scieee AI-readable full text Open interactive document viewer

Fe/S cluster biogenesis regulation by the Janus-faced regulator, IscR: an unforeseen mechanism of DNA recognition and discrimination

Joana Abreu Luís da Silva Santos

Full text

III Joana Abreu Luís da Silva Santos FE/S CLUSTER BIOGENESIS REGULATION BY THE JANUSFACED REGULATOR, ISCR: AN UNFORESEEN MECHANISM OF DNA RECOGNITION AND DISCRIMINATION Tese de Candidatura ao grau de Doutor em Ciências Biomédicas submetida ao Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto: Orientador – Doutor Pedro Pereira Categoria – Investigador Principal Afiliação – IBMC - Instituto de Biologia Molecular e Celular Co-orientadora – Doutora Sandra Macedo-Ribeiro Categoria – Investigadora Principal Afiliação – IBMC - Instituto de Biologia Molecular e Celular Co-Orientadora – Professora Doutora Ana Margarida Damas Categoria – Professora Catedrática Afiliação – ICBAS - Instituto de Ciências Biomédicas Abel Salazar da Universidade do Porto IV V Preceitos Legais De acordo com o disposto no nº 2 do artigo 8º do Decreto-lei nº 388/70, nesta dissertação foram utilizados os resultados de trabalhos publicados abaixo indicados. No cumprimento do disposto referido Decreto-Lei, a autora desta dissertação declara que interveio na conceção e execução do trabalho experimental, na interpretação e redação dos resultados publicados sob o nome Santos, J. A.: Santos, J.A., Alonso-García, N., Macedo-Ribeiro, S., Pereira, P.J.B. (2014). "The unique regulation of iron-sulfur cluster biogenesis in a Gram-positive bacterium." Proc Natl Acad Sci U S A. 111(22): E2251-E2260. VI O trabalho apresentado nesta tese foi realizado no IBMC - Instituto de Biologia Molecular e Celular da Universidade do Porto e foi financiado por Fundos FEDER através do Programa Operacional Factores de Competitividade – COMPETE e por Fundos Nacionais através da FCT – Fundação para a Ciência e a Tecnologia no âmbito do projeto PTDC/BBB-BEP/2127/2012 (FCOMP-01-0124FEDER-028116). VII “When one door of happiness closes, another opens; but often we look so long at the closed door that we do not see the one which has been opened for us.” ― Helen Keller VIII IX Agradecimentos Estas são as primeiras palavras que escrevi para a minha tese. As primeiras palavras devem pertencer às pessoas que me ajudaram a chegar até aqui, às pessoas que caminharam comigo e tornaram o sucesso desta etapa, uma realidade. Gostaria de agradecer aos meus supervisores Pedro Pereira e Sandra Macedo-Ribeiro por terem acreditado em mim e por me terem dado a oportunidade de realizar este trabalho. O caminho que traçámos fez-me crescer tanto a nível profissional, como pessoal. Obrigada por terem confiado em mim e no meu trabalho. Agradeço também à Professora Ana Margarida Damas por ter aceite co-orientar a minha tese, assim como à Annalisa Pastore e a todos os elementos do seu grupo por me terem recebido no seu laboratório de braços abertos e me terem ajudado em tudo o que precisei. Ainda que a minha visita tenha sido tão curta, consegui adquirir um conhecimento preponderante para o desenvolvimento do trabalho aqui apresentado. A minha família foi e sempre será a minha âncora, o meu mais adorado porto de abrigo. A minha mãe sempre me fez ver a realidade, sempre me ajudou a chegar mais longe e sempre reconheceu o meu melhor, mesmo quando as palavras permaneciam escondidas, teve sempre um sorriso do coração para me dar. O meu pai sempre me ensinou a sonhar, a acreditar no possível do impossível e sempre teve enormes demonstrações de alegria e carinho para as minhas vitórias, por mais pequenas que fossem. Para os meus pais guardo o pedaço mais caloroso do meu coração. A minha avó, essa mulher de mãos fortes e coração alegre, sempre me ensinou isso mesmo: a ser forte e alegre e a não desistir. A ela devo muito mais do que a minha educação. Devo uma imensidão de bons momentos que fizeram de mim uma criança, uma adolescente, uma mulher feliz. Minha mana, minha companheira de uma vida, tu que estás sempre lá para tudo, ensinaste-me que há sempre um lado bom em tudo e que a fé é algo que devemos ter em nós, nas pessoas que amamos e em Deus. Não há batalhas que não possamos ganhar se acreditarmos. Os meus queridos tios, Lina e Fernando, que acompanharam a minha infância, me ajudaram a crescer e a tornar-me uma pessoa melhor, ensinaram-me que por mais que a vida mude, X podemos sempre continuar iguais a nós mesmos. Os meus sogros são um verdadeiro exemplo para mim, receberam-me de coração aberto e em tão pouco tempo ensinaram-me mais do que muita gente numa vida inteira: o amor e a amizade pode perdurar no tempo e ajudar a ultrapassar tudo o que o destino nos reserve. Acima de tudo, devemos valorizar o que temos e não o que não temos ou o que não podemos ter. À minha restante família, agradeço todo o amor e carinho incondicional ao longo de todos estes anos. O meu querido avô não pôde testemunhar esta caminhada, mas sei que acreditava fervorosamente no meu potencial e esteja onde estiver rezo para que esteja orgulhoso de mim. E como poderia eu ter chegado aqui sem os meus amigos? Esses que partilharam tantos e bons momentos comigo? Vocês sabem quem são, mas não posso deixar de escrever umas palavras de apreço a alguns que por razões impossíveis de definir, me fizeram ser maior e chegar mais longe. Rita, tudo o que passámos juntas enriqueceu-me e faz-me saber que nunca poderei estar sozinha contigo por perto. Sofia, obrigada por tudo o que me deste ao longo destes 12 anos, contigo partilhei alguns dos momentos mais sorridentes da minha vida. Sílvia, minha “bina”, tu és tudo aquilo que sempre desejei para melhor amiga: sorridente, bondosa, carinhosa e muito muito especial. Joaninha, sem ti não me teria mantido minimamente sã durante a escrita desta tese (assim como em tantos outros momentos do doutoramento!), essa é a mais pura das verdades. Tu cativaste-me e continuas a cativar-me todos os dias e, com isto, ambas sabemos que digo tudo o que há por dizer. Ana, João e Margarida, a vossa família é a minha família, estou grata por vos ter na minha vida, pois a nossa ligação nunca poderá esmorecer. Gabriela, Isabel, Sara, Iliona, Bebiana, e Rosa: vocês ajudaram-me a crescer, fizeram parte deste caminho, deram-me a mão sempre que precisei e, por isso, sei que a nossa amizade perdurará no tempo. Vilaça Babe, ainda bem que estás por perto, ajudas-me mais do que imaginas. Para voçês, estarei sempre aqui. Aos meus amigos mais recentes, mas pelos quais nutro uma amizade incondicional: Aida, Alexandre, Ana, Tiago, Rute, Bruno e Luís vocês são verdadeiramente os melhores companheiros para todos os momentos. A minha vida é muito mais colorida por vos ter como amigos. Nada disto teria sido possível sem a ajuda, paciência e companheirismo dos meus colegas e amigos de laboratório, por quem nutro um carinho especial. XI Vivemos todo o tipo de momentos, mas levo comigo os risos, as palermices, as demonstrações de carinho e os bons conselhos. Sem vocês não teria chegado onde cheguei. Desejo-vos o melhor deste mundo, porque pessoas especiais não merecem menos do que isso! Um especial agradecimento à Noélia Alonso, ao Frederico Silva e ao Paulo Oliveira. À Noélia pela contribuição preponderante para a publicação do artigo e por me ter acompanhado em todo o processo, sem nunca me deixar desanimar. Ao Frederico, pela amizade, acompanhamento e inestimável ajuda ao longo dos últimos anos. Ao Paulo, por estar sempre disponível para discutir ciência e por me ter ajudado sempre que precisei. Agradeço aos três, por sentir que ficam genuinamente felizes com as minhas vitórias. Rodrigo, meu mais que tudo, tu mostraste-me a melhor face do amor: aquela em que posso ser amada, aceite e valorizada por tudo aquilo que sou, sem medos e sem restrições. Ensinaste-me que o amor é caminhar de mão dada: nunca à frente, nunca atrás, sempre lado a lado. Não poderia ter pedido melhor dádiva do que amar e ser amada por alguém como tu: forte, honesto e essencialmente único. És o meu melhor amigo e todos os dias anseio pelo nosso futuro juntos. Um obrigado honesto e eterno a todos, Joana XVIII Fig. 24 - Modulation of apo-IscR Tp specificity by a single point mutation ....... 106 Fig. 25 - Model for IscR discrimination between type-1 and type-2 promoter sequences.. ........................................................................................................ 113 XIX List of Tables Table 1 - IscR regulon in E. coli ............................................................................ 48 Table 2 - Sequence motifs compiled from IscR and NsrR DNA-binding sites ...... 53 Table 3 - Oligonucleotides used in binding and crystallization assays ................. 60 Table 4 - Statistics of data collection, processing, and refinement ...................... 65 Table 5 - Binding affinities between Apo-IscR Ec E43A and type-1 and type-2 promoter sequences ............................................................................................. 81 Table 6 - Structural similarity between T. potens IscR and other winged-helix transcription regulators ......................................................................................... 97 Table 7 - Binding affinities between IscR and type-1 and type-2 promoter sequences ......................................................................................................... 104 XX Abbreviations ATC – A-type carrier CD – Circular dichroism DMRB – Dissimilatory metal reducing bacteria EMSA – Electrophoretic mobility shift assay ENDOR – Electron-nuclear double resonance EPR – Electron paramagnetic ressonance DTT – Dithiothreitol DNA – Deoxyribonucleic acid DNIC – Di-nitrosyl iron complex FAD – flavin adenosine nucleotide FADH2 – reduced flavin adenosine nucleotide Fdx – Ferredoxin FNR – Fumarate nitrate regulator GPR – Gram-positive region Hmp – Haemoglobin H 2 O 2 – Hydrogen peroxide IAV – Influenza A virus IHF – Integration host factor IMAC – Immobilized metal affinity chromatography IPTG – Isopropyl β-D-1-thiogalactopyranoside ISC – Iron-sulfur cluster IscR – Iron-sulfur cluster regulator MST – Microscale thermophoresis MFC – Microbial fuel cell MHC – Multiheme c-type cytochromes Mtb – Mycobacterium tuberculosis NDSB-201 – 3-(1-pyridino)-1-propane sulfonate NIF – Nitrogen fixation NMR – Nuclear magnetic ressonance NO – Nitric oxide O 2 – Molecular oxygen XXI O 2- – Superoxide OH - – Hydroxyl anion OH – Hydroxyl ORE – Oxidant-responsive element PLP – Pyridoxal-5’-phosphate RNAP – Ribonucleic acid polymerase RNS – Reactive nitrogen species RRE – Roussin’s red ester ROS – Reactive oxygen species Sº – Sulfane sulfur S 2- – Sulfide SOD – Superoxide TEV – Tobacco etch virus UVRR – Ultraviolet resonance raman Uv/Vis – Ultraviolet/Visible UP – Upstream promoter XXII 23 Chapter 1 G eneral Introduction 24 Chapter 1 1.1 - Fe/S clusters as ubiquitous and multipurpose cofactors in Nature Iron is an essential biological cofactor playing a major role in multiple cellular processes, such as nitrogen fixation and respiration, and can be incorporated in proteins in several ways: as mono or di-iron reaction centers or combined with elemental sulfur in the form of Fe/S clusters (1-3). Iron-sulfur (Fe/S) clusters are ubiquitous and complex protein cofactors consisting of iron and elemental sulfur that are involved in processes as diverse as DNA replication and photosynthesis (4, 5). Due to their stability at multiple oxidation states and their physiologically relevant redox potentials (ranging from -500 to -150mV), Fe/S clusters confer to many enzymes the ability to participate in electron transfer and redox catalysis, as well as to function as sensors that modulate gene expression according to the cellular redox balance (4, 6). Thanks to their redox properties, Fe/S clusters are versatile prosthetic groups and the high abundance of Fe/S cluster-containing proteins is proof of the evolutionary success of Fe/S chemistry (7, 8). Fe/S clusters in rubredoxins are composed by one iron atom coordinated by four cysteinyl residues, whereas in rhombic [2Fe–2S] clusters each iron atom is ligated by two protein ligands (Fig. 1) (7). The combination of rhombic centers leads to the formation of [4Fe–4S] and more complex structures (5). Once incorporated into proteins, iron in Fe/S clusters is commonly coordinated by cysteine or histidine residues; but aspartate and serine side chains or backbone amides were also shown to function as cluster ligands (9). Several different protein folds have been found to coordinate these simple Fe/S clusters. Of the nearly 50 folds identified, over 90% harbor [2Fe-2S] 2+,+ or [4Fe-4S] 2+,+ clusters, being the latter three times more abundant, which is consistent with the higher chemical stability of tetranuclear clusters (10). Nevertheless, it remains difficult to infer the presence of Fe/S clusters directly from protein sequences. During the past decades, considerable progress has been made towards the quantitative and qualitative characterization of iron-sulfur centers of proteins (11). The properties of iron-sulfur clusters are determined by their electronic arrangement and ability to electron delocalization (12). Iron-sulfur proteins display a wide range of midpoint potentials, resulting from several factors, such as the 25 nature of the cluster ligands (13). Electron paramagnetic resonance (EPR) and Mössbauer spectroscopies are the techniques most commonly used to detect ironsulfur clusters in proteins and investigate their properties, but complementary techniques are also widely applied, namely Nuclear magnetic resonance (NMR) spectroscopy, X-ray crystallography, Electron-nuclear double resonance (ENDOR), Magnetic circular dichroism and Ultraviolet-visible (UV/Vis) absorption (14, 15). Information obtained from EPR analysis includes electronic structure, metal coordination-sphere composition and geometry, whereas Mössbauer spectroscopy provides detailed information of the chemical state of the iron atoms, as well as the electron distribution in various redox states of distinct iron-sulfur cluster types (16). Studies of hyperfine-shifted resonances by NMR provides relevant information about their structures in solution, their electron distribution from iron ions onto protein atoms, and the electron-transfer reactions in which they participate (17). The combination of these different techniques provides full characterization of the protein active center. Fig. 1 - Common types of iron–sulfur clusters. Structural rearrangements of rubredoxin type, [2Fe-2S], [3Fe-4S], and [4Fe-4S] iron–sulfur clusters. Iron is colored in yellow, sulfide in orange and coordinating residues (SR) are indicated. 26 Chapter 1 1.1.1. Fe/S clusters as oxidative stress targets Reactive oxygen species Although Fe/S incorporation into proteins proved to be highly beneficial during evolution, due to their intrinsic chemical reactivity, Fe/S clusters can be very fragile and become hazardous elements for the cell (18, 19). Oxygen species convert exposed Fe/S clusters to unstable forms that quickly decompose, ultimately interfering with several cellular processes in which they play essential roles. Moreover, degradation of Fe/S clusters can trigger the formation of reactive oxygen species (ROS, Box 1, equations 1-2) that are detrimental to lipids, proteins and DNA (20). Fe/S-containing proteins can react with superoxide (ROS; Box 1, equations 3-6) through their exposed clusters, producing the hydroxyl anion and often leading to loss of protein activity. Therefore, Fe/S clusters can be both targets and generators of ROS, and both events can potentially inhibit pivotal metabolic pathways (18, 19). Nitric oxide (NO) stress Nitric oxide (NO) is a signaling and defense molecule of major importance (21). In eukaryotes and at nanomolar concentrations, NO functions as signal via reversible coordination with the heme group in soluble guanylate cyclase to facilitate vasodilatation, while at micromolar concentrations within mammalian macrophages it is used as an effector molecule in the defense against pathogenic invasion (22, 21). Although for some bacteria (e.g. soil bacteria) NO is a natural metabolite, its ability to react with several key biomolecules including DNA, metalloproteins, thiol groups of proteins and low molecular weight thiols (e.g. glutathione and homocysteine), means that NO is also cytotoxic and can pose a potential threat to bacterial survival (23). Thus, it is crucial for bacteria to sense increased environmental NO levels and trigger specific adaptive responses to neutralize its poisonous effect (24). 27 Box 1 – Oxidative Stress (adapted from (25)) Oxidative stress results from an imbalance between reactive oxygen species (free radicals) and antioxidant defenses (26). This imbalance can be the consequence of exposure to increased levels of ROS: superoxide (O 2- ), hydrogen peroxide (H 2 O 2 ) and the hydroxyl radical (OH - ), which are products of the stepwise reduction of molecular oxygen (Equation 1)        + 2               ∙ +   →    (1) During aerobic growth, both superoxide and hydrogen peroxide are endogenously generated upon auto-oxidation of flavin cofactors of redox enzymes (27). Reaction between Fe 2+ and hydrogen peroxide yields the highly reactive hydroxyl anion (Fenton reaction, equation 1), linking the cellular iron levels to oxidative stress.   +    +   →    +  ∙ +    (2) The highly detrimental reaction of superoxide with protein Fe/S clusters produces hydroxyl anion (OH) and results in additional oxidative stress (equations 3-6). The hydroxyl anion is the strongest oxidant that exists in aqueous environments and is able to cause severe and sometimes lethal DNA lesions (26) [4 − 4]  +   + 2  → [4 − 4]  +     (3) [4 − 4]  → [3 − 4]  +   (4)   +     +   →   +  ∙ +    (5)  ∙ +  →    +  (6) Several NO-responsive regulatory proteins contain iron-sulfur clusters as their sensory unit and NO-mediated modification of Fe/S proteins is well documented in both bacteria and mammalian cells (28-31). The reaction of ironsulfur clusters in regulatory proteins was shown to produce at least two distinct iron-nitrosyl species: dinitrosyl iron complex (DNIC) and Roussin’s Res Ester (RRE) (32). The condensation of two RRE species yields a novel, tetranuclear octonitrosyl cluster. Insights into the mechanisms of cluster nitrosylation were provided by recent studies on the WhiD protein from Streptomyces coelicolor and the WhiB-like proteins from Mycobacterium tuberculosis (28). Since reversible modification of iron-sulfur clusters by nitric oxide can serve as genetic switch in a 34 Chapter 1 potential of SoxR upon DNA binding suggests that the solvent-exposed environment and electronic structures of the [2Fe–2S] cluster in SoxR may be altered when the protein is bound to its cognate DNA (63). The direct interaction between the sensory-domain of SoxR and the DNA-binding region provides a direct way for communication of the oxidative signal. Redox-induced changes in the [2Fe–2S] cluster of SoxR are transmitted to the DNA-binding domain and produce distortions in target promoters, allowing transcription activation (64). The SoxR–DNA structure suggests a reasonable mechanism by which reversible oxidation of the [2Fe–2S] cluster leads to an interdomain structural rearrangement required for the remodeling of the -35 and -10 promoter elements, so they are optimally positioned to interact with the RNAP (Ribonucleic Acid Polymerase) (67). However, a high-resolution structure of the transcriptionally inactive [2Fe–2S] + form of SoxR bound to DNA is essential to further understand how the redox signal may be propagated from the [2Fe-2S] cluster to the cognate DNA. Redox and nitrosative stress sensing by SoxR Recent studies in different bacteria challenged the generally accepted view that SoxR responded to superoxide and suggested that this regulator has a much broader sensorial capacity, mediating the oxidative stress response to redoxcycling drugs, such as viologens, phenazines and quinones (68-70). In fact, as mentioned previously, the [2Fe-2S] cluster of SoxR is solvent-exposed and poses as a readily available platform for the reduction of redox-active drugs (64). Interestingly, in enteric bacteria, SoxR senses a broader range of compounds than in non-enteric bacteria, such as Pseudomonas aeruginosa and Streptomyces coelicolor (69). Such differences in SoxR sensitivity are fully consistent with its role in the general stress response in enterobacteria and with a more restricted regulon in other bacteria that lack the soxS gene. More recently, it was demonstrated that the residues in the vicinity of the [2Fe-2S] cluster are responsible for fine-tuning SoxR sensitivity. In fact, a hypervariable motif of three residues within the highly conserved Fe/S binding site region (69) was shown to be the primary modulator of SoxR proteins sensitivity towards different redox compounds (69). The SoxRS regulon can also be activated by NO, through direct nitrosylation of the [2Fe-2S] cluster of SoxR. The reaction between NO and 35 SoxR is irreversible, with the concomitant formation of a protein-bound DNIC. Although relatively stable in vitro, nitrosylated iron-sulfur centers in SoxR rapidly disappear in vivo, probably meaning that such proteins are scavenged through specific protective mechanisms dedicated to counteract nitrosative stress (71). 1.3. Bacterial Fe/S cluster biogenesis machineries In striking contrast to the chemical and structural simplicity of Fe/S clusters, their synthesis and assembly into apoproteins is a highly complex and orchestrated cellular process (reviewed in (72)). In the past decade, different machineries in both bacteria and eukaryotes were shown to be dedicated to Fe/Sproteins maturation, namely the NIF, ISC and SUF systems (73, 72, 74). The NIF system, first identified in Azotobacter vinelandii, is mostly dedicated to the maturation of the nitrogenase enzyme under nitrogen fixation conditions (75), but it has also been found to mature other (non-nitrogenase) Fe/Scontaining proteins in organisms that, such as Helicobacter pylori, do not fix nitrogen (76). In contrast, both ISC and SUF machineries guarantee the maturation of the remaining cellular Fe/S proteins. Homologous ISC proteins are found in mitochondria (77) and SUF homologues are found in chloroplasts (78). Despite the obvious differences among the various systems, synthesis of Fe/S clusters and their transfer into apo-targets is underlined by the same basic principles and has common molecular players (Fig. 4) (72). The overall biosynthetic process can be divided into two steps: (i) the de novo assembly of the Fe/S clusters on a recipient protein, known as scaffold, and (ii) its subsequent transfer into an apo-protein. Briefly, L-cysteine is converted into L-alanine by a cysteine desulfurase (named IscS, NifS or SufS) with the concomitant release of sulfur (79), which is transferred to the scaffold protein that provides the molecular platform for Fe/S cluster assembly (80, 81). The transient Fe/S cluster is subsequently transferred to final acceptors (82, 83). 