-Resistent S. aureus ) A9 Hemoculture - MRSA (Multi-Resistent S. aureus ) A39 Bronchial - MSSA (Multi-Sensitive S. aureus ) Enterococcus faecalis strains A74 Urine Enterococcus faecium strains A78 Skin ulcer Bacteriophages PE1 - Engineering phages towards Pseudomonas aeruginosa detection and control Supplementary material 72 phiIBB-PAA2 Accession number: NC_022971.1 vB_PaeM_CEB_DP1 Accession number: KR869157 PA14G - PA14-20 - vB_PaeP_PE3 Accession number: MN901924.1 PE3Δgp1–gp12 D. P. Pires et al., (2021) PE3Δgp1–gp12:Nluc This work Plasmids pRS415 ATCC 87520 pGFP Laboratory stock 79 phiIBBPAA2_0053 33356 34045 690 RBP Listeria 3. 0E-02 phiIBBPAA2_0054 34042 35583 1542 viral protein Enterobacteria phage T7 6.7E-06 phiIBBPAA2_0055 35592 36239 648 RB domain of short TFP gp12 Bizionia argentinensis JUB59 79 phiIBBPAA2_0056 36229 36477 249 hypothetical protein Pseudomonas virus Pa223 1.0E-49 phiIBBPAA2_0057 36461 36652 192 hypothetical protein Pseudomonas virus LUZ24 1.0E-34 phiIBBPAA2_0058 36663 37289 627 virion protein Pseudomonas virus LUZ24 1.0E-151 phiIBBPAA2_0059 37293 37613 321 hypothetical protein Pseudomonas virus LUZ24 5.0E-72 phiIBBPAA2_0060 37662 38615 954 major head protein Microcystis phage Mic1 2.0E-101 phiIBBPAA2_0061 38634 39626 993 scaffolding protein Pseudomonas aeruginosa 0.0 phiIBBPAA2_0062 39626 39868 243 hypothetical protein Pseudomonas aeruginosa 4.0E-51 phiIBBPAA2_0063 39871 41991 2121 portal protein Pseudomonas phage phiIBB-PAA2 2.2E-40 phiIBBPAA2_0064 41991 43439 1449 terminase large subunit Pseudomonas virus LUZ24 5.0E-47 phiIBBPAA2_0065 43439 43837 399 lysozyme Pseudomonas phage TL 2.0E-89 phiIBBPAA2_0066 43869 44327 459 hypothetical protein Pseudomonas phage phiIBB-PAA2 5.0E-107 Table S4 - Annotation of phage PE3. For each locus_tag, the transcription start and stop position. The corresponding gene product size and putative predicted function based on the best hit and E-value obtained locus_tag Minimum (bp) Maximum (bp) Length (bp) Putative function Best Species Hit E-value vBPaePPE3_001 1776 2060 285 hypothetical protein Pseudomonas phage phiKMV 4.0E-62 vBPaePPE3_002 2060 2287 228 hypothetical protein Pseudomonas phage phiKMV 5.0E-46 80 vBPaePPE3_003 2298 2837 540 hypothetical protein Pseudomonas phage LUZ19 5.0E-128 vBPaePPE3_004 2834 3004 171 hypothetical protein Pseudomonas phage vB_PaeP_130_113 1.0E-32 vBPaePPE3_005 3007 3126 120 hypothetical protein Pseudomonas phage vB_PaeP_PE3 7.0E-18 vBPaePPE3_006 3205 3573 369 hypothetical protein Pseudomonas phage phiKMV 4.0E-85 vBPaePPE3_007 3560 3787 228 hypothetical protein Pseudomonas phage phiKMV 7.0E-49 vBPaePPE3_008 3784 3969 186 hypothetical protein Pseudomonas phage vB_PaeP_PE3 3.0E-34 vBPaePPE3_009 3966 4139 174 hypothetical protein Pseudomonas aeruginosa 3.0E-34 vBPaePPE3_010 4139 4420 282 hypothetical protein Pseudomonas aeruginosa 2.0E-59 vBPaePPE3_011 4420 4680 261 hypothetical protein Pseudomonas aeruginosa 4.0E-55 vBPaePPE3_012 4682 4969 288 hypothetical protein Pseudomonas phage vB_PaeP_PE3 2.0E-63 vBPaePPE3_013 5048 5464 417 hypothetical protein Pseudomonas phage vB_PaeP_PE3 1.0E-92 vBPaePPE3_014 5533 5892 360 hypothetical protein Pseudomonas phage phiKMV 2.0E-78 vBPaePPE3_015 5895 6704 810 DNA-binding protein Pseudomonas phage vB_PaeP_PE3 0.0 vBPaePPE3_016 6784 7203 420 hypothetical protein Pseudomonas phage vB_PaeP_PE3 7.0E-98 