Phenolic, polysaccharides composition, and texture properties during ripening and storage time of new table grape cultivars in Chile

Citation: Peña-Neira, A.; Cortiella, M.G.i.; Ubeda, C.; Pastenes, C.; Villalobos, L.; Contador, L.; Infante, R.; Gómez, C. Phenolic, Polysaccharides Composition, and Texture Properties during Ripening and Storage Time of New Table Grape Cultivars in Chile. Plants 2023, 12, 2488. https://doi.org/10.3390/ plants12132488 Academic Editors: Jelena Dragiši´c Maksimovi´c and Vuk Maksimovi´c Received: 25 April 2023 Revised: 16 June 2023 Accepted: 26 June 2023 Published: 29 June 2023 Copyright: © 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). plants Article Phenolic, Polysaccharides Composition, and Texture Properties during Ripening and Storage Time of New Table Grape Cultivars in Chile Alvaro Peña-Neira 1,*, Mariona Gil i Cortiella 2, Cristina Ubeda 3, Claudio Pastenes 4, Luís Villalobos 4,† , Loreto Contador 4, Rodrigo Infante 4and Camila Gómez 1 1 Department of Agro-Industry and Enology, Facultad de Ciencias Agronómicas, Universidad de Chile, Santa Rosa 11315, La Pintana, Santiago 8820000, Chile 2Instituto de Ciencias Químicas Aplicadas, Facultad de Ingeniería, Universidad Autónoma de Chile, Av. El Llano Subercaseaux 2801, San Miguel, Santiago 8910060, Chile; [email protected] 3 Área de Nutrición y Bromatología, Departamento de Nutrición y Bromatología, Toxicología y Medicina Legal, Facultad de Farmacia, Universidad de Sevilla, C/P. García González no. 2, E-41012 Sevilla, Spain; [email protected] 4 Department of Plant Production, Facultad de Ciencias Agronómicas, Universidad de Chile, Santa Rosa 11315, La Pintana, Santiago 8820000, Chile; [email protected] (C.P.); [email protected] (L.V.) *Correspondence: [email protected]; Tel.: +56-9-94991911 † Present address: Centro de Estudios Avanzados en Fruticultura, Rengo 2940000, Chile. Abstract: The aim of this study is to determine the phenolic and polysaccharidic composition, texture properties, and gene expression of new seedless table grape cultivars Timco ™ and Krissy ™ and compare them to the traditional table grape variety Crimson Seedless (Vitis vinifera L.), during ripening and in commercial postharvest conditions. According to the results, phenolic compounds were present in very different proportions. The total anthocyanins responsible for skin color increased during maturation and the majority anthocyanin in the three cultivars was peonidin-3-glucoside, followed by malvidin-3-glucoside. The phenolic compounds presented a different behavior (decreasing or increasing) during postharvest. The total skin soluble polysaccharides decreased during ripening and postharvest in Crimson Seedless and Krissy ™ and remained constant from technological maturity to postharvest storage in Timco ™ . In all cultivars, the majority soluble polysaccharide fraction was that with a molecular mass between 500 and 35 KDa. The skin mechanical properties of table grapes were good parameters for differentiating varieties, with better results for the new cultivars, compared to the traditional Crimson Seedless, especially in postharvest. Genes involved in the flavonoid pathway and cell wall metabolism in skins exhibited an increase in expression from veraison to remaining constant at the end of the berry ripening. Keywords: Vitis vinifera; Crimson Seedless; Timco ™ ; Krissy ™ ; polyphenolic profile; gene expression; phenylpropanoid biosynthesis 1. Introduction Grape ripening has been studied for many years and harvesting fruit at optimal ripeness is essential for marketing and storing table grapes [1]. The quality of the grape berry at harvest is determined by several significant physiological and biochemical changes that occur simultaneously in the grape berry during the ripening phase. Veraison, the first symptom of ripening, marks the start of major metabolic changes, including sugar accumulation, softening of the berries, anthocyanin formation, organic acid metabolism, and accumulation of flavor compounds [2–4]. In general, table grapes have bigger berries and firmer pulp compared to wine grapes. Due to their reduced propensity for withering and crushing, these characteristics make Plants 2023,12, 2488. https://doi.org/10.3390/plants12132488 https://www.mdpi.com/journal/plants Plants 2023,12, 2488 2 of 21 table grapes less vulnerable to harm during transportation. On the other hand, consumers generally prefer seedless varieties with medium-sized berries, crisp, thin skin, and a sweet taste [ 5 , 6 ]. At technological maturity, the quality of table grapes is determined by their appearance, physical, and chemical characteristics. While the balance between sweetness and acidity is a fundamental concept in assessing the quality of many fruits, such as table grapes [ 6 ], texture is an important factor in determining the quality of table grapes. The viticulture and postharvest industries may be interested in instrument mechanical properties to identify the potential of each variety and help meet market demands [ 7 ]. These mechanistic variables are associated with certain organoleptic properties and thus indirectly affect consumer acceptance of the product [ 7 , 8 ]. Grape berries’ loss of firmness during ripening has frequently been linked to the breakdown of cell walls, particularly pectic polysaccharides [ 9 ]. Changes in the structure and composition of the cell wall are the result of hydrolytic enzymes produced by the fruit, namely polygalacturonase (PG), pectinesterase (PE), β -galactosidase ( β -GAL), pectate lyase (PL), and cellulase, resulting from complex interactions [ 10 ]. The activity of these enzymes and the expression of the genes encoding them differ between table grape varieties, which may explain differences in the firmness of the varieties at the time of harvest [9,10]. Furthermore, the appearance of grapes has a significant impact on their commercial value, and poorly colored red–pink varieties lead to low consumer acceptance [ 11 ]. There is a strong correlation between anthocyanin concentration and the grape skin color index [ 12 ]. Only during veraison do anthocyanins begin to form in the skin of red grapes. Many of the genes involved in the flavonoid pathway exhibit a dramatic increase in expression in skin cells at veraison, according to analysis of their patterns of expression. Despite variations in gene expression levels between grape varieties, expression of the gene encoding a glycosyl transferase involved in the last stages of anthocyanin production was positively linked with anthocyanin synthesis [ 3 ]. In addition to anthocyanins, grapes are rich in other phenolic compounds thought to have antioxidant properties and health benefits [ 5 ]. For this reason, table grapes can be considered as a product with functional properties, as they are rich in nutrients and antioxidants and thus have many health benefits [13]. About 80% of Chile’s production of table grapes is exported. Chile is the world’s and the Southern Hemisphere’s top exporter of table grapes, according to the United States Department of Agriculture (USDA). Grape exports for the 2019/2020 season reached approximately 657,000 tons [ 14 , 15 ]. In recent years, Chile has been introducing several new varieties from various national and international breeding programs to the world market, which are replacing traditional grape varieties such as Red Globe, Crimson Seedless, and Thompson Seedless. Chile is searching for grapes with a superior size, better condition, and taste [ 14 , 16 ]. Last season (2021/2022), traditional varieties (Red Globe, Crimson Seedless, Thompson, Flame, Sugraone, Autumn Royal) accounted for 48% of production, with the remaining 52% being over 30 licensed new varieties, such as Timco ™ , Sweet Celebration ™ , Arra15™, Allison™, Magenta™, Scarlotta™, Pristine™, Sable™, Krissy™, and Maylen. Due to the lack of characterization of new varieties during ripening and postharvest storage, the aim of this study is to determine the phenolic and polysaccharidic composition, texture properties, and gene expression of new seedless table grape cultivars Timco ™ and Krissy ™ and compare them to the traditional table grape variety Crimson Seedless (Vitis vinifera L.), during ripening and in commercial