36 Chapter 1 Fig. 4 - Biogenesis of Fe/S clusters by the ISC and SUF machineries. A) The ISC system is encoded by the iscRSUA-hscBA-fdx operon. IscS converts L-cysteine into alanine with the concomitant release of sulfur to IscU, the scaffold protein onto which Fe and S are transiently assembled as Fe/S clusters (depicted as yellow and orange spheres, respectively). Delivery of labile [2Fe-2S] clusters from IscU to A-type Fe/S carriers (ATCs) is facilitated through interaction with the HscBA co-chaperone duo, whereas [4Fe-4S] cluster release from the scaffold to an ATC is not stimulated by the presence of these chaperones (84) and transfer to an ATC can occur directly. From the ATC, the Fe/S cluster is delivered to apo-targets. The identity of the Fe 2+ (yellow sphere) donor remains elusive although experimental evidence strongly supports a role for CyaY, a frataxin homologue. Electrons required for cluster assembly are most probably donated by ferredoxin (Fdx). B) The SUF system is encoded by the sufABCDSE operon. SufS and SufE form a heterodimeric cysteine desulfurase complex, in which sulfur is transferred from SufS to SufE, and subsequently to the scaffold SufB onto which the Fe/S cluster is assembled. SufB binds a FADH 2 cofactor and is part of a SufBC 2 D complex, wherein SufC is an ATPase and SufD is presumably involved in iron acquisition. Regardless of the type of Fe/S cluster (yellow and orange square) assembled on SufB, the cluster is directly delivered from the scaffold to an ATC that subsequently matures final apo-targets. 1.3.1. The ISC system The Escherichia coli ISC system, encoded by the iscRSUA-hscBA-fdx (isc) operon, catalyzes the maturation of the majority of Fe/S cluster proteins under non-stress conditions (Fig. 4). The ISC machinery exists in both prokaryotes and eukaryotes and its considered the housekeeping system for Fe/S cluster biogenesis in prokaryotes, including E. coli and A. vinelandii (85). E. coli IscS, a PLP (pyridoxal-5’-phosphate) dependent enzyme, is a homodimer of 90kDa in solution (86). IscS catalyzes the conversion of cysteine to 37 alanine with the concomintant production of sulfur, via the formation of a persulfide on a conserved Cys residue (Cys328). The enzyme-bound persulfide can then be transferred to Cys residues on the scaffold protein (87). Deletion of IscS is lethal in A. vinelandii and leads to severe growth defects in E. coli (79, 88). Many of these defects are a direct consequence of the reduced activity of Fe/S enzymes (79). IscU sequence is highly homologous to the N-terminal domain of NifU, the scaffold of the NIF system and contains the three conserved Cys residues known to be involved in cluster coordination (89). Extensive biochemical studies led to the confirmation that IscU serves as the scaffold component for the ISC machinery: it incorporates both iron and sulfur, stimulates the assembly of the Fe/S cluster, and its transfer to apotargets (89, 90, 84, 91). Analysis of the enzymatic IscS-directed cluster assembly on IscU revealed the sequential formation of two [2Fe-2S] 2+ clusters, followed by the slow formation of a single [4Fe-4S] 2+ cluster on each IscU homodimer (89). Importantly, formation of the [4Fe-4S] 2+ cluster-containing form was accompanied by a loss of the 2[2Fe-2S] 2+ cluster species, suggesting that the [4Fe-4S] 2+ species is formed by reductive coupling of the two [2Fe-2S] 2+ clusters (89). Additionally, pre-formed clusters on IscU were shown to be efficiently transferred to apo-proteins, such as acotinase (84), ferredoxin (92), NsrR (93), and IscR (93). During Fe/S cluster assembly, IscS interacts with and directly transfers sulfur to the IscU scaffold protein (80). Sulfur transfer was shown to occur between Cys328 of IscS and Cys63 of IscU involving the formation of a disulfide bridge in a covalently bound IscS-IscU complex (87). The crystal structure of the IscS-IscU complex showed that one monomer of IscU interacts with one subunit of the IscS homodimer leading to a 2:2 stoichiometry (94). Following cluster assembly, E. coli IscU was shown to interact with both HscA and HscB for cluster transfer to apoproteins (95). A conserved motif in IscU, LPPVK, was identified as the primary HscA recognition site (95) and the co-chaperone HscB was shown to stimulate HscA-IscU interaction (96), contacting with IscU through a conserved patch of hydrophobic residues (97, 98). The rate of cluster transfer from IscU to apo-targets is greatly enhanced (>20-fold) when HscA and HscB are present, an effect that was shown to be ATP-dependent (99). 38 Chapter 1 In summary, Fe/S cluster assembly and subsequent deliver to apo-proteins is an intricate process, involving a concerted action and conformational changes of the scaffold, chaperones and final targets. 1.3.2. The SUF system In E. coli, deletion of the entire isc operon produces growth defects and simultaneously leads to reduced activity of Fe/S enzymes (100). The fact that such strains remained viable raised the possibility of functional compensation and led to the identification of the SUF system (101). The E. coli SUF system is composed by six genes forming the sufABCDSE (suf) operon and its function in Fe/S clusters biogenesis was assigned after the analysis of diverse combinations of both ISC and SUF E. coli mutant strains (101). Suppression of either the isc or suf operons is not lethal in E. coli (for synthetic lethality both systems have to be inactivated) and suf mutations have only a mild effect on the activity of Fe/S proteins. However, absence of the SUF system increases E. coli sensitivity to iron starvation (85), whereas in strains lacking the ISC pathway and under anaerobic conditions, suf operon expression fully restored the activity of FNR (fumarate and nitrate reduction regulatory protein) (43) . Although there is some redundancy between the two systems, the ISC system functions as the housekeeping Fe/S cluster assembly system in E. coli, whereas the suf operon is specifically triggered to synthesize Fe/S clusters in conditions that lead to the disruption of iron or sulfur metabolism, such as iron starvation or oxidative stress (Fig. 4) (102, 85). The SUF machinery for Fe/S cluster assembly relies on the formation of two separate complexes of suf encoded proteins: the SufBCD and the SufSE complexes. The SufBCD complex was shown to function as a scaffold that is able to bind and transfer a [4Fe-4S] cluster to apoproteins, including SufA (83, 103, 81). In the SufBCD complex, SufB is regarded as the scaffold containing the Cys residues to coordinate nascent Fe/S clusters; SufC is an ATPase resembling those associated with ABC transporters (104) and SufD was suggested to be involved in iron entry into the scaffold complex (105). The SufSE complex poses as a sulfur donor for Fe/S cluster formation. SufS is cysteine desulfurase homologous to IscS, whose activity is greatly enhanced through interaction with SufE (106, 107). In vitro experiments showed that the cysteine desulfurase activity 39 of the SufS-SufE complex is substantially stimulated in presence of the SufBCD complex and SufE in turn interacts with SufB, leading to the proposal that sulfur transfer from SufS to SufB is mediated by SufE (108). The SufBCD complex exists predominantly as a SufBC 2 D stable form, which is the most efficient complex in Fdx maturation and therefore is proposed to serve as the terminal scaffold (109). A worth noticing feature of the SufBC 2 D complex is its ability to bind one equivalent of flavin adenosine nucleotide (FAD) only in its reduced state (FADH 2 ) (81). This cofactor can eventually provide the electrons to mobilize the ferric iron required for Fe/S cluster assembly from ferric citrate, ferritins or CyaY. 1.3.3. The delivery step – A-type proteins Once a cluster is assembled on a scaffold, it must be delivered to an apotarget. In E. coli, the total number of Fe/S-containing proteins is predicted to be close to 150 (8) and experimental data indicates that A-type proteins mediate the Fe/S clusters delivery process (Fig. 4) (110, 111). E. coli possesses three A-type proteins, namely IscA, SufA and ErpA that share 30% sequence identity. IscA and SufA belong to the isc and suf operon, respectively, whereas ErpA is located elsewhere in the chromosome (111). A-type proteins were initially proposed to act as complementary scaffolds given the presence of three highly conserved cysteine residues on their C-terminal region, as it was observed for the IscU scaffold (112, 113). This proposal was underscored by the observation that the pre-formed cluster could be transferred to apo-targets (113, 114). However, this view was profoundly challenged by several observations. First, A-type proteins are not able to interact with cysteine desulfurase enzymes, an essential step for sulfur transfer and subsequent cluster assembly on a scaffold (94). Second, while mutations on IscA or SufA were found to be almost neutral, an erpA mutation was found to be lethal under respiratory growth conditions and neither of these proteins was able to compensate for a mutation on IscU (115, 100). Finally, both IscU and SufBCD were able to mature IscA and SufA, respectively, but the reverse reaction was not possible (83, 114). Taken together, these results established A-type proteins as “Fe/S clusters carriers” (ATCs, A-Type Carriers) rather than scaffolds (109, 116). Moreover, function of A-type proteins was shown to require functional SufB or 40 Chapter 1 IscU, further proving that ATCs are unlikely to have a scaffold function (111). Under this perspective, nascent clusters would be transferred from their scaffolds to ATCs that would deliver them to apo-proteins. However, phylogenomic and genetic analyses suggest that ATCs function enables multiple routes for Fe/S clusters trafficking and that the choice of maturation route is modulated by growth conditions, such as oxygen levels (111). 1.3.4. CyaY as an iron donor for Fe/S cluster biogenesis CyaY, the bacterial homolog of eukaryotic frataxin, is the primary candidate as iron donor for Fe/S cluster biosynthesis (117). In humans, reduced levels of frataxin were linked to the neurodegenerative disease Friedreich’s ataxia (118). This pathology is a consequence of Fe/S cluster biogenesis disruption, mitochondrial iron accumulation and oxidative stress, which are known contributors for reduced activity of Fe/S proteins (119). In contrast to frataxin deletion in eukaryotes organisms, suppression of CyaY, the bacterial homolog of frataxin, does not alter iron content or sensitivity to oxidative stress (120). Nonetheless, the CyaY E. coli mutant had reduced amounts of Fe/S clustercontaining respiratory Complex I and Complex II, which is probably a consequence of decreased maturation of Fe/S proteins (121, 122). In vitro studies provided further insights into CyaY function: CyaY can bind iron specifically forming a stable complex, albeit with some distinct properties from other ironbinding proteins (123). CyaY interacts strongly with the IscU-IscS complex, forming a heterotrimeric assembly (124) and was able to donate iron for Fe/S cluster assembly on IscU in the presence of both IscS and cysteine (125). Further biochemical studies, suggested that CyaY can act as an iron-dependent inhibitor of cluster formation, whose function is exerted through interaction with IscS and modulated by iron bioavailability to adapt Fe/S cluster biogenesis to the pool of Fe/S acceptor proteins (126). Very recently, ferredoxin (Fdx) was shown to bind to IscS (127, 128), while supplying electrons to reduce sulfane sulfur (S 0 ) to sulfide (S 2- ) following the enzymatic conversion of cysteine (127). Moreover, Fdx and CyaY compete for overlapping binding sites on IscS and holo-Fdx binding to IscS does not perturb the affinity of IscS for IscU (127, 128). These results reinforce the 41 proposal of Fdx and CyaY acting, in a stepwise fashion, as electrons and iron donors for Fe/S cluster biosynthesis, respectively,. 1.3.5. ISC and SUF systems under stress conditions Fe/S proteins are easily damaged by oxidative stress due to the inherent reactivity of their Fe/S clusters (18, 129). Hence, such environmental stress conditions are expected to influence the function of protein machineries responsible for the de novo synthesis and delivery of Fe/S clusters to apoproteins. Although the ISC and the SUF systems share the same basic principles, combined genetic and biochemical studies pinpointed several differences in the ability to function under stress conditions (102, 85). The ISC system is sensitive to oxidative stress, being fully inactivated by ROS (102). Indeed, the Fe/S cluster assembled on IscU is exposed and thus intrinsically prone to oxidation (89, 130). Such cluster accessibility promotes copper or cobalt attack that, due to their thiophilicity (i.e ability to bind sulfur), can replace iron and form mixed clusters. Although this was true for cooper (131), cobalt reacts preferentially with degraded or transiently synthetized clusters, rather than attack them directly in Fe/S proteins. Indeed, a transient iron-cobalt-sulfur complex built on IscU could be transferred to an apo-protein (129). Thus cobalt toxicity is intimately linked to the poisoning of the entire Fe/S cluster biogenesis pathway. In E. coli, submicromolar concentrations of H 2 O 2 were detrimental to the ISC machinery and, under such conditions, the suf operon was activated to compensate the lack of Fe/S cluster biosynthesis (102). Likewise, suf operon expression was triggered under iron starvation conditions (85). These results made evident that organisms exposed to oxidants rely on the SUF system to mediate Fe/S cluster biogenesis rather than the ISC pathway. Additionally, the fact that SufB has FADH 2 as a cofactor may be indicative that the SUF system is better equipped for iron mobilization when iron is scarce, given that this cofactor can probably provide the necessary reducing power to mobilize iron from diverse sources (105, 81). Moreover, the E. coli SufS-SufE complex is more resistant to oxidative stress than the IscS-IscU complex (132) and the SUF system efficiently repaired damaged clusters (102). Finally, transcriptomic analysis showed that 42 Chapter 1 cobalt induced suf operon expression, linking cobalt toxicity to the impairment of Fe/S cluster biosynthesis, iron bioavailability and oxidative stress (133). 1.3.6. Diversity of ISC and SUF systems Homologs of E. coli ISC and SUF proteins are found in a wide range of organisms, but some species contain distinct patterns of Fe/S cluster biosynthesis systems. For instance, in contrast to E. coli and most Gram-negative bacteria, cyanobacteria (e.g Synechocystis spp.) possess only an incomplete SUF system and no ISC system (134) and Mycobacterium tuberculosis (Mtb), the causative agent of tuberculosis, contains a simplified SufBCDS operon (135). A similar scenario is encountered in most Gram-positive bacteria that carry only a suf operon (136), a particular case that will be described in more detail in the following section. Fe/S cluster biogenesis in Gram-positive bacteria Fe/S cluster biogenesis systems have been under intensive scrutiny in Gram-negative bacteria, such as E. coli (reviewed in (137)), but are poorly understood in Gram-positive bacteria. In silico analyses identified a highly conserved SUF machinery in Gram-positive bacteria that is relatively different from the E. coli SUF system (138). Bioinformatic characterization identified cis-acting elements on the suf promoter region similar to those located upstream of the suf operon in E. coli. Similar to what was observed in E. coli, the Fur and OxyR regulators, as well as the DNA-bending protein IHF (integration host factor), probably recognize these regions (136). However, in contrast to E. coli, no orthologs of IscR, SufE or SufA were found in the Gram-positive bacterium Enterococcus faecalis (138). Furthermore, Gram-positive bacteria code for an IscU-like protein, named SufU, that lacks the conserved HscA recognition motif LPPVK (138). Such feature is fully consistent with the absence of a HscA in Gram-positive organisms. SufU is essential in Bacillus subtilis and was shown to interact with SufS, from which it receives sulfur, to subsequently maturate apo-targets (139). Moreover, SufU is highly homologous to the N-terminal domain of A. vinelandii NifU, including the residues known to coordinate the cluster. Besides lacking the specific LPPKV 43 motif, SufU also contains a characteristic 19 amino acid insertion that is apparently restricted to SufU homologues from Gram-positive bacteria. This insertion was named Gram-positive region (GPR) and may be involved in the interaction of SufU with other macromolecules (136). However, considering that SufB lacks some of the cysteine residues that were found to coordinate the Fe/S cluster in its E. coli homolog (81), additional experiments are required to establish if SufBCD is indeed a scaffold in Gram-positive bacteria and, if so, understand the presence of two scaffold proteins. In fact, it is possible that there is no scaffold redundancy, given that SufU was shown to act as desulfurase activator in B. subtilis (140). SufC and SufB are highly similar to their E. coli orthologues, but functional and biochemical data is required to fully understand the SufBCD complex role in Fe/S cluster biogenesis in Gram-positive bacteria. 1.4. IscR, the Fe/S cluster biogenesis regulator 1.4.1. Concerted regulation of ISC and SUF systems by IscR Fe/S proteins are widely distributed in Nature and essential for many cellular processes (8). The synthesis of many of these proteins is regulated to accommodate changes in environmental conditions that can be detrimental to Fe/S clusters (141). Consistent with this notion, both Fe/S cluster biogenesis machineries, ISC and SUF, are tightly regulated by the [2Fe-2S] cluster-containing transcription factor IscR (142). IscR, encoded by the first gene of the iscRSUAhscBA-fdx (isc) operon, acts as a repressor of the Isc pathway and was shown to coordinate a [2Fe-2S] +1 cluster upon anaerobic isolation (142). Mutations on either iscA or hscA genes significantly reduced the activity of IscR, showing that repression by IscR is dependent of functional ISC machinery and is closely linked to its Fe/S cluster (142). Biochemical characterization of purified holo-IscR ([2Fe2S]-IscR) provided insights into the mechanism by which IscR is able to sense the cellular Fe/S cluster status. Mössbauer experiments using whole cell extracts revealed that [2Fe-2S] +1 -IscR is the predominant form in vivo, which becomes further oxidized even upon anaerobic isolation (143). However, cluster oxidation did not affect the binding affinity of IscR towards the isc promoter (143). Sitespecific mutagenesis revealed that the three highly conserved cysteine residues 50 Chapter 1 The ability of IscR to recognize different binding motifs was unexpected, given that the IscR monomer contains a single DNA binding domain (142). Regulation of type-2 promoters by IscR, such as the hyaA promoter, was subsequently characterized and provided insights into the differential DNA recognition by IscR (159). Surprisingly, binding of IscR to type-2 promoters does not require the [2Fe-2S] cluster, a feature that is not linked to whether IscR acts as an activator or as a repressor (144). Further characterization of the interaction between IscR and its targets, demonstrated that presence of the Fe/S cluster greatly enhances the affinity of IscR towards type-1 promoters and is essential for their regulation in vivo (147, 144, 142), whereas both apo-IscR and holo-IscR bind with similar affinities to type-2 promoters both in vitro and in vivo (144). Extensive analysis of the type-2 sequences allowed the identification of an imperfect palindrome motif, containing several bases at conserved positions, including a CC dinucleotide (Fig. 7). Although the position of the binding sites within the hyaA, sufA and ydiU promoters is nearly the same relative to their predicted -35 elements, IscR repressed the hya operon expression, but induced the expression of both suf and ydiU operons. This observation may result from minor differences in the spacer regions to the -35 hexamer and/or the strong interaction of IscR with the hyaA promoter in comparison to other IscR-target promoters (144). Fig. 7 - Comparison between IscR-binding sites and the IscR binding motifs proposed from phylogenetic sequence conservation. Sites recognized exclusively by [2Fe-2S]-IscR (iscb, yadR and yhgI) were compiled as type-1 promoters, whereas recognition of type-2 promoter sequences was shown to be independent of IscR cluster occupancy. Strictly conserved bases are highlighted in red and residues conserved between at least two sequences are colored in yellow. In the binding motifs: R and Y are puRine and pYrimidine, respectively; S is G or C; W is A or T; K is T or G; M is A or C and n is any nucleotide (147). Alignment prepared with ClustalW (161) and colored with Aline (162). 51 Given that both holoand apo-forms were shown to interact similarly with type-2 promoters, holo-IscR binding to these promoters under anaerobiosis is probably prevented through the presence of other transcription factors that compete with IscR for the same binding site. This was found to be the case for both sufA and hyaA promoters, where the IscR binding site overlaps with the binding sequence of Fur and ArcA, respectively (154, 159). This interplay between IscR and other transcription factors represents a mechanism by which these promoters are tightly regulated in response to environmental conditions. Thus, in contrast to other well characterized Fe/S-containing regulators that have only one transcriptionally active protein form, both apoand holo-IscR enroll in specific regulatory roles, being able to differentially recognize two types of DNA sequences according to its cluster occupancy (146, 144). 