GenoListeria Multiplex: Identification by multiplex real-time PCR of 30 major clonal complexes of Listeria monocytogenes strains

The present document, in its electronic form, is made available to users as an analytical method. This document is the property of ANSES. Any reproduction, whether total or partial, is permitted only on the express condition that the source is cited, for example by indicating its reference (including its version and year) and its title. Funded by the European Union. Views and opinions expressed are however those of the author(s) only and do not necessarily reflect those of the European Union or European Health and Digital Executive Agency (HaDEA). Neither the European Union nor HaDEA can be held responsible for them ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 ANALYTICAL METHOD FOR FOOD SAFETY REFERENCE: ANSES/LSAliments/LSA-INS-1517Version 04 23 October 2023 GenoListeria Multiplex: Identification by multiplex real-time PCR of 30 major clonal complexes of Listeria monocytogenes strains ANSES Laboratory for Food Safety European Union Reference Laboratory for Listeria monocytogenes Référence : LSA-INS-1517 - revision 4 2 / 26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 History of the method A method can be updated in order to take account of changes. A change is considered major when it relates to key aspects, the application field or the critical points of the method, which if taken into account could significantly change the scope, the performance or the result of the analytical method. A major change leads to major adaptations. If the method is modified to this extent, it is then revalidated, totally or partially. A change is considered minor if it provides useful or practical clarifications, reformulates the instructions to make them clearer or more precise, or corrects minor errors. A minor change do not affect the performance characteristics of the methods; it does not require revalidation The following table summarises the version history of this method. Version Nature of the changes (major/minor) Date Main changes V0 Initiale version 17/01/2022 - V1 Minor change 15/02/2023 Add reporting dye and quencher in table 1 and section 6 Interpretation precisions were provided in section 9.1 Add the possibility of 15 µL reaction in section 8.1 and 8.2 Range of DNA concentration was updated to 1-0.1 ng/µL. It was specified that measurement must be obtained by fluorimetric quantification of double strand DNA V2 Major change 05/10/2023 Suppression of CC14-ST91-ST360 from the method Modification of the scheme of the method accordingly, addition of CC18 with the FAM dye to the duplex CC8-CC121 which become a triplex CC8-CC18-CC121 The numbering of the PCR was changed starting from IIa-5 because PCR IIa-4 (CC14-ST91-CC18) was removed in table 1 Minor change The dye of CC18 probe was changed to FAM (due to the modification of the triplex IIa-1) and CC121 to HEX (due to typo error) in table 1 Addition of a specific positive control for CC101 in section 5.1 & 8.2 The sentence: All controls DNA can be provided by the EURL for Lm, was added to section 5.1 The sentence “If the Ct is less than 30, the PCR is systematically redone”. Was removed from section 9.1. As it comes in contradiction with the cycle threshold (Ct≤30) establish for the method. Maisons-Alfort laboratory for food safety was replaced by ANSES laboratory for food safety, exact date of publication, mention to EU funding and “French was specified for the national reference laboratory was added in front page. V3 Minor change 23/10/2023 Reference to French NRL was removed from the front page. V4 Minor change 19/09/2025 Add Table 5a with recommended master mixes and add two real-time PCR master mixes with issues in table 5b, based on inter-laboratory validation trail results Référence : LSA-INS-1517 - revision 4 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 3 / 26 Section 5.1: Modification of the positive control. Plasmid “pBluescriptIISK+” was replaced by “pUC57”, and specific DNA control for CC101 was