postharvest conditions. We evaluated a variety of parameters including: (i) grape maturity indicators, (ii) phenolic composition and antioxidant activity of skins, (iii) skin soluble polysaccharides according to molecular mass distribution, (vi) texture properties, and (v) gene expression of transcriptional regulators and biosynthetic enzymes of the anthocyanin pathway and cell wall metabolism of berry skins, related to the synthesis of anthocyanins and color, as well as the texture of berries, respectively. Plants 2023,12, 2488 3 of 21 2. Results and Discussion 2.1. Evolution of Basic Physical and Chemical Variables The berry weight, equatorial diameter, length, and technological maturity parameters such as total soluble solids ( ◦ Brix), TA (expressed as g H 2 SO 4 equivalents per liter of juice), and pH of varieties investigated are shown in Table 1. Table 1. Data of sampling, the berry weight, equatorial diameter, length, and technological maturity parameters of grapes from cultivars Crimson Seedless, Timco ™ , and Krissy ™ during ripening and postharvest storage. Variable Cultivar Period before Harvest Period Postharvest Sampling Dates: 30 January 2018 (D1) 12 February 2018 (D2) 26 February 2018 (D3) 9 March 2018 (D4) 2 May 2018 (D5) 25 June 2018 (D6) Weight of 50 berries (g) Crimson 244.8 ±18.5 a 264.6 ±22.4 ab 296.4 ±25.3 b 294.0 ±37.9 b 262.5 ±22.4 ab 262.7 ±27.8 ab Timco™ 420.8 ±21.2 a 471.3 ±24.6 ab 493.2 ±13 ab 522.0 ±60.4 b 527.8 ±57.5 b 526.2 ±29.7 ab Krissy™ 331.7 ±14.7 a 426.7 ±39.4 ab 485.1 ±28.3 b 432.8 ±27.2 ab 420.1 ±78.5 ab 457.6 ±90.5 b Length (mm) Crimson 17.58 ±0.55 a 18.25 ±0.25 a 18.70 ±0.81 a 18.27 ±0.84 a 17.04 ±0.34 a 16.64 ±0.56 a Timco™ 21.91 ±0.36 a 22.71 ±0.56 a 22.82 ±0.33 a 22.68 ±0.93 a 22.19 ±0.67 a 21.96 ±1.1 ab Krissy™ 20.87 ±0.36 a 22.90 ±0.90 b 23.83 ±0.33 b 22.42 ±0.39 b 21.75 ±1.47 b 21.50 ±2.11 b Equatorial diameter (mm) Crimson 22.52 ±0.53 a 24.11 ±1.16 b 25.20 ±0.49 b 24.72 ±0.50 b 24.06 ±1.02 b 23.37 ±1.19 ab Timco™ 26.73 ±0.67 a 28.25 ±0.55 b 28.77 ±0.47 b 30.53 ±1.17 b 30.14 ±1.73 b 29.67 ±0.58 b Krissy™ 20.85 ±1.06 a 25.66 ±0.84 b 25.58 ±0.67 b 24.91 ±0.84 b 24.72 ±1.25 b 23.07 ±2.62 ab Total soluble solids (◦Brix) Crimson 13.47 ±0.31 c 15.13 ±0.12 cb 16.87 ±0.12 b 18.73 ±0.31 ab 20.20 ±0.35 ab 21.73 ±0.64 a Timco™ 13.47 ±0.23 c 16.20 ±0.20 bc 17.27 ±0.31 b 18.73 ±0.23 ab 19.40 ±0.20 a 21.40 ±0.35 a Krissy™ 13.60 ±0.20 c 16.07 ±0.31 bc 18.33 ±0.12 bc 19.40 ±0.53 b 20.87 ±1.01 ab 22.07 ±0.31 a pH Crimson 2.90 ±0.01 a 3.18 ±0.04 a 3.16 ±0.02 a 3.35 ±0.52 a 3.50 ±0.02 a 3.54 ±0.04 a Timco™ 2.92 ±0.03 a 3.21 ±0.06 a 3.26 ±0.06 b 3.36 ±0.02 a 3.50 ±0.02 a 3.56 ±0.05 a Krissy™ 2.90 ±0.02 a 3.17 ±0.07 a 3.30 ±0.03 b 3.40 ±0.04 a 3.50 ±0.06 a 3.54 ±0.01 a Titratable acidity (g H2SO4/L) Crimson 6.35 ±0.10 ab 5.97 ±0.26 b 3.68 ±0.21 b 3.22 ±0.14 c 3.95 ±0.24 b 3.98 ±0.11 b Timco™ 6.62 ±0.60 a 5.36 ±0.34 a 3.54 ±0.10 a 3.74 ±0.07 a 4.32 ±0.29 a 4.03 ±0.10 a Krissy™ 8.20 ±0.02 b 7.15 ±0.25 a 4.32 ±0.07 ab 4.27 ±0.22 bc 5.04 ±0.21 b 4.8 ±0.04 a Different letters within a row indicate statistical differences among sampling points (p< 0.05, Tukey post hoc test) for the same variable and cultivar. Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Berry size is the most important quality factor in the international table grape market. Preference for grape berries is affected by berry size, texture, skin thickness, and astringency. In seedless cultivars, berry size is usually increased by external application of gibberellin or cytokinins in the early stages of fruit development [ 17 ] as a routine agronomic practice in commercial table grape vineyards. In general, berry weight and equatorial diameter increased to varying degrees during ripening for all studied table grapes. At commercial maturity (D4), the berries weighed between 294 and 522 mg, which corresponded to the Crimson Seedless and Timco ™ varieties, respectively, and their weight decreased during storage, except for the Krissy ™ cultivar. The greater standard deviation presented in the weight by Krissy ™ during postharvest storage compared to the other varieties under study would indicate a greater heterogeneity in the berries, which could explain the slight increase observed toward the last sampling, considering that in each sampling during storage, berries are obtained from different bunches stored inside boxes. The length of the berries for all varieties showed a slight increase during ripening, unlike the equatorial diameter that increased in the same period with values in D4 in a range between 24.72 (Crimson Seedless) and 30.53 mm (Timco™). Both parameters remained unchanged during the postharvest period. Sugar and organic acids are important to berry flavor. The total soluble solids (TSS) content is commonly used to assess the quality of table grapes and determine harvest ripeness. The TSS varied among cultivars at different sampling dates because of their early maturity and different ripening behavior. The TSS values for the three cultivars Plants 2023,12, 2488 4 of 21 at technological maturity (D4) ranged from 18.73 (Crimson Seedless and Timco ™ ) to 19.40 (Krissy ™ ). This may be due to the phenomenon of evaporation during long-term storage [ 18 ]. Furthermore, as expected, all varieties showed a significant increase in the pH and a significant decrease in total acidity during ripening. During storage, the pH remained almost constant, while total acidity increased slightly in all three varieties. Our results concerning the physiochemical parameters agree with previous studies concerning table grapes’ ripening and postharvest storage [9,16,17]. 2.2. Evolution of Phenolic Compounds and Antioxidants in Skins Phenolics are good antioxidants because of their vulnerability to oxidation owing to their hydroxyl groups and unsaturated double bonds (18). The polyphenolic profile of grapes is affected by the variety, geographic, climatic, and agronomical conditions, among other factors [17,19–21]. The behavior in the evolution of total phenols during ripening was quite similar for the three cultivars. The total phenols values in skins at technological maturity (D4) ranged from 0.75 gallic acid mg/g FW (Timco ™ ) to 1.51 gallic acid mg/g FW (Crimson Seedless). The values are like those reported for red table grapes by other authors [20,21]. During the postharvest period, it was possible to observe a decrease in total phenols for the Crimson Seedless samples. On the other hand, both Timco ™ and Krissy ™ showed an increase in the value of total phenols. Sheng et al. [ 22 ], for the Summer black variety, observed an increase in the total phenol content during 28 days of storage. These authors point out that this increase is greater with the exposure of the berries to UV radiation given an increase in the expression of the genes in the phenylpropanoid pathway that are still active postharvest. All the varieties studied showed an increase in the content of total anthocyanins during maturation and up to the date of technological maturity (D4), the date on which the samples presented a range between 0.38 for Timco ™ and 0.75 for Crimson Seedless (Table 2). This coincides with other authors who have observed an increase in the concentration of total anthocyanins from veraison to technological maturity [ 3 , 10 , 11 ]. Comparing both postharvest storage dates (54 and 75 days), the Crimson Seedless and Krissy ™ samples showed a decrease in the total anthocyanin content, while the Timco ™ ones did not experience changes. According to Xie et al. [ 23 ], the concentration of anthocyanins in grape berries in advanced ripening processes is a balance between synthesis and degradation. These authors observed that although anthocyanin synthesis genes were highly expressed in the Yan73 grape cultivar at the late ripening stage, anthocyanins were markedly degraded, presumably by the action of enzymes peroxidase and polyphenol oxidase (PPO). This balance could favor degradation over time, especially in a long postharvest storage. This could explain the rapid decrease in anthocyanin content observed in the Timco ™ samples from D4 (technological maturity) to D5, which subsequently maintained their concentration until D6. On the other hand, during postharvest storage, an early