1.4.4. The Rrf2 family of regulators IscR belongs to the widespread Rrf2 family of regulators (PF02082, Pfam database). Rrf2 members are relatively small proteins (12-18 kDa) with a characteristic helix-turn-helix (HTH) domain next to their N-terminus. Besides IscR, this family contains the global cysteine regulator, CymR (163); the NO-sensing repressor, NsrR (164); and the rhizobial iron regulator A, RirA (165). With the exception of CymR, all Rrf2 members with an assigned function were shown to coordinate a Fe/S cluster (142, 165, 166). In B. subtilis, CymR is the regulator of the cysteine biosynthesis pathway (167) and its activity is positively regulated by the interaction with the oacetylserine (OAS)-thiol-lyase, CysK (168). Complex formation (CymR-CysK) stabilizes binding of CymR to DNA. Through binding to its OAS substrate, a direct percursor of cysteine, CysK is able to act as an indirect sensor of the cellular cysteine concentration and transmit this information to CymR. When cysteine is present, OAS concentrations are low and formation of the CymR-CysK complex is favored, which in turn leads to repression of cysteine biosynthesis (168). In Staphylococcus aureus, CymR was shown to indirectly regulate biofilm formation and stress response, playing a key role in virulence (169-171). The crystal structure of both CymR from B. subtilis and S. aureus reveals a biologically active dimer, where each monomer folds into two tightly packed domains: a DNA-binding 52 Chapter 1 domain, harboring the characteristic winged helix–turn–helix (wHTH) motif; and a long dimerization domain, which places the wHTH motifs at the extremes, opposing each other (Fig. 8A). This architecture explains how these small regulators can recognize DNA targets encompassing 23 to 27 bp (169, 163). Notably, RirA, IscR and NsrR contain three conserved C-terminal cysteine residues (Fig. 8B), but these conserved residues are not found in all Rrf2 family proteins. Some Rrf2 family members comprise two, one or no cysteines and, with the exception of IscR, NsrR and CymR (146, 169, 172), the ligands and sensing mechanisms that activate or inactivate these proteins are unknown. NsrR is a relatively well-characterized Rrf2 regulator, particularly in B. subtilis, where it was shown to control the transcription of genes involved in NO detoxification (172). For NO detoxification, B. subtilis makes use of both flavohemoglobin (hmp) and nitrite reductase (encoded by the nasDEF operon) proteins (173). NsrR is a master regulator of NO metabolism in both Gramnegative and Gram-positive bacteria, repressing the transcription of the nasDEF operon and hmp gene under anaerobic fermentative growth conditions (174). Transcription of these genes is controlled by the membrane-bound histidine kinase ResE and the cytoplasmic ResD regulator (172). NsrR recognizes the -35 element of the nasD promoter, leading to the disruption of the RNA polymerase-ResD-DNA complex (172). Under NO-exposure, both nasD and hmp are derepressed due to the release of NsrR from the nasD promoter through direct nitrosylation of its [4Fe4S] cluster (172, 175). A set of NsrR-controlled genes identified by transcriptmic analysis belongs to the Fur regulon and is involved in iron homeostasis (176). There is some controversy regarding the type of cluster bound by NsrR. Both S. coelicolor (166) and Neisseria gonorrhoeae NsrR (177) coordinate [2Fe-2S] clusters, whereas isolation of B. subtilis NsrR yielded a protein containing a [4Fe4S] cluster. (175). Regardless of the type of cluster, NsrR orthologues bear a Fe/S cluster that reacts directly with NO, leading to the formation of DNIC and derepression of the nasD promoter (166, 175). NsrR binding sites compiled from the nasD and hmp promoters display an imperfect dyad symmetry that was not found in other promoter regions known to be controlled by NsrR and whose recognition by NsrR is NO insensitive (Table 2) (174, 172). Moreover, in B. subtilis, binding of NsrR was modulated by ResD and Fur in co-regulated promoters (174) and its Fe/S cluster was reactive towards other molecules such as cyanide, 53 dithiothreitol, and O 2 (175). Thus, NsrR serves as a sensor of environmental NO concentrations and is involved in the global stress response to nitrosative stress (173). IscR and NsrR share low sequence similarity within the helix-turn-helix domain, having only three identical amino acids (underlined, 28-LADISER-QGISLSYLEQLFSRLRK-51), and therefore recognize very distinct DNA binding motifs (Table 2) (147, 178). Although it is predicted that Rrf2 regulators contain a common strutural signature characterized by a N-terminal helix–turn–helix DNAbinding domain, members of this family display different DNA-binding properties that are translated in distinct cellular functions. Fig. 8 - Structure of the Rrf2 family regulator CymR and the Fe/S cluster binding region in other Rrf2 regulators. A) Structure of the B. subtilis CymR monomer, showing the dimerization helix and the typical HTH DNA-binding domain [PDB entry 2Y75 (163)]. The predicted location of the cluster-coordinating cysteine residues found in homologous Fe/S cluster-containing Rrf2 proteins (e.g., IscR, NsrR, and RirA) is delimited by lines. B) Amino acid sequence alignment of B. subtilis CymR with Fe/Scontaining Rrf2-type regulators. The sequences of IscR and NsrR of E. coli, RirA of Rhizobium leguminosarum (R. leguminosarum) and CymR of B. subtilis, are aligned. Strictly conserved amino acids are highlighted in red, and increasing residue conservation is represented by a color gradient from green to red. Alignment prepared with ClustalW (162). The three cysteines assigned as cluster ligands in IscR, NsrR, RirA are denoted with open triangles. Table 2 – Sequence motifs compiled from IscR and NsrR DNA-binding sites Protein DNA-binding motif* Ref. IscR ATASYYGACTRwwwYAGTCRRSTAT or AWARCCCYTSnGTTTGMnGKKKTKWA (147) NsrR gATGyATTTxAAATrCAtc (178) *R and Y are puRine and pYrimidine, respectively; S is G or C; W is A or T; K is T or G; M is A or C and n is any nucleotide 54 Chapter 1 1.4.5. Implications of IscR in host-pathogen interactions The interaction between pathogenic microbes and their hosts is determined by survival strategies on both sides (179). Due to its redox properties, iron holds a central position at the host-pathogen interface, being vital for the growth of virtually all organisms, including pathogenic bacteria. Iron utilization by pathogens requires specific mechanisms that allow the interaction with and the acquisition of iron from iron-binding proteins (180). However, high concentrations of iron lead to oxidative stress, while low concentrations substantially affect bacterial growth. Hence, to guarantee their survival, pathogens have to tightly regulate both iron acquisition and transport (180). Additionally, to counteract bacterial invasion, the host innate immune system generates ROS and reactive nitrogen species (RNS) responsible for oxidative stress (179). Both iron starvation and oxidative stress have a detrimental effect on the function and biogenesis of Fe/S enzymes (18). Thus, the ability to adapt to changes in O 2 and iron bioavailability is vital for many bacterial pathogens, as many niches within a host are hypoxic (181) and iron depleted (180). Pathogenic bacteria have evolved transcriptional regulatory systems that perceive such hostile conditions and respond by reprogramming gene expression (182, 183). For this reason, defensive mechanisms that detoxify ROS and RNS and repair damaged cell components essential for the intracellular survival of the pathogen during infection are strictly regulated in pathogens (179, 182). Given the role of IscR is as a sensor of the cellular Fe/S clusters pool that directly modulates the expression of a diverse set of genes, it is not surprising that IscR function directly affects the ability of some microbial pathogens to maintain iron homeostasis and resist oxidative stress during host infection (184-187). The plant pathogen Erwinia chrysanthemi faces both iron starvation and oxidative stress at the onset of infection and consequently both oxidative-stress resistant and Fe/S biogenesis systems are essential for virulence (186). Arabidopsis thaliana produces ROS to counteract infection, which are detrimental to Fe/S clusters. The degradation of Fe/S clusters is sensed by E. chrysanthemi IscR, whose activity is essential to maintain the appropriate levels of Fe/S cluster biogenesis in such adverse environments (186). Moreover, IscR was required for peroxide resistance in Pseudomonas aeruginosa PA14, an opportunistic human pathogen responsible for lethal infections in immunocompromised individuals 55 (188). P. aeruginosa iscR mutant was shown to be hypersensitive to H 2 O 2 and paraquat, due to decreased catalase A (KatA) enzyme activity (184). Recently, it was shown that IscR regulated the P. aeruginosa isc operon under both physiological and stress conditions, conferring resistance to oxidative stress and contributing to iron homeostasis (184). In Shigella flexneri, a facultative intracellular pathogen and the causative agent of bacterial dysentery, the expression of both suf and isc promoters increased when the pathogen was living intracellularlly due to iron scarcity. IscR was found to be a positive regulator of suf expression under oxidant conditions and a negative regulator of isc expression in the absence of hydrogen peroxide, protecting S. flexneri against oxidative stress (187). IscR was also found to modulate sensitivity to oxidative stress through repression of Fe/S cluster biogenesis during host coinfection with the bacterium Haemophilus influenza and influenza A virus (IAV) (189). Furthermore, IscR function on Vibrio vulnificus highly impacted the motility and adhesion to host cells, its hemolytic activity, and the survival of this pathogen under oxidative stress during infection (185). Thus, V. vulnificus IscR, whose expression is upregulated by the transcriptional regulator Aph, functions as a global regulator contributing to the overall efficiency of pathogenesis by regulating not only the Fe/S cluster biogenesis genes but also the expression of a wide range of virulence and survival related genes (185, 190). Very recently, IscR was also linked to the virulence of food-borne pathogen Yersinia pseudotuberculosis possibly through the control of the Type III secretion systems (T3SS), an injectisome that delivers bacterial effector proteins directly into the host cell cytoplasm (191). In conclusion, apart from its evident biological importance in the regulation of both ISC and SUF machineries, IscR may be of pharmacological interest. In plants, regulation of Fe/S cluster biogenesis is proposed to be achieved by glutaredoxins that could act as Fe/S cluster‐containing sensor of the SUF machinery (192), whereas in mammals, IRP1 and IRP2 proteins act posttranscriptionally to adjust the cellular requirements for iron (193). Hence, since IscR structural homologs can be found in the pathogens mentioned above, but are absent in their hosts of choice, IscR is a potential target for novel antimicrobial agents. 56 Chapter 1 57 Chapter 2 M ethods 58 Chapter 2 Protein Expression and Purification A synthetic iscr gene, encoding the same amino acid sequence as TherJR_1914 from the T. potens genome, except for a Gly-Leu insertion immediately downstream from the N-terminal methionine and containing the NcoI and Acc65I restriction sites, was ordered from Eurofins MWG Operon. The E. coli iscr gene (b2531) fragment spanning nucleotides +4 to +489 of the IscR ORF was amplified from an E. coli K12 colony using specific primers (see Table A.1 in Appendix). IscR Tp -wt ORF was cloned into the NdeI and XhoI sites of the expression vector pET30a or into the Acc65I and NcoI sites of the expression vector pETZ2_1a, whereas IscR Ec -wt ORF was cloned into HindIII and NcoI sites of the expression vector pETZ2_1a (194). The latter constructs were used to obtain the triple mutants (C92/101/107S for T. potens or C92/98/104S for E. coli) corresponding to the clusterless forms of the proteins (apo-IscR Tp and apo-IscR Ec ) by site-directed mutagenesis (see Table A.2 in Appendix). All constructs were verified by DNA sequencing. The N-terminal His 6 -tagged apo-IscR Tp was overexpressed in E. coli BL21 (DE3) cells and the E. coli protein in E. coli BL21 Star (DE3) (Life Technologies). Briefly, cells were grown in LB medium at 37 °C until OD 600 = 0.7. At this point, the temperature was decreased to either 25 °C (apo-IscR Ec ) or 30 °C (apo-IscR Tp ), and the expression was induced with the addition of 0.5 mM isopropyl β-D-1-thiogalactopyranoside (IPTG). Cells were harvested by centrifugation after 4 h and lysed by incubation (60 min on ice with shaking) with 25 µg/mL chicken egg white lysozyme (Sigma). Clarified protein extracts in 20 mM sodium phosphate (pH 7.5), 0.5 M NaCl, 10 mM imidazole, 5% (vol/vol) glycerol, 150 mM arginine, and 2.5 mM β-mercaptoethanol (buffer A) were loaded onto a HisTrap HP column (GE Healthcare) preequilibrated in the same buffer, and bound proteins were eluted with buffer A containing 125 mM imidazole. The IscR-containing fractions were pooled, and the His6 and the solubility tags were removed by incubation with tobacco etch virus (TEV) protease at 4 °C concomitantly to an overnight dialysis against 20 mM sodium phosphate (pH 7.5), 0.2 M NaCl, 10 mM imidazole, 5% (vol/vol) glycerol, 150 mM arginine, and 2.5 mM β-mercaptoethanol. After overnight dialysis, the NaCl was restituted to approximately 0,5M by adding the necessary volume of a 5M NaCl solution and pure recombinant IscR was separated from the expression tag and noncleaved 59 material by a second immobilized-metal affinity chromatography (IMAC) step, in the same conditions as described above. The buffer was further exchanged for 10 mM Hepes (pH 7.5), 800 mM KCl, and 5% (vol/vol) glycerol using a HiPrep 26/10 (GE Healthcare) desalting column. Following concentration in a centrifugal device, the protein was either used immediately or flash-frozen in liquid nitrogen and stored at −80 °C until needed. Final protein concentrations were estimated by measuring the absorbance of the samples at 280 nm. Point mutants apo-IscR Tp - E43A, apo-IscR Ec E43A, and apo-IscR Tp -P40S were generated by site-directed mutagenesis of the pETZ2_1a constructs (see Table A.2 in Appendix). All IscR protein variants used for biochemical and crystallization experiments were expressed and purified as described for apo-IscR Tp , except for selenomethionyl apo-IscR Tp that was produced in a methionine auxotroph strain (E. coli B834, Stratagene), using SelenoMet medium (Molecular Dimensions) following manufacturer’s instructions and for apo-IscR Tp -wt that was purified by a single IMAC step followed by desalting on a HiPrep 26/10 column (GE Healthcare). The E. coli cysteine desulfurase IscS used in reconstitution assays was expressed and purified as described previously (195). Electrophoretic Mobility-Shift Assay Complementary oligonucleotides (Sigma) containing the sequence of the E. coli hya or of the T. potens isc promoter (Table 3) were annealed into doublestranded DNA by heating a 50 µM solution to 95 °C for 5 min in a water bath, followed by slowly (overnight) cooling to room temperature. For electrophoretic mobility-shift assay (EMSA) analysis using the complete sequence of the T. potens suf promoter region (Table 3), the sequence upstream of the sufC gene (TherJR_0923) was amplified by PCR using a synthetic template (Eurofins). DNA solutions (1 µM) were incubated with 7.5–10 µM purified protein at room temperature for 20 min in binding buffer [40 mM Tris·HCl (pH 8.0), 100–150 mM KCl, 5% (vol/vol) glycerol, and 1 mM DTT (Dithiothreitol)], and the resulting complexes were resolved on 8% (wt/vol) nondenaturing polyacrylamide gels using 1× TAE (40 mM Tris·HCl, 20 mM acetic acid, and 1 mM EDTA) as running buffer. DNA was detected by either ethidium bromide staining or chemiluminescent detection. For chemiluminescent detection, annealed DNA probes were end- 66 Chapter 2 67 Chapter 3 The E. coli Fe/S cluster biogenesis regulator, IscR – structural fine-tuning of DNA discrimination 68 Chapter 3 3.1. Summary The ubiquitous iron-sulfur (Fe/S) cluster-containing proteins are involved in countless biological routes and play crucial roles for the functioning of both prokaryotic and eukaryotic cells. The transcription factor IscR was first implicated in the repression of the ISC (Iron Sulfur Cluster) biogenesis pathway and was shown to harbor a [2Fe–2S] cluster. Promoters controlled by IscR belong to two distinct sequence groups and the [2Fe-2S] cluster of IscR was shown to be essential for regulation of type-1 promoters (isc, yadR, yhgI), while apo-IscR is responsible for the regulation of type-2 promoters (sufA, hyaA, hybO, napF, ydiU). IscR regulation of the ISC machinery relies on a feedback mechanism fine-tuned by the cellular Fe/S cluster status, while it activates the SUF pathway to compensate for oxidative damage of Fe/S-containing proteins. Despite recent advances in understanding the regulation of isc and suf operons by environmental signals, the features of IscR modulating sequence discrimination and the structural changes associated with DNA binding specificity upon ligation of the [2Fe-2S] cluster remain poorly understood. Here we report a detailed structural and biochemical characterization of IscR suggesting that unfavorable interactions with Glu43 impair recognition of type-1 promoters by apo-IscR. Our findings suggest that binding of a Fe/S cofactor leads to the reshaping of the DNA-IscR interface for specific recognition of type-1 sites. 69 3.2. Introduction Iron-sulfur (Fe/S) proteins are widely distributed in Nature and are key components in several physiological processes including respiration, photosynthesis, DNA repair, metabolism and regulation of gene expression (6, 208). Relying on their chemical versatility, Fe/S proteins can serve as regulatory sensors of diverse small molecules (36). FNR is one of the best characterized Fe/S-containing regulators, with an activation mechanism transversal to the majority of metalloregulators: the switch to a transcriptionally productive mode requires binding of a specific metal (209, 40). In contrast, the transcriptional regulator IscR has two active transcriptional forms: the clusterless (apo-IscR) and the [2Fe-2S]-bound forms that exhibit altered DNA recognition specificity and thereby control different sets of genes according to environmental conditions (146, 147, 144). IscR belongs to the Rrf2 family of regulators, displaying the typical winged helix–turn–helix motif close to the N-terminus and a C-terminal Fe/S cluster coordinated by three cysteine and one histidine ligands (143). It is now known that the expression of ~40 genes is under the direct or indirect control of IscR, which is the key regulator of Fe/S biogenesis: the [2Fe-2S]-form of IscR represses the transcription of the isc operon encoding the ISC Fe/S biogenesis pathway and, under stress conditions, the apo-form activates the expression of the suf operon (147, 142, 145). In E.coli, Fe/S homeostasis is maintained through a negative feedback loop based on the ability of [2Fe-2S]-IscR to sense the cellular demand for Fe/S clusters and actively regulate the transcription of the iscRSUA–hscBA–fdx operon (146). Thus, due to its intrinsic sensor properties, IscR adjusts the synthesis of proteins involved in the Fe/S cluster biogenesis pathway and allows E. coli to cope with varying Fe/S cluster requirements. Two distinct promoter sequences were compiled from IscR-regulated genes (147), termed type-1 and type-2 DNA-binding motifs, and whose recognition by IscR is dependent of its cluster occupancy (144). Type-1 promoters are recognized exclusively by [2Fe-2S]-IscR, whereas both [2Fe-2S]-IscR and apoIscR interact similarly with type-2 sequences, suggesting that the Fe/S cluster is dispensable for recognition of the latter motifs (144). Given that the structure of 70 Chapter 3 IscR is predicted to harbor a single wHTH DNA-binding domain, it is unexpected that it can interact and distinguish two DNA binding sites. To unveil the features underlying promoter discrimination by IscR, the three-dimensional structure of apo-IscR Ec in complex with a type-2 target sequence the hya promoter from the hydrogenase-1 operon, was solved. This experimental model combined with biochemical studies revealed some of the molecular details involved in the unusual environmentally modulated recognition of two distinct promoter consensus sequences by IscR, using a single predicted helix–turn–helix DNA binding motif. Our studies highlight the role of the Glu43 residue on DNA sequence discrimination by IscR and how structural changes taking place upon ligation of a [2Fe-2S] cluster contribute to broaden DNA specificity of IscR to include type-1 promoters. 71 3.3. Results Apo-IscR Ec induces structural changes on type-2 binding motifs It remains unclear how cluster ligation enables IscR to recognize two very distinct DNA motifs (Fig. 7) using a single wHTH domain (146, 144). To address this question, DNA-binding assays using an IscR variant (apo-IscR Ec ) with the putative cluster-coordinating cysteine residues mutated to serines (C92/98/104S) were performed. Conservative replacement of the cysteine ligands ensures a minimal structural and functional impact, as well as a homogeneous apo-protein preparation lacking the Fe/S cluster. The CD spectra obtained for the hya binding sequence (hyaEc, Table 3) display the characteristic features of B-form DNA with a negative peak at ≈240nm and a positive peak centered at ≈277nm (blue line, Fig. 9A) (210). Conformational changes in the DNA can be monitored within this region because there is no ellipticity from the intrinsic Cotton effect of the protein (211). A large increase in the magnitude of the CD signal (≈85% increase in the ∆ε value at saturation) with a slight wavelength shift to 272 nm following sequential additions of apo-IscR Ec indicative of productive binding of apo-IscR Ec to the hya binding site. Although the shift blue shift of the signal maximum is not readily interpreted, it can be a consequence of, for example, DNA unwinding induced by protein binding (212). Both DNA and protein concentrations were kept well above the previously determined apparent K d of apo-IscR Ec binding to the hya sequence (≈44±3 nM) to ensure that binding would occur in a 1:1 ratio and allow stoichiometric determination (144). It is clear that the ellipticity changes (∆∆ε) increase to a plateau at approximately 2:1 molar ratio of apo-IscR Ec :hya (Fig. 9B). Since E. coli IscR was shown to be a dimer in solution, this means that each hya duplex is recognized by one dimer of apo-IscR Ec . This observation is in contrast with previous results indicating that two dimers of E. coli IscR (both wild-type IscR and IscR-C92/98/104A) bind to one hya site (144). DNA bending is an important structural feature for base read-out in proteinDNA interactions and even small distortions can fine-tune sequence recognition by favoring the formation of specific contacts (213). To further investigate the features modulating DNA recognition by IscR, we performed a DNA bending assay using the pBend5 vector that contains duplicate sets of restriction sites (214). This assay 72 Chapter 3 allows an empirical estimation of the magnitude of bending induced by a specific DNA-binding protein, such as IscR. Following the hya promoter (hya_bend, Table 3) cloning into the pBend5 vector, a set of DNA fragments with identical sizes but displaying distinct relative positions of the protein-binding site were generated by digestion (Fig. 9C). The electrophoretic mobility of bent DNA is dependent upon the location of the bend; migration delay is greatest when the DNA is bent at its center and smallest when near its end (215). Gel retardation analysis clearly shows that the fragment with the most centrally positioned hya binding sequence (EcoRV, Fig. 9C, 9D) has minimum mobility and that mobility increases as the binding site is placed nearer the ends of the fragment (BamHI and MluI, Fig. 9C, 9D). Fragments obtained after digestion with BamHI and MluI have virtually identical mobility in the absence of apo-IscR Ec , suggesting that the hya site did not contain significant intrinsic DNA bending prior to complex formation. Taking into consideration the mobility of each hya fragment in complex with apo-IscR Ec , it was estimated that the hya sequence is distorted approximately 24º±2º from linearity (196). However, this analysis is influenced not only by protein-induced bends, but also by other distortions in DNA structure as a consequence of protein shape or DNA flexibility (212). Thus, the value obtained can reflect more than one type of DNA structural change and is better described as DNA flexure angle. Nevertheless, these results suggest that binding of one apo-IscR Ec dimer to the hya promoter sequence is accompanied by structural deformations, though their nature could not be distinguished by the techniques used. 73 Fig. 9 - Apo-IscR Ec binding to type-2 promoter sequences. (A, B) Apo-IscR Ec binds as a dimer and induces structural deformations in the hya promoter sequence. A - CD spectra following apoIscR Ec binding to the hyaEc sequence (hyaEc, Table 3). Scans were taken from 230 to 360 nm following sequential additions of apo-IscR Ec (235 µM). Representative spectra corresponding to protein:DNA ratios of 0, 0.34, 0.68, 1.02, 1.37, 1.71, 2.05, 2.39, 2.73, 3.07 3.42, 3.76, 4.10 are shown. Experiments were carried out in 40mM Tris-HCl pH 7.5, 150mM KCl, 1mM DTT, 5% glycerol (vol/vol). Inset shows an electrophoretic mobility shift assay assessing complex formation immediately after the CD titration. The band-shift corresponding to the apo-IscR Ec :hya complex is denoted by an arrow. (B) The change in the CD spectrum of the hyaEc sequence following sequential additions of apo-IscR Ec is indicative of a 2:1 apo-IscR Ec :hya complex. Values of ∆ε were taken at the peak maxima wavelength of the CD spectra (272 nm) shown in A. (C-E) The hya binding site is bent by apo-IscR Ec . C - Schematic representation of the hya site (hya_bend, Table 3) inserted between the MluI–BamHI restriction sites of the pBend5 vector. The region delimited by the MluI–BamHI recognition sequences contains restriction sites in duplicate to generate DNA fragments that are identical in length but contain the protein-binding sequence (black rectangle, hyaEc) at different positions. D - Gel electrophoresis of permuted fragments containing the hyaEc recognition site. Apo-IscR Ec protein was mixed separately with 6 different fragments. The DNA fragments used were generated by digestion restriction enzymes, which, from left to right, are MluI, BglII, XhoI, EcoRV, StuI, and BamHI. 