Midbiotics : conjugative plasmids for genetic engineering of natural gut flora

This is a self-archived version of an original article. This version may differ from the original in pagination and typographic details. Author(s): Title: Year: Version: Copyright: Rights: Rights url: Please cite the original version: CC BY-NC-ND 4.0 https://creativecommons.org/licenses/by-nc-nd/4.0/ Midbiotics : conjugative plasmids for genetic engineering of natural gut flora © 2019 The Authors Published version Ruotsalainen, Pilvi; Penttinen, Reetta; Mattila, Sari; Jalasvuori, Matti Ruotsalainen, P., Penttinen, R., Mattila, S., & Jalasvuori, M. (2019). Midbiotics : conjugative plasmids for genetic engineering of natural gut flora. Gut Microbes, 10(6), 643-653. https://doi.org/10.1080/19490976.2019.1591136 2019 Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=kgmi20 Gut Microbes ISSN: 1949-0976 (Print) 1949-0984 (Online) Journal homepage: https://www.tandfonline.com/loi/kgmi20 Midbiotics: conjugative plasmids for genetic engineering of natural gut flora Pilvi Ruotsalainen, Reetta Penttinen, Sari Mattila & Matti Jalasvuori To cite this article: Pilvi Ruotsalainen, Reetta Penttinen, Sari Mattila & Matti Jalasvuori (2019) Midbiotics: conjugative plasmids for genetic engineering of natural gut flora, Gut Microbes, 10:6, 643-653, DOI: 10.1080/19490976.2019.1591136 To link to this article: https://doi.org/10.1080/19490976.2019.1591136 © 2019 The Author(s). Published with license by Taylor & Francis Group, LLC. View supplementary material Published online: 05 Apr 2019. Submit your article to this journal Article views: 2096 View related articles View Crossmark data BRIEF REPORT Midbiotics: conjugative plasmids for genetic engineering of natural gut flora Pilvi Ruotsalainen a , Reetta Penttinen a , Sari Mattila b , and Matti Jalasvuori a,c a University of Jyväskylä, Department of Biological and Environmental Science, Nanoscience Center, Jyväskylä, Finland; b Department of Biological Sciences, University of Helsinki, Helsinki, Finland; c Department of Genetics, University of Cambridge, Cambridge, UK ABSTRACT The possibility to modify gut bacterial flora has become an important goal, and various approaches are used to achieve desirable communities. However, the genetic engineering of existing microbes in the gut, which are already compatible with the rest of the community and host immune system, has not received much attention. Here, we discuss and experimentally evaluate the possibility to use modified and mobilizable CRISPR-Cas9-endocing plasmid as a tool to induce changes in bacterial communities. This plasmid system (briefly midbiotic) is delivered from bacterial vector into target bacteria via conjugation. Compared to, for example, bacteriophage-based applications, the benefits of conjugative plasmids include their independence of any particular receptor(s) on host bacteria and their relative immunity to bacterial defense mechanisms (such as restriction-modification systems) due to the synthesis of the complementary strand with host-specific epigenetic modifications. We show that conjugative plasmid in association with a mobilizable antibiotic resistance gene targeting CRISPR-plasmid efficiently causes ESBL-positive transconjugants to lose their resistance, and multiple gene types can be targeted simultaneously by introducing several CRISPR RNA encoding segments into the transferred plasmids. In the rare cases where the midbiotic plasmids failed to resensitize bacteria to antibiotics, the CRISPR spacer- (s) and their adjacent repeats or larger regions were found to be lost. Results also revealed potential caveats in the design of conjugative engineering systems as well as workarounds to minimize these risks. ARTICLE HISTORY Received 19 November 2018 Revised 19 February 2019 Accepted 28 February 2019 KEYWORDS Genetic engineering; antibiotic resistance; ESBL carriage; conjugative plasmid; CRISPR editing; enterobacteria Introduction The possibility to engineer gut microbiome has become a notable avenue of research. Restoration of microbial balance in the gut can provide a cure to a multitude of complex diseases. Nonetheless, stable installation of foreign beneficial microbes in the gut is problematic. Studies have shown that dietary supplement bacteria (probiotics) disappear from the community soon after their ingestion ceases. 1,2 This has led many teams to compile bacterial cocktails that would establish a more stable population within the gut. 3 Also, the nearcomplete replacement of gut flora has been used to revert dysbiosis. This so-called bacterial transplantation is an effective approach to cure especially recurrent diarrhea caused by Clostridium difficile, 4-6 but could also be used to improve various other conditions. 7 The composition of gut flora is also sensitive to diet, and, for example, increase of fiber can result in notable shifts in the community composition. 