removed. Method DNeasy® Blood & Tissue kit QiaGen was added in section 7.3. Major change Real-time PCR 149_CC2_8862 performs poorly on complex DNA extracts (such as enrichment broth extracts). It has been replaced by a real-time PCR located at a nearby genetic position with similar characteristics, called 149_CC2_8868. Modification of Tables 2, 3, and 6. Référence : LSA-INS-1517 - revision 4 4 / 26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 Foreword This method has been developed by: Benjamin FELIX, Karine CAPITAINE and Sandrine TE ANSES –Laboratory for Food Safety (Laboratoire de Sécurité des Aliments) European Union Laboratory for Listeria monocytogenes Adresse : 14, rue Pierre et Marie Curie – 94700 Maisons-Alfort Contact : Benjamin FELIX, eurl-li[email protected] Référence : LSA-INS-1517 - revision 4 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 5 / 26 Contents Foreword ....................................................................................................................................... 4 Warnings and safety precautions ................................................................................................ 7 BIOHAZARD .................................................................................................................................. 7 HAZARDS OF REAGENTS ............................................................................................................ 7 1. Purpose and scope ................................................................................................................ 8 2. Reference documents ........................................................................................................... 8 3. Terms, acronyms and definitions ......................................................................................... 8 4. Principle of the method ......................................................................................................... 9 5. Reagents ................................................................................................................................ 9 5.1 Positive control ................................................................................................................... 9 5.2 PCR reagents .................................................................................................................. 11 6. Equipment and materials .................................................................................................... 15 Usual microbiology apparatus and equipment ........................................................................ 15 7. Samples ................................................................................................................................ 15 7.1 Conditions for acceptance of samples .............................................................................. 15 7.2 Conservation of samples before analysis ......................................................................... 15 7.3 Conservation of samples after analysis ............................................................................ 16 7.4 Preparation of samples for analysis .................................................................................. 16 8. Procedure ............................................................................................................................. 16 8.1 Real time PCR analysis in the form of triplex/duplex PCRs .............................................. 16 8.2 Preparation of the PCR mix .............................................................................................. 17 8.3 Amplification conditions .................................................................................................... 17 9. Results .................................................................................................................................. 18 9.1 Control of the validity of the results ................................................................................... 