100-bp DNA ladders were used for comparison and the 74 Chapter 3 250bp ladder band is indicated. E - Calculation of the flexure angle of the hyaEc sequence induced by apo-IscR Ec . The mobility of the apo-IscR Ec :hya complexes (R bound ) was normalized to the mobility of the corresponding free probe (R free ). Flexure displacement corresponds to the ratio between the distance from the 5’ end of each fragment to the center of the hyaEc binding site and the full size of the probe. The plotted points were fitted with a quadratic function: y = 0.1445x 2 - 0.1450x + 0.6941 (r 2 = 0.983). The first and second order parameters of the equation are in close agreement and estimate a hyaEc flexure angle of 24°±2. Structure of apo-IscR Ec bound to a type-2 promoter In order to better grasp the fine molecular details of specific promoter sequences recognition by IscR, the structure of apo-IscR Ec in complex with one of its type-2 target sequences, the hya promoter, was determined using orthorothombic (P 444 ) crystals diffracting to 2,5 Å (Table 4). The asymmetric unit contained the apo-IscR Ec biological dimer bound to a 26-base double stranded oligonucleotide with a single nucleotide overhang at the 5’-end of each strand (hya_26_OH, Table 3, Fig. 10A). This structure is highly similar to the recently reported model of apo-IscR Ec (C92/98/104A mutant) in complex with DNA (PDB entry 4HF1; (216)), superposing with a r.m.s.d. of 0.5 Å for 124 aligned Cα atoms. The apo-IscR Ec monomer is mostly α-helical and encompasses two central structural features: a DNA-binding domain and a dimerization helix (Fig. 10B, 10C). Residues 88 to 103, encompassing part of the putative iron-sulfur clusterbinding region (Fig. 10B), are disordered in both monomers and could not be modeled (Fig. 10A-C). The structures of the monomers are nearly identical, superposing with an r.m.s.d. of 1,2 Å for 115 aligned Cα atoms. The characteristic wHTH domain of Rrf2 regulators involved in DNA-recognition is formed by helices α2, α3, β-strands β1 and β2 and the wing (Fig. 10B, 10C). The length of the dimerization helix allows for the placement of each DNA-binding domain at the extremes of the dimer, as well as for the DNA-recognition helix (α3) of each monomer to specifically recognize the major groove and the wing to interact with adjacent minor grooves (Fig. 10A). Such structural architecture accounts for the somehow unexpected ability of IscR to recognize DNA sequences that are relatively long imperfect palindromes (Fig. 7) (147). 75 Fig. 10 – The 3D structure of apo-IscR Ec bound to the hya promoter. (A) Interactions at the DNA-recognition interface. One of the monomers is colored from N- (blue) to C-terminal (red). Residues making contacts with the DNA are highlighted as sticks and basic residues as spheres. Hydrogen bonds between apo-IscR Ec and DNA are represented as dotted lines. (B) Ribbon representation of the apo-IscR Ec monomer. (C) Topology diagram of the apo-IscR Ec monomer. Secondary structure element colors match those on B. Apo-IscR Ec dimer formation involves mostly interactions between residues from helix α5 of one monomer and helix α6 of the neighboring subunit, but residues from helices α1 and α2 also contribute to stabilize the homodimer (Fig. 11). Overall, 42 amino acids from monomer A and 40 amino acids from monomer B are found at the inter-subunit interface. Each monomer buries ~17% (1692 Å 2 ) of its total solvent accessible surface. The main chain of Arg116 crosslinks the dimerization helix α5 of one monomer with the C-terminal helix α6 of the opposing subunit (Fig. 11). Arg116 from one monomer forms a salt bridge with Glu128 OE1 and OE2, whereas Arg116 from the adjacent monomer hydrogen bonds to Asn132 OD1 and the main chain oxygens of Gln133 and Glu134. The inter-monomer association of helices α5 and α6 is further achieved by an interaction between the 82 Chapter 3 Fig. 15 – Interaction of apo-IscR Ec E43A with type-1 and type-2 binding sites. (A) Glu43 is fully conserved among IscR proteins from Gram-negative bacteria. Amino acid sequence alignment of representative IscR proteins from Gram-negative bacteria: Escherichia coli (P08AGK), Erwinia chrysanthemi (E0SAX8), Yersinia pestis (Q0WD07), Shigella flexneri (P0AGL1), Azotobacter vinelandii (O69219). The Glu43 residue is highlighted with a red triangle, other strictly conserved amino acids are colored in red and recognition helix α‐‐is underlined. Increasing residue conservation is represented by a color gradient from green to red. Alignment prepared with ClustalW (161) and colored with Aline (162). (B) Apo-IscR Ec E43A interacts similarly with type-2 hyaEc and type-1 iscbEc sequences. Curves correspond to titration of the hyaEc and iscbEc sequences (Table 3) with either apo-IscR Ec (triangles) or apo-IscR Ec E43A (squares). Values of ∆ε were taken at 272 nm for sequential additions of protein. Given the specific bidentate interaction of the Glu43 residue with type-2 sequences, the fact that substitution of this amino acid by an alanine had little effect on the DNA-binding activity of IscR was unexpected. One reasonable explanation is that elimination of the Glu43 side chain influences specificity, rather than binding affinity. Indeed, the apo-IscR Ec E43A bound to the hya site with similar affinity as the wild-type protein (216). However, it did not discriminate between nucleotide bases at positions 6 or 7, since cold sequences mutated at the C6-C7 positions (Table 3) were able to compete with the hya sequence for binding 83 to this variant but not for the apo-IscR Ec protein (Fig. 16B). Therefore, substitution of Glu43 for an alanine does not perturb substantially the recognition of the hya promoter nor the stoichiometry of the complex. During the course of this work, the structure of the IscR Ec E43A variant bound to the hya sequence (C92/C98/C104/E43A, PDB entry 4HF2, (216)) was solved and, despite losing specificity for the symmetrical CC dinucleotide, this variant was otherwise similarly bound to the hya site and retained all other specific interactions (216). Fig. 16 - Glu43 role in the DNA sequence discrimination by E. coli IscR. (A) Recognition of the hya promoter by IscR is unaffected by elimination of the Glu43 side chain. Competition assay using a 100x fold molar excess of cold competitors, either specific (cold hyaEc) or non-specific (cold random sequence, RS). (B) Apo-IscR Ec E43A looses discrimination against the well-conserved CC dinucleotide in type-2 binding sites. Cold hyaEc sequences mutated at either the C6 (C6G, C6A or C6T, Table 3) or the C7 (C7G, C7A or C7T, Table 3) bases compete significantly with the wild type hyaEc sequence for binding to apo-IscR Ec E43A (left panel), whereas binding to apo-IscR Ec is mostly unaffected by the presence of cold competitors (right panel). (C) Type-2 CC dinucleotide (green) is replaced by a TT dinucleotide (red) in type-1 binding sites. Conserved nucleotides are colored in black. DNA sequence alignment was performed with ClustalW (161) and colored with Aline (162). (D) The single E43A mutation allows apo-IscR Ec to specifically recognize type-1 motifs. 84 Chapter 3 Competition assay using a 100x fold molar excess of cold competitors, either specific (cold iscbEc) or unspecific (cold RS, random sequence). DNA sequences used in this group of experiments are listed in Table 3. Glu43 discriminates against Type-1 promoters Unlike type-2 sequences, in type-1 promoters the C6-C7 bases are replaced by a TT dinucleotide (Fig. 16C). Given that apo-IscR recognizes type-2 but not type-1 promoter sequences, a possible inhibitory interaction of Glu43 with the T6-T7 bases that could somehow prevent recognition of type-1 promoters by apo-IscR was proposed (147). Indeed, Apo-IscR Ec E43A specifically recognized the type-1 iscbEc sequence (Table 3, Fig. 16D). These results were further substantiated by microscale thermophoresis measurements that yielded a K d of 154 nM for Apo-IscR Ec E43A binding to the iscbEc sequence, a value that is in close agreement with the K d obtained for the hyaEc sequence (Table 3, Table 5) and is indicative that the Glu43 residue does not contribute substantially to the binding energy to either type of site. In line with previous results linking the Fe/S cluster of IscR to the recognition of type-1 promoters (147, 159, 142), apo-IscR Ec was unable to recognize the iscb sequence (Fig. 16D). In summary, these findings suggest that elimination of the Glu43 side chain probably lifts the unfavorable interactions with sequences containing thymine at positions 6 and 7, due to lack of suitable hydrogen-bond donors. Hence, Glu43 residue is a crucial selectivity filter that negatively affects binding of E. coli apoIscR to type-1 binding motifs, thereby linking specific recognition of these sequences by E. coli IscR to conformational rearrangements following binding of the [2Fe-2S] cluster. These results are substantiated by the findings of other research group (216) and demonstrated the key role of Glu43 in sequence discrimination. 85 3.4. Discussion In E. coli, IscR is a master transcriptional regulator controlling the expression of systems dedicated to the biogenesis of Fe/S clusters, as well as the O 2 -dependent expression of several Fe/S-containing proteins (147). According to its cluster occupancy, which is modulated by O 2 availability in vivo, IscR controls the expression of two sets of target promoters containing distinct DNA motifs (146, 144). The biochemical and structural analysis of IscR variants reported here unveils determinant features underlying DNA recognition that explain how cluster ligation enables IscR to specifically discriminate between two types of binding sites through a single DNA-binding domain, an ability undescribed for any other transcription factor. The structure of the apo-IscR Ec :hya complex resembles those described for other regulators of the Rrf2 family, containing a wHTH DNA-binding domain that greatly contributes to specific recognition of the type-2 binding site (169, 163). Binding to the hya sequence is accompanied by mild structural changes and induces a relatively small DNA bend, suggesting that apo-IscR is naturally shaped to recognize type-2 DNA motifs. The wing residue Arg59 interacts extensively with the AT-rich minor groove region and provides an anchoring point for IscR’s accurate placement and concomitant DNA sequence read-out. Specific binding is strengthened by interactions between major groove cytosines (C6C7 and C7’), purines (A19 and G20’) and thymines (T18 and T19’) and the side chains of Glu43, Ser40 and Gln44, respectively. The contact between Glu43 and two consecutive bases is somewhat striking because bidentate interactions are normally restricted to single base positions (223). Despite the bidentate contact between the highly conserved Glu43 residue and the C6C7 and C7´A8´ dinucleotides in each hya half-site, this interaction contributes less than expected for the overall complex affinity. Thus, the interaction between Glu43 and the CC dinucleotide poses as a central feature in the DNA-protein interface responsible for site-specific interaction of apo-IscR Ec with type-2 sequences. While involved in specific recognition of type-2 motifs, the Glu43 residue is used to discriminate against type-1 sequences. At physiological pH, this residue is expected to have hydrogen acceptor groups but not donor groups, and therefore 86 Chapter 3 can only form hydrogen bonds with cytosine and adenine bases (224). Lack of energetically favourable interactions between Glu43 and the conserved T6T7 dinucleotide in one half-site of type-1 sites may negatively affect the placement of the recognition helix within the DNA major groove, thereby limiting productive binding to type-1 motifs. Consistent with this hypothesis, specific interaction of apo-IscR with the type-1 isc promoter sequence was possible through the replacement of the Glu43 residue by an apolar and smaller residue, such as alanine. Consequently, one can speculate that at least part of the role of Fe/S cluster binding is the removal of the Glu43 negative effect on high-affinity binding to type-1 promoters. By using a structure-guided mutagenesis approach, a key sequence discriminatory role for Glu43 could be unveiled. Relocation of this residue upon cluster binding is crucial for type-1 promoters specific recognition, suggesting that reversible Fe/S cluster ligation enables IscR to act as a sensor of Fe/S cluster homeostasis through a switch in its target-site specificity. 87 . Chapter 4 The unique regulation of Fe/S cluster biogenesis in a Gram-positive bacterium 88 Chapter 4 4.1. Summary Iron-sulfur clusters function as co-factors of a wide range of proteins, with diverse molecular roles in both prokaryotic and eukaryotic cells. Dedicated machineries assemble the clusters and deliver them to the final acceptor molecules in a tightly regulated process. In the prototypical Gram-negative bacterium E. coli, the two existing iron-sulfur cluster assembly systems, ISC and SUF, are closely interconnected. The ISC pathway regulator, IscR, is a transcription factor of the helix-turn-helix type that can coordinate a [2Fe-2S] cluster. Redox conditions and iron or sulfur availability modulate the ligation status of the labile IscR cluster, which in turn determines a switch in DNA sequence specificity of the regulator: cluster-containing IscR can bind to a family of gene promoters (type-1), while the cluster-less form only recognizes a second group of sequences (type-2). However, iron-sulfur cluster biogenesis in Gram-positive bacteria is not so well characterized, and most organisms of this group display only one of the ironsulfur cluster assembly systems. A notable exception is the unique Gram-positive dissimilatory metal reducing bacterium Thermincola potens, where genes from both systems could be identified, albeit with a diverging organization from that of Gram-negative bacteria. We demonstrated that one of these genes encodes a functional IscR homologue, and is likely involved in the regulation of iron-sulfur cluster biogenesis in T. potens. Structural and biochemical characterization of T. potens and E. coli IscR revealed a strikingly similar architecture and unveiled an unforeseen conservation of the unique mechanism of sequence discrimination characteristic of this distinctive group of transcription regulators. 89 4.2. Introduction Iron-sulfur (Fe/S) proteins play crucial roles for the functioning of both prokaryotic and eukaryotic cells, being required for biological functions ranging from electron transport to redox and non-redox catalysis, and from DNA synthesis and repair to sensing in regulatory processes (7). The main role of the Fe/S cluster assembly machineries is to mobilize iron and sulfur atoms from their storage sources, assemble the two components into a Fe/S cluster, and then transfer the newly formed cluster to the final protein acceptors (73). In Escherichia coli, there are two of these Fe/S cluster ‘‘factories’’, the ISC (Iron Sulfur Cluster) and SUF (SUlFur assimilation) systems whose corresponding genes are organized in two operons, iscSUA-hscBA-fdx and sufABCDSE, respectively (73, 225). Deletion mutants of the ISC system display a variety of growth defects due to loss of Fe/S cluster-containing enzyme activity and disruption of sulfur metabolism, whereas failure of both the ISC and SUF systems leads to synthetic lethality (226, 101). In E. coli, the ISC machinery is considered the housekeeping system responsible for the maturation of a large variety of Fe/S proteins, whereas the SUF system is triggered under stress conditions, such as oxidative stress or iron starvation (85). IscR is a [2Fe-2S] cluster-containing transcription factor with a single predicted helix–turn–helix motif, first identified for its role in regulating expression of the ISC biogenesis pathway (142) and subsequently found to control the expression of more than 40 genes in E. coli (147, 142). According to the currently accepted model for Fe/S cluster biogenesis, under conditions unfavorable for Fe/S cluster formation the labile IscR cluster is lost and IscRmediated repression of the isc operon is alleviated. At the same time, apo-IscR activates the SUF operon to further compensate for damage or loss of Fe/S clusters (154, 145). Once the demand for Fe/S biogenesis is met, higher levels of cluster-containing holo-IscR exist, causing an increased repression of the ISC pathway. Moreover, under iron limitation the ISC and SUF machineries are unable to maintain the levels of holo-IscR and therefore this feedback mechanism allows IscR to sense Fe/S demand and enables E. coli to respond appropriately to stress conditions (146). There are two classes of IscR binding sites in the E. coli genome: a type-1 90 Chapter 4 site deduced from iscR, yadR, and yhgI promoter regions, and a type-2 site compiled from the IscR sites upstream of the hyaA, ydiU, and sufA promoters (147). Interestingly, IscR binds type-1 promoters solely in its holo-form, while binding to type-2 promoters was shown to be independent of the presence of the Fe/S cluster (144). In E. coli, IscR mutation E43A enabled specific recognition of type-1 promoters by apo-IscR, likely mimicking the interaction mode of the clusterbound form of the protein (see Chapter 3, (216)). Although a molecular level understanding of the complex processes of Fe/S cluster biosynthesis in several organisms is now emerging from the combination of in vivo and in vitro approaches, these machineries are still poorly understood in Gram-positive bacteria. While homologs of the E. coli ISC or SUF systems are present in several organisms, some species exhibit unusual Fe/S cluster biosynthetic machineries. Most Gram-positive bacteria carry only a suf operon, containing genes coding for SufU and the SufBCD complex (227, 138), but no sufE or sufA-related genes, even if in some cases sufA can be found elsewhere in the genome (139, 138). Thermincola potens (strain JR) is an anaerobic, thermophilic, Gram-positive dissimilatory metal reducing bacterium (DMRB), isolated from a thermophilic microbial fuel cell (MFC) (228). It is of the first Gram-positive DMRB for which there is a complete genome sequence, which revealed an unusual abundance of multiheme c-type cytochromes (228, 229). Using homology searches, we identified a series of genes with sequence similarity to both E. coli SUF and ISC machineries in the T. potens genome, including a gene locus coding for a putative IscR protein. Taken together, our results both identify and characterize a unique Fe/S biogenesis regulator in Gram-positive bacteria. Through structural and biochemical analysis of both T. potens and E. coli apo-IscR proteins and their E43A mutants, we were able to unveil subtle structural features important for DNA recognition and binding specificity. 