increase in anthocyanin content was observed in the cultivar of the table grape ‘Yaghouti’ (Vitis vinifera L.), an increase that would be associated with the synthesis of anthocyanins related to the increase in sugar concentration (TSS) during the first period of storage. After this period of increase, a subsequent decrease is also observed [ 24 ] which coincides with the behavior presented in postharvest storage by the cultivars Crimson Seedless and Krissy ™ , for TSS and total anthocyanins (Tables 1and 2). Total tannins decreased in all varieties during ripening (Table 2). At the date of commercial harvest, the highest values were presented by Crimson Seedless (5.47) and Krissy ™ (6.57) and the lowest by Timco ™ (3.48). The values of the total tannins from skins at the time of technological maturity are within the values observed for 36 grape cultivars (Vitis vinifera L.) by other authors [ 25 ]. The evolution of tannins from veraison to technological maturity has been studied by several authors [ 26 ]. Some of them point out that most of the tannin synthesis occurs immediately after fruit set and ends several weeks Plants 2023,12, 2488 5 of 21 before veraison, while the second stage of tannin accumulation occurs just before this point, where the maximum tannin levels are found [ 26 , 27 ]. After veraison, Bogs et al. [ 28 ] found that the expressed genes most relevant to tannin synthesis were no longer detectable. This may partly explain why tannins do not accumulate during ripening and the generally decreasing levels that we observed. Table 2. Total phenols, anthocyanins, tannins, antioxidant capacity, and main individual anthocyanins in skins in Crimson Seedless, Timco ™ , and Krissy ™ cultivars during ripening and postharvest storage. Variable 1Cultivar Period before Harvest Period Postharvest Sampling Dates: 30 January 2018 (D1) 12 February 2018 (D2) 26 February 2018 (D3) 9 March 2018 (D4) 2 May 2018 (D5) 25 June 2018 (D6) Total phenols (mg/g FW) Crimson 1.32 ±0.09 b 1.57 ±0.09 c 1.52 ±0.18 c 1.51 ±0.23 c 1.23 ±0.03 a 1.29 ±0.28 ab Timco™ 0.75 ±0.10 a 0.89 ±0.07 b 0.78 ±0.41 ab 0.75 ±0.06 ab 0.86 ±0.16 b 0.89 ±0.15 b Krissy™ 1.45 ±0.12 b 1.46 ±0.12 b 1.33 ±0.11 a 1.44 ±0.13 b 1.87 ±0.54 bc 1.90 ±0.17 c Total anthocyanins (mg/g FW) Crimson 0.40 ±0.03 a 0.81 ±0.07 c 0.78 ±0.09 c 0.75 ±0.15 c 0.81 ±0.04 c 0.65 ±0.12 b Timco™ 0.33 ±0.09 b 0.34 ±0.09 b 0.33 ±0.16 b 0.38 ±0.05 c 0.29 ±0.13 a 0.29 ±0.09 a Krissy™ 0.34 ±0.03 a 0.55 ±0.10 b 0.63 ±0.06 c 0.65 ±0.07 c 0.74 ±0.27 c 0.57 ±0.03 b Total tannins (mg/g FW) Crimson 6.67 ±0.25 b 5.77 ±0.44 b 5.36 ±0.98 ab 5.47 ±1.33 ab 4.75 ±0.66 a 4.81 ±1.11 ab Timco™ 5.61 ±3.83 b 3.24 ±0.69 a 5.87 ±0.62 b 3.48 ±0.63 a 4.38 ±0.85 a 5.10 ±0.63 a Krissy™ 8.96 ±2.94 ab 6.57 ±0.95 b 6.22 ±0.55 b 6.57 ±0.67 b 9.17 ±2.96 ab 9.53 ±1.63 a Antioxidant activity (ORAC) (mmol/g TE FW) Crimson 4188 ±195 a 5569 ±366 b 5396 ±670 b 4627 ±169 ab 5477 ±195 b 4450 ±212 ab Timco™ 1180 ±161 a 2368.33 ±484 b 2463 ±190 b 2453 ±289 b 3105 ±181 c 2894 ±286 bc Krissy™ 3428 ±262 a 4710 ±327 b 4713 ±146 b 3821 ±145 ab 3105 ±181 a 3088 ±223 a Delphinidin-3glucoside (µg/g FW) Crimson ND 11.1 ±0.10 a 12.2 ±0.30 a 13,4 ±0.50 a 13.1 ±0.20 a 12.6 ±0.30 a Timco™ ND ND ND ND ND ND Krissy™ 10.10 ±0.20 b 7.20 ±0.30 a 12.01 ±0.10 c 10.41 ±0.10 b 10.31 ±0.20 b 9.21 ±0.12 b Cyanidin-3glucoside (µg/g FW) Crimson 10.01 ±0.31 a 18.20 ±0.31 b 20.12 ±0.27 b 21.20 ±0.17 b 19.35 ±0.21 b 19.21 ±1.02 b Timco™ 20.12 ±1.01 a 19.17 ±1.01 a 20.67 ±0.61 a 19.58 ±1.17 a 20.02 ±1.13 a 19.00 ±1.01 a Krissy™ 20.02 ±1.00 a 19.41 ±1.63 a 30.03 ±3.44 b 51.61 ±4.83 bc 50.37 ±5.16 bc 56.10 ±7.12 c Petunidin-3glucoside (µg/g FW) Crimson ND 10.01 ±0.90 a 10.71 ±1.21 a 11.09 ±1.36 a 10.21 ±1.98 a 10.11 ±0.96 a Timco™ ND ND ND ND ND ND Krissy™ 11.07 ±0.71 a 20.12 ±3.01 b 20.42 ±1.97 b 40.25 ±2.58 c 17.35 ±3.13 b 15.01 ±2.08 b Peonidin-3glucoside (µg/g FW) Crimson 70.16 ±4.14 a 110.41 ±5.29 ab 113.71 ±4.86 b 249.97 ±6.19 d 222.39 ±4.02 c 222.95 ±5.06 c Timco™ 40.27 ±4.75 a 80.62 ±4.99 b 100.96 ±6.07 c 120.82 ±5.54 cd 140.76 ±7.21 d 110.91 ±6.95 cd Krissy™ 70.17 ±4,29 a 80.23 ±7.03 a 140.86 ±8.32 b 210.88 ±6.97 c 223.83 ±8.23 c 212.20 ±6.01 cd Malvidin-3glucoside (µg/g FW) Crimson 113.19 ±7.11 a 119.41 ±4.28 a 127.12 ±6.02 a 147.44 ±6.92 b 172.17 ±6.81 c 116.19 ±6.54 a Timco™ 20.92 ±3.81 a 30.86 ±5.51 b 38.03 ±5.86 b 39.03 ±2.42 b 27.32 ±3.81 b 31.43 ±4.42 b Krissy™ 31.43 ±4.31 a 42.74 ±4.62 a 91.29 ±5.71 b 88.28 ±6.53 b 44.24 ±5.71 a 51.45 ±6.31 ab 1 Different letters within a row indicate statistical differences among sampling points (p< 0.05, Tukey post hoc test) for the same variable and cultivar. Total phenols are expressed as Gallic acid equivalents. Total tannins are expressed as Catechin equivalents. Anthocyanins are expressed as malvidina-3-glucoside equivalents. FW means fresh weight. Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. During postharvest, no significant changes were observed in any of the varieties studied. In contrast, Sheng et al. [ 22 ] observed that during the storage of table grapes of the Summer black variety, a rapid decrease in 21 days was appreciated for total tannins, and a steady decrease thereafter. The antioxidant activity of grapes depends on the quantitative differences in phenolic compounds and the content of various other antioxidants, such as carotenoids and vitamin C, which decrease during ripening [ 29 , 30 ]. All grape varieties studied showed elevated ORAC values at technological maturity ranging from 2453 µ mol TE/100 g (TimcoTM) to 4627 µ mol TE/100 g (Crimson Seedless). In all the varieties, it was observed that the antioxidant capacity presented an early increase in the first stage of maturation and remained without significant differences until the commercial harvest. These results differ from those observed by other studies in that the antioxidant capacity decreased during the Plants 2023,12, 2488 6 of 21 ripening of the berries [ 29 , 31 , 32 ]. This could be because these studies were carried out with grapes destined to produce wine that reach a higher state of maturation compared with table grapes and therefore there is a greater probability of a decrease in the compounds responsible for the antioxidant capacity. At the end of storage, the antioxidant activity levels in all the varieties (ranging from 2894–4450 µ mol TE/100 g) did not lead to an excessive reduction in the antioxidant capacity of grapes. These results agree with Nicolosi et al. [ 33 ], who studied the evolution of the antioxidant capacity in postharvest storage for the table grape varieties Vittoria, Superior Seedless®, Italia, Crimson Seedless, Red Globe, and Black Pearl. Determining the anthocyanin profile of grapes at different stages of maturity is important for understanding the phenolic changes that occur during grape berry development [ 34 ]. Anthocyanins monomers, delphinidin-3-glucoside, cyanidin-3-glucoside, petunidin-3-glucoside, peonidin-3-glucoside, and malvidin-3-glucoside were identified in table grapes of the varieties studied, except for Timco ™ in which the presence of delphinidin-3-glucoside and petunidin-3-glucoside were not detected. In all varieties at harvest time (D4), the majority anthocyanin was peonidin-3-glucoside, followed by malvidin-3-glucoside, in agreement with other authors [ 33 ]. In this study, the content for the two main anthocyanins presented in Crimson Seedless, Timco ™ , and Krissy ™ significantly increased toward the last weeks of ripening. The goal of postharvest storage techniques is to manipulate the metabolism of fruits during storage to extend the shelf life of produce. Postharvest treatments such as low temperatures, high CO 2 concentrations, and controlled and modified atmosphere packaging slow down many metabolic processes, leading to natural deterioration and loss of quality [ 19 ]. However, some of these treatments adversely affect anthocyanin levels, which adversely affect fruit color and nutritional value. Postharvest cold storage is known to activate modulation in a variety of fruits, including table grapes, but may affect anthocyanin biosynthesis, degradation, or both [ 35 ]. During postharvest storage, a decrease in the concentration of the two major anthocyanins was observed for all varieties studied, when comparing the last sampling date (D6) with the technological maturity date (D4). This coincides with other authors [ 29 ], who observed during 60 days of postharvest storage (0–1 ◦ C) the decrease in the anthocyanins delphinidin-3-glucoside, cyanidin-3-glucoside, pelargonidin-3-glucoside, and malvidin-3-glucoside in berries of the table grape cultivar Rishbaba. 