18 9.2 Calculation and expression of results ............................................................................... 18 10. Performance characteristics of the method ....................................................................... 26 Référence : LSA-INS-1517 - revision 4 6 / 26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 Tables and figure Table 1: reference ADN ..................................................................................................................................................... 10 Table 2: Primers and probes for the detection of GenoListeria targeted genes ............................................................. 122 Figure 1: GenoListeria multiplex Scheme ........................................................................................................................ 194 Table 3: Expression of the results...................................................................................................................................... 19 Table 4: Molecular serotype interpretation ...................................................................................................................... 20 Table 5: STs or CCs of the strains that can be detected by the PCR of GenoListeria Scheme .......................................... 220 Table 6a & b: Recommended Master Mix & Master mix with PCR issues ........................................................................ 22 Table 7: Positive control plasmids composition ................................................................................................................ 23 Introduction The “GenoListeria multiplex” in house method was developed by the Salmonella and Listeria Unit (SEL), this version is an adaptation of the ANSES internal method LSA-INS-1493 developed for simplex PCR assays thought high throughput PCR. The present in house method “GenoListeria multiplex” is made of 12 multiplex reactions. The present in house method was developed by the ANSES Food Safety Laboratory (ANSES LSAl) in 2021-2022 as part of a multi-partner collaborative effort. The SEL unit, within the framework of the activities of the European Union Reference Laboratory for Listeria monocytogenes (EURL Lm), is the leader of the project. This method was developed in collaboration with the B3PA unit of the ANSES LSAl Boulogne sur Mer location, the National Reference Laboratories (NRLs Lm) of the European Union (BE, CH, CY, DE, GR, IT, NL (RIVM and WFSR), PT, SE, SI, and SK) in charge of L. monocytogenes typing in their country, the French Institute for Pig and Pork Industry (IFIP) and ADRIA development of Quimper. The method was published in 2023 in the scientific journal Microbiology Spectrum: https://zenodo.org/records/10017525. The “GenoListeria multiplex” includes the molecular serotyping scheme of Vitullo et al. 2013. It identifies 6 genetic markers through 2 triplex PCR reactions (Lmo0737, prs, plcA and Lmo1118, ORF2110, ORF2819) to provide the molecular serotype of the strains. Following molecular serotyping, the method allows the identification, by real-time PCR, of 30 clonal complexes (CCs) of Multi locus sequence typing (MLST) circulating in food, animals, and environment and responsible for clinical cases in humans in Europe. The 30 CCs are covered by 30 genetic markers part of PCR reactions providing the following identifications: CC1, CC2, CC3, CC4, CC5, CC6, CC7, CC8, CC11-ST451, CC14-ST14-ST206-ST399, CC18, CC19-ST398-802-1308, CC20, CC21, CC26, CC29, CC31, CC37, CC54, CC59, CC77, CC87, CC101, CC121, CC155, CC193, CC199, CC204, and CC224. CC9 identification is provided by Lmo1118 molecular serotype PCR. The primers and probes were developed both, to be performed as 35 simplex PCR (In house method LSA-INS-1493) or one duplex and 11 triplex PCR in the present method. Référence : LSA-INS-1517 - revision 4 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 7 / 26 Warnings and safety precautions The user of this method should be familiar with standard laboratory practices. It is the responsibility of the user to