91 4.3. Results Unique Fe/S cluster biogenesis in Thermincola potens In Gram-positive bacteria there is conservation of the suf operon, often present as sufCDSUB, which is the only machinery for Fe/S cluster biosynthesis in the majority of these organisms (136, 138). Surprisingly, homology searches on the Gram-positive DMRB T. potens JR genome (228) allowed identifying two gene loci with sequence similarity to E. coli SUF and ISC machineries (Fig. 17A). In T. potens, there are ORFs coding for homologues of the transcription factor IscR (TherJR_1914, 37% identical to the E. coli protein (142)), the cysteine desulfurase IscS (TherJR_1913 (226, 88)) and the scaffold IscU (TherJR_1912 (230)) from the ISC pathway. An additional suf-like operon in T. potens comprises homologues of sufC (TherJR_0923), sufB and sufD (TherJR_0924) from the E. coli SUF pathway, and hcsA (TherJR_0925) and hcsB (TherJR_0926) from the E. coli isc operon (104, 105, 96). When compared to other Gram-positive bacteria, namely from the Firmicutes phylum, some unique features of the T. potens suf operon become evident. In T. potens, the suf operon does not code for cysteine desulfurase (SufS) homologues, although there are elsewhere in the T. potens genome two additional genes coding for putative cysteine desulfurases (TherJR_0460 and TherJR_3003) homologous to CsdA/SufS, which can function as complementary sulfur sources for Fe/S cluster biogenesis, possibly through the recruitment of the SUF machinery (231). The T. potens suf operon is also devoid of homologues of SufU, recently reported to be a zinc-dependent sulfurtransferase in B. subtilis (140), but encodes a sufBD protein, which together with sufC was shown to act as scaffold in Gramnegative bacteria (83, 103). Furthermore, the suf operon in T. potens includes the hscA and hscB genes coding for the chaperones responsible for transferring preformed clusters from the scaffold IscU to final acceptors and that, in E. coli, are cotranscribed with the isc and not with the suf operon (226). Additionally, genes coding for A-type carriers are absent from the T. potens genome. IscU is a highly conserved protein that functions as scaffold for cluster assembly and subsequent transfer. Preserved features include the cluster ligands (three cysteines and one histidine), an aspartate residue that plays a critical role in 98 Chapter 4 DNA-binding surface (Glu33, Asp30 and Glu43; Fig. 13) are structurally equivalent to the acidic residues identified on the equivalent side of apo-IscR Tp . However, only Glu43 contacts directly the bound oligonucleotide. Together with Gln44 (conserved) and Ser40 (variable), Glu43 is involved in base-specific recognition within the major groove (Fig. 20A) and was shown to specifically discriminate against type-1 promoter sequences in E. coli (see Chapter 3, (216)). Overall, there is a stricking conservation of the DNA-binding interface (Fig. 17D; Fig. 20A). ApoIscR Tp differs from the E. coli homologue only at four positions within the interaction surface, which could result in altered DNA binding affinity and specificity: Ser27 (Pro27 in apo-IscR Ec ), Pro40 (Ser40 in apo-IscR Ec ) and Ala61Gln62 (Pro61-Gly62 in apo-IscR Ec ). The replacement of Pro27 by a serine is likely to increase the flexibility of the linker between the first two α-helices, although a large change in DNA affinity is not predictable. In contrast, the substitution of Pro61-Gly62 by an Ala-Gln dipeptide can impact the conformation of the wing βhairpin and interfere with the tight packing of this structural element within the minor groove. In particular, the residue at position 40 is likely to play a key role in sequence-specific recognition of DNA (Fig. 20B). In the IscR Ec -DNA complex the protein packs very tightly within the major groove, leaving limited space for bulkier residues (Fig. 20A, 20B). Although a proline could be accommodated at the N-terminus of helix α3 without helical disruption (Fig. 20B), the resulting steric hindrance might prevent the placement and base readout of the conserved Glu43-Gln44 and/or contacts of the residues interacting with the phosphate backbone (Tyr9, Ser38, Tyr41). Substitution of the purines interacting with Ser40 (G20’ and A19) prevents binding of E. coli apo-IscR to the hya promoter sequence, highlighting the importance of this residue for basespecific recognition (144). Further, mutation of Ser40 to alanine in E. coli IscR decreases binding to the hya promoter by 90% when compared to the wild type protein, a decrease that is sequence-dependent and more pronounced for type-2 sites (216). 99 Fig. 20 – Sequence conservation at the IscR-DNA interface (A) Bidentate binding of apo-IscR Ec (C92/98/104S) to the hya promoter DNA sequence. In one of the monomers, residues are colored according to conservation, where red corresponds to positions strictly conserved between E. coli and T. potens IscR. Residues at the DNA-interacting interface are represented as balls and sticks. Hydrogen bonds between apo-IscR Ec and DNA are represented as dotted lines. (B) Apo-IscR Ec S40 interacts specifically with the hya promoter and is substituted by a proline in apo-IscR Tp . Stereoscopic view of key residues involved in DNA recognition by apo-IscR Ec (magenta) and corresponding residues in apo-IscR Tp (green) are represented as sticks and color-coded (nitrogen blue, oxygen red). The influence of Pro40 in apo-IscR Tp interaction with DNA is evidenced by its inability to bind the E. coli hya promoter sequence (Fig. 21A). Replacement of Pro40 in IscR Tp by the structurally equivalent amino acid in E. coli IscR (apoIscR Tp -P40S) is sufficient to allow binding to the heterologous promoter (Fig. 21A). The presence of a serine residue at position 40 is likely to alleviate the tight packing of IscR within the major groove of DNA, reducing steric hindrance and allowing binding. Accordingly, the IscR Tp -E43A mutant, where the shorter alanine side chain can provide room for positional adjustments of this region, also recognized the hya sequence (Table 3, Fig. 21A) with an affinity comparable to 100 Chapter 4 that of the E. coli protein, as assessed by microscale thermophoresis (Table 7). Taken together, these results suggest that substitution of Ser40 by a proline in apo-IscR Tp prevents base recognition through steric hindrance, an impairment lifted by introducing less bulky residues at either position 40 or 43. Fig. 21 - Binding of IscR to type-2 promoter sequences. (A) Electrophoretic mobility-shift assay analysis of apo-IscR binding to the E. coli hya promoter. Arrows denote observed band-shifts. (B) Stereoscopic view of the intricate network of hydrogen bonds in apo-IscR Tp (one monomer of the functional dimer is colored green and the other one blue) centered on the cluster-binding residue 107 (light gray). The 2Fo − Fc electron density map around residue 107 is represented as an orange mesh. Water molecules and strictly conserved residues in closely related IscR molecules are colored red. (C) In apo-IscR Ec (C92/98/104S), serine 104 (ball and stick) participates in a network of polar interactions with neighboring residues (sticks), cross-linking helices α1, α2, and α5. The corresponding cysteine residue in the wild-type protein could be part of a sensing mechanism for the presence of the Fe/S cluster. Position of the cluster-binding residues In contrast to previous studies with E. coli IscR, where all putative clusterbinding cysteine residues were mutated to alanine in order to obtain homogeneous cluster-less protein (144, 216, 145), in T. potens IscR the corresponding residues 101 were mutated to serine, which is a closer structural match. In both E. coli IscR and apo-IscR Tp structures, the region involved in iron-sulfur cluster association is partially disordered, but the serine residues replacing Cys107 in apo-IscR Tp and Cys104 in apo-IscR Ec are clearly visible in the electron density maps (Fig. 21B, 21C). In contrast to what is observed for the Cys-to-Ala mutant structure of E. coli free apo-IscR where the two visible cluster ligands (Ala104 and His107) are on the outer face of the longer dimerization helix α5 (216), in apo-IscR Tp the equivalent Ser107 is part of the coil region preceding helix α5 and the crystal structure shows it participates in a water-mediated network of hydrogen bonds connecting this structural segment to helices α1 and α2 (Fig. 21B). In particular, the Ser107 sidechain is hydrogen-bonded to Thr109 OG1 within each monomer. Both residues also establish polar interactions with ordered solvent molecules that participate in a hydrogen bond network interfacing the two monomers of the functional dimer and involving the side chains of Gln19, Asp16, and Gln35 from the adjacent monomer (the last two residues strictly conserved across IscR molecules, Fig. 17D). Of particular relevance is the involvement of Asp16 side chain in a salt bridge with Arg34 within the DNA-binding helix-turn-helix motif. The cluster-binding segment is further stabilized by a polar contact with Gln140 of the adjacent monomer, which also connects the corresponding helices α1 and α6. Altogether, this polar interaction network tightly connects the cluster-binding segment at the Nterminal portion of helix α5 from one monomer with the N-terminal helix α1, helix α6 and helix α2 from the adjacent monomer. Particularly, this network suggests an interconnection between structural changes in the cluster-binding segment and functional effects at the DNA-binding interface. The geometry of the hydrogen bonds established by the mutated Ser107 in apo-IscR Tp , and the rotational freedom of Thr109, evidenced by the two discrete conformations of its side-chain in the current crystal structure, are compatible with the existence of similar hydrogen bonds involving Cys107 in the cluster-free wildtype IscR. Indeed, the cysteine side chain thiol group is a moderately good hydrogen bond donor, sometimes crucial for protein activity and function (240243). In the crystal structure of the apo-IscR Ec -DNA complex, Ser104 (structurally equivalent to Ser107 in T. potens IscR) is also well defined in the electron density 102 Chapter 4 maps. In one of the monomers, Ser104 is part of helix α5, as previously observed (216). However, in the other monomer of the apo-IscR Ec dimer this residue hydrogen bonds to the conserved Thr106 (Thr109 in T. potens IscR), which in turn engages in a network of direct polar contacts crosslinking the dimerization helix α5 to the C-terminus of the adjacent helix α2 (Arg34, Gln35) and to helix α1 (Asp16) (Fig. 21C). This hydrogen bond network involves direct interactions between the amino acid side chains, in contrast to what is observed in apo-IscR Tp , where solvent molecules mediate some of the contacts. In the Cys-to-Ala triple mutant of E. coli IscR this arrangement of polar contacts is preserved, with the expected exception of residue 104, which is there an alanine (216). The predicted function of residue 107/104 (in T. potens and E. coli, respectively) in iron-sulfur cluster binding, as well as its location between the dimerization helix of one monomer and the first helix of the helix-turn-helix DNAbinding motif of the neighboring subunit, suggest a possible role as a central nanoswitch, whereby cluster binding-induced movement could trigger a global motion involving both the dimer interface and the DNA-binding region from the opposite monomer. The resultingstructural changes could explain the observed alteration in DNA binding specificity upon cluster association (216). A single mutation allows apo-IscR Tp to recognize type-1 promoter sequences from T. potens and E. coli In E. coli, holo-IscR was shown to interact with both type-1 and type-2 DNA motifs in a similar manner, while apo-IscR bound solely to type-2 promoter sequences (144). Recently, it was also demonstrated that replacement of Glu43 by alanine in E. coli IscR C92/98/104A removed unfavorable interactions with type-1 motifs, allowing recognition of these promoters (216). The T. potens isc promoter region displays cis-regulatory elements similar to those identified in the type-1 E. coli iscRSUA-hscBA-fdx, including the -35 hexamer and the -10 element sequences (142). In fact, it is possible to delimit a segment (iscTp_1; Fig. 22A, Table 3) displaying 48% identity to the E. coli isc promoter sequence and containing a -10 element and a consensus -35 hexamer of the Eσ 70 -binding site with a 20-bp spacer region (216). 103 Fig. 22 - The T. potens isc promoter region contains two binding sites for IscR Tp . (A) IscR binding sites in type-1 [T. potens isc (iscTp) and E. coli isca (iscaEc) and iscb (iscbEc)] and type-2 [E. coli hya (hyaEc)] promoters. Numbers refer to the most upstream base of each IscR site relative to the corresponding start codon. Conserved bases between the isc promoters are highlighted in red whereas bases conserved between the five T. potens isc promoter sequences are shaded black. The highly conserved CC motif in type-2 promoters is colored green (12). (B) DNA recognition was assessed by electrophoretic mobility shift assay of the complexes formed between apo-IscR Tp or apo-IscR Tp E43A and either the full (iscTp_1) or trimmed (iscTp_2) isc promoter sequence. DNA band-shifts are denoted by arrows. Similar to what is observed for E. coli apo-IscR and isc, apo-IscR Tp does not bind iscTp_1 (Fig. 22B). Using an enzymatic system under oxygen-depleted atmosphere (195), a Fe/S cluster could be reversibly reconstituted in wild-type apo-IscR Tp yielding the holo form of the protein, as judged by the appearance of an absorption maximum at 420 nm (Fig. 23A). A dose-dependent structural change of iscTp_1 DNA could be identified by circular dichroism spectroscopy, upon holo-IscR Tp -wt binding (Fig. 23B). These results demonstrate that, as expected for a bona fide IscR, the enzymatically reconstituted Fe/S cluster-bound form of IscR Tp -wt binds to the T. potens isc promoter region (Fig. 23B). As seen for E. coli IscR (216), the single point mutant apo-IscR Tp E43A binds specifically to the iscTp_1 sequence, seemingly forming two distinct complexes – with either one or two IscR dimers binding to the target sequence – as suggested by the two observed DNA band shifts (Fig. 22B). This is further supported by the observation 104 Chapter 4 of a single complex with the 3’-trimmed iscTp_1 sequence, termed iscTp_2 (Fig. 22A, 22B; Table 3). In E. coli, DNase footprinting led to the identification of two IscR binding sites within the isc promoter region, iscra and iscrb (147). Two highly homologous regions could be identified in the T. potens isc promoter, iscTp_3 and iscTp_4 (Fig. 22A, Table 7), to which apo-IscR Tp E43A displays specific binding (Fig. 24A, Table 7). Further, removal of the two 3’-end nucleotides of iscTp_3, yielding the shorter iscTp_5 (Fig. 22A, Table 7), effectively prevents binding of apo-IscR Tp E43A (Fig. 24A, Table 7), in good agreement with the observed bidentate binding of IscR to the minor groove of AT-rich segments at the termini of its recognition sequence (Fig. 20A). Table 7 - Binding affinities between IscR and type-1 and type-2 promoter sequences determined by microscale thermophoresis DNA sequence IscR variant Dissociation constant K d (nM) hyaEc Apo-IscR Tp E43A 340 ± 52 Apo-IscR Tp n. d. Apo-IscR Tp P40S 11900 ± 3340 iscbEc Apo-IscR Tp E43A 97 ± 6 Apo-IscR Tp n. d. iscTp_3 Apo-IscR Tp E43A 320 ± 19 Apo-IscR Tp n. d. iscTp_4 Apo-IscR Tp E43A 905 ± 87 (a) Apo-IscR Tp n. d. iscTp_5 Apo-IscR Tp E43A n. d. n. d. – binding not detected (a) The K d value might be overestimated, since saturation was not reached. 105 Fig. 23 - T. potens IscR is a Fe/S-containing protein that binds the isc promoter sequence (A) Upper panel: Time course of Fe/S cluster assembly on apo-IscR Tp -wt. There is a timedependent increase of the characteristic Fe/S cluster absorption peak at 420nm for reconstituted apo-IscR Tp -wt (R-IscR Tp -wt; blue circles), while no noticeable variation could be observed for the assay performed in the absence of cysteine (NR-IscR Tp -wt, black circles). At the end of the assay, the reaction containing R-IscR Tp -wt displayed a characteristic brown colour (top cuvette; R), which was essentially absent in the control reaction (bottom cuvette; NR). Lower panel: UV/Visible absorption spectra of R-IscR Tp -wt. The spectrum of purified R-IscR Tp -wt (blue curve) displays local maxima at 420 nm and 320 nm that are characteristic of Fe/S clusters, which disappeared upon reduction with 2 mM dithionite (red curve). (B) Fe/S cluster binding modulates recognition of type-1 promoter DNA sequences by IscR. Circular dichroism spectra of iscTp_1 DNA sequence (Table 3) with increasing concentrations of R-IscR Tp -wt (top panel) or NR-IscR Tp - wt (bottom panel). The spectra were recorded upon successive additions of each purified protein to an iscTp_1 solution (2 µM). A significant change in ellipticity at the characteristic B-DNA peak at 285 nm (4) can only be observed upon R-IscR Tp -wt addition, indicating that only the Fe/S clustercontaining form of IscR Tp -wt is able to recognize the Thermincola potens isc promoter sequence and induce local DNA structural changes. Experiments were carried out at 20°C in 40 mM Tris pH 8, 150 mM KCl, 5% (v/v) glycerol, 1mM DTT. In line with the considerable conservation between E. coli and T. potens IscR proteins and isc promoter sequences, there is cross-recognition between the transcriptional regulator of T. potens and the E. coli promoter. While apo-IscR Tp does not bind E. coli iscrb (iscbEc, Table 7), this sequence is specifically recognized by the E43A mutant (Fig. 24B; Table 7), as observed for E. coli apoIscR (216). Therefore, the unique mechanism of promoter sequence discrimination by IscR seems to be conserved between these organisms. 106 Chapter 4 Fig. 24 - Modulation of apo-IscR Tp specificity by a single point mutation. (A) There are two independent binding sites for apo-IscR Tp E43A in the T. potens isc promoter. Purified apo-IscR Tp E43A (7.5 µM) was incubated with iscTp_3, iscTp_4 and iscTp_5 sequences, analyzed by nondenaturing PAGE, and visualized by ethidium bromide staining. An arrow denotes the DNA band-shift upon complex formation. (B) Cross-recognition of the E. coli isc promoter by T. potens IscR. Purified proteins (apoIscR Tp , apo-IscR Tp E43A, or apo-IscR Ec E43A) were incubated with DIG-labeled iscrb promoter sequence (iscbEc) (Table 3) and analyzed by nondenaturing PAGE. An arrow denotes bands indicative of DNA– IscR complex formation. Where indicated, cold iscrb or a similarly sized random sequence (random) was added in 100-fold molar excess as competitor . 107 4.4. Discussion We performed a detailed analysis of the product of gene TherJR_1914 from T. potens, undoubtedly establishing its functional relationship with the Fe/S cluster-binding transcription regulator, IscR, known to control Fe/S cluster biogenesis in several Gram-negative bacteria. The identification of an IscR homologue in T. potens was unprecedented: most other Gram-positive bacteria studied so far do not code for any IscR-like proteins nor have an isc operon, and the rare cases where an isc operon is present (e.g. the DMRB Desulfobacterium hafniense or the bacterium Clostridium perfringens (233)) lack the SUF machinery. The combination of biochemical and structural studies, on T. potens IscR and its homologue from E. coli, revealed also an unforeseen conservation of the unique mode of IscR promoter sequence recognition and discrimination. Despite extensive conservation of the DNA-binding surface, apo-IscR Tp was unable to recognize the heterologous hya promoter from E. coli. Residue at position 40 played a pivotal role in this process, since relief of steric hindrance (P40S mutant) was sufficient to promote binding. These subtle differences in specificity highlight the precise tailoring of each IscR molecule to its cognate partners, despite overall conservation of the recognition mechanism. Similar to the E. coli molecule (see Chapter 3, (144)), the cluster-less form of the protein binds to the here-identified T. potens suf (type-2) promoter, while the novel type-1 promoter (isc) is recognized by holo-IscR. In the absence of the Fe/S cluster, the strictly conserved Glu43 residue is pivotal for discriminating between type-1 and type-2 promoters by establishing specific interactions with an invariant CC dinucleotide in type-2 sequences. In fact, mutation of this residue to an uncharged alanine seems to mimic the cluster-induced specificity switch of IscR, allowing the cluster-less regulator to recognize and to bind to type-1 promoter sequences (216). In apo-IscR Tp , the E43A mutation promotes binding to two sequences upstream of the T. potens iscRSU operon. These regions are highly homologous to the E. coli isc sequences recognized by both holoand mutant apo-IscR E43A. Given that one of these sequences (iscTp_4) contains a -35element sequence, we propose that T. potens holo-IscR may act as a repressor of Fe/S biogenesis by hindering RNA polymerase binding. As a whole, our results 114 Chapter 5 unfavorable interaction with the TT dinucleotide has an inhibitory effect on type-1 sites recognition (b,e). Although binding of [2Fe-2S]-IscR to type-2 sequences is possible in vitro, it is prevented in vivo by additional transcription factors bound at target promoters (c). Upon cluster binding, a conformational change lifts the unfavorable interactions with the type-1 TT dinucleotide through displacement of the Glu43 side chain, which is denoted by a curved arrow (d). In summary, our findings unveil an unforeseen conservation of cofactorbased transcription regulation mechanism. Under anaerobiosis, structural changes induced by cluster ligation allow the specific recognition of type-1 promoters by IscR. Although there is a wide range of transcription factors whose function requires a cofactor, to our knowledge, IscR is the only active regulator in both apo and holo-forms whose DNA-binding specificity was found to be modulated by cofactor binding. 115 Chapter 6 F uture Perspectives 116 Chapter 6 Future perspectives The emergence and spread of antibiotic resistance in pathogenic bacteria is now a serious threat to global public health (250). The discovery of drugs with novel modes of action will be vital for the replacement of current drugs for which resistance is widespread. Identifying a suitable target is the first step in a structurebased drug design approach. When choosing a potential antimicrobial drug target, three requirements must be convened: the target is i) essential for pathogen survival; ii) its function is restricted to the pathogen; and iii) small molecules can be used to modify its activity (251). During the past decade, IscR was identified as a potential target for novel antimicrobial agents due to its role as a global regulator contributing to the overall virulence of several human and plant pathogens (185, 191, 186). However, additional experiments are required to assess if non-toxic antimicrobial agents can modulate IscR transcriptional activity. Nevertheless, structure-based drug design provides an excellent platform for the identification of novel antibacterial agents and the structural and biochemical characterization of IscR described herein is of utmost importance to pursue such line of research. Our studies unveil a novel paradigm on Fe/S cluster biogenesis with the identification of the isc and suf operons in a Gram-positive bacterium, T. potens, as well as the discovery of its functional IscR regulator. To gain further insights into T. potens Fe/S cluster biogenesis, multiple questions need to be addressed. First, it is necessary to characterize T. potens IscR in vivo and its function under different environmental conditions, namely oxidative stress. The outcome of this characterization could provide experimental evidence of the link between tight regulation of Fe/S cluster biogenesis and the physiology of this bacterium. Second, given the controversy on SufU function in Gram-positive bacteria, where it was shown to act as an enhancer of the cysteine desulfurase activity rather than as a scaffold, it would be of interest to assign the functional role of the TherJR_1912 gene product, whose amino acid sequence is closely related to its Gram-negative bacteria scaffold counterparts (139, 227, 140). Third, given the lack of a SufS encoding gene, one would expect this function to be compensated by additional T. potens cysteine desulfurases homologous to CsdA/SufS proteins, but 117 the interaction between these proteins and the predicted T. potens SufBCD scaffold protein needs to be tested in vitro. Ultimately, the work described in this thesis contributes for a deeper understanding of Fe/S cluster biogenesis regulation by IscR and demonstrates the conservation of its unique mechanism of sequence discrimination. Description of features governing DNA recognition links the structure of IscR with in vivo sequence discrimination, which is essential for accurate control of target promoters according to environmental conditions. Given the relevance of IscR for pathogen virulence and the prospective use of T. potens in bioremediation and renewable energy production, our findings create exciting novel avenues of research with potential therapeutic and industrial applications. 