2.3. Evolution of Skin Soluble Polysaccharides The plant cell wall is a complex interconnected structure composed of polysaccharides, cell wall proteins, and polyphenols. During fruit ripening and postharvest storage, the chemical composition of cell walls and tissue structures changes, affecting the sensory, chemical, and physical properties of grapes [36,37]. Table 3shows the results of soluble polysaccharides of the skins of the three varieties under study, during ripening and in postharvest storage. These pectin polysaccharides are the building blocks of pectin, which are released from the complex cell wall network by the actions of various types of endogenous and exogenous enzymes during ripening [ 37 ]. During ripening, the berry undergoes many compositional changes that affect the final chemical composition and overall polysaccharide profile at harvest and affect the firmness during and throughout the ripening period of the berry [38,39]. Large changes in specific polysaccharide components and in protein content are observed during softening and ripening [ 40 ]. Fasori et al. [ 41 ] reported that the most prominent changes in the grape skins from the ripening stage to mid-ripening to full ripeness were due to the modification of hemicellulose and pectin in the inner layer, mainly the modification of cellulose (pectin was more less) in the epidermal layer. Pectin depolymerization and solubilization correlates with skin wall swelling, leading to the conclusion that pectin depolymerization and de-esterification are key processes leading to increased cell wall porosity and the softening of fruit during ripening. Plants 2023,12, 2488 7 of 21 Table 3. Skin soluble polysaccharides (mg of pectin/g of skins) according to molecular mass distribution: F1 > 500 KDa, F2: 500–35 KDa, F3: 35–5 KDa. Variable 1Cultivar Period before Harvest Period Postharvest Sampling Dates: 30 January 2018 (D1) 12 February 2018 (D2) 26 February 2018 (D3) 9 March 2018 (D4) 2 May 2018 (D5) 25 June 2018 (D6) F1 (mg/g of skins) Crimson 134.1 ±12.4 bc 161.1 ±12.2 bc 164.4 ±109.5 c 81.3 ±4.8 ab 79 ±52.8 ab 25.1 ±9.8 a Timco™ ND ND ND 13 ±1.4 a 20.5 ±4.2 ab 22.3 ±5.4 b Krissy™ 23.2 ±4.9 ab 24.7 ±16.1 b 16.6 ±3.8 ab 15.7 ±1.8 ab 9.4 ±1.2 a 12.9 ±4 ab F2 (mg/g of skins) Crimson 354.5 ±35.9 c 374 ±17.1 c 308.3 ±21.6 c 281.7 ±16.7 bc 127.3 ±44.6 a 163.1 ±4 ab Timco™ 179.7 ±38.4 b 118.8 ±14.7 a 113.5 ±43.9 a 209.5 ±8.2 b 209.2 ±36.9 b 206.1 ±33.9 b Krissy™ 153.6 ±26.9 ab 123.7 ±26.6 ab 129.4 ±11.0 ab 159.8 ±24.7 b 113.7 ±14.6 a 147.1 ±24.5 ab F3 (mg/g of skins) Crimson 266.7 ±3.1 c 297.8 ±29.9 cd 320.4 ±10 d 147.4 ±15.7 b 71.8 ±28 a 101.6 ±10.7 a Timco™ 173.9 ±82.4 b 89.1 ±6.7 a 59.7 ±29.6 d 98.7 ±15.5 a 97.4 ±7.7 a 109.9 ±14.7 ab Krissy™ 227.9 ±40.4 c 185.4 ±79.3 bc 116.9 ±25.0 ab 119.4 ±16.3 ab 84.7 ±11.2 a 116.9 ±16.4 ab Total polysaccharides (mg/g of skins) Crimson 755.3 ±30.3 c 832.8 ±50.1 c 793.1 ±335.4 c 510.4 ±14.4 b 278.1 ±119.1 a 289.8 ±23.1 a Timco™ 353.6 ±118.9 c 207.9 ±12.2 ab 173.2 ±73.5 a 321.2 ±11.9 bc 327.1 ±40.8 bc 338.3 ±53.8 c Krissy™ 404.7 ±59.3 c 333.8 ±83.6 bc 262.8 ±32 ab 294.9 ±38.7 ab 207.8 ±24.7 a 276.9 ±42.7 ab 1 Different letters within a row indicate statistical differences among sampling points (p< 0.05, Tukey post hoc test) for the same variable and cultivar. Results are expressed as pectin equivalents. Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. In all varieties, a decrease in total polysaccharides was observed during ripening (Table 3), which in technological maturity (D4) reached values in a range of 510.4 mg/g for Crimson Seedless and 294.9 mg/g for Krissy ™ . These results agree with what was observed by Ortega-Regules et al. [ 42 ], who reported that different grape cultivars undergo different changes in their polysaccharide profiles during ripening and there is no change in arabinose concentration. Rhamnose, however, was more varied, either increasing, remaining constant, or decreasing slightly depending on the cultivar, which can explain the different evolution in certain fractions of polysaccharides. At commercial harvest, the fraction of polysaccharides with the highest concentration corresponded to F2 (molecular mass between 500 and 35 KDa), followed by F3 (molecular mass from 35 to 5 KDa) and finally, F1 (molecular mass greater than > 500 KDa). This coincided with what was observed by Gil et al. [ 43 ], who reported that the total concentration of medium to low molecular weight polysaccharides in Cabernet Sauvignon cultivar grapes increased with greater grape maturity. Timco ™ and Krissy ™ presented a similar behavior (without statistical differences between D1 and D4). On the contrary, Crimson Seedless presented a decrease in this fraction. 2.4. Mechanical Behavior of Red Table Grape Varieties Crimson, Timco™, and Kryssy™ during Ripening and Extended Cold Storage Period Texture is an important factor in determining the quality of table grapes for fresh consumption. Berry firmness is considered a measurement of its freshness [44]. Texture includes all physical properties perceived through contact that are related to deformation when a force is applied that can be objectively measured in terms of force, distance, and time [ 45 ]. These mechanical variables are correlated with several sensory attributes and thus indirectly with consumer acceptability of products [7,8]. Sensory characteristics such as skin thickness and friability and flesh firmness are suggested to differentiate commercial table grape cultivars [ 46 ]. Nevertheless, there are few descriptions of the physical–mechanical parameters of table grapes in the literature, and only a few reports are available on varietal differences in the mechanical properties of grape texture. The results of the mechanical behavior of red table grape varieties Crimson, Timco ™ , and Kryssy ™ , during ripening and an extended cold storage period are presented below (Figures 1–4). Plants 2023,12, 2488 8 of 21 Plants 2023, 12, x FOR PEER REVIEW 8 of 22 Texture includes all physical properties perceived through contact that are related to deformation when a force is applied that can be objectively measured in terms of force, distance, and time [45]. These mechanical variables are correlated with several sensory attributes and thus indirectly with consumer acceptability of products [7,8]. Sensory characteristics such as skin thickness and friability and flesh firmness are suggested to differentiate commercial table grape cultivars [46]. Nevertheless, there are few descriptions of the physical–mechanical parameters of table grapes in the literature, and only a few reports are available on varietal differences in the mechanical properties of grape texture. The results of the mechanical behavior of red table grape varieties Crimson, Timco TM , and Kryssy TM , during ripening and an extended cold storage period are presented below (Figures 1–4). Figure 1. Two-dimensional plot of the two first principal components in PCA of the cultivars studied (Crimson Seedless, Timco™, Krissy™). Mechanical variables in yellow diamond (maximum force, maximum force area, lineal distance, Young’s modulus, final force, numbers of peaks, and total areas) and observation (variety:date) in dots. Figure 2. Maximum Force of three red table grapes at six different sampling dates. Standard error is shown for each parameter (n = 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after Figure 1. Two-dimensional plot of the two first principal components in PCA of the cultivars studied (Crimson Seedless, Timco ™ , Krissy ™ ). Mechanical variables in yellow diamond (maximum force, maximum force area, lineal distance, Young’s modulus, final force, numbers of peaks, and total areas) and observation (variety:date) in dots. Plants 2023, 12, x FOR PEER REVIEW 8 of 22 Texture includes all physical properties perceived through contact that are related to deformation when a force