8 In some circumstances, however, the possibility to modify the genomes of existing bacteria in the gut could provide an alternative to remodel the system. So far, the genetic engineering of bacterial communities in situ has mainly focused on bacteriophage-based applications. 9,10 Conjugative plasmids offer an alternative route with differing engineering qualities. They are circular antagonistic genetic elements that can mediate their own transfer from one bacterium to another. In addition, these selftransmissible plasmids can co-transfer nonconjugative plasmids with appropriate oriT site. 11 The relaxosome of the conjugative plasmid recognizes the similar oriT site in non-conjugative plasmid and mobilizes it through conjugation. 12 The exact conjugation mechanisms vary between plasmids, but they all form a channel between the cells through which the plasmid is usually transported as CONTACT Matti Jalasvuori [email protected] Department of Biological and Environmental Science, University of Jyväskylä, Survontie 9C, Ambiotica Building, Jyväskylä, Finland Supplemental data for this article can be accessed on the publisher’s website. GUT MICROBES 2019, VOL. 10, NO. 6, 643–653 https://doi.org/10.1080/19490976.2019.1591136 © 2019 The Author(s). Published with license by Taylor & Francis Group, LLC. This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivatives License (http://creativecommons.org/licenses/by-ncnd/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited, and is not altered, transformed, or built upon in any way. a single-stranded DNA molecule to the recipient bacterium. Plasmids can be readily modified with various molecular biology methods, thus providing a relatively simple platform for carrying out in situ genetic engineering of bacterial cells. Given that the diversity of gut microbiota varies even between genetically identical twins, 13 the attempts to colonize maladapted (engineered) bacteria within an already established community can be a challenging if not an impossible task. In this respect, the introduction of an engineered mobile element into the existing community instead of relying on the establishment of an entire bacterium provides a potential workaround for deploying desired functionalities within the system. Given the established concepts of probiotics (health-promoting bacteria) and prebiotics (nutrients that promote the growth of beneficial bacteria), ”midbiotics”(plasmid-probiotics in a sense) provide yet an alternative form of biotic substances that can be used to acquire beneficial changes in the gut flora. Naturally, such plasmids have only limited use, albeit, in certain instances, they may be even a preferable choice over probiotics such as when only particular genes need to be removed from the community. Plasmids are divided into incompatibility groups (Inc) based on their potential to stably coexist in a bacterial cell. In other words, two plasmids that share the same Inc-group cannot be maintained in a single cell indefinitely. Conjugative plasmids also often encode entryexclusion mechanisms that prevent related plasmids from entering the cell. Due to these natural features, the plasmids used for engineering should be uncommon in the targeted flora. Naturally, determining the existence of certain plasmid types routinely from a heterogenous community is a laborious task. Yet, certain antibiotic resistance–conferring plasmids of Enterobacteriaceae, for instance, are relatively rare in patients. Indeed, in a metastudy, Carattoli reviewed the prevalence of different resistance plasmid families in Extended Spectrum Beta-Lactamase (ESBL) strains. 14 Among the rarest were IncP-type plasmids. Despite this, conjugative IncP-plasmids are well-studied, they have a robust conjugation machinery and a broad host range. As such, they provide an example of potential backbones that could be utilized for engineering purposes. In bacteriophage-based applications, the genetic material within the phage is replaced, and as it infects a cell after the attachment to a specific receptor on the host cell surface, it delivers the genomic cargo into the bacterial host. 9,10 Phagebased tools have acquired notable attention and are currently under development toward drugs. The advantage of phages is that they have a narrow host range, and thus, they target specifically only the desired fraction of the bacterial community. Yet, bacteria rapidly become resistant to phages, and phages cannot be easily used to exert activity against even all variants of certain species. In this regard, conjugative plasmids provide qualities that could be useful for alternative and more generally applicable engineering purposes. As noted above, conjugative plasmids are usually delivered as a single DNA strand to the recipient cell. The complementing strand is synthesized in the recipient bacterium and thus it contains all the host-specific modifications in the nucleic acids. 