118 Chapter 6 119 A ppendix 120 Appendix Table A. 1 – Forward and reverse primers used for construct generation Protein Vector Gene Acession Number Restriction sites Forward primer (5′→3′) Reverse primer (5′→3′) IscR Ec -wt pETZ2_1a P0AGK8 NcoI and HindIII ccatgggaaga ctgacatctaaa ggg attcaagctttta agcgcgtaact t IscR Tp -wt pET30a D5X843 NdeI and XhoI cagggccatatg ggccttaaagtc agtacgaaaggt ctcgaattcgg atccggtctcg aggatgtagta catgtaccc Table A. 2 Forward and reverse primers used for site-directed mutagenesis. The mutated nucleotides are underlined Protein Substitution Forward primer (5′→3′) Reverse primer (5′→3′) Apo-IscR Tp (C92/101/107S) C92S cattgctcctgtcgag a g tgtgtctcaggatga tcatcctgagacacactct cgacaggagcaatg C101S tctcaggatgatccgga acatagcctgaaattcg cgaatttcaggctatgttcc ggatcatcctgaga C107S ggaacattgcctgaaatt cgactttagcgtgacga aatc gatttcgtcacgctaaagt cgaatttcaggcaatgttc c Apo-IscR Ec (C92/98/104S) C92S gtagatgccacccgt a g tcagggtaaaggcg cgcctttaccctgactacg ggtggcatctac C98S cagggtaaaggcggc a g ccagggcggcg cgccgccctggctgccgcctt taccctg C104S gccagggcggcgataa aagcctgaccc gggtcaggcttttatcgcc gccctggc Apo-IscR Tp E43A (C92/101/107S/ E43A) E43A gtcagaaccgtatttgg c acagctgattgccgtac gtacggcaatcagctgtg ccaaatacggttctgac Apo-IscR Ec E43A (C92/98/104S/E43A) E43A atttccctttcttatctggc acaactgttttcccgtctg cagacgggaaaacagtt gtgccagataagaaagg gaaat Apo-IscR Tp P40S (C92/101/107S/P42S) P40S cggcaaggcttgtcaga atcgtatctggaacag ctgttccagatacgcttctg acaagccttgccg 121 B ibliography 122 Bibliography 1. Bagg A & Neilands JB (1987) Ferric uptake regulation protein acts as a repressor, employing iron (II) as a cofactor to bind the operator of an iron transport operon in Escherichia coli. Biochemistry 26(17):5471-5477. 2. Huynh BH, Patil DS, Moura I, Teixeira M, Moura JJ, DerVartanian DV, Czechowski MH, Prickril BC, Peck HD, Jr., & LeGall J (1987) On the active sites of the [NiFe] hydrogenase from Desulfovibrio gigas. Mossbauer and redox-titration studies. J Biol Chem 262(2):795-800. 3. Nordlund P & Eklund H (1995) Di-iron-carboxylate proteins. Curr Opin Struct Biol 5(6):758-766. 4. Beinert H & Kiley PJ (1999) Fe-S proteins in sensing and regulatory functions. Curr Opin Chem Biol 3(2):152-157. 5. Johnson DC, Dean DR, Smith AD, & Johnson MK (2005) Structure, function, and formation of biological iron-sulfur clusters. Annu Rev Biochem 74:247-281. 6. Kiley PJ & Beinert H (2003) The role of Fe-S proteins in sensing and regulation in bacteria. Curr Opin Microbiol 6(2):181-185. 7. Beinert H, Holm RH, & Munck E (1997) Iron-sulfur clusters: nature's modular, multipurpose structures. Science 277(5326):653-659. 8. Py B & Barras F (2010) Building Fe-S proteins: bacterial strategies. Nat Rev Microbiol 8(6):436-446. 9. Moulis JM, Davasse V, Golinelli M-P, Meyer J, & Quinkal I (1996) The coordination sphere of iron-sulfur clusters: lessons from site-directed mutagenesis experiments. J Biol Inorg Chem 1(1):2-14. 10. Meyer J (2008) Iron-sulfur protein folds, iron-sulfur chemistry, and evolution. J Biol Inorg Chem 13(2):157-170. 11. Cammack R (2013) Iron–Sulfur Proteins. Encyclopedia of Biological Chemistry, eds Lennarz WJ & Lane MD (Academic Press, Waltham), pp 657-664. 12. Noodleman L, Lovell T, Liu T, Himo F, & Torres RA (2002) Insights into properties and energetics of iron-sulfur proteins from simple clusters to nitrogenase. Curr Opin Chem Biol 6(2):259-273. 13. Moore GR, Pettigrew GW, & Rogers NK (1986) Factors influencing redox potentials of electron transfer proteins. Proc Natl Acad Sci U S A 83(14):49984999. 14. Banci L, Bertini I, Ferretti S, Luchinat C, & Piccioli M (1993) The structure of iron-sulfur clusters in proteins as monitored by NMR, mössbauer, EPR and molecular dynamics. J Mol Struct 292(0):207-219. 15. Solomon EI, Pavel EG, Loeb KE, & Campochiaro C (1995) Magnetic circular dichroism spectroscopy as a probe of the geometric and electronic structure of nonheme ferrous enzymes. Coord Chem Rev 144(0):369-460. 16. Johnson CE, Cammack R, Rao KK, & Hall DO (1971) The interpretation of the EPR and Mossbauer spectra of two-iron, one-electron, iron-sulphur proteins. Biochem Biophys Res Commun 43(3):564-571. 17. Cheng H & Markley JL (1995) NMR spectroscopic studies of paramagnetic proteins: iron-sulfur proteins. Annu Rev Biophys Biomol Struct 24:209-237. 18. Imlay JA (2006) Iron-sulphur clusters and the problem with oxygen. Mol Microbiol 59(4):1073-1082. 19. Imlay JA (2008) Cellular defenses against superoxide and hydrogen peroxide. Annu Rev Biochem 77:755-776. 20. Schieber M & Chandel NS (2014) ROS Function in Redox Signaling and Oxidative Stress. Curr Biol 24(10):R453-R462. 123 21. Tripathi P (2007) Nitric oxide and immune response. Indian J Biochem Biophys 44(5):310-319. 22. Derbyshire ER & Marletta MA (2012) Structure and regulation of soluble guanylate cyclase. Annu Rev Biochem 81:533-559. 23. Poole RK & Hughes MN (2000) New functions for the ancient globin family: bacterial responses to nitric oxide and nitrosative stress. Mol Microbiol 36(4):775783. 24. Spiro S (2006) Nitric oxide-sensing mechanisms in Escherichia coli. Biochem Soc Trans 34(Pt 1):200-202. 25. Green J & Paget MS (2004) Bacterial redox sensors. Nat Rev Microbiol 2(12):954966. 26. Cross CE, Halliwell B, Borish ET, Pryor WA, Ames BN, Saul RL, McCord JM, & Harman D (1987) Oxygen radicals and human disease. Ann Intern Med 107(4):526545. 27. Messner KR & Imlay JA (1999) The identification of primary sites of superoxide and hydrogen peroxide formation in the aerobic respiratory chain and sulfite reductase complex of Escherichia coli. J Biol Chem 274(15):10119-10128. 28. Crack JC, Smith LJ, Stapleton MR, Peck J, Watmough NJ, Buttner MJ, Buxton RS, Green J, Oganesyan VS, Thomson AJ, & Le Brun NE (2011) Mechanistic insight into the nitrosylation of the [4Fe-4S] cluster of WhiB-like proteins. J Am Chem Soc 133(4):1112-1121. 29. Crack JC, Stapleton MR, Green J, Thomson AJ, & Le Brun NE (2013) Mechanism of [4Fe-4S](Cys)4 cluster nitrosylation is conserved among NO-responsive regulators. J Biol Chem 288(16):11492-11502. 30. Cruz-Ramos H, Crack J, Wu G, Hughes MN, Scott C, Thomson AJ, Green J, & Poole RK (2002) NO sensing by FNR: regulation of the Escherichia coli NOdetoxifying flavohaemoglobin, Hmp. EMBO J 21(13):3235-3244. 31. Ding H & Demple B (2000) Direct nitric oxide signal transduction via nitrosylation of iron-sulfur centers in the SoxR transcription activator. Proc Natl Acad Sci U S A 97(10):5146-5150. 32. Lewandowska H, Kalinowska M, Brzoska K, Wojciuk K, Wojciuk G, & Kruszewski M (2011) Nitrosyl iron complexes--synthesis, structure and biology. Dalton Trans 40(33):8273-8289. 33. Yang W, Rogers PA, & Ding H (2002) Repair of nitric oxide-modified ferredoxin [2Fe-2S] cluster by cysteine desulfurase (IscS). J Biol Chem 277(15):12868-12873. 34. Crack JC, Green J, Hutchings MI, Thomson AJ, & Le Brun NE (2012) Bacterial iron-sulfur regulatory proteins as biological sensor-switches. Antioxid Redox Signal 17(9):1215-1231. 35. Green J, Crack JC, Thomson AJ, & LeBrun NE (2009) Bacterial sensors of oxygen. Curr Opin Microbiol 12(2):145-151. 36. Crack JC, Green J, Thomson AJ, & Le Brun NE (2012) Iron-sulfur cluster sensorregulators. Curr Opin Chem Biol 16(1-2):35-44. 37. Unden G & Bongaerts J (1997) Alternative respiratory pathways of Escherichia coli: energetics and transcriptional regulation in response to electron acceptors. Biochim Biophys Acta 1320(3):217-234. 38. Gonzalez R, Tao H, Purvis JE, York SW, Shanmugam KT, & Ingram LO (2003) Gene array-based identification of changes that contribute to ethanol tolerance in ethanologenic Escherichia coli: comparison of KO11 (parent) to LY01 (resistant mutant). Biotechnol Prog 19(2):612-623. 130 Bibliography cluster assembly: evidence for its implication in the pathogen's survival. J Bacteriol 187(17):6137-6146. 136. Riboldi GP, de Mattos EP, & Frazzon J (2013) Biogenesis of [Fe-S] cluster in Firmicutes: an unexploited field of investigation. Antonie Van Leeuwenhoek 104(3):283-300. 137. Roche B, Aussel L, Ezraty B, Mandin P, Py B, & Barras F (2013) Reprint of: Iron/sulfur proteins biogenesis in prokaryotes: formation, regulation and diversity. Biochim Biophys Acta 1827(8-9):923-937. 138. Riboldi GP, Verli H, & Frazzon J (2009) Structural studies of the Enterococcus faecalis SufU [Fe-S] cluster protein. BMC Biochem 10:3. 139. Albrecht AG, Netz DJ, Miethke M, Pierik AJ, Burghaus O, Peuckert F, Lill R, & Marahiel MA (2010) SufU is an essential iron-sulfur cluster scaffold protein in Bacillus subtilis. J Bacteriol 192(6):1643-1651. 140. Selbach BP, Chung AH, Scott AD, George SJ, Cramer SP, & Dos Santos PC (2014) Fe-S cluster biogenesis in Gram-positive bacteria: SufU is a zinc-dependent sulfur transfer protein. Biochemistry 53(1):152-160. 141. Patschowski T, Bates DM, & Kiley PJ (2000) Mechanism for sensing and responding to oxygen deprivation in prokaryotic organisms. Bacterial Stress Responses, eds Storz G & Hengge-Aronis R (ASM Press). 142. Schwartz CJ, Giel JL, Patschkowski T, Luther C, Ruzicka FJ, Beinert H, & Kiley PJ (2001) IscR, an Fe-S cluster-containing transcription factor, represses expression of Escherichia coli genes encoding Fe-S cluster assembly proteins. Proc Natl Acad Sci U S A 98(26):14895-14900. 143. Fleischhacker AS, Stubna A, Hsueh KL, Guo Y, Teter SJ, Rose JC, Brunold TC, Markley JL, Munck E, & Kiley PJ (2012) Characterization of the [2Fe-2S] cluster of Escherichia coli transcription factor IscR. Biochemistry 51(22):4453-4462. 144. Nesbit AD, Giel JL, Rose JC, & Kiley PJ (2009) Sequence-specific binding to a subset of IscR-regulated promoters does not require IscR Fe-S cluster ligation. J Mol Biol 387(1):28-41. 145. Yeo WS, Lee JH, Lee KC, & Roe JH (2006) IscR acts as an activator in response to oxidative stress for the suf operon encoding Fe-S assembly proteins. Mol Microbiol 61(1):206-218. 146. Giel JL, Nesbit AD, Mettert EL, Fleischhacker AS, Wanta BT, & Kiley PJ (2013) Regulation of iron-sulphur cluster homeostasis through transcriptional control of the Isc pathway by [2Fe-2S]-IscR in Escherichia coli. Mol Microbiol 87(3):478492. 147. Giel JL, Rodionov D, Liu M, Blattner FR, & Kiley PJ (2006) IscR-dependent gene expression links iron-sulphur cluster assembly to the control of O2-regulated genes in Escherichia coli. Mol Microbiol 60(4):1058-1075. 148. Borukhov S & Severinov K (2002) Role of the RNA polymerase sigma subunit in transcription initiation. Res Microbiol 153(9):557-562. 149. Gourse RL, Ross W, & Gaal T (2000) UPs and downs in bacterial transcription initiation: the role of the alpha subunit of RNA polymerase in promoter recognition. Molecular Microbiology 37(4):687-695. 150. Frazzon J & Dean DR (2001) Feedback regulation of iron-sulfur cluster biosynthesis. Proc Natl Acad Sci U S A 98(26):14751-14753. 151. Lee JH, Yeo WS, & Roe JH (2004) Induction of the sufA operon encoding Fe-S assembly proteins by superoxide generators and hydrogen peroxide: involvement of OxyR, IHF and an unidentified oxidant-responsive factor. Mol Microbiol 51(6):1745-1755. 131 152. Zheng M, Åslund F, & Storz G (1998) Activation of the OxyR Transcription Factor by Reversible Disulfide Bond Formation. Science 279(5357):1718-1722. 153. Lee JH, Yeo WS, & Roe JH (2003) Regulation of the sufABCDSE operon by fur. J Microbiol 41(2):109-114. 154. Lee KC, Yeo WS, & Roe JH (2008) Oxidant-responsive induction of the suf operon, encoding a Fe-S assembly system, through Fur and IscR in Escherichia coli. J Bacteriol 190(24):8244-8247. 155. Varghese S, Wu A, Park S, Imlay KR, & Imlay JA (2007) Submicromolar hydrogen peroxide disrupts the ability of Fur protein to control free-iron levels in Escherichia coli. Mol Microbiol 64(3):822-830. 156. Masse E, Vanderpool CK, & Gottesman S (2005) Effect of RyhB small RNA on global iron use in Escherichia coli. J Bacteriol 187(20):6962-6971. 157. Desnoyers G, Morissette A, Prevost K, & Masse E (2009) Small RNA-induced differential degradation of the polycistronic mRNA iscRSUA. EMBO J 28(11):1551-1561. 158. Richard DJ, Sawers G, Sargent F, McWalter L, & Boxer DH (1999) Transcriptional regulation in response to oxygen and nitrate of the operons encoding the [NiFe] hydrogenases 1 and 2 of Escherichia coli. Microbiology 145 ( Pt 10):2903-2912. 159. Nesbit AD, Fleischhacker AS, Teter SJ, & Kiley PJ (2012) ArcA and AppY antagonize IscR repression of hydrogenase-1 expression under anaerobic conditions, revealing a novel mode of O2 regulation of gene expression in Escherichia coli. J Bacteriol 194(24):6892-6899. 160. Stewart V, Bledsoe PJ, & Williams SB (2003) Dual overlapping promoters control napF (periplasmic nitrate reductase) operon expression in Escherichia coli K-12. J Bacteriol 185(19):5862-5870. 161. Thompson JD, Gibson TJ, & Higgins DG (2002) Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics Chapter 2:Unit 2 3. 162. Bond CS & Schuttelkopf AW (2009) ALINE: a WYSIWYG protein-sequence alignment editor for publication-quality alignments. Acta Crystallogr D Biol Crystallogr 65(Pt 5):510-512. 163. Shepard W, Soutourina O, Courtois E, England P, Haouz A, & Martin-Verstraete I (2011) Insights into the Rrf2 repressor family--the structure of CymR, the global cysteine regulator of Bacillus subtilis. FEBS J 278(15):2689-2701. 164. Tucker NP, Le Brun NE, Dixon R, & Hutchings MI (2010) There's NO stopping NsrR, a global regulator of the bacterial NO stress response. Trends Microbiol 18(4):149-156. 165. Todd JD, Wexler M, Sawers G, Yeoman KH, Poole PS, & Johnston AW (2002) RirA, an iron-responsive regulator in the symbiotic bacterium Rhizobium leguminosarum. Microbiology 148(Pt 12):4059-4071. 166. Tucker NP, Hicks MG, Clarke TA, Crack JC, Chandra G, Le Brun NE, Dixon R, & Hutchings MI (2008) The transcriptional repressor protein NsrR senses nitric oxide directly via a [2Fe-2S] cluster. PLoS One 3(11):e3623. 167. Even S, Burguiere P, Auger S, Soutourina O, Danchin A, & Martin-Verstraete I (2006) Global control of cysteine metabolism by CymR in Bacillus subtilis. J Bacteriol 188(6):2184-2197. 168. Tanous C, Soutourina O, Raynal B, Hullo MF, Mervelet P, Gilles AM, Noirot P, Danchin A, England P, & Martin-Verstraete I (2008) The CymR regulator in complex with the enzyme CysK controls cysteine metabolism in Bacillus subtilis. J Biol Chem 283(51):35551-35560. 132 Bibliography 169. Ji Q, Zhang L, Sun F, Deng X, Liang H, Bae T, & He C (2012) Staphylococcus aureus CymR is a new thiol-based oxidation-sensing regulator of stress resistance and oxidative response. J Biol Chem 287(25):21102-21109. 170. Soutourina O, Dubrac S, Poupel O, Msadek T, & Martin-Verstraete I (2010) The pleiotropic CymR regulator of Staphylococcus aureus plays an important role in virulence and stress response. PLoS Pathog 6(5):e1000894. 171. Soutourina O, Poupel O, Coppee JY, Danchin A, Msadek T, & Martin-Verstraete I (2009) CymR, the master regulator of cysteine metabolism in Staphylococcus aureus, controls host sulphur source utilization and plays a role in biofilm formation. Mol Microbiol 73(2):194-211. 172. Kommineni S, Yukl E, Hayashi T, Delepine J, Geng H, Moenne-Loccoz P, & Nakano MM (2010) Nitric oxide-sensitive and -insensitive interaction of Bacillus subtilis NsrR with a ResDE-controlled promoter. Mol Microbiol 78(5):1280-1293. 173. Kommineni S, Lama A, Popescu B, & Nakano MM (2012) Global transcriptional control by NsrR in Bacillus subtilis. J Bacteriol 194(7):1679-1688. 174. Henares B, Kommineni S, Chumsakul O, Ogasawara N, Ishikawa S, & Nakano MM (2014) The ResD Response Regulator, through Functional Interaction with NsrR and Fur, Plays Three Distinct Roles in Bacillus subtilis Transcriptional Control. J Bacteriol 196(2):493-503. 175. Yukl ET, Elbaz MA, Nakano MM, & Moenne-Loccoz P (2008) Transcription Factor NsrR from Bacillus subtilis Senses Nitric Oxide with a 4Fe-4S Cluster (dagger). Biochemistry 47(49):13084-13092. 176. Bsat N, Herbig A, Casillas-Martinez L, Setlow P, & Helmann JD (1998) Bacillus subtilis contains multiple Fur homologues: identification of the iron uptake (Fur) and peroxide regulon (PerR) repressors. Mol Microbiol 29(1):189-198. 177. Isabella VM, Lapek JD, Jr., Kennedy EM, & Clark VL (2009) Functional analysis of NsrR, a nitric oxide-sensing Rrf2 repressor in Neisseria gonorrhoeae. Mol Microbiol 71(1):227-239. 178. Rodionov DA, Dubchak IL, Arkin AP, Alm EJ, & Gelfand MS (2005) Dissimilatory metabolism of nitrogen oxides in bacteria: comparative reconstruction of transcriptional networks. PLoS Comput Biol 1(5):e55. 179. Eisenreich W, Heesemann J, Rudel T, & Goebel W (2013) Metabolic host responses to infection by intracellular bacterial pathogens. Front Cell Infect Microbiol 3:24. 180. Nairz M, Schroll A, Sonnweber T, & Weiss G (2010) The struggle for iron - a metal at the host-pathogen interface. Cell Microbiol 12(12):1691-1702. 181. Dietz I, Jerchel S, Szaszak M, Shima K, & Rupp J (2012) When oxygen runs short: the microenvironment drives host-pathogen interactions. Microbes Infect 14(4):311-316. 182. Green J, Rolfe MD, & Smith LJ (2014) Transcriptional regulation of bacterial virulence gene expression by molecular oxygen and nitric oxide. Virulence 5(4). 183. Troxell B & Hassan HM (2013) Transcriptional regulation by Ferric Uptake Regulator (Fur) in pathogenic bacteria. Front Cell Infect Microbiol 3:59. 184. Kim SH, Lee BY, Lau GW, & Cho YH (2009) IscR modulates catalase A (KatA) activity, peroxide resistance and full virulence of Pseudomonas aeruginosa PA14. J Microbiol Biotechnol 19(12):1520-1526. 185. Lim JG & Choi SH (2014) IscR is a global regulator essential for pathogenesis of Vibrio vulnificus and induced by host cells. Infect Immun 82(2):569-578. 133 186. Rincon-Enriquez G, Crete P, Barras F, & Py B (2008) Biogenesis of Fe/S proteins and pathogenicity: IscR plays a key role in allowing Erwinia chrysanthemi to adapt to hostile conditions. Mol Microbiol 67(6):1257-1273. 187. Runyen-Janecky L, Daugherty A, Lloyd B, Wellington C, Eskandarian H, & Sagransky M (2008) Role and regulation of iron-sulfur cluster biosynthesis genes in Shigella flexneri virulence. Infect Immun 76(3):1083-1092. 188. Young LS (1984) The clinical challenge of infections due to Pseudomonas aeruginosa. Rev Infect Dis 6 Suppl 3:S603-607. 189. Wong SM, Bernui M, Shen H, & Akerley BJ (2013) Genome-wide fitness profiling reveals adaptations required by Haemophilus in coinfection with influenza A virus in the murine lung. Proc Natl Acad Sci U S A 110(38):15413-15418. 190. Lim JG, Park JH, & Choi SH (2014) Low cell density regulator AphA upregulates the expression of Vibrio vulnificus iscR gene encoding the Fe-S cluster regulator IscR. J Microbiol. 191. Miller HK, Kwuan L, Schwiesow L, Bernick DL, Mettert E, Ramirez HA, Ragle JM, Chan PP, Kiley PJ, Lowe TM, & Auerbuch V (2014) IscR Is Essential for Yersinia pseudotuberculosis Type III Secretion and Virulence. PLoS Pathog 10(6):e1004194. 192. Bandyopadhyay S, Gama F, Molina-Navarro MM, Gualberto JM, Claxton R, Naik SG, Huynh BH, Herrero E, Jacquot JP, Johnson MK, & Rouhier N (2008) Chloroplast monothiol glutaredoxins as scaffold proteins for the assembly and delivery of [2Fe-2S] clusters. EMBO J 27(7):1122-1133. 193. Lill R, Hoffmann B, Molik S, Pierik AJ, Rietzschel N, Stehling O, Uzarska MA, Webert H, Wilbrecht C, & Mühlenhoff U (2012) The role of mitochondria in cellular iron–sulfur protein biogenesis and iron metabolism. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1823(9):1491-1508. 194. Olichon A & Surrey T (2007) Selection of genetically encoded fluorescent single domain antibodies engineered for efficient expression in Escherichia coli. J Biol Chem 282(50):36314-36320. 195. Prischi F, Pastore C, Carroni M, Iannuzzi C, Adinolfi S, Temussi P, & Pastore A (2010) Of the vulnerability of orphan complex proteins: the case study of the E. coli IscU and IscS proteins. Protein Expr Purif 73(2):161-166. 196. Ferrari S, Harley VR, Pontiggia A, Goodfellow PN, Lovell-Badge R, & Bianchi ME (1992) SRY, like HMG1, recognizes sharp angles in DNA. EMBO J 11(12):4497-4506. 197. Carpenter ML & Kneale GG (1994) Circular dichroism for the analysis of proteinDNA interactions. Methods Mol Biol 30:339-345. 198. Jerabek-Willemsen M, Wienken CJ, Braun D, Baaske P, & Duhr S (2011) Molecular interaction studies using microscale thermophoresis. Assay Drug Dev Technol 9(4):342-353. 199. Flot D, Mairs T, Giraud T, Guijarro M, Lesourd M, Rey V, van Brussel D, Morawe C, Borel C, Hignette O, Chavanne J, Nurizzo D, McSweeney S, & Mitchell E (2010) The ID23-2 structural biology microfocus beamline at the ESRF. J Synchrotron Radiat 17(1):107-118. 200. Kabsch W (2010) XDS. Acta Crystallogr D Biol Crystallogr 66(2):125-132. 201. Kabsch W (2010) Integration, scaling, space-group assignment and postrefinement. Acta Crystallogr D Biol Crystallogr 66(2):133-144. 202. Collaborative Computational Project N (1994) The CCP4 suite: programs for protein crystallography. Acta Crystallogr D Biol Crystallogr 50(Pt 5):760-763. 134 Bibliography 203. Sheldrick GM (2010) Experimental phasing with SHELXC/D/E: combining chain tracing with density modification. Acta Crystallogr D Biol Crystallogr 66(Pt 4):479-485. 204. Pape T & Schneider TR (2004) HKL2MAP: a graphical user interface for macromolecular phasing with SHELX programs. J Appl Crystallogr 37(5):843-844. 205. McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, & Read RJ (2007) Phaser crystallographic software. J Appl Crystallogr 40(Pt 4):658-674. 206. Emsley P & Cowtan K (2004) Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60(Pt 12 Pt 1):2126-2132. 207. Adams PD, Afonine PV, Bunkoczi G, Chen VB, Davis IW, Echols N, Headd JJ, Hung LW, Kapral GJ, Grosse-Kunstleve RW, McCoy AJ, Moriarty NW, Oeffner R, Read RJ, Richardson DC, Richardson JS, Terwilliger TC, & Zwart PH (2010) PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66(Pt 2):213-221. 208. Lill R (2009) Function and biogenesis of iron-sulphur proteins. Nature 460(7257):831-838. 209. Fleischhacker AS & Kiley PJ (2011) Iron-containing transcription factors and their roles as sensors. Curr Opin Chem Biol 15(2):335-341. 210. Cary PD & Kneale GG (2009) Circular dichroism for the analysis of protein-DNA interactions. Methods Mol Biol 543:613-624. 211. Blout ER, Schmier I, & Simmons NS (1962) New Cotton Effects in Polypeptides and Proteins. J Am Chem Soc 84(16):3193-3194. 212. Kerppola TK & Curran T (1991) DNA bending by Fos and Jun: the flexible hinge model. Science 254(5035):1210-1214. 213. Dickerson RE (1998) DNA bending: the prevalence of kinkiness and the virtues of normality. Nucleic Acids Res 26(8):1906-1926. 