is applied that can be objectively measured in terms of force, distance, and time [45]. These mechanical variables are correlated with several sensory attributes and thus indirectly with consumer acceptability of products [7,8]. Sensory characteristics such as skin thickness and friability and flesh firmness are suggested to differentiate commercial table grape cultivars [46]. Nevertheless, there are few descriptions of the physical–mechanical parameters of table grapes in the literature, and only a few reports are available on varietal differences in the mechanical properties of grape texture. The results of the mechanical behavior of red table grape varieties Crimson, Timco TM , and Kryssy TM , during ripening and an extended cold storage period are presented below (Figures 1–4). Figure 1. Two-dimensional plot of the two first principal components in PCA of the cultivars studied (Crimson Seedless, Timco™, Krissy™). Mechanical variables in yellow diamond (maximum force, maximum force area, lineal distance, Young’s modulus, final force, numbers of peaks, and total areas) and observation (variety:date) in dots. Figure 2. Maximum Force of three red table grapes at six different sampling dates. Standard error is shown for each parameter (n = 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after Figure 2. Maximum Force of three red table grapes at six different sampling dates. Standard error is shown for each parameter (n= 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Principal components analysis (PCA) was performed to better understand the differences among grapes according to the cultivar, physical, and mechanical parameters (Figure 1). From the loadings of selected variables (prerupture variable: Young’s modulus of elasticity of the skin; at rupture: maximum force, maximum force area; postrupture variables: number of peaks, final force, final force area, and lineal distance.). PC1 (56.50% total variance) was most highly correlated with skin mechanical properties such as lineal distance, Young’s modulus of the skin, final force, number of peaks, and total areas. PC2 (34.90% total variance) was most correlated with the maximum force and maximum force area. Plants 2023,12, 2488 9 of 21 Plants 2023, 12, x FOR PEER REVIEW 9 of 22 veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Figure 3. Young’s Modulus of three red table grapes in six different sampling dates. Standard error is shown for each parameter (n = 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Figure 4. Peak numbers of three red table grapes in six different sampling dates. Standard error is shown for each parameter (n = 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Principal components analysis (PCA) was performed to better understand the differences among grapes according to the cultivar, physical, and mechanical parameters (Figure 1). From the loadings of selected variables (prerupture variable: Young’s modulus of elasticity of the skin; at rupture: maximum force, maximum force area; postrupture variables: number of peaks, final force, final force area, and lineal distance.). PC1 (56.50% total variance) was most highly correlated with skin mechanical properties such as lineal distance, Young’s modulus of the skin, final force, number of peaks, and total areas. PC2 (34.90% total variance) was most correlated with the maximum force and maximum force area. Figure 3. Young’s Modulus of three red table grapes in six different sampling dates. Standard error is shown for each parameter (n= 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Plants 2023, 12, x FOR PEER REVIEW 9 of 22 veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Figure 3. Young’s Modulus of three red table grapes in six different sampling dates. Standard error is shown for each parameter (n = 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Figure 4. Peak numbers of three red table grapes in six different sampling dates. Standard error is shown for each parameter (n = 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Principal components analysis (PCA) was performed to better understand the differences among grapes according to the cultivar, physical, and mechanical parameters (Figure 1). From the loadings of selected variables (prerupture variable: Young’s modulus of elasticity of the skin; at rupture: maximum force, maximum force area; postrupture variables: number of peaks, final force, final force area, and lineal distance.). PC1 (56.50% total variance) was most highly correlated with skin mechanical properties such as lineal distance, Young’s modulus of the skin, final force, number of peaks, and total areas. PC2 (34.90% total variance) was most correlated with the maximum force and maximum force area. Figure 4. Peak numbers of three red table grapes in six different sampling dates. Standard error is shown for each parameter (n= 50). Sampling along harvest: D1, veraison; D2, 12 DAV (days after veraison); D3, 26 DAV; D4, 37 DAV. Sampling along storage: D5, 54 DOS (days of storage); D6, 108 DOS. Based on these results, the skin mechanical properties of table grapes were good parameters for differentiating varieties. Hence, they might be used to advantage as varietal markers, since these parameters are also little influenced by the ripening stage of the grape, as has been demonstrated for wine grapes [47]. The maximum force (firmness), began to decrease from the sampling date two for the three varieties. However, during the cold storage period after harvest, Timco ™ and Kryssy ™ maintained their firmness while it strongly decreased in Crimson Seedless ( Figure 2 ). During the maturation period, these results coincide with those of Conner [ 48 ] for the germplasm of the Muscadine variety. According to the results of that author, the firmness was found to decline with increasing maturity and storage times, as was observed in the case of Crimson Seedless. Young’s modulus is a measure of the elasticity (rigidity) of the skin. A low Young’s modulus represents a berry with low turgidity [ 48 ]. Timco ™ and Kryssy ™ tended to maintain their turgor, whereas Crimson Seedless was strongly affected by a long cold Plants 2023,12, 2488 16 of 21 Table 4. Cont. Gene Abv Accession Sense Sequence (50→30) Amplicon (bp) Tm (◦C) Efficiency XET2 AY043238.1 Forward AGCCTGTGGAATGCGGATGACT 121 61.45 1.98 Reverse CCACTGAAGCCTCACACCCATC PME NM_001281162.1 Forward GTGATGCCACGGTGGTCTTCCA 85 62.8 1.96 Reverse CCTTGGGCGGTGATGGTGTTCT GRIP28 NM_001281212.1 Forward GCAGTTGGCTCACACCGCTTTG 125 62.4 2.05 Reverse AACAGTCCTGAACCGCCTCCAA F30H NM_001280987.1 Forward AGGAGGAGGTTGCGGTGCTAAC 132 62.3 1.98 Reverse CGCCGAACACTCTCCTGCCTAA F3050H NM_001281235.1 Forward TCCATCGCATGGCTGGACATCC 101 62.55 1.93 Reverse GCCGTGTGCTCCTCCATCATCT UFGT AF000372.1 Forward TCAGGCGGAGGTCCTAGCACAT 81 62.3 2.11 Reverse GCCACGCTTTCCCACAATGAGT ACT XM_002282480.4 Forward GGCTGGATTTGCGGGTGATGAT 80 61.5 1.97 Reverse CCATGACACCAGTGTGCCTTGG AIG1 XM_002281960.4 Forward GCACGGCTGAAGGCAGAAGAGA 104 62.4 1.99 Reverse TCCGTCTCCCTCTGTGCTCTCT GADPH XM_002263109.3 Forward AGGCTGGAGAAGGCTGCTACCT 139 62.4 1.89 Reverse TGCTGGACCTGTTGTCACCGAT 3.7.2. RNA Extraction from Grape Skin and cDNA Synthesis RNA extraction was performed from grapes previously stored at − 80 ◦ C. The skins were peeled with fresh, sterile razor blades, immersed in liquid nitrogen in a mortar, and immediately pulverized with a pistil until a fine powder was achieved. RNA was extracted following the sodium perchlorate method [ 55 ], with some modifications. The still cold fine powder was transferred to a 50 mL falcon tube and slowly added to 15 mL of the extraction buffer which contained sodium perchlorate 5 M, Tris 0.3 M pH 8.3, SDS 1%, PEG 20000 2%, PVPP 8.5%, and 2-mercaptoethanol 2%. The extract was vortexed for 45 s and stored at − 20 ◦ C for 45 min. The extract was then passed through a syringe containing glass wool and a 0.45 um PVDF filter at the base by centrifuging at 1500 × gfor 5 min at 4 ◦ C. The eluate was then vortexed with 1.5 vol. of 100% cold ethanol, allowed to precipitate for 30 min at − 20 ◦ C, and then centrifuged at 1500 × gfor 45 min at 4 ◦ C. Then, the supernatant was discarded and 2 mL of Tris 10 mM with EDTA 1 mM pH 7.5 was added to the precipitate. The aqueous phase was