15 This way the host does not recognize the incoming plasmid as foreign genetic material, which, in turn, allows the plasmid to establish itself into a natural community without prior knowledge of the features of bacteria therein. Additionally, unlike phages, conjugative plasmids are not dependent on specific receptors on host cells as plasmids require only cell-cell contact. And once plasmid gets into natural bacteria, it can further disseminate itself into the next host. The transfer rate from one bacterium to another is, of course, slower and less-precise than phagemediated delivery of DNA. This sets certain boundaries for the utilization of plasmids. Nevertheless, conjugative plasmids can provide a broad host range for introducing genetic material into the gut flora. The advent of CRISPR-Cas9 editing has provoked numerous studies where specific target sequences within various host organisms are modified, 16 even enabling strain-specific elimination of bacteria from heterologous communities. 10 Introduction of CRISPR-Cas9 editing components into conjugative plasmids provides a potential mean to remove unwanted genes such as those conferring antibiotic resistance from diverse bacterial systems. ESBL carriage refers to nonsymptomatic colonization of the gut by bacteria 644 P. RUOTSALAINEN ET AL. which are resistant to a wide range of different beta-lactam antibiotics. 17,18 This is of major concern, as beta-lactams are the most commonly used class of antimicrobials, owing to their broad spectrum and minimal side effects. They are abundantly administered to treat and prevent bacterial infections during various medical procedures. Over the past few decades, ESBL carriage has become increasingly more common among longterm hospitalized patients as well as in the community. 19 ESBL carriage serves as a reservoir of resistance genes and significantly increases the risk of clinical infections. 20-22 As such, we here set to evaluate the possibility to use conjugatively transferred plasmids to induce the loss of ESBL genes (located either in plasmids or in the chromosome) from a bacterial community. Results and discussion We constructed a midbiotic system consisting of ac onjugativeIncPplasmidRP4 23 and a mobilizable pCas9 plasmid containing Streptococcus pyogenes– derived CRISPR/Cas9 24 that targets conserved sites in two different beta-lactamase genes via plasmidencoded CRISPR RNA (crRNA). Part of RP4 originof-transfer (oriT) site was cloned into pCas9 plasmid in order to make it horizontally transferrable by the RP4-encoded relaxosome complex. Further, 543 bp region, including the target site of the CRISPR/Cas9 system, was deleted from the beta-lactamase gene blaTEM-2 of RP4 to prevent the system from selftargeting. From now on, the RP4 blaTEM−2Δ172−714 plasmidisreferredtoasdeliveryplasmidandthemodified pCas9 as pCRISPR plasmid, crRNA/multicrRNA referring to spacer(s) targeting the betalactamase gene(s). A donor bacterium (Escherichia coli HMS174) harboring midbiotic plasmids (delivery and pCRISPR-crRNA plasmids) was cocultured together with recipient E. coli strain (HB101) carrying a conjugative ESBL-plasmid pEC15 that encodes blaTEM-52b target gene. 25 The transfer of these plasmids to ESBL-positive bacteria and the subsequent coexpression of endonuclease Cas9 and crRNA should induce the loss of resistance by guiding the Cas9 complex to ESBL gene and create a double-stranded nick within the target site (Figure 1a). Nicking linearizes the plasmid and prevents its replication. Indeed, after 24 h, only approximately 1:10 000 transconjugants retained the resistance in comparison to a control treatment lacking the crRNA (Figure 1b). To rule out the possibility that this might result from the unequal conjugation rates between pCRISPR-crRNA and pCRISPR-control plasmid, both were conjugated independently to a recipient HB101 lacking the target plasmid (Figure 2a). Altogether, this suggests that in principle the dispersal of such midbiotics in the bacterial flora would relatively efficiently resensitize the ESBL-harbouring recipients to beta-lactams. Yet, while this approach appears promising in accelerating ESBL loss, there are still potential obstacles to be taken into account when specific genes are targeted with Cas9. These obstacles would be relevant to most in situ applications that seek to delete specific functions from the community (and sometimes in applications that attempt to introduce them); hence, we decided to take a closer look at the caveats and the realistic prospects of midbiotic engineering. In many cases, there can be multiple variants of the genes that encode undesired phenotypes. Forexample,thereisnosingleguidingcrRNA sequence that would direct Cas9 to all possible ESBL variants. However, all classes of betalactamase