214. Kim J, Zwieb C, Wu C, & Adhya S (1989) Bending of DNA by gene-regulatory proteins: construction and use of a DNA bending vector. Gene 85(1):15-23. 215. Wu HM & Crothers DM (1984) The locus of sequence-directed and proteininduced DNA bending. Nature 308(5959):509-513. 216. Rajagopalan S, Teter SJ, Zwart PH, Brennan RG, Phillips KJ, & Kiley PJ (2013) Studies of IscR reveal a unique mechanism for metal-dependent regulation of DNA binding specificity. Nat Struct Mol Biol 20(6):740-747. 217. Zheng G, Lu XJ, & Olson WK (2009) Web 3DNA--a web server for the analysis, reconstruction, and visualization of three-dimensional nucleic-acid structures. Nucleic Acids Res 37(Web Server issue):W240-246. 218. van Dijk M & Bonvin AM (2009) 3D-DART: a DNA structure modelling server. Nucleic Acids Res 37(Web Server issue):W235-239. 219. Rohs R, West SM, Sosinsky A, Liu P, Mann RS, & Honig B (2009) The role of DNA shape in protein-DNA recognition. Nature 461(7268):1248-1253. 220. West SM, Rohs R, Mann RS, & Honig B (2010) Electrostatic interactions between arginines and the minor groove in the nucleosome. J Biomol Struct Dyn 27(6):861866. 221. Haran TE & Mohanty U (2009) The unique structure of A-tracts and intrinsic DNA bending. Q Rev Biophys 42(1):41-81. 222. Zeng J, Zhang X, Wang Y, Ai C, Liu Q, & Qiu G (2008) Glu43 is an essential residue for coordinating the [Fe2S2] cluster of IscR from Acidithiobacillus ferrooxidans. FEBS Lett 582(28):3889-3892. 135 223. Luscombe NM, Laskowski RA, & Thornton JM (2001) Amino acid-base interactions: a three-dimensional analysis of protein-DNA interactions at an atomic level. Nucleic Acids Res 29(13):2860-2874. 224. Kondo J & Westhof E (2011) Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes. Nucleic Acids Res 39(19):8628-8637. 225. Fontecave M, Choudens SO, Py B, & Barras F (2005) Mechanisms of iron-sulfur cluster assembly: the SUF machinery. J Biol Inorg Chem 10(7):713-721. 226. Takahashi Y & Nakamura M (1999) Functional assignment of the ORF2-iscSiscU-iscA-hscB-hscA-fdx-ORF3 gene cluster involved in the assembly of Fe-S clusters in Escherichia coli. J Biochem 126(5):917-926. 227. Riboldi GP, de Oliveira JS, & Frazzon J (2011) Enterococcus faecalis SufU scaffold protein enhances SufS desulfurase activity by acquiring sulfur from its cysteine-153. Biochim Biophys Acta 1814(12):1910-1918. 228. Byrne-Bailey KG, Wrighton KC, Melnyk RA, Agbo P, Hazen TC, & Coates JD (2010) Complete genome sequence of the electricity-producing "Thermincola potens" strain JR. J Bacteriol 192(15):4078-4079. 229. Carlson HK, Iavarone AT, Gorur A, Yeo BS, Tran R, Melnyk RA, Mathies RA, Auer M, & Coates JD (2012) Surface multiheme c-type cytochromes from Thermincola potens and implications for respiratory metal reduction by Grampositive bacteria. Proc Natl Acad Sci U S A 109(5):1702-1707. 230. Yuvaniyama P, Agar JN, Cash VL, Johnson MK, & Dean DR (2000) NifS-directed assembly of a transient [2Fe-2S] cluster within the NifU protein. Proc Natl Acad Sci U S A 97(2):599-604. 231. Trotter V, Vinella D, Loiseau L, Ollagnier de Choudens S, Fontecave M, & Barras F (2009) The CsdA cysteine desulphurase promotes Fe/S biogenesis by recruiting Suf components and participates to a new sulphur transfer pathway by recruiting CsdL (ex-YgdL), a ubiquitin-modifying-like protein. Mol Microbiol 74(6):15271542. 232. Hoff KG, Ta DT, Tapley TL, Silberg JJ, & Vickery LE (2002) Hsc66 substrate specificity is directed toward a discrete region of the iron-sulfur cluster template protein IscU. J Biol Chem 277(30):27353-27359. 233. Andre G, Haudecoeur E, Monot M, Ohtani K, Shimizu T, Dupuy B, & MartinVerstraete I (2010) Global regulation of gene expression in response to cysteine availability in Clostridium perfringens. BMC Microbiol 10:234. 234. Shen G, Balasubramanian R, Wang T, Wu Y, Hoffart LM, Krebs C, Bryant DA, & Golbeck JH (2007) SufR coordinates two [4Fe-4S]2+, 1+ clusters and functions as a transcriptional repressor of the sufBCDS operon and an autoregulator of sufR in cyanobacteria. J Biol Chem 282(44):31909-31919. 235. Mansy SS, Wu G, Surerus KK, & Cowan JA (2002) Iron-sulfur cluster biosynthesis. Thermatoga maritima IscU is a structured iron-sulfur cluster assembly protein. J Biol Chem 277(24):21397-21404. 236. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, & Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23(21):2947-2948. 237. Reboiro-Jato D, Reboiro-Jato M, Fdez-Riverola F, Vieira CP, Fonseca NA, & Vieira J (2012) ADOPS--Automatic Detection Of Positively Selected Sites. J Integr Bioinform 9(3):200. 136 Bibliography 238. Choi YS, Shin DH, Chung IY, Kim SH, Heo YJ, & Cho YH (2007) Identification of Pseudomonas aeruginosa genes crucial for hydrogen peroxide resistance. J Microbiol Biotechnol 17(8):1344-1352. 239. Zeng J, Zhang K, Liu J, & Qiu G (2008) Expression, purification, and characterization of iron-sulfur cluster assembly regulator IscR from Acidithiobacillus ferrooxidans. J Microbiol Biotechnol 18(10):1672-1677. 240. Fuentes-Prior P & Salvesen GS (2004) The protein structures that shape caspase activity, specificity, activation and inhibition. Biochem J 384(Pt 2):201-232. 241. Gregoret LM, Rader SD, Fletterick RJ, & Cohen FE (1991) Hydrogen bonds involving sulfur atoms in proteins. Proteins 9(2):99-107. 242. Turk V, Stoka V, Vasiljeva O, Renko M, Sun T, Turk B, & Turk D (2012) Cysteine cathepsins: from structure, function and regulation to new frontiers. Biochim Biophys Acta 1824(1):68-88. 243. Zhou P, Tian F, Lv F, & Shang Z (2009) Geometric characteristics of hydrogen bonds involving sulfur atoms in proteins. Proteins 76(1):151-163. 244. Tsaneva IR & Weiss B (1990) soxR, a locus governing a superoxide response regulon in Escherichia coli K-12. J Bacteriol 172(8):4197-4205. 245. Wrighton KC, Thrash JC, Melnyk RA, Bigi JP, Byrne-Bailey KG, Remis JP, Schichnes D, Auer M, Chang CJ, & Coates JD (2011) Evidence for direct electron transfer by a gram-positive bacterium isolated from a microbial fuel cell. Appl Environ Microbiol 77(21):7633-7639. 246. Albracht SP & Subramanian J (1977) The number of Fe atoms in the iron-sulphur centers of the respiratory chain. Biochim Biophys Acta 462(1):36-48. 247. Lanciano P, Vergnes A, Grimaldi S, Guigliarelli B, & Magalon A (2007) Biogenesis of a respiratory complex is orchestrated by a single accessory protein. J Biol Chem 282(24):17468-17474. 248. Lumppio HL, Shenvi NV, Summers AO, Voordouw G, & Kurtz DM, Jr. (2001) Rubrerythrin and rubredoxin oxidoreductase in Desulfovibrio vulgaris: a novel oxidative stress protection system. J Bacteriol 183(1):101-108. 249. Wrighton KC, Agbo P, Warnecke F, Weber KA, Brodie EL, DeSantis TZ, Hugenholtz P, Andersen GL, & Coates JD (2008) A novel ecological role of the Firmicutes identified in thermophilic microbial fuel cells. ISME J 2(11):1146-1156. 250. Balsalobre LC, Dropa M, & Matte MH (2014) An overview of antimicrobial resistance and its public health significance. Braz J Microbiol 45(1):1-5. 251. Drinkwater N & McGowan S (2014) From crystal to compound: structure-based antimalarial drug discovery. Biochem J 461(3):349-369. 137 The unique regulation of iron-sulfur cluster biogenesis in a Gram-positive bacterium Joana A. Santos a,b , Noelia Alonso-García a , Sandra Macedo-Ribeiro a,1 , and Pedro José Barbosa Pereira a,1 a Instituto de Biologia Molecular e Celular (IBMC), Universidade do Porto, 4150-180 Porto, Portugal; and b Instituto de Ciências Biomédicas de Abel Salazar (ICBAS), Universidade do Porto, 4050-313 Porto, Portugal Edited by Gregory A. Petsko, Weill Cornell Medical College, New York, NY, and approved April 28, 2014 (received for review December 6, 2013) Iron-sulfur clusters function as cofactors of a wide range of proteins, with diverse molecular roles in both prokaryotic and eukaryotic cells. Dedicated machineries assemble the clusters and deliver them to the final acceptor molecules in a tightly regulated process. In the prototypical Gram-negative bacterium Escherichia coli, the two existing iron-sulfur cluster assembly systems, iron-sulfur cluster (ISC) and sulfur assimilation (SUF) pathways, are closely interconnected. The ISC pathway regulator, IscR, is a transcription factor of the helix-turn-helix type that can coordinate a [2Fe-2S] cluster. Redox conditions and iron or sulfur availability modulate the ligation status of the labile IscR cluster, which in turn determines a switch in DNA sequence specificity of the regulator: cluster-containing IscR can bind to a family of gene promoters (type-1) whereas the clusterless form recognizes only a second group of sequences (type-2). However, iron-sulfur cluster biogenesis in Gram-positive bacteria is not so well characterized, and most organisms of this group display only one of the iron-sulfur cluster assembly systems. A notable exception is the unique Gram-positive dissimilatory metal reducing bacterium Thermincola potens, where genes from both systems could be identified, albeit with a diverging organization from that of Gram-negative bacteria. We demonstrated that one of these genes encodes a functional IscR homolog and is likely involved in the regulation of iron-sulfur cluster biogenesis in T. potens. Structural and biochemical characterization of T. potens and E. coli IscR revealed a strikingly similar architecture and unveiled an unforeseen conservation of the unique mechanism of sequence discrimination characteristic of this distinctive group of transcription regulators. Rrf2-like regulator | transcription regulation | helix-turn-helix motif | DNA recognition | specificity modulation Iron-sulfur (Fe/S) proteins play crucial roles for the functioning of both prokaryotic and eukaryotic cells, being required for biological functions ranging from electron transport to redox and nonredox catalysis, and from DNA synthesis and repair to sensing in regulatory processes (1). The main role of the Fe/S cluster assembly machineries is to mobilize iron and sulfur atoms from their storage sources, assemble the two components into an Fe/S cluster, and then transfer the newly formed cluster to the final protein acceptors (2). In Escherichia coli, there are two of these Fe/S cluster ‘‘factories,’’ the ISC (iron-sulfur cluster) and SUF (sulfur assimilation) systems, whose corresponding genes are organized in two operons, iscSUA-hscBA-fdx and sufABCDSE, respectively (2, 3). Deletion mutants of the ISC system display a variety of growth defects due to loss of Fe/S cluster-containing enzyme activity and disruption of sulfur metabolism whereas failure of both the ISC and SUF systems leads to synthetic lethality (4, 5). In E. coli, the ISC machinery is considered the housekeeping system responsible for the maturation of a large variety of Fe/S proteins whereas the SUF system is triggered under stress conditions, such as oxidative stress or iron starvation (6). ISC pathway regulator (IscR) is a [2Fe-2S] cluster-containing transcription factor with a single predicted helix-turn-helix motif, first identified for its role in regulating expression of the ISC biogenesis pathway (7) and subsequently found to control the expression of more than 40 genes in E. coli (7, 8). According to the currently accepted model for Fe/S cluster biogenesis, under conditions unfavorable for Fe/S cluster formation, the labile IscR cluster is lost, and IscR-mediated repression of the isc (ironsulfur cluster) operon is alleviated. At the same time, apo-IscR activates the suf (sulfur assimilation) operon to further compensate for damage or loss of Fe/S clusters (9, 10). Once the demand for Fe/S biogenesis is met, higher levels of cluster-containing holo-IscR exist, causing an increased repression of the ISC pathway. Moreover, under iron limitation, the ISC and SUF machineries are unable to maintain the levels of holo-IscR, and therefore this feedback mechanism allows IscR to sense Fe/S demand and enables E. coli to respond appropriately to stress conditions (11). There are two classes of IscR binding sites in the E. coli genome: a type-1 site deduced from iscR,yadR, and yhgI promoter regions and a type-2 site compiled from the IscR sites upstream of the hyaA,ydiU, and sufA promoters (8). Interestingly, IscR binds type-1 promoters solely in its holo-form whereas binding to type-2 promoters was shown to be independent of the presence of the Fe/S cluster (12). In E. coli, IscR mutation E43A enabled specific recognition of type-1 promoters by apo-IscR, likely mimicking the interaction mode of the cluster-bound form of the protein (13). Significance Iron-sulfur clusters are ubiquitous cofactors of proteins intervening in disparate biological processes. Iron-sulfur cluster biosynthesis pathways are tightly regulated in Gram-negative bacteria. One of the participating transcription factors, ironsulfur cluster pathway (ISC) regulator (IscR), can itself bind an iron-sulfur cluster. Depending on its ligation status, IscR recognizes and binds to distinct promoters, therefore modulating cluster biosynthesis. This unique protein at the crossroad between the ISC and sulfur assimilation (SUF) iron-sulfur cluster biosynthetic pathways was thought to be restricted to Gramnegative bacteria. We demonstrated the existence of a functional IscR in the unique Gram-positive bacterium Thermincola potens. Structural and functional analysis of T. potens and Escherichia coli IscR unveiled a conserved mechanism of promoter discrimination, along with subtle structural differences that explain their distinct DNA sequence recognition specificity. Author contributions: J.A.S., S.M.-R., and P.J.B.P. designed research; J.A.S., N.A.-G., and P.J.B.P. performed research; J.A.S., N.A.-G., S.M.-R., and P.J.B.P. analyzed data; and J.A.S., S.M.-R., and P.J.B.P. wrote the paper. The authors declare no conflict of interest. This article is a PNAS Direct Submission. Data deposition: The atomic coordinates and structure factors have been deposited in the Protein Data Bank, www.pdb.org (PDB ID codes 4CHU and 4CIC). 1 To whom correspondence may be addressed. E-mail: [email protected] or sribeiro@ ibmc.up.pt. This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1322728111/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1322728111 PNAS Early Edition | 1of10 BIOCHEMISTRY PNAS PLUS Although a molecular-level understanding of the complex processes of Fe/S cluster biosynthesis in several organisms is now emerging from the combination of in vivo and in vitro approaches, these machineries are still poorly understood in Gram-positive bacteria. Although homologs of the E. coli ISC or SUF systems are present in several organisms, some species exhibit unusual Fe/S cluster biosynthetic machineries. Most Gram-positive bacteria carry only a suf operon, containing genes coding for SufU and the SufBCD complex (14, 15), but no sufE or sufA-related genes, even if in some cases sufA can be found elsewhere in the genome (14, 16). Thermincola potens (strain JR) is an anaerobic, thermophilic, Gram-positive dissimilatory metal-reducing bacterium (DMRB), isolated from a thermophilic microbial fuel cell (17). It is of the first Gram-positive DMRB for which there is a complete genome sequence, which revealed an unusual abundance of multiheme c-type cytochromes (17, 18). Using homology searches, we identified a series of genes with sequence similarity to both E. coli SUF and ISC machineries in the T. potens genome, including a gene locus coding for a putative IscR protein. Taken together, our results both identify and characterize a unique Fe/S biogenesis regulator in Gram-positive bacteria. Through structural and biochemical analysis of both T. potens and E. coli apo-IscR proteins and their E43A mutants, we were able to unveil subtle structural features important for DNA recognition and binding specificity. Results Unique Fe/S Cluster Biogenesis in T. potens.In Gram-positive bacteria, there is conservation of the suf operon, often present as sufCDSUB, which is the only machinery for Fe/S cluster biosynthesis in the majority of these organisms (14, 19). Surprisingly, homology searches on the Gram-positive DMRB T. potens JR genome (17) allowed identifying two gene loci with sequence similarity to E. coli SUF and ISC machineries (Fig. 1A). In T. potens, there are ORFs coding for homologs of the transcription factor IscR (TherJR_1914, 37% identical to the E. coli protein) (7), the cysteine desulfurase IscS (TherJR_1913) (4, 20), and the scaffold IscU (TherJR_1912) (21) from the ISC pathway. An additional suf-like operon in T. potens comprises homologs of sufC (TherJR_0923), sufB, and sufD (TherJR_0924) from the E. coli SUF pathway, and the chaperones hcsA (TherJR_0925) and hcsB (TherJR_0926) from the E. coli isc operon (22–24). Compared with other Gram-positive bacteria, namely from the Firmicutes phylum, some unique features of the T. potens suf operon become evident. In T. potens, the suf operon does not code for cysteine desulfurase (SufS) homologs although there are elsewhere in the T. potens genome two additional genes coding for putative cysteine desulfurases (TherJR_0460 and TherJR_3003) homologous to CsdA/SufS, which can function as complementary sulfur sources for Fe/S cluster biogenesis, possibly through the recruitment of the SUF machinery (25). The T. potens suf operon is also devoid of homologs of SufU, recently reported to be a zinc-dependent sulfurtransferase in Bacillus subtilis (26), but encodes a sufBD protein, which together with sufC was shown to act as scaffold in Gram-negative bacteria (27, 28). Furthermore, the suf operon in T. potens includes the hscA and hscB genes coding for the chaperones responsible for transferring preformed clusters from the scaffold IscU to final acceptors and that, in E. coli,arecotranscribed with the isc and not with the suf operon (4). Additionally, genes coding for A-type carriers are absent from the T. potens genome. IscU is a highly conserved protein that functions as scaffold for cluster assembly and subsequent transfer. Preserved features include the cluster ligands (three cysteines and one histidine), an aspartate residue that plays a critical role in cluster transfer to apo-proteins and the LPPVK motif recognized by the chaperone HscA (29) (Fig. S1). Some Gram-positive bacteria (e.g., Enterococcus faecalis) were shown to possess an IscU homolog, SufU, which does not contain the HscA recognition site and has a 19-residue insertion between the first two conserved cysteines (14). The T. potens scaffold protein displays conservation of the characteristic IscU LPPVK motif and does not contain the insertion signature specific of SufU-type proteins. Accordingly, phylogenetic analysis of IscU and SufU protein sequences places the protein encoded by the TherJR_1912 gene between the Gram-negative IscU-type and the SufU-like proteins from Gram-positive bacteria (Fig. 1B). As previously reported for Clostridium perfringens (30), searches for Fe/S cluster biogenesis operons in Gram-positive bacteria with completely sequenced genomes, namely the DMRBs Desulfitobacterium hafniense and Desulfotomaculum reducens, revealed that they possess a single ISC gene locus (iscRSU) but no SUF apparatus. In contrast, in other Gram-positive bacteria (e.g., E. faecalis), only the SUF pathway can be found. Therefore, contrary to other Gram-positive bacteria described so far, T. potens not only has two gene loci coding for the two Fe/S cluster biosynthesis machineries present in E. coli (ISC and SUF), but these systems display a unique organization. The T. potens TherJR_1914 Gene Codes for IscR. IscR is a [2Fe-2S] cluster-containing transcriptional regulator encoded by the first gene of the iscRSUA-hscBA-fdx operon that regulates both ISC and SUF systems in E. coli and other Gram-negative bacteria (10, 11). Apart from the sequence-unrelated SufR found in cyanobacteria (31, 32), no IscR homolog was described in Grampositive bacteria, with the possible exception of some species of the Clostridium genus for which functional data are still lacking (30). In T. potens, the TherJR_1914 gene encodes a protein of the Rrf2 family of transcriptional regulators, sharing only 37% identity with E. coli IscR but with full conservation of the cysteine residues known to coordinate the [2Fe-2S] cluster (Cys 92, 98, 104 ,E. coli numbering) (Fig. 1C)(10). Clusterless (apo) IscR from E. coli was shown to activate suf operon expression during stress conditions, such as iron starvation (6). The as-purified apo form of the protein encoded by T. potens gene TherJR_1914 (apo-IscR Tp -wt) was found to bind to the upstream region of the putative suf operon, between genes TherJR_0922 and TherJR_0923 (Fig. 1D). A similar behavior was observed for a triple mutant (C92/101/107S) of IscR Tp (apoIscR Tp )(Fig.1D) where all putative cluster-binding cysteine residues (Fig. 1C) were replaced by serine. Given the structural similarity between cysteine and serine and the requirement for homogeneous sample for downstream functional and structural assays, this variant was used in all experiments where the apo form of IscR Tp was required. The ability of apo-IscR Tp -wt and apo-IscR Tp to bind the promoter region of the suf operon suggests that IscR Tp canfunctionasanFe/Sclusterregulatorin this organism, with the apo form involved in the regulation of the suf operon expression, as observed for E. coli. Although such regulators have been found and characterized in a number of Gram-negative bacteria (7, 8, 33–35), the characterization of orthologous proteins from Gram-positive species has not yet been reported. Therefore, T. potens has a unique organization and regulation of Fe/S cluster assembly genes, among Grampositive bacteria. Overall Structure of T. potens IscR. The 3D structure of free apo T. potens IscR, with the putative cluster-binding cysteines mutated to serine (the clusterless IscR triple-mutants C92/101/107S for T. potens or C92/98/104S for E. coli are hereby termed apoIscR Tp and apo-IscR Ec , respectively) was determined by X-ray crystallography from tetragonal (P4 1 ) crystals diffracting to 1.6-Å resolution. The crystallographic asymmetric unit contains the functional IscR homodimer (Fig. 2A). Apo-IscR Tp monomers 2of10 | www.pnas.org/cgi/doi/10.1073/pnas.1322728111 Santos et al. 20]. Ligand dilutions were prepared in assay buffer without Tween 20 and mixed with each protein sample at a volume ratio of 1:1. Measurements with apo-IscR Tp , apo-IscR Tp P40S, and apo-IscR Tp E43A were performed in standard capillaries whereas hydrophilic capillaries were used for measurements with apo-IscR Ec E43A. For each interaction, data from at least two independent runs were averaged, and the average curve was fitted with NTAnalysis software (NanoTemper Technologies). Crystallization of apo-IscR Tp and apo-IscR Ec :hya Complex. Initial crystallization conditions for apo-IscR Tp were screened at 20 °C using the sitting-drop method with commercial sparse-matrix crystallization screens. Drops consisting of equal volumes (1 μL) of protein (at 20 mg/mL) and precipitant solution were equilibrated against a 300-μL reservoir. Crystals were obtained after 2 d using 0.1 M Bis-Tris (pH 6.5) and 3 M NaCl as