recovered after each addition of 1 vol. of phenol, chloroform, and isoamyl alcohol (25:24:21) and 1 vol. of chloroform: isoamyl alcohol (24:1) to the above solution. To the aqueous solution was added 0.1 vol of sodium acetate 3 M pH 5.2 and 2 vol. of 80% cold ethanol and the genetic material was allowed to precipitate for 2 h at − 20 ◦ C and then centrifuged at 12,500 × gfor 30 min at 4 ◦ C. Subsequently, the supernatant was discarded, then 1 mL of 80% cold ethanol was added to the precipitate which was then sedimented, rinsed, and dried. Subsequently, the supernatant was discarded, 1 mL of cold 80% ethanol was added to the resulting precipitate, and then centrifuged at 10,000 × gfor 10 min at 4 ◦ C, and then the supernatant was discarded again and allowed to dry. The pellet was resuspended in nuclease-free water, 0.25 vol of LiCl 2 10 M was added, and the RNA precipitate was kept overnight at 4 ◦ C. The pellet was cleaned twice with 80% cold ethanol, resuspended with 40 µ L nuclease-free water, and treated with recombinant DNase I (Roche, Mannheim, Germany), following the manufacturer’s instructions. Quality and quantity of resultant RNA was assessed through electrophoretic bleach-gel technique [ 82 ] and spectrophotometry (OD 260/280). The cDNA synthesis was performed with 1 ug of RNA, which was then reverse transcribed using the SuperScript ™ IV First-Strand cDNA Synthesis Reaction kit (Thermo Fisher Scientific, Carlsbad, California, United States), following the manufacturer’s protocol. Plants 2023,12, 2488 17 of 21 3.7.3. Gene Expression Analysis by qPCR Gene expression analysis was performed by the Lightcycler ™ 96 system (Roche Diagnostics, Mannheim, Germany) and using FastStart Essential DNA Green Master kit (Roche Diagnostics, Mannheim, Germany), following the manufacturer’s protocols. The mixture for the qPCR reaction was 0.5 µ M of each primer, a 1:50 dilution of the cDNA, and the master mix in a final reaction volume of 20 µ L. Amplification curves analysis was performed by the LightCycler ® 96 software (Roche Diagnostics, Mannheim, Germany) and the purity of the amplified products was confirmed by melting curve analysis. Each sampling date had 3 biological replicates and 3 technical replicates for each grape variety. To obtain the relative expression of each gene, five 10-fold serial dilutions were assessed to calculate the amplification efficiency according to (1), where E is the efficiency for each primer and m is the slope between serial dilutions and the threshold cycle (Cq). E=10(−1 m)−1 (1) The efficiencies for each primer were summarized in Table 4, and these values were used to obtain the relative expression of each gene of interest (GOI) with respect to their reference genes (R) following the expression (2). To obtain the relative expression and follow their evolution through time, the Cq of GOI and reference genes were referenced to the Cq mean value of each gene from the Crimson variety at the first sampling date. relative expression =E−(CqGOI−CqGOICal) GOI n q∏n i=1E−(CqRi−CqRiCal) Ri (2) 3.8. Statistical Analyses Data analysis was performed using InfoStat (version 2017p, FCA-Universidad Nacional de Córdaba, Argentina). Means were compared using ANOVA and post hoc test (Tukey) ( α = 0.05). All tests met the assumption of residual normality. Gene expression analyses for each sampling date were evaluated by ANOVA analysis, testing the assumptions of normality and homogeneity of variance. Means were subjected to post hoc Tukey analysis when p-values were less than 0.05. 4. Conclusions Determining the optimum harvest time is a significant factor affecting the quality of table grapes. Monitoring the evolution of grapes’ physicochemical properties, phenolic, and polysaccharidic composition and texture properties during ripening could be a valuable tool for determining the optimum harvest time to ensure optimal postharvest conditions and market acceptability. The market is looking for grapes with a superior size, condition, and taste and has been introducing new varieties from several national and international breeding programs, such as Timco ™ and Krissy ™ , that are replacing popular grape varieties, such as Crimson Seedless. According to the results, phenolic compounds from skins were present in very different proportions among the varieties studied. The total anthocyanins responsible for the color of the skins increased during ripening and the majority individual anthocyanins in the three varieties was peonidin-3-glucoside, followed by malvidin-3-glucoside. The phenolic compounds presented a different behavior (decreasing or increasing) during postharvest. The total skin soluble polysaccharides decreased during ripening and postharvest in Crimson Seedless and Kryssy ™ and remained constant from technological maturity to postharvest storage in Timco ™ . In all varieties, the majority soluble polysaccharide fraction was that with a molecular mass between 500 and 35 KDa (F2). The skin mechanical properties of table grapes were good parameters for differentiating varieties, with better results for the new varieties Timco ™ and Kryssy ™ , compared to the traditional variety Crimson Seedless, especially postharvest. For this work, Timco ™ was the crispiest variety whereas Crimson Seedless’ peak counts decreased Plants 2023,12, 2488 18 of 21 dramatically after cold storage. Timco ™ and Kryssy ™ tended to maintain their turgor, whereas Crimson was strongly affected by a long cold storage. The firmness began to decrease early during ripening for the three varieties; however, at the cold storage period, Timco ™ and Kryssy ™ maintained their firmness while it strongly decreased in Crimson. The cell wall metabolism gene expression profiles followed similar trends in exocarp tissues throughout berry development in all the varieties studied. Similar results were observed for genes involved in the phenylpropanoid pathway. These results may position the Timco ™ and Kryssy ™ varieties as a very good alternative and competitor to Crimson Seedless, which is currently one of the table grape cultivars in Chile with a high commercial demand. Author Contributions: Conceptualization, A.P.-N., M.G.i.C. and L.V.; methodology, C.G. and L.V.; data curation, M.G.i.C. and A.P.-N.; writing—original draft preparation, A.P.-N. and L.C.; writing—review and editing, C.U., M.G.i.C., C.P., L.V., R.I. and A.P.-N.; funding acquisition, A.P.-N. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by ANID-Chile [FONDECYT 1181142, FONDEQUIP EQM130129 projects]. Data Availability Statement: The data is contained within the manuscript. Acknowledgments: The authors are grateful to the GESEX fruit Exporter Company for providing the commercial vineyards and the postharvest storage cold chambers, for the trials of this study. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of the data; in the writing of the manuscript; or in the decision to publish the results. References 1. Coombe, B.G. Relationship of Growth and Development to Changes in Sugars, Auxins, and Gibberellins in Fruit of Seeded and Seedless Varieties of Vitis vinifera.Plant Physiol. 1960,35, 241–250. [CrossRef] [PubMed] 2. Coombe, B.G. Research on Development and Ripening of the Grape Berry. Am. J. Enol. Vitic. 1992,43, 101–110. [CrossRef] 3. Robinson, S.P.; Davies, C. Molecular Biology of Grape Berry Ripening. Aust. J. Grape Wine Res. 2000,6, 175–188. [CrossRef] 4. Brummell, D.A.; Harpster, M.H. Cell Wall Metabolism in Fruit Softening and Quality and Its Manipulation in Transgenic Plants. Plant Mol. Biol. 2001,47, 311–339. [CrossRef] 5. Seccia, A.; Viscecchia, R.; Nardone, G. Table Grapes as Functional Food: Consumer Preferences for Health and Environmental Attributes. BIO Web Conf. 2019,15, 03011. [CrossRef] 6. Jayasena, V.; Cameron, I. ◦ Brix/Acid Ratio as a Predictor of Consumer Acceptability of Crimson Seedless Table Grapes. J. Food Qual. 2008,31, 736–750. [CrossRef] 7. Rolle, L.; Siret, R.; Segade, S.R.; Maury, C.; Gerbi, V.; Jourjon, F. Instrumental Texture Analysis Parameters as Markers of Table-Grape and Winegrape Quality: A Review. Am. J. Enol. Vitic. 2012,63, 11–28. [CrossRef] 8. Abbott, J.A. Quality Measurement of Fruits and Vegetables. Postharvest Biol. Technol. 