genes share sequences that are usually conserved within the class (Figure 3). Targeting these sites would provide a broad activity against the class regardless of specific knowledge of the variant in any particular case. When various crRNAs are combined into the same plasmid similarly to spacer arrays of natural CRISPR systems, several targets could be abolished with a single pCRISPR plasmid. We tested this by adding two crRNA coding sites separated by a repeat into the pCRISPR plasmid. This pCRISPR-multi-crRNA plasmid was then transferred into two bacterial strains each harboring a different type of an ESBL gene (blaTEM-52b and blaCTX-M-14). The plasmid exhibited the activity against both ESBL types, leading to a nearly 500-fold decrease in cell density in treated bacteria compared to control, suggesting that combination of crRNA sites could indeed be utilized to achieve broad activity (Figure 1c). GUT MICROBES 645 We further studied the individual bacteria that appeared to have avoided the anti-ESBL effect despite having been introduced with the midbiotic system. In other words, some bacteria which had received the pCRISPR-crRNA/multicrRNA plasmid still retained the resistance to betalactams (Figure 1b-c). Sequencing of CRISPR spacer locus of these plasmids (8 escape colonies/ replicate/experiment) revealed that the observed tolerance to the midbiotic treatment after 24 Figure 1. Midbiotic plasmids against ESBL-positive bacteria. (a). 1) Donor cell delivers midbiotic plasmid system (pCRISPR plasmid and delivery plasmid both of which share the same origin of transfer site, oriT) via conjugation into recipient target cell that harbors ESBL plasmid (pESBL). 2) After a successful delivery of the plasmids, the new host cell starts producing the components required for CRISPR/Cas9-activity (endonuclease Cas9, crRNA and tracrRNA, encoded by pCRISPR). 3) Cas9 cleaves the ESBL gene based on crRNA that is programmed to target a conserved region within the gene. 4) This results in degradation of ESBL plasmid. (b). Among the transconjugants (Transc) receiving the pCRISPR-crRNA, a difference of nearly four orders of magnitude in ESBL-positive bacteria was observed. Rec denotes the total number of recipient bacteria. Out of the survivors, the deletion of the spacer in the CRISPR locus of pCRISPR-crRNA plasmid (white arrowheads) explained the loss of activity. The mean cell density (cfu/ml) is calculated from a total of six replicates from two different experiments (n= 6). The black bars indicate the standard error of mean (SEM). (c). Transformation of pCRISPR-multi-crRNA into target bacteria caused the cell density of HB101(pEC13) (blaCTX-M) to decline by two orders of magnitude and HB101(pEC15) (blaTEM) by three orders of magnitude. The deletion of either one (green and yellow arrowheads) or both of the spacers (blue arrowheads) resulted in the survival of transformants. Larger deletion in CRISPR locus was most likely the reason for the unsuccessful amplification of some escape mutants, as the primer binding sites were located in the deletion (orange arrowheads). Some survivors contained the intact spacers, suggesting that Cas9 gene or the target sequence might carry mutations. The mean cell density is calculated from three replicates (n= 3). The black bars indicate the standard error of mean (SEM). Figure 2. Conjugation of midbiotic system. (a). The conjugation rates of pCRISPR-crRNA and pCRISPR-control plasmid are equal, determined by measuring the mobilization frequencies after 24 h conjugation. Therefore, the presence of spacers does not itself hinder the mobilization rate of the pCRISPR plasmid. The mean cell density was calculated from three replicates (n= 3). The black bars indicate the standard error of mean (SEM). (b). After 72 h, the delivery plasmid was observed to conjugate independently without the mobilizable pCRISPR-control plasmid, as the density of cells containing pCRISPR-control plasmid was two orders of magnitude lower than cells with delivery plasmid. Also, when 90 colonies from delivery plasmid selection plate were streaked on plate selecting for pCRISPR-control plasmid, none of them was observed to contain the pCRISPR-control plasmid. On the contrary, all the 90 colonies with pCRISPR-control plasmid also contained the delivery plasmid. The mean cell density was calculated from three replicates (n= 3). The black bars indicate the standard error of mean (SEM). 646 P. RUOTSALAINEN ET AL. h was mainly due to loss of the beta-lactamasetargeting spacer(s) and their adjacent repeat (see the graphic illustration of spacer deletions in Figure 1b-c). In some cases, however, we did not succeed to amplify the crRNA coding region at all, suggesting that a larger deletion might have occurred within the region. On the other hand, sometimes the crRNA site was unaltered, indicating potential changes elsewhere, such as mutations in tracrRNA, Cas9 or PAM sequence. 10 Nevertheless, the emergence of mutants may be difficult to prevent, but in principle several copies of the crRNA regions, for example, could be included in the plasmid, hence allowing it to retain its activity even if one of the sites is lost. Another potential concern derives from the separation of the midbiotic into two or more plasmids. It is possible that the delivery plasmid mobilizing the pCRISPR plasmid goes ‘rogue’and spreads alone in the community, thus attenuating the desired effect. We investigated this possibility by cultivating midbiotic bacteria (harboring pCRISPR control plasmid) together with ESBL-positive strain for 72 h during which the culture was refreshed once a day. All of the studied clones (90 colonies) with the mobilizable pCRISPR plasmid also contained the delivery plasmid. In contrast to this, all bacteria harboring the delivery plasmid had lost the pCRISPR plasmid (Figure 2b). This indicates that the mobilizable pCRISPR plasmid is not always delivered together with the conjugative plasmid, thus requiring countermeasures to minimize the probability of such events. There are at least two possibilities to achieve this: either the pCRISPR plasmid and delivery plasmid could be combined into a single plasmid or the toxin–antitoxin system could be separated so that the pCRISPR plasmid carries the gene for antitoxin and the delivery plasmid encodes the toxin. In the latter case, the dispersal of the delivery plasmid alone would lead to cytotoxic response and death of the recipient cell. Conjugative plasmids are agents in natural microbial communities, albeit not an inherent part of any particular strain or species. In the recent bloom in microbiota research, they have so far been a seldom utilized tool for inducing genetic changes in existing bacterial communities. Plasmids could be used both to introduce desired genes or remove existing ones. Whether they have applications beyond laboratories is yet to be demonstrated, and the possible spread of malevolent traits via horizontal gene transfer may be a deterrent against using plasmids for engineering purposes. Indeed, the obvious risk in introducing a conjugative plasmid into a bacterial community is that the element may pick up an unwanted gene and disperse it further into other hosts. Before introduction into clinical applications, the resistance genes of delivery plasmid should be deleted to prevent dispersal of new resistance genes. However, it must be noted that the communities aimed to be engineered will nevertheless harbor various types of mobile genetic elements, and, thus, if there is notable selection within the population for acquiring a particular gene, it is likely to disperse anyway. In any event, if the plasmid used for midbiotic-like engineering must be removed Figure 3. Designing of guide RNA for conserved sites in betalactamase genes. A potential obstacle in gene deletion by midbiotic application is the diversity of the genes that need to be targeted. By combining multiple spacers into a single plasmid and selecting conserved sites within target genes, it is possible to increase the coverage. As the beta-lactamase genes belonging to the same class share conserved sites in nucleotide level, these sites can be used to design spacers for CRISPR/Cas9 system in order to target several resistance gene variants with a single spacer. Majority of the genes in class blaTEM (154) contain the conserved target sequence (green bar). The target sequence selected for the class of blaCTX-M genes (green bar) is not as highly conserved as in the blaTEM class, only 52 genes contain the exact sequence. Only one gene in blaTEM class has a point mutation (red rectangle) in the first nucleotide next to PAM (blue), whereas genes of blaCTX-M class have more variation in these nucleotides. These mismatches in the first seven nucleotides next to PAM might hinder the recognition of the target by Cas9 24 and thus the efficiency of the spacer. GUT MICROBES 647 from the community, the plasmid-dependent bacteriophages could provide a way to induce direct selection against the plasmid. However, while in vitro experiments suggest that this would result in plasmid loss, 26,27 it is yet to be determined whether this occurs also in vivo. Overall, the fraction of the community that can be engineered with conjugative plasmids is equal to the fraction of the flora that receives them. Studies suggest that plasmid dynamics and persistence in a community is a complicated matter where trophic levels and various characteristics of plasmids, their hosts and the environment play an indispensable role. 28,29 Without extensive selection for the midbiotic plasmid, it is unlikely to spread to even all possible hosts. Therefore, as in the case of ESBL carriage, the midbiotic system could be considered as a booster which accelerates ESBL