precipitant. Before data collection, crystals were cryoprotected by immersing them briefly in a 1:1 mixture of precipitant solution and 40% (vol/vol) of 2 mg/mL NDSB-201 (3-(1-pyridino)-1-propane sulfonate) solution in ethylene glycol and flashcooled in liquid nitrogen (46). Selenomethionyl apo-IscR Tp crystallized in the same conditions and was cryoprotected following the procedure described above. A 3.8-fold molar excess of apo-IscR Ec was mixed with double-stranded oligonucleotide (prepared as described in Electrophoretic Mobility-Shift Assay) comprising region −30 to −55 of the E. coli hya promoter sequence with a single-base 5′overhang (hya_26_OH)(Table S1) and incubated at room temperature for 30 min. The complex was either used immediately or flash frozen in liquid nitrogen and stored at −80 °C. Initial crystallization conditions were established at the High Throughput Crystallization Laboratory of the European Molecular Biology Laboratory, using the sitting-drop method. Crystals were obtained at 20 °C, from 0.2-μL drops composed of identical volumes of complex solution [350 μM protein and 92 μM oligonucleotide in 40 mM Tris·HCl (pH 8.0), 150 mM KCl, 10% (vol/vol) glycerol, 1 mM DTT] and of precipitant [0.1 M citric acid (pH 4.0 or 6.0), 1 M lithium chloride, 20% (wt/vol) PEG 6000]. Better and larger crystals could be obtained from the condition at pH 4.0 using the hanging-drop vapor diffusion method. The optimized crystals were cryoprotected in the same conditions as the apoIscR Tp crystals. Data Collection and Processing. X-ray diffraction data were collected from cooled (100 K) single crystals at synchrotron beam lines ID29 (apo-IscR Tp and Se-Met apo-IscR Tp ) (47) and ID23-EH2 (apo-IscR Ec :hya complex) (48) of the European Synchrotron Radiation Facility. The apo-IscR Tp data were recorded on a Pilatus 6M detector (Dectris) using a wavelength of 0.9763 Å (native dataset) or 0.9792 Å (Se-Met dataset). For the native data, 1,200 images were collected in 0.1° oscillation steps with 0.1-s exposure per frame whereas, for the Se-Met data, 3,600 images were recorded in 0.1° oscillation steps with 0.037-s exposure per frame. The apo-IscR Ec :hya complex data were recorded on a MX-225 detector (Marresearch) using a wavelength of 0.8726 Å. One hundred images were collected in 0.95° oscillation steps with 5.43-s exposure per frame. Diffraction data were integrated with XDS (49), scaled with XSCALE (50), and reduced with utilities from the CCP4 program suite (51). Data collection statistics are summarized in Table 2. Structure Solution and Refinement. The structure of apo-IscR Tp was solved by single-wavelength anomalous diffraction using the anomalous signal of selenium-substituted crystals with the SHELXC/SHELXD/SHELXE pipeline (52) and the HKL2MAP GUI (53). The resulting electron density maps were readily interpretable. The structure of the apo-IscR Ec :hya complex was solved by molecular replacement with PHASER (54) using a truncated version of the refined apo-IscR Tp structure as search model. For both structures, alternating cycles of model building with COOT (55) and of refinement with PHENIX (56) were performed until model completion. For the apo-IscR Tp structure, the final model comprises residues Gly-3 to Gly85 and Ser101 to Ile149 for subunit Table 2. Statistics of data collection, processing, and refinement Dataset T. potens IscR* (native) T. potens IscR* (Se-Met) E. coli IscR-DNA complex* Crystallographic analysis Wavelength, Å 0.9763 0.9792 0.8726 Space group P4 1 P4 1 P2 1 2 1 2 1 Unit cell dimensions, Å a =b=53.6; c =118.4 a =b=53.4; c =118.7 a =49.0; b =75.8; c =173.4 Resolution range, Å 53.6–1.60 (1.69–1.60) 48.7–2.47 (2.61–2.47) 46.0–2.49 (2.62–2.49) Reflections (measured/unique) 196,159/43,750 (28,394/6,325) 111,297/11,861 (13,614/1,647) 87,182/23,387 (12,463/3,244) Completeness, % 99.7 (98.7) 99.1 (94.1) 99.3 (96.3) Multiplicity 4.5 (4.5) 9.4 (8.3) 3.7 (3.8) R merge† 0.046 (1.299) 0.190 (1.573) 0.103 (0.911) R pim‡ 0.024 (0.688) 0.064 (0.555) 0.061 (0.531) 〈I/σ(I)〉14.3 (1.6) 7.3 (1.4) 8.6 (1.5) Monomers per asymmetric unit 2 2 2 Mathews coefficient, Å 3 ·Da −1 2.53 2.52 3.13 Solvent content, % 51.4 51.2 60.7 Structure refinement Resolution range, Å 48.8–1.60 —46.0–2.49 R factor§ /Free R factor¶ 0.202/0.220 —0.207/0.251 Unique reflections (work/test set) 41,642/1,973 —22,057/1,193 Water molecules 156 —15 Total no. of atoms 2,363 —2,999 No. of macromolecule atoms 2,205 —2,984 rmsd bond lengths, Å 0.011 —0.008 rmsd bond angles, ° 1.09 —1.38 Average overall B factor, Å 2 38.1 —77.7 Ramachandran favored, % 97.5 —96.0 Ramachandran outliers, % 0.0 —0.4 PDB entry 4cic —4chu *Values in parentheses correspond to the outermost resolution shell. Each dataset was recorded from a single crystal. † R merge =P hkl P i jI i (hkl)–〈I(hkl)〉j/P hkl P i I i (hkl), where I i (hkl) is the observed intensity and〈I(hkl)〉is the average intensity of multiple observations of symmetry-related reflections. ‡ R pim =P hkl [1/(N–1)] 1/2 P i jI i (hkl)–〈I(hkl)〉j/P hkl P i I i (hkl), where I i (hkl) is the observed intensity and〈I(hkl)〉is the average intensity of multiple observations of symmetry-related reflections. § R factor =PjjF o j−jF c jj/PjF o j, where jF o jand jF c jare observed and calculated structure factor amplitudes, respectively. ¶ Free R factor is the cross-validation R factor computed for a randomly chosen subset of 5% of the total number of reflections, which were not used during refinement. Santos et al. PNAS Early Edition | 9of10 BIOCHEMISTRY PNAS PLUS A and Gly-3 to Gly85 and Ser101 to Tyr148 for subunit B whereas the apoIscR Ec :hya complex comprises residues Met0 to Asp88 and Lys103 to Ser139 for subunit A, and Gly1 to Asp84 and Gln93 to Val135 for subunit B. Model refinement statistics are summarized in Table 2. ACKNOWLEDGMENTS. We thank Jorge Vieira for help with Automatic Detection of Positively Selected Sites. We acknowledge the European Synchrotron Radiation Facility (ESRF) for provision of synchrotron radiation facilities and thank the ESRF staff for help with data collection. Microscale thermophoresis data collection was carried out at the Campus Science Support Facilities Protein Technologies Facility (www.csf.ac.at). This work was funded by Fundo Europeu de Desenvolvimento Regional through the Operational Competitiveness Programme-COMPETE and by national funds through Fundação para a Ciência e a Tecnologia under project FCOMP-010124-FEDER-028116 (PTDC/BBB ‐BEP/2127/2012) and PhD Fellowship SFRH/ BD/66461/2009 (to J.A.S.). The research leading to these results has received funding from the European Community’s Seventh Framework Programme (FP7/2007-2013) under BioStruct-X (Grant Agreement 283570). 1. Beinert H, Holm RH, Münck E (1997) Iron-sulfur clusters: Nature’s modular, multipurpose structures. Science 277(5326):653–659. 2. Ayala-Castro C, Saini A, Outten FW (2008) Fe-S cluster assembly pathways in bacteria. Microbiol Mol Biol Rev 72(1):110–125. 3. Fontecave M, Choudens SO, Py B, Barras F (2005) Mechanisms of iron-sulfur cluster assembly: The SUF machinery. J Biol Inorg Chem 10(7):713–721. 4. Takahashi Y, Nakamura M (1999) Functional assignment of the ORF2-iscS-iscU-iscAhscB-hscA-fdx-ORF3 gene cluster involved in the assembly of Fe-S clusters in Escherichia coli.JBiochem126(5):917–926. 5. Takahashi Y, Tokumoto U (2002) A third bacterial system for the assembly of ironsulfur clusters with homologs in archaea and plastids. J Biol Chem 277(32): 28380–28383. 6. Outten FW, Djaman O, Storz G (2004) A suf operon requirement for Fe-S cluster assembly during iron starvation in Escherichia coli.Mol Microbiol 52(3):861–872. 7. Schwartz CJ, et al. (2001) IscR, an Fe-S cluster-containing transcription factor, represses expression of Escherichia coli genes encoding Fe-S cluster assembly proteins. Proc Natl Acad Sci USA 98(26):14895–14900. 8. Giel JL, Rodionov D, Liu M, Blattner FR, Kiley PJ (2006) IscR-dependent gene expression links iron-sulphur cluster assembly to the control of O2-regulated genes in Escherichia coli.Mol Microbiol 60(4):1058–1075. 9. Lee KC, Yeo WS, Roe JH (2008) Oxidant-responsive induction of the suf operon, encoding a Fe-S assembly system, through Fur and IscR in Escherichia coli.J Bacteriol 190(24):8244–8247. 10. Yeo WS, Lee JH, Lee KC, Roe JH (2006) IscR acts as an activator in response to oxidative stress for the suf operon encoding Fe-S assembly proteins. Mol Microbiol 61(1):206–218. 11. Giel JL, et al. (2013) Regulation of iron-sulphur cluster homeostasis through transcriptional control of the Isc pathway by [2Fe-2S]-IscR in Escherichia coli.Mol Microbiol 87(3):478–492. 12. Nesbit AD, Giel JL, Rose JC, Kiley PJ (2009) Sequence-specific binding to a subset of IscR-regulated promoters does not require IscR Fe-S cluster ligation. J Mol Biol 387(1): 28–41. 13. Rajagopalan S, et al. (2013) Studies of IscR reveal a unique mechanism for metaldependent regulation of DNA binding specificity. Nat Struct Mol Biol 20(6):740–747. 14. Riboldi GP, Verli H, Frazzon J (2009) Structural studies of the Enterococcus faecalis SufU [Fe-S] cluster protein. BMC Biochem 10:3. 15. Riboldi GP, de Oliveira JS, Frazzon J (2011) Enterococcus faecalis SufU scaffold protein enhances SufS desulfurase activity by acquiring sulfur from its cysteine-153. Biochim Biophys Acta 1814(12):1910–1918. 16. Albrecht AG, et al. (2010) SufU is an essential iron-sulfur cluster scaffold protein in Bacillus subtilis.J Bacteriol 192(6):1643–1651. 17. Byrne-Bailey KG, et al. (2010) Complete genome sequence of the electricity-producing “Thermincola potens”strain JR. J Bacteriol 192(15):4078–4079. 18. Carlson HK, et al. (2012) Surface multiheme c-type cytochromes from Thermincola potens and implications for respiratory metal reduction by Gram-positive bacteria. Proc Natl Acad Sci USA 109(5):1702–1707. 19. Riboldi GP, de Mattos EP, Frazzon J (2013) Biogenesis of [Fe-S] cluster in Firmicutes:An unexploited field of investigation. Antonie van Leeuwenhoek 104(3):283–300. 20. Zheng L, Cash VL, Flint DH, Dean DR (1998) Assembly of iron-sulfur clusters. Identification of an iscSUA-hscBA-fdx gene cluster from Azotobacter vinelandii.J Biol Chem 273(21):13264–13272. 21. Yuvaniyama P, Agar JN, Cash VL, Johnson MK, Dean DR (2000) NifS-directed assembly of a transient [2Fe-2S] cluster within the NifU protein. Proc Natl Acad Sci USA 97(2):599–604. 22. Rangachari K, et al. (2002) SufC hydrolyzes ATP and interacts with SufB from Thermotoga maritima.FEBS Lett 514(2-3):225–228. 23. Saini A, Mapolelo DT, Chahal HK, Johnson MK, Outten FW (2010) SufD and SufC ATPase activity are required for iron acquisition during in vivo Fe-S cluster formation on SufB. Biochemistry 49(43):9402–9412. 24. Silberg JJ, Tapley TL, Hoff KG, Vickery LE (2004) Regulation of the HscA ATPase reaction cycle by the co-chaperone HscB and the iron-sulfur cluster assembly protein IscU. J Biol Chem 279(52):53924–53931. 25. Trotter V, et al. (2009) The CsdA cysteine desulphurase promotes Fe/S biogenesis by recruiting Suf components and participates to a new sulphur transfer pathway by recruiting CsdL (ex-YgdL), a ubiquitin-modifying-like protein. Mol Microbiol 74(6): 1527–1542. 26. Selbach BP, et al. (2014) Fe-S cluster biogenesis in Gram-positive bacteria: SufU is a zinc-dependent sulfur transfer protein. Biochemistry 53(1):152–160. 27. Chahal HK, Dai Y, Saini A, Ayala-Castro C, Outten FW (2009) The SufBCD Fe-S scaffold complex interacts with SufA for Fe-S cluster transfer. Biochemistry 48(44): 10644–10653. 28. Tian T, He H, Liu XQ (2014) The SufBCD protein complex is the scaffold for iron-sulfur cluster assembly in Thermus thermophiles HB8. Biochem Biophys Res Commun 443(2): 376–381. 29. Hoff KG, Ta DT, Tapley TL, Silberg JJ, Vickery LE (2002) Hsc66 substrate specificity is directed toward a discrete region of the iron-sulfur cluster template protein IscU. J Biol Chem 277(30):27353–27359. 30. André G, et al. (2010) Global regulation of gene expression in response to cysteine availability in Clostridium perfringens.BMC Microbiol 10:234. 31. Shen G, et al. (2007) SufR coordinates two [4Fe-4S]2+,1+clusters and functions as a transcriptional repressor of the sufBCDS operon and an autoregulator of sufR in cyanobacteria. J Biol Chem 282(44):31909–31919. 32. Wang T, et al. (2004) The sufR gene (sll0088 in Synechocystis sp. strain PCC 6803) functions as a repressor of the sufBCDS operon in iron-sulfur cluster biogenesis in cyanobacteria. J Bacteriol 186(4):956–967. 33. Choi YS, et al. (2007) Identification of Pseudomonas aeruginosa genes crucial for hydrogen peroxide resistance. J Microbiol Biotechnol 17(8):1344–1352. 34. Runyen-Janecky L, et al. (2008) Role and regulation of iron-sulfur cluster biosynthesis genes in Shigella flexneri virulence. Infect Immun 76(3):1083–1092. 35. Zeng J, Zhang K, Liu J, Qiu G (2008) Expression, purification, and characterization of iron-sulfur cluster assembly regulator IscR from Acidithiobacillus ferrooxidans. J Microbiol Biotechnol 18(10):1672–1677. 36. Shepard W, et al. (2011) Insights into the Rrf2 repressor family—the structure of CymR, the global cysteine regulator of Bacillus subtilis.FEBS J 278(15):2689–2701. 37. Ji Q, et al. (2012) Staphylococcus aureus CymR is a new thiol-based oxidation-sensing regulator of stress resistance and oxidative response. JBiolChem287(25): 21102–21109. 38. Gregoret LM, Rader SD, Fletterick RJ, Cohen FE (1991) Hydrogen bonds involving sulfur atoms in proteins. Proteins 9(2):99–107. 39. Zhou P, Tian F, Lv F, Shang Z (2009) Geometric characteristics of hydrogen bonds involving sulfur atoms in proteins. Proteins 76(1):151–163. 40. Fuentes-Prior P, Salvesen GS (2004) The protein structures that shape caspase activity, specificity, activation and inhibition. Biochem J 384(Pt 2):201–232. 41. Turk V, et al. (2012) Cysteine cathepsins: From structure, function and regulation to new frontiers. Biochim Biophys Acta 1824(1):68–88. 42. Prischi F, et al. (2010) Of the vulnerability of orphan complex proteins: The case study of the E. coli IscU and IscS proteins. Protein Expr Purif 73(2):161–166. 43. Olichon A, Surrey T (2007) Selection of genetically encoded fluorescent single domain antibodies engineered for efficient expression in Escherichia coli.J Biol Chem 282(50): 36314–36320. 44. Carpenter ML, Kneale GG (1994) Circular dichroism for the analysis of protein-DNA interactions. Methods Mol Biol 30:339–345. 45. Jerabek-Willemsen M, Wienken CJ, Braun D, Baaske P, Duhr S (2011) Molecular interaction studies using microscale thermophoresis. Assay Drug Dev Technol 9(4): 342–353. 46. Pereira PJ, et al. (2008) Mycobacterium tuberculosis glucosyl-3-phosphoglycerate synthase: Structure of a key enzyme in methylglucose lipopolysaccharide biosynthesis. PLoS ONE 3(11):e3748. 47. de Sanctis D, et al. (2012) ID29: A high-intensity highly automated ESRF beamline for macromolecular crystallography experiments exploiting anomalous scattering. J Synchrotron Radiat 19(Pt 3):455–461. 48. Flot D, et al. (2010) The ID23-2 structural biology microfocus beamline at the ESRF. J Synchrotron Radiat 17(1):107–118. 49. Kabsch W (2010) XDS. Acta Crystallogr D Biol Crystallogr 66(Pt 2):125–132. 50. Kabsch W (2010) Integration, scaling, space-group assignment and post-refinement. Acta Crystallogr D Biol Crystallogr 66(Pt 2):133–144. 51. Collaborative Computational Project, Number 4 (1994) The CCP4 suite: Programs for protein crystallography. Acta Crystallogr D Biol Crystallogr 50(Pt 5):760–763. 52. Sheldrick GM (2010) Experimental phasing with SHELXC/D/E: Combining chain tracing with density modification. Acta Crystallogr D Biol Crystallogr 66(Pt 4):479–485. 53. Pape T, Schneider TR (2004) HKL2MAP: A graphical user interface for macromolecular phasing with SHELX programs. J Appl Cryst 37:843–844. 54. McCoy AJ, et al. (2007) Phaser crystallographic software. J Appl Cryst 40(Pt 4):658–674. 55. Emsley P, Cowtan K (2004) Coot: Model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr 60(Pt 12 Pt 1):2126–2132. 56. Adams PD, et al. (2010) PHENIX: A comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr 66(Pt 2):213–221. 57. Reboiro-Jato D, et al. (2012) ADOPS—Automatic Detection Of Positively Selected Sites. J Integr Bioinform 9(3):200. 58. Thompson JD, Gibson TJ, Higgins DG (2002) Multiple sequence alignment using ClustalW and ClustalX. Curr Protoc Bioinformatics Chapter 2: Unit 2 3. 59. Bond CS, Schüttelkopf AW (2009) ALINE: A WYSIWYG protein-sequence alignment editor for publication-quality alignments. Acta Crystallogr D Biol Crystallogr 65(Pt 5): 510–512. 60. Holm L, Rosenström P (2010) Dali server: Conservation mapping in 3D. Nucleic Acids Res 38(Web Server issue):W545–W549. 10 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1322728111 Santos et al. Supporting Information Santos et al. 10.1073/pnas.1322728111 Fig. S1. Thermincola potens Fe/S cluster scaffold protein displays the conserved features of IscU-type scaffolds from Gram-negative bacteria. Amino acid sequence alignment of the T. potens TherJR_1912 gene product and homologous proteins from both Gram-positive (Enterococcus faecalis,Streptococcus pyogenes,Bacillus subtilis) and Gram-negative bacteria (Escherichia coli). Strictly conserved amino acids are highlighted in red and increasing residue conservation is represented by a color gradient from green to red. Cysteine residues known to coordinate the Fe/S cluster are denoted by a star (1), the “LPPVK” HscA-binding motif is represented in bold (2), and the characteristic Gram-positive insertion is underlined (3). Numbers above the alignment refer to the T. potens amino acid sequence numbering. Alignment prepared with ClustalW (4) and colored with Aline (5). 1. Mansy SS, Wu G, Surerus KK, Cowan JA (2002) Iron-sulfur cluster biosynthesis. Thermatoga maritima IscU is a structured iron-sulfur cluster assembly protein. J Biol Chem 277(24):21397– 21404. 2. Hoff KG, Silberg JJ, Vickery LE (2000) Interaction of the iron-sulfur cluster assembly protein IscU with the Hsc66/Hsc20 molecular chaperone system of Escherichia coli.Proc Natl Acad Sci USA 97(14):7790–7795. 3. Riboldi GP, Verli H, Frazzon J (2009) Structural studies of the Enterococcus faecalis SufU [Fe-S] cluster protein. BMC Biochem 10:3. 4. Larkin MA, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23(21):2947–2948. 5. Bond CS, Schüttelkopf AW (2009) ALINE: A WYSIWYG protein-sequence alignment editor for publication-quality alignments. Acta Crystallogr D Biol Crystallogr 65(Pt 5):510–512. Fig. S2. The overall structure of the biologically active iron-sulfur cluster (ISC) pathway regulator (IscR) dimer is mostly unchanged upon DNA binding. (A) Superposition of the 3D structures of free apo-IscR Tp (green), free E. coli apo-IscR (magenta; PDB ID code 4HF0), and hya promoter-bound apo-IscR Ec (blue). (B) Superposition of the 3D structures of free apo-IscR Tp and hya promoter-bound apo-IscR Ec (colors as in A). The molecules were rotated ∼90° around y, relative to the view in A.(C) An asymmetric electrostatic surface orients the functional apo-IscR Ec dimer toward its hya DNA target. Positive surface electrostatic potential is shown in blue and negative in red. The DNA molecule backbone is depicted as a white ribbon with bases in green. Santos et al. www.pnas.org/cgi/content/short/1322728111 1of3 Fig. S3. The T. potens isc promoter region contains two binding sites for IscR Tp .(A) DNA recognition was assessed by electrophoretic mobility-shift assay of the complexes formed between apo-IscR Tp or apo-IscR Tp E43A and either the full (iscTp_1) or trimmed (iscTp_2)isc promoter sequence. DNA band-shifts are denoted by arrows. (B,Upper) Time course of Fe/S cluster assembly on apo-IscR Tp -wt. There is a time-dependent increase of the characteristic Fe/S cluster absorption peak at 420 nm for reconstituted apo-IscR Tp -wt (R-IscR Tp -wt; blue circles) whereas no noticeable variation could be observed for the assay performed in the absence of cysteine (NR-IscR Tp -wt, black circles). At the end of the assay, the reaction containing R-IscR Tp -wt displayed a characteristic brown color (upper cuvette; R), which was essentially absent in the control reaction (lower cuvette; NR). (Lower) UV/Visible absorption spectra of R-IscR Tp -wt. The spectrum of purified R-IscR Tp -wt (blue curve) displays local maxima at 420 nm and 320 nm that are characteristic of Fe/S clusters, which disappeared upon reduction with 2 mM dithionite (red curve). (C) Fe/S cluster binding modulates recognition of type-1 promoter DNA sequences by IscR. Circular dichroism spectra of iscTp_1 DNA sequence (Table S1) with increasing concentrations of R-IscR Tp -wt (Upper) or NR-IscR Tp -wt (Lower). The spectra were recorded upon successive additions of each purified protein to an iscTp_1 solution (2 μM). A significant change in ellipticity at the characteristic B-DNA peak at 285 nm (1, 2) can be observed only upon R-IscR Tp -wt addition, indicating that only the Fe/S cluster-containing form of IscR Tp -wt is able to recognize the T. potens isc promoter sequence and induce local DNA structural changes. Experiments were carried out at 20 °C in 40 mM Tris (pH 8), 150 mM KCl, 5% (vol/vol) glycerol, 1 mM DTT. 1. Carpenter ML, Kneale GG (1994) Circular dichroism for the analysis of protein-DNA interactions. Methods Mol Biol 30:339–345. 2. Carpenter ML, Kneale GG (1991) Circular dichroism and fluorescence analysis of the interaction of Pf1 gene 5 protein with poly(dT). J Mol Biol 217(4):681–689. Table S1. Oligonucleotides used in binding and crystallization assays Name Sequence hyaEc 5′-AAATCCACAC AGTTTGTATT GTTTTG-3′ iscbEc 5′-TAAATAGTTG ACCAATTTAC TCGGGAATGT CAGACT-3′ iscTp_1 5′-TAAAAAATCT TAGTATTTTA GTTGGAATTT TTCTTGACCA GAAAATAACT GTATGC-3′ iscTp_2 5′-TAAAAAATCT TAGTATTTTA GTTGGAATTT TTCTTGACC-3′ iscTp_3 5′-TAAAAAATCT TAGTATTTTA GTTGGAATT-3′ iscTp_4 5′-TTTTTCTTGA CCAGAAAATA ACTGTATGC-3′ iscTp_5 5′-TAAAAAATCT TAGTATTTTA GTTGGAA-3′ hya_26_OH 5′-GAAATCCACA CAGTTTGTAT TGTTTTG-3′ suf 5′-CGCTTTATAT TTAGGAAAGA TGCAGCGCCG GCTATAAAAT AGCCGGCTTT TTCTAAGCTC TTAATCAATA GCCGGATCCA ATTATTGTAG AATCCTGCCC AAAATTATTT GTACTTTTTT ATCCCGGCAG GAGGATAAAT GTGGGTGGAC AAAGAAAAAT ACCCCTGTAG TTTTTGGATT TAAACCAGGA ATCCGTCAGG AGGGAATATT GCGCTTTATA TTTAGGAAAG ATGCAGCGCC GGCTATAAAA TAGCCGGCTT TTTCTAAGCT CTTAATCAAT AGCCGGATCC AATTATTGTA GAATCCTGCC CAAAATTATT TGTACTTTTT TATCCCGGCA GGAGGATAAA TGTGGGTGGA CAAAGAAAAA TACCCCTGTA GTTTTTGGAT TTAAACCAGG AATCCGTCAG GAGGGAATAT TG-3′ Santos et al. www.pnas.org/cgi/content/short/1322728111 2of3 Table S2. Binding affinities between IscR and type-1 and type-2 promoter sequences determined by microscale thermophoresis DNA sequence IscR variant Dissociation constant K d ,nM hyaEc Apo-IscR Ec E43A 180 ±18 Apo-IscR Tp E43A 340 ±52 Apo-IscR Tp n.d. Apo-IscR Tp P40S 11,900 ±3,340 iscbEc Apo-IscR Ec E43A 154 ±7 Apo-IscR Tp E43A 97 ±6 Apo-IscR Tp n.d. iscTp_3 Apo-IscR Tp E43A 320 ±19 Apo-IscR Tp n.d. iscTp_4 Apo-IscR Tp E43A 905 ±87* Apo-IscR Tp n.d. iscTp_5 Apo-IscR Tp E43A n.d. n.d., binding not detected. *The K d value might be overestimated because saturation was not reached. Santos et al. www.pnas.org/cgi/content/short/1322728111 3of3