1999,15, 207–225. [CrossRef] 9. Balic, I.; Ejsmentewicz, T.; Sanhueza, D.; Silva, C.; Peredo, T.; Olmedo, P.; Barros, M.; Verdonk, J.C.; Paredes, R.; Meneses, C.; et al. Biochemical and Physiological Study of the Firmness of Table Grape Berries. Postharvest Biol. Technol. 2014 ,93, 15–23. [CrossRef] 10. Peppi, M.C.; Fidelibus, M.W.; Dokoozlian, N. Abscisic Acid Application Timing and Concentration Affect Firmness, Pigmentation, and Color of ‘Flame Seedless’ Grapes. HortScience 2006,41, 1440–1445. [CrossRef] 11. Shahab, M.; Roberto, S.R.; Ahmed, S.; Colombo, R.C.; Silvestre, J.P.; Koyama, R.; de Souza, R.T. Relationship between Anthocyanins and Skin Color of Table Grapes Treated with Abscisic Acid at Different Stages of Berry Ripening. Sci. Hortic. 2020 ,259, 108859. [CrossRef] 12. Yang, J.; Martinson, T.E.; Liu, R.H. Phytochemical Profiles and Antioxidant Activities of Wine Grapes. Food Chem. 2009 ,116, 332–339. [CrossRef] 13. Cid, P.; García, M.; Pinolef, A.; Barba, P. Phenotyping Tools for Genetic Improvement of Table Grapes in Chile. Acta Hortic. 2019 , 1248, 267–274. [CrossRef] 14. Eurofresh. Chile’s Table Grape Exports to Rise by 29%. 2021. Available online: www.eurofresh-distribution.com/news/chilestable-grape-exports-to-rise-by-29/ (accessed on 26 December 2022). 15. Eurofresh. Chile’s Grape Exports Remain Stable Despite Drought. 2020. Available online: www.eurofresh-distribution.com/ news/chiles-grape-exports-remain-stable-despite-drought (accessed on 17 September 2022). 16. Reynolds, A.; Wardle, D.; Zurowski, C.; Looney, N. Phenylureas, CPPU and thidiazuron affect yield components, fruit composition, and storage potential of four seedless grape selections. J. Am. Soc. Hort. Sci. 1992,117, 85–89. [CrossRef] 17. Brewer, M.S. Natural Antioxidants: Sources, Compounds, Mechanisms of Action, and Potential Application. Compr. Rev. Food Sci. Food Saf. 2011,10, 195–247. [CrossRef] Plants 2023,12, 2488 19 of 21 18. Gallo, V.; Mastrorilli, P.; Cafagna, I.; Nitti, G.; Latronico, M.; Longobardi, F.; Minoja, A.P.; Napoli, C.; Romito, V.; Schäfer, H.; et al. Effects of agronomical practices on chemical composition of table grapes evaluated by NMR spectroscopy. J. Food Comp. Anal. 2014,35, 44–52. [CrossRef] 19. Deng, Y.; Wu, Y.; Li, Y. Effects of High O 2 Levels on Post-Harvest Quality and Shelf Life of Table Grapes during Long-Term Storage. Eur. Food Res. Technol. 2005,221, 392–397. [CrossRef] 20. Lago-Vanzela, E.S.; Da-Silva, R.; Gomes, E.; García-Romero, E.; Hermosín-Gutiérrez, I. Phenolic Composition of the Brazilian Seedless Table Grape Varieties BRS Clara and BRS Morena. J. Agric. Food Chem. 2011,59, 8314–8323. [CrossRef] 21. Zhang, L.; Li, X.; Pang, Y.; Cai, X.; Lu, J.; Ren, X.; Kong, Q. Phenolics composition and contents, as the key quality parameters of table grapes, may be influenced obviously and differently in response to short-term high temperature. LWT 2021 ,149, 111791. [CrossRef] 22. Sheng, K.; Zheng, H.; Shui, S.; Yan, L.; Liu, C.; Zheng, L. Comparison of Postharvest UV-B and UV-C Treatments on Table Grape: Changes in Phenolic Compounds and Their Transcription of Biosynthetic Genes during Storage. Postharvest Biol. Technol. 2018 , 138, 74–81. [CrossRef] 23. Xie, S.; Liu, Y.; Chen, H.; Zhang, Z.; Ge, M. Anthocyanin degradation and the underlying molecular mechanism in a red-fleshed grape variety. LWT 2021,151, 112198. [CrossRef] 24. Nia, A.E.; Taghipour, S.; Siahmansou, S. Pre-harvest application of chitosan and postharvest Aloe vera gel coating enhances quality of table grape (Vitis vinifera L. cv. ‘Yaghouti’) during postharvest period. Food Chem. 2021,347, 129012. [CrossRef] 25. Downey, M.; Mazza, M.; Seddon, T.J.; Rochfort, S.; Millikan, M. Variation in Condensed Tannin Content, Composition and Polymer Length Distribution in the Skin of 36 Grape Cultivars. Curr. Bioact. Compd. 2012,8, 200–217. [CrossRef] 26. Watrelot, A.; Norton, E. Chemistry and Reactivity of Tannins in Vitis spp.: A Review. Molecules 2020 ,25, 2110. [CrossRef] [PubMed] 27. Downey, M.O.; Harvey, J.S.; Robinson, S.P. Synthesis of Flavonols and Expression of Flavonol Synthase Genes in the Developing Grape Berries of Shiraz and Chardonnay (Vitis vinifera L.). Aust. J. Grape Wine Res. 2003,9, 110–121. [CrossRef] 28. Bogs, J.; Downey, M.O.; Harvey, J.S.; Ashton, A.R.; Tanner, G.J.; Robinson, S.P. Proanthocyanidin Synthesis and Expression of Genes Encoding Leucoanthocyanidin Reductase and Anthocyanidin Reductase in Developing Grape Berries and Grapevine Leaves. Plant Physiol. 2005,139, 652–663. [CrossRef] 29. Eshghi, S.; Karimi, R.; Shiri, A.; Karami, M.; Moradi, M. Effects of polysaccharide-based coatings on postharvest storage life of grape: Measuring the changes in nutritional, antioxidant and phenolic compounds. J. Food Meas. Charact. 2022 ,16, 1159–1170. [CrossRef] 30. Razungles, A.; Bayonove, C.L.; Cordonnier, R.E.; Sapis, J.C. Grape Carotenoids: Changes During the Maturation Period and Localization in Mature Berries. Am. J. Enol. Vitic. 1988,39, 44–48. [CrossRef] 31. Doshi, P.; Adsule, P.; Banerjee, K. Phenolic Composition and Antioxidant Activity in Grapevine Parts and Berries (Vitis vinifera L.) Cv. Kishmish Chornyi (Sharad Seedless) during Maturation. Int. J. Food Sci. Technol. 2006,41, 1–9. [CrossRef] 32. Benbouguerra, N.; Richard, T.; Saucier, C.; Garcia, F. Voltammetric Behavior, Flavanol and Anthocyanin Contents, and Antioxidant Capacity of Grape Skins and Seeds during Ripening (Vitis vinifera Var. Merlot, Tannat, and Syrah). Antioxidants 2020 ,9, 800. [CrossRef] 33. Nicolosi, E.; Ferlito, F.; Amenta, M.; Russo, T.; Rapisarda, P. Changes in the Quality and Antioxidant Components of Minimally Processed Table Grapes during Storage. Sci. Hortic. 2018,232, 175–183. [CrossRef] 34. Downey, M.O.; Dokoozlian, N.K.; Krstic, M.P. Cultural Practice and Environmental Impacts on the Flavonoid Composition of Grapes and Wine: A Review of Recent Research. Am. J. Enol. Vitic. 2006,57, 257–268. [CrossRef] 35. De Pascual-Teresa, S.; Sanchez-Ballesta, M.T. Anthocyanins: From Plant to Health. Phytochem. Rev. 2008,7, 281–299. [CrossRef] 36. Albersheim, P.; Darvill, A.; Roberts, K.; Sederoff, R.; Staehelin, A. Plant Cell Walls. From Chemistry to Biology. Ann. Bot. 2011 , 108, viii–ix. [CrossRef] 37. Guadalupe, Z.; Ayestarán, B.; Williams, P.; Doco, T. Determination of Must and Wine Polysaccharides by Gas ChromatographyMass Spectrometry (GC-MS) and Size-Exclusion Chromatography (SEC). In Polysaccharides; Springer International Publishing: Cham, Switzerland, 2015; pp. 1–28. 38. Garrido-Bañuelos, G.; Buica, A.; Schückel, J.; Zietsman, A.J.J.; Willats, W.G.T.; Moore, J.P.; Du Toit, W.J. Investigating the Relationship between Grape Cell Wall Polysaccharide Composition and the Extractability of Phenolic Compounds into Shiraz Wines. Part I: Vintage and Ripeness Effects. Food Chem. 2019,278, 36–46. [CrossRef] 39. Nunan, K.J.; Sims, I.M.; Bacic, A.; Robinson, S.P.; Fincher, G.B. Changes in Cell Wall Composition during Ripening of Grape Berries. Plant Physiol. 1998,118, 783–792. [CrossRef] 40. Nunan, K.J.; Davies, C.; Robinson, S.P.; Fincher, G.B. Expression Patterns of Cell Wall-Modifying Enzymes during Grape Berry Development. Planta 2001,214, 257–264. [CrossRef] 41. Fasoli, M.; Dell’Anna, R.; Dal Santo, S.; Balestrini, R.; Sanson, A.; Pezzotti, M.; Monti, F.; Zenoni, S. Pectins, Hemicelluloses and Celluloses Show Specific Dynamics in the Internal and External Surfaces of Grape Berry Skin During Ripening. Plant Cell Physiol. 2016,57, 1332–1349. [CrossRef] 42. Ortega-Regules, A.; Ros-García, J.M.; Bautista-Ortín, A.B.; López-Roca, J.M.; Gómez-Plaza, E. Changes in Skin Cell Wall Composition during the Maturation of Four Premium Wine Grape Varieties. J. Sci. Food Agric. 2008,88, 420–428. [CrossRef] Plants 2023,12, 2488 20 of 21 43. Gil, M.; Quiros, M.; Fort, F.; Morales, P.; Gonzalez, R.; Canals, J.-M.; Zamora, F. Influence of Grape Maturity and Maceration Length on Polysaccharide Composition of Cabernet Sauvignon Red Wines. Am. J. Enol. Vitic. 2015,66, 393–397. [CrossRef] 44. Vargas, A.; Perez, J.; Pablo Zoffoli, J.; Perez, A. Evolution of the Texture in Thompson Seedless Berries. Cien. Investig. Agric. 2001 , 27, 117–126. [CrossRef] 45. Letaief, H.; Rolle, L.; Zeppa, G.; Gerbi, V. Assessment of Grape Skin Hardness by a Puncture Test. J. Sci. Food Agric. 