vBPaePPE3_017 6974 7516 543 hypothetical protein Pseudomonas phage vB_PaeP_PE3 3.0E-129 vBPaePPE3_018 7526 7729 204 hypothetical protein Pseudomonas phage PT5 3.0E-41 vBPaePPE3_019 7702 8526 825 putative DNA primase Aquifex aeolicus 1.3E-22 vBPaePPE3_020 8495 9763 1269 DNA helicase Bacillus phage SPP1 1.5E-39 vBPaePPE3_021 9753 10370 618 putative nucleotidyl transferase Pseudomonas phage vB_PaeP_PE3 2.0E-148 vBPaePPE3_022 10370 11317 948 DNA ligase Pseudomonas phage vB_PaeP_PE3 1.5E-37 81 vBPaePPE3_023 11320 11649 330 hypothetical protein Pseudomonas phage vB_PaeP_PE3 2.0E-74 vBPaePPE3_024 11646 14069 2424 DNA polymerase I Plasmodium falciparum 6.0E-64 vBPaePPE3_025 14066 14377 312 hypothetical protein Pseudomonas phage LKD16 2.0E-69 vBPaePPE3_026 14432 15481 1050 hypothetical protein Pseudomonas phage MPK7 0.0 vBPaePPE3_027 15481 16422 942 5'-3' exonuclease Mycobacterium smegmatis 4.3E-30 vBPaePPE3_028 16412 16852 441 putative DNA endonuclease VII Pseudomonas phage MPK6 5.0E-105 vBPaePPE3_029 16849 17895 1047 DNA polymerase Pyrobaculum calidifontis 2.7E-10 vBPaePPE3_030 17905 18267 363 hypothetical protein Pseudomonas phage vB_PaeP_PE3 1.0E-80 vBPaePPE3_031 18260 18610 351 hypothetical protein Pseudomonas phage vB_PaeP_PE3 4.0E-78 vBPaePPE3_032 18619 21066 2448 putative DNA-dependent RNA polymerase Enterobacteria phage T7 6.0E-152 vBPaePPE3_033 21240 21491 252 hypothetical protein Pseudomonas phage LUZ19 1.0E-52 vBPaePPE3_034 21491 21964 474 putative acetyltransferase Pseudomonas phage vB_PaeP_PE3 5.0E-114 vBPaePPE3_035 21909 22205 297 putative structural protein Pseudomonas phage vB_PaeP_PE3] 4.0E-61 vBPaePPE3_036 22217 23749 1533 putative head-tail connector protein Enterobacteria phage T7 5.6E-91 vBPaePPE3_037 23753 24721 969 scaffolding protein Pseudomonas phage vB_PaeP_PE3 0.0 vBPaePPE3_038 24774 25781 1008 capsid protein Pseudomonas phage phiKMV 0.0 vBPaePPE3_039 25878 26432 555 tail tubular protein A Pseudomonas phage LUZ19 8.0E-132 vBPaePPE3_040 26435 28915 2481 tail tubular protein B Enterobacteria phage T7 8.3E-110 vBPaePPE3_041 28915 29460 546 putative internal virion protein A Pseudomonas phage phiKMV 2.0E-124 82 vBPaePPE3_042 29460 32156 2697 internal virion protein Pseudomonas phage vB_PaeP_PE3 0.0 vBPaePPE3_043 32160 36173 4014 internal virion protein Pseudomonas phage vB_PaeP_PE3 0.0 vBPaePPE3_044 36175 36930 756 putative tail fiber protein Enterobacteria phage T7 4.6E-11 vBPaePPE3_045 36930 37388 459 tail fiber protein Pseudomonas phage LUZ19 7.0E-106 vBPaePPE3_046 37381 38286 906 tail fiber protein Pseudomonas phage vB_PaeP_PE3 0.0 vBPaePPE3_047 38290 38895 606 tail fiber protein Pseudomonas phage LUZ19 9.0E-148 vBPaePPE3_048 38895 39200 306 hypothetical protein Pseudomonas phage vB_PaeP_PAO1_115pyo 1.0E-68 vBPaePPE3_049 39210 41015 1806 terminase large subunit Pseudomonas phage vB_PaeP_PE3 1.4E-32 vBPaePPE3_050 41012 41212 201 hypothetical protein Pseudomonas phage phiKMV 2.0E-38 vBPaePPE3_051 41209 41691 483 endolysin Pseudomonas phage vB_PaeP_PE3 1.0E-114 vBPaePPE3_052 41649 41978 330 hypothetical protein Pseudomonas phage DL62 4.0E-72 vBPaePPE3_053 42130 42480 351 minor structural protein Pseudomonas phage vB_PaeP_PE3 3.0E-72 vBPaePPE3_054 42499 42744 246 particle protein Pseudomonas phage vB_PaeP_PE3 3.0E-49 vBPaePPE3_055 42753 42968 216 hypothetical protein Pseudomonas phage LUZ19 3.0E-42