establish proper health and safety practices and to ensure compliance with applicable regulations. It is essential that manipulations conducted in accordance with this method be performed by appropriately trained personnel. BIOHAZARD Infection by this bacterium is frequently accompanied by minor digestive problems, including diarrhoea. However, there are serious forms that may affect sensitive populations such as pregnant women, the elderly and the immunocompromised individuals. Operators handling L. monocytogenes must therefore work in a Level 2 laboratory. HAZARDS OF REAGENTS For all questions, consult safety data sheets (SDS) provided by the provider or producer. Référence : LSA-INS-1517 - revision 4 8 / 26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 1. Purpose and scope This method describes the identification, on L. monocytogenes bacterial strains, of 30 CCs of MLST and 5 molecular serotypes by real-time PCR through 12 multiplex PCR reactions. 2. Reference documents [1] Vitullo, M. et al. Real-time PCRs assay for serogrouping Listeria monocytogenes and differentiation from other Listeria spp. Mol Cell Probes 27, 68-70 (2013). [2] NF EN ISO 20837 standard: Microbiology of food and animal feeding stuffs - Polymerase chain reaction (PCR) for the detection of food-borne pathogens - Requirements for sample preparation for qualitative detection [3] NF EN ISO 22119 standard: Microbiology of food and animal feeding stuffs - Real-time polymerase chain reaction (PCR) for the detection of food-borne pathogens - General requirements and definitions [4] NF EN ISO 20838 standard: Microbiology of food and animal feeding stuffs - Polymerase chain reaction (PCR) for the detection of food-borne pathogens - Requirements for amplification and detection for qualitative methods 3. Terms, acronyms and definitions Ct Cycle threshold dATP Desoxyadenosine triphosphate dCTP Desoxycytidine triphosphate dGTP Desoxyguanosine triphosphate dTTP Desoxythymidine triphosphate DNA Desoxyribonucleic Acid dNTP Desoxynucleotide Lm Listeria monocytogenes pb base pair prs gene Gene coding for phosphoribosylpyrophosphate synthetase PCR Polymerase Chain Reaction plcA Phosphatidylinositol-phospholipase C Taq Thermus aquaticus Référence : LSA-INS-1517 - revision 4 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 9 / 26 4. Principle of the method The 35 GenoListeria genomic markers scheme (Table 2) are identified by Taqman® real-time PCR probes. Two PCR protocols were optimized, one conventional thermal cycling and one fast thermal cycling (Needing dedicated master mix and thermocycler). The real-time PCR assay identify a genetic marker specific of the 30 CCs and 5 molecular serotypes sought by the method. Among the 35 real-time PCR probes of the GenoListeria scheme, 29 were designed within the framework of the method development by the ANSES SEL unit. The real-time PCR assay also integrate the 6 markers of the molecular serotyping scheme of Vitullo et al. 2013 that identify the strain molecular serotype (so called serogroup) IIa, IIb, IIc, IVb et IVa and L throught two triplex PCR reactions. The PCR that identify the genus Listeria (prs – gene of the phosphoribosylpyrophosphate synthetase) and a species monocytogenes (plcA – gene of the Phosphatidylinositol-phospholipase C) of Vitullo et al. 2013 scheme are used as internal control. Both PCR are part of the same triplex. The Vitullo et al. 2013 scheme was developed by the UK-NRL Lm, Public Health England. This method details the implementation of 12 multiplex PCRs (adapted for use of conventional real time PCR instruments). The molecular serotype should be performed in a first stage, the CC multiplex identification should be performed according to the molecular serotype. In this method (Figure 1), the CC are given by order of abundance according to three studies that described the diversity of Lm in Food in France (Maury et al. 2016, Félix et al. 2018) and in Europe (Painset et al. 2019) (Figure 1). This method requires the following steps: ▪ Verification of the concentration and quality of the DNA extracts ▪ Real-time PCR analysis ▪ Interpretation of results 5. Reagents Caution: Certain trade names or suppliers may be mentioned by name in the description of the products necessary for applying this method. This information is given as an indication for users of the method and does not in any way imply that ANSES recommends the exclusive use of these products. Equivalent products may be used if it has been demonstrated that they produce the same results. 