2008 ,88, 1567–1575. [CrossRef] 46. Cliff, M.A.; Dever, M.C.; Reynolds, A.G. Descriptive Profiling of New and Commercial British Columbia Table Grape Cultivars. Am. J. Enol. Vitic. 1996,47, 301–308. [CrossRef] 47. Torchio, F.; Cagnasso, E.; Gerbi, V.; Rolle, L. Mechanical Properties, Phenolic Composition and Extractability Indices of Barbera Grapes of Different Soluble Solids Contents from Several Growing Areas. Anal. Chim. Acta 2010 ,660, 183–189. [CrossRef] [PubMed] 48. Conner, P.J. Instrumental Textural Analysis of Muscadine Grape Germplasm. HortScience 2013,48, 1130–1134. [CrossRef] 49. Zouid, I.; Siret, R.; Mehinagic, E.; Maury, C.; Chevalier, M.; Jourjon, F. Evolution of Grape Berries during Ripening: Investigations into the Links between Their Mechanical Properties and the Extractability of Their Skin Anthocyanins. OENO One 2010 ,44, 87. [CrossRef] 50. Maury, C.; Madieta, E.; Le Moigne, M.; Mehinagic, E.; Siret, R.; Jourjon, F. Development of a Mechanical Texture Test to Evaluate the Ripening Process of Cabernet Franc Grapes. J. Texture Stud. 2009,40, 511–535. [CrossRef] 51. Van Hecke, E.; Allaf, K.; Bouvier, J.M. Texture and Structure of Crispy-Puffed Food Products Part Ii: Mechanical Properties in Puncture. J. Texture Stud. 1998,29, 617–632. [CrossRef] 52. Roudaut, G.; Dacremont, C.; Vallès Pàmies, B.; Colas, B.; Le Meste, M. Crispness: A Critical Review on Sensory and Material Science Approaches. Trends Food Sci. Technol. 2002,13, 217–227. [CrossRef] 53. Bourne, M.C. Practice of Objective Texture Measurement. In Food Texture and Viscosity; Academic Press: New York, NY, USA, 1982; pp. 118–198. 54. Saeleaw, M.; Schleining, G. A Review: Crispness in Dry Foods and Quality Measurements Based on Acoustic–Mechanical Destructive Techniques. J. Food Eng. 2011,105, 387–399. [CrossRef] 55. Boss, P.K.; Davies, C.; Robinson, S.P. Analysis of the Expression of Anthocyanin Pathway Genes in Developing Vitis Vinifera L. Cv Shiraz Grape Berries and the Implications for Pathway Regulation. Plant Physiol. 1996,111, 1059–1066. [CrossRef] 56. Nakatsuka, T.; Nishihara, M.; Mishiba, K.; Yamamura, S. Temporal Expression of Flavonoid Biosynthesis-Related Genes Regulates Flower Pigmentation in Gentian Plants. Plant Sci. 2005,168, 1309–1318. [CrossRef] 57. Kobayashi, S.; Goto-Yamamoto, N.; Hirochika, H. Association of VvmybA1 Gene Expression with Anthocyanin Production in Grape (Vitis vinifera) Skin-Color Mutants. J. Jpn. Soc. Hortic. Sci. 2005,74, 196–203. [CrossRef] 58. Nakajima, J.; Tanaka, Y.; Yamazaki, M.; Saito, K. Reaction Mechanism from Leucoanthocyanidin to Anthocyanidin 3-Glucoside, a Key Reaction for Coloring in Anthocyanin Biosynthesis. J. Biol. Chem. 2001,276, 25797–25803. [CrossRef] 59. Castellarin, S.D.; Di Gaspero, G. Transcriptional Control of Anthocyanin Biosynthetic Genes in Extreme Phenotypes for Berry Pigmentation of Naturally Occurring Grapevines. BMC Plant Biol. 2007,7, 46. [CrossRef] 60. Castellarin, S.D.; Gambetta, G.A.; Wada, H.; Shackel, K.A.; Matthews, M.A. Fruit Ripening in Vitis vinifera: Spatiotemporal Relationships among Turgor, Sugar Accumulation, and Anthocyanin Biosynthesis. J. Exp. Bot. 2011,62, 4345–4354. [CrossRef] 61. Glissant, D.; Dédaldéchamp, F.; Delrot, S. Transcriptomic Analysis of Grape Berry Softening during Ripening. OENO One 2008 , 42, 1. [CrossRef] 62. Terrier, N.; Glissant, D.; Grimplet, J.; Barrieu, F.; Abbal, P.; Couture, C.; Ageorges, A.; Atanassova, R.; Léon, C.; Renaudin, J.-P.; et al. Isogene Specific Oligo Arrays Reveal Multifaceted Changes in Gene Expression during Grape Berry (Vitis vinifera L.) Development. Planta 2005,222, 832–847. [CrossRef] 63. Barnavon, L.; Doco, T.; Terrier, N.; Ageorges, A.; Romieu, C.; Pellerin, P. Involvement of Pectin Methyl-Esterase during the Ripening of Grape Berries: Partial CDNA Isolation, Transcript Expression and Changes in the Degree of Methyl-Esterification of Cell Wall Pectins. Phytochemistry 2001,58, 693–701. [CrossRef] 64. Shevchik, V.E.; Hugouvieux-Cotte-Pattat, N. PaeX, a Second Pectin Acetylesterase of Erwinia Chrysanthemi 3937. J. Bacteriol. 2003 , 185, 3091–3100. [CrossRef] 65. Lionetti, V.; Raiola, A.; Mattei, B.; Bellincampi, D. The Grapevine VvPMEI1 Gene Encodes a Novel Functional Pectin Methylesterase Inhibitor Associated to Grape Berry Development. PLoS ONE 2015,10, e0133810. [CrossRef] [PubMed] 66. Di Matteo, A.; Giovane, A.; Raiola, A.; Camardella, L.; Bonivento, D.; De Lorenzo, G.; Cervone, F.; Bellincampi, D.; Tsernoglou, D. Structural Basis for the Interaction between Pectin Methylesterase and a Specific Inhibitor Protein. Plant Cell 2005 ,17, 849–858. [CrossRef] [PubMed] 67. Ishimaru, M.; Kobayashi, S. Expression of a Xyloglucan Endo-Transglycosylase Gene Is Closely Related to Grape Berry Softening. Plant Sci. 2002,162, 621–628. [CrossRef] 68. Lijavetzky, D.; Carbonell-Bejerano, P.; Grimplet, J.; Bravo, G.; Flores, P.; Fenoll, J.; Hellín, P.; Oliveros, J.C.; Martínez-Zapater, J.M. Berry Flesh and Skin Ripening Features in Vitis vinifera as Assessed by Transcriptional Profiling. PLoS ONE 2012 ,7, e39547. [CrossRef] 69. Vargas, A.M.; Fajardo, C.; Borrego, J.; De Andrés, M.T.; Ibáñez, J. Polymorphisms in VvPel Associate with Variation in Berry Texture and Bunch Size in the Grapevine. Aust. J. Grape Wine Res. 2013,19, 193–207. [CrossRef] Plants 2023,12, 2488 21 of 21 70. Ahmed, A.E.; Labavitch, J.M. Cell Wall Metabolism in Ripening Fruit. Plant Physiol. 1980,65, 1014–1016. [CrossRef] 71. Rosli, H.G.; Civello, P.M.; Martínez, G.A. Changes in Cell Wall Composition of Three Fragaria x Ananassa Cultivars with Different Softening Rate during Ripening. Plant Physiol. Biochem. 2004,42, 823–831. [CrossRef] 72. Schlosser, J.; Olsson, N.; Weis, M.; Reid, K.; Peng, F.; Lund, S.; Bowen, P. Cellular Expansion and Gene Expression in the Developing Grape (Vitis vinifera L.). Protoplasma 2008,232, 255–265. [CrossRef] 73. Naleway, J.J.; Coleman, D.J.; Hawley, R.M.; Cook, G.M. Cellulase Assay as a Method of Monitoring Grape Ripening. FASEB J. 2008,22, 841.2. [CrossRef] 74. Ubeda, C.; Cortiella, M.G.I.; Villalobos-Gonzalez, L.; Gomez, C.; Pastenes, C.; Peña-Neira, A. Ripening and Storage Time Effects on the Aromatic Profile of New Table Grape Cultivars in Chile. Molecules 2020,25, 5790. [CrossRef] 75. International Organisation of Vine and Wine (OIV). Compedium of International Methods of Wine and Must Analysis, 2022nd OIV ed.; International Organisation of Vine and Wine (OIV): Paris, France, 2022; Volume 1, ISBN 978-2-85038-052-5. 76. Ribéreau-Gayon, P.; Glories, Y.; Maujean, A.; Dubourdieu, D. Phenolic Compounds. In Handbook of Enology, Volume 2: The Chemistry of Wine and Stabilization and Treatments; John Wiley & Sons, Ltd.: Chinchester, UK, 2006; pp. 141–203. 77. Mercurio, M.D.; Dambergs, R.G.; Herderich, M.J.; Smith, P.A. High Throughput Analysis of Red Wine and Grape PhenolicsAdaptation and Validation of Methyl Cellulose Precipitable Tannin Assay and Modified Somers Color Assay to a Rapid 96 Well Plate Format. J. Agric. Food Chem. 2007,55, 4651–4657. [CrossRef] 78. Peña-Neira, A.; Cáceres, A.; Pastenes, C. Low Molecular Weight Phenolic and Anthocyanin Composition of Grape Skins from Cv. Syrah (Vitis vinifera L.) in the Maipo Valley (Chile): Effect of Clusters Thinning and Vineyard Yield. Food Sci. Technol. Int. 2007 ,13, 153–158. [CrossRef] 79. Cejudo-Bastante, M.J.; del Barrio-Galan, R.; Heredia, F.J.; Medel-Maraboli, M.; Peña-Neira, A. Location effects on the polyphenolic and polysaccharidic profiles and colour of Carignan grape variety wines from the Chilean Maule region. Food Res. Int. 2018 ,106, 729–735. [CrossRef] 80. Gil-Cortiella, M.; Peña-Neira, Á. Extraction of Soluble Polysaccharides from Grape Skins. Cienc. Investig. Agrar. 2017 ,44, 83–93. [CrossRef] 81. González-Agüero, M.; García-Rojas, M.; Di Genova, A.; Correa, J.; Maass, A.; Orellana, A.; Hinrichsen, P. Identification of Two Putative Reference Genes from Grapevine Suitable for Gene Expression Analysis in Berry and Related Tissues Derived from RNA-Seq Data. BMC Genom. 2013,14, 878. [CrossRef] 82. Aranda, P.S.; LaJoie, D.M.; Jorcyk, C.L. Bleach gel: A simple agarose gel for analyzing RNA quality. Electrophoresis 2012 ,33, 366–369. [CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.