curing rather than an outright treatment. Sometimes, however, even a small fraction of engineered bacteria may be enough, such as in the case of making the midbiotics encode externally secreted bacteriocins against unwanted bacterial species. Yet, the overall improved understanding of the survival conditions of plasmids can help us find ways both to get rid of conjugative plasmids and, if necessary, to facilitate their dispersal. Nevertheless, while caution is necessary, the ability to introduce or remove genes within natural bacterial communities is a real possibility that could be considered as a potential tool for genetic engineering of existing bacterial systems or, for example, modification of gut microbe transplants prior to their implementation. Materials and methods Plasmids, bacterial strains and culture conditions In this study, the so-called midbiotic system consists of the conjugative RP4 blaTEM−2Δ172−714 plasmid (delivery plasmid) and mobilizable pCas9 plasmid (pCRISPR plasmid, a gift from Luciano Marraffini, Addgene plasmid # 42876) encoding the S. pyogenes CRISPR/Cas9 system 24 with crRNA(s) targeting conservative sites of different beta-lactamase resistance genes in ESBL plasmids (Table 1). pCas9 was made mobilizable by cloning RP4 oriT site 12,30 (50980–51793 bps, amplified with primers RP4oriT-F and RP4oriT-R, Supplementary Table 1) into pCas9 digested with SalI (ThermoScientific; Waltham, Massachusetts, United States) into region spanning 7377–7486 bps. The phosphorylated ESBLgene-targeting crRNA oligonucleotides (2 µM each) were first annealed together in 50 µl reaction with 1x of T4 ligase buffer (New England Biolabs; Ipswich, Massachusetts, United States) and 0.05 M NaCl by heating first at 95°C for 5 min and then cooling it down gradually (1°C/35 sec) to 20°C. Then, crRNA insert was ligated into BsaI (ThermoScientific) digested pCas9 plasmid by T4 ligase in T4 ligase buffer (New England Biolabs; Ipswich, Massachusetts, United States). In order to prepare the pCRISPR-multi-crRNA plasmid, the multicrRNA insert was multiplied by PCR from a synthetic plasmid (GenScript; Nanjing, China) with primers spacer-multi-crRNA-F and spacermulti-crRNA-R (Supplementary Table 1). PCR product was purified according to instructions of Qiagen PCR purification kit before being ligated (similarly as above) into the plasmid. The pCRISPRcontrol plasmid was otherwise similar but lacked the crRNA (Table 1). If not mentioned otherwise, all the PCRs were done according to instructions of Phusion Hot Start II High-Fidelity PCR mastermix (ThermoScientific), except for an extended initial denaturation (from 5 min to 7 min 30 s), using C1000 Thermal Cycler (Bio-Rad Laboratories Inc.; Hercules, California, United States). Both ESBL plasmids, pEC13 and pEC15, in recipient strains, originate from nosocomial isolates, 25 and the conserved sites of their respective beta-lactamase genes (Table 1) were selected as targets for the CRISPR/Cas9 system of pCRISPR plasmids. All the bacterial cultures were grown at +37°C in Luria Bertani Lennox-broth (LB) 31 and, as necessary, plated on LB-agar (1%) plates. When appropriate, the following antibiotic concentrations were used: rifampicin (50 µg/ml), streptomycin (25 µg/ml), kanamycin (25 µg/ml), chloramphenicol (25 µg/ml) and ampicillin (150 µg/ml). Liquid cultures were shaken at 220 rpm. Partial deletion of blaTEM-2 in RP4 The part of blaTEM-2 gene (172–714 bp) containing the crRNA target site was deleted from RP4 to prevent the midbiotic system from self-targeting the 648 P. RUOTSALAINEN ET AL. Table 1. Bacterial strains and plasmids used in the experiments and the spacer sequences of pCRISPR plasmid. Only the resistance genes relevant to the experiments are mentioned here. Strain features Plasmid Relevant characteristics Resistance genes DONOR HMS174 E. coli K-12, chromosomal rifampicin-resistance RP4 blaTEM−2Δ172−714 IncP plasmid aph(3ʹ)-Ib, tet, blaTEM2Δ172–714 pCRISPR-crRNA oriT site of RP4 (50 980-51 793 bp) A spacer targeting conservative site of blaTEM genes cat pCRISPR-multicrRNA c 3 spacers targeting conservative sites of blaTEM, blaCTX-M, blaSHV genes, respectively pCRISPR-control Without crRNA RECIPIENT HB101 E. coli K-12, chromosomal streptomycin resistance pEC13 Target of pCRISPR-multi-crRNA blaCTX-M-14 pEC15 Target of pCRISPR-crRNA/multi-crRNA blaTEM-52b RECIPIENT BL21 Gold E. coli B, chromosomal tetracyclin resistance pCRISPR-crRNA A spacer targeting conservative site of blaTEM genes cat Sequence of the crRNA (5 →3ʹ) crRNA a AAACTCACCAGTCACAGAAAAGCATCTTAG multi-crRNA b AAACTCACCAGTCACAGAAAAGCATCTTAGTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAACAAATAGGTCACCAGAACCAGGTTTTA GAGCTATGCTGTTTTGAATGGTCCCAAAACAACTGAATGAGGCGCTTCCCG a Sequence of crRNA of pCRISPR-crRNA b Sequence of crRNAs of pCRISPR-multi-crRNA c The plasmid was isolated from the DH5αstrain. GUT MICROBES 649