5.1 Positive control The reference DNAs used as PCR positive controls for each of the markers come from strains in the ANSES collection, except for two strains that come from the Hungarian NRL and Slovak NRL collections (Table 1). The 39 amplification products derived from the genome of the reference strains, flanked at each end by a 20 bp region, were cloned into six puc57 plasmids. The plasmids carry between five and nine amplification products and are organized as follows (Table 7): - Plasmid DNA IIa A: CC8-CC121-CC18, CC31-CC37-CC155, CC7-CC14-ST14-CC204 - Plasmid DNA IIa B: CC20-CC21-CC101, CC26-CC29-CC193, CC199-CC11-ST451-CC19ST398 - Plasmid DNA IIb: CC3-CC87-CC5, CC59-CC77-CC224 Référence : LSA-INS-1517 - revision 4 16 / 26 ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex 7.3 Conservation of samples after analysis The genomic DNA samples can be stored after analysis in a DNA bank for later use, notably for the sequencing of the complete genome of the strains (valid if the extraction was carried out following the Wizard® Genomic DNA Purification Kit Promega extraction (ANSES LSA-INS-1227 procedure) or DNeasy® Blood & Tissue kit QiaGen (ANSES LSA-INS-1494 operating mode). 7.4 Preparation of samples for analysis The genomic DNA extracts are aliquoted and diluted with DNase and RNase free molecular biology water to bring them to a DNA concentration between 1 and 0.1 ng/µL, before being added to the PCR mix. DNA concentration should be obtained by fluorometric measurement for the only quantification of double strand DNA. 8. Procedure 8.1 Real time PCR analysis in the form of triplex/duplex PCRs This method requires to use conventional real time PCR instruments with three detection channels: dye FAM 520 nm, dye HEX 554 nm (compatible with VIC 549 nm), dye Cy5 669 nm. In this analysis configuration the PCRs are performed as triplex FAM-HEX-Cy5 or duplex FAM-HEX. The triplex mixes all have the same composition, as well as the duplex mixes. The reaction volume could be performed in 15 µL and 20 µL format. The PCR should be performed in two rounds: 1) For all samples triplex PCR 1 (prs, plcA, Lmo0737) and PCR 2 (ORF2819, ORF2110, Lmo1118). 2) The other triplex or duplex PCR (Table 2) may be performed according to the molecular serotype deduced (Figure 1). Multiplex PCR can be performed one by one or several PCRs can be performed at the same time. Reference : LSA-INS-1517 - revision 4 17 /26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 8.2 Preparation of the PCR mix In the mix PCR room Sample preparation should be adapted according to the PCR mix used. In a DNA room According to the plate plan, add 2µl of each diluted DNA if the final volume of reaction is 20µL, or 1.5µl if the final volume is 15µL. Controls: For each duplex or triplex PCR, include: - the positive control at 1X concentration (mixture of plasmids) (Section 5.1) - the negative PCR control: DNA-free water (section 5.2). 8.3 Amplification conditions Conventional program Fast program* 2 min 50°C 2min 95°C 10 min 95°C 3 sec 95°C 40 cycles 15 sec 95°C 40 cycles 30 sec 60°C 1 min 60°C Temperature ramping 2°C/sec Temperature ramping 3 to 5 °C/sec *Fast Program was tested with only GoTaq® Probe qPCR Master Mix (ref Promega A6102) Triplex Duplex 20 µL 15 µL 20 µL 15 µL Reagent µl /reaction µl /reaction Reagent µl /reaction µl /reaction H2O 5.3 3.975 H2O 6.2 4.65 2X master mix 10 7.5 2X master mix 10 7.5 20 µM Forward Primer 1 0.3 0.225 20 µM Forward Primer 1 0.3 0.225 20 µM Reverse Primer 1 0.3 0.225 20 µM Reverse Primer 1 0.3 0.225 20 µM Probe 1 0.3 0.225 20 µM Probe 1 0.3 0.225 20 µM Forward Primer 2 0.3 0.225 20 µM Forward Primer 2 0.3 0.225 20 µM Reverse Primer 2 0.3 0.225 20 µM Reverse Primer 2 0.3 0.225 20 µM Probe 2 0.3 0.225 20 µM Probe 2 0.3 0.225 20 µM Forward Primer 3 0.3 0.225 Total 18 13.5 20 µM Reverse Primer 3 0.3 0.225 20 µM Probe 3 0.3 0.225 Total 18 13.5 Référence : LSA-INS-1517 - revision 4 18 / 26 ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex 9. Results 9.1 Control of the validity of the results An amplification, to be considered positive, must have a detection threshold less than or equal to 30 cycles (Ct≤ 30). Late amplifications, beyond 30 cycles (Ct>30), are considered as non-specific. The positive control and the negative control must have the expected result to validate the manipulation (5.1 and 8.1.1). The internal PCR control prs is positive for the L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. marthii and L. grayi strains (Vitullo et al. 2013). The PCR internal control plcA is positive for all L. monocytogenes strains. The amplification curve of the test samples, to be considered positive, must be within a detection intensity range greater or equivalent to the positive control (ΔRN): PCR controls (5.1) and internal controls prs and plcA (8.1.1). This control should be applied particularly to the real time PCR 21322_SNP_LMO00485_CC101. Internal controls (prs and plcA), must be positive for all L. monocytogenes. To be valid, the test PCRs must have a Ct equivalent to the internal controls (prs and plcA). If the test PCR Ct is higher than the internal controls, it is necessarily related to contamination. 9.2 Calculation and expression of results The interpretation of the sample results is carried out by comparison with the control DNA according to table 4. The GenoListeria PCR has been developed so that a strain can only be identified by one of the PCRs performed. If a strain is identified by several PCRs, contamination by several different DNA extracts must be suspected. It is possible that a strain with a different ST or CC from the target CCs may be identified by some of the PCRs in the GenoListeria scheme. These joint identifications could not be avoided when designing the probes. They are considered as cross reactions. A list of the cross reactions identified during the development of the method is detailed in table 5. The cross reactions must be specified when writing the analysis report. The interpretation of the results is done according to the table 3 and 4 for the expression of results. Reference : LSA-INS-1517 - revision 4 19 /26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 Table 3: Expression of the results Clonal Complex GenoListeria CC1 CC2 CC3 CC4 CC5 CC6 CC7 CC8 CC9 CC11 (ST451) CC14 (ST14-ST206-ST399) CC18 CC19 (ST398) CC20 CC21 CC26 CC29 CC31 CC37 CC54 CC59 CC77 CC87 CC101 CC121 CC155 CC193 CC199 CC204 CC224 Other CCs* Listeria not Listeria monocytogenes** « NonListeria »*** CC1-P-F-R (149_CC1_1911) CC2-P-F-R (149_CC2_8868) CC3-P-F-R (4711_CC3_6907) CC4-P-F-R (4711_CC4_3572) CC5-P-F-R (4711_CC5_9574) CC6-P-F-R (149_CC6_4418) CC7-P-F-R (258_CC7_6968) CC8-P-F-R (258_CC8_952) CC9-P-F-R (258_CC9_5506) CC11-ST451_1_P-F-R (111_ CC451_9204) CC14-ST14-P-F-R (258_SNP_LMO002932_ST14) CC18-P-F-R (258_CC18_7946) CC19-ST398-P-F-R (111_Lmo01705_ST398_1) CC20-P-F-R (21322_CC20_1143) CC21-P-F-R (21322_CC21_5690) CC26-P-F-R (3511_CC26_4338) CC29-P-F-R (3511_CC29_2081) CC31-P-F-R (1615_CC31_8696) CC37-P-F-R (1615_CC37_4509) CC54-P-F-R (1_CC54_731) CC59-P-F-R (359_ CC59_5912) CC77-P-F-R (359_CC77_3146) CC87-P-F-R (258_CC87_8655) CC101-P-F-R (21322_SNP_LMO00485_CC101) CC121-P-F-R (258_CC121_3159) CC155-P-F-R (1615_CC155_5334) CC193-P-F-R (3511_CC193_5118) CC199_2-P-F-R (111_CC199_711) CC204-P-F-R (258_CC204_2959) CC224-P-F-R (359_CC224_7283) plcA prs Positive PCR reaction Ct≤30 *: Includes all L. monocytogenes not targeted by GenoListeria . **: includes the following specie L. grayi, L. marthii, L. innocua, L. welshimeri, L. seeligeri, L. innocua, L. seeligeri, L. ivanovii ***: includes bacterial strains not belonging to the family Listeriaceae except for the following secies: L. booria, L. newyorkensis, L. riparia, L. grandensis, L. weihenstephanensis, L. weihenstephanensis, L. rocourtiae, L. aquatica, L. floridensis , L. Fleischmannii subsp. Fleischmanii, L. fleischmanii subsp. Coloradonensis. Référence : LSA-INS-1517 - revision 4 20 / 26 ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex Table 4: Molecular serotype interpretation Molecular serotype (Doumith et al. 2010 nomenclature) Lmo0737 Lmo1118 ORF2110 ORF2819 plca prs IIa IIb IIc IVb IVb (atypical) IVa L Reference : LSA-INS-1517 - revision 4 21 /26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 Table 5: STs or CCs of the strains that can be detected by the PCR of GenoListeria scheme CC or ST targeted by the method Real time PCR probe reference Joint detection of strains not belonging to the targeted CCs – (co-detection predicted in silico) CC1 149_CC1_1911 ST213, CC183, ST773 (CC373*, ST1125) CC2 149_CC2_8868 CC3 4711_CC3_6907 CC1000 (CC489, ST558, ST1046, ST1041, CC1211) CC4 4711_CC4_3572 (ST631) CC5 4711_CC5_9574 CC6 149_CC6_4418 CC7 258_CC7_6968 (CC373*) CC8 258_CC8_952 ST1110 (ST1018) CC9 Lmo1118 (ST184, ST395, ST1331*) CC11-ST451 111_ CC451_9204 CC14-ST14-ST206-ST399 258_SNP_LMO002932_ST14 CC689 (ST843) CC18 258_CC18_7946 CC19-ST398-802-1308 111_Lmo01705_ST398_1 (CC1127) CC20 21322_CC20_1143 ST19, ST173 (ST226*, ST364, ST378, ST1021, ST1071, ST1078) CC21 21322_CC21_5690 CC403 CC26 3511_CC26_4338 (ST376, ST790, CC912, ST1024, ST1331) CC29 3511_CC29_2081 (CC344, ST1082) CC31 1615_CC31_8696 CC37 1615_CC37_4509 CC321 (ST648, ST828, ST1068) CC54 1_CC54_731 CC59 359_ CC59_5912 CC77 359_CC77_3146 CC87 258_CC87_8655 CC88 CC101 21322_SNP_LMO00485_CC101 (CC90, ST671, ST1127) CC121 258_CC121_3159 CC689 CC155 1615_CC155_5334 CC193 3511_CC193_5118 CC124 (ST798) CC199 111_CC199_711 (CC739, ST1331*) CC204 258_CC204_2959 (ST798) CC224 359_CC224_7283 ST581, ST585 (ST226*, ST1118) *: ST or CC identified as a cross-reaction by two distinct primer and probe sets (): ST or CC under brackets were predicted in silico as cross reaction, but not tested on strain Référence : LSA-INS-1517 - revision 4 22 / 26 ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex Table 6a: Recommended PCR Master Mix Master Mix Manufacturer Thermal cycling PerfeCTa qPCR ToughMix Low Rox Quantabio Conventional SsoAdvanced Universal Probes Supermix Bio-Rad GoTaq Probe qPCR master mix Promega Fast Table 6b: Master Mix with PCR issues Master Mix Manufacturer Thermal cycling Taqman Universal PCR master mix Life technologies Conventional Lightcycler 480 Probes master Roche Platinum Quantitative PCR SuperMix UDG Invitrogen-ThermoFisher Luna® Universal Probe qPCR Master Mix New England Biolabs Universal TaqMan Multiplex MasterMix Thermofisher Fast Kapa probe fast qPCR Kit Master Mix (2X) Universal Kapa Biosystems Reference : LSA-INS-1517 - revision 4 23 /26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 Table 7: Positive control plasmids composition Real time PCR name ANSES strain reference Molecular serotype MLST Clonal complex MLST type Amplicon size Recombinant plasmid reference Sequence used as positive control (amplicons flanked by 20 bp at each end) prs 17SEL375LM IIc CC9 ST622 141 Molecular_serotyping taaattctaatcgtgaactagctgaagagattgcgaaagaagtaggtattgagttagggaaatcaagtgttactcattttagtgatggagaaatc caaattaacattgaagaaagtatccgtggttgtcatgtatatgttattcaatcaacgagtaatcctgtaaaccagaatttaatggaa plcA 17SEL375LM IIc CC9 ST622 79 Molecular_serotyping cgctttggaagcttgataagcagtctggacaatctctttgaattttgttttcacactcggaccattgtagtcatcttgaattacttggttaggtgcgc cgaactgcatgccgaatttgcg Lmo0737 17SEL375LM IIc CC9 ST622 102 Molecular_serotyping tatcattgaaacaacaaaacgagcacggaagttgctaggtaacgatgtcttaattttcgctggaaaatgggaagatggtattgatgagaaagt gttgggcgatccacttgctaaacaagatgcaaaagaagtgattaagcaat ORF2110 17SEL82LM IVb CC6 ST6 94 Molecular_serotyping ttattaggtggaggaattgttgcacaagcagcagaggaagccccaatcgatgaaaagatagttggggaaacggtaacaaatgacggagaa gagtttatagtcgatgagattagtgatttagaagatgttaattca ORF2819 10CEB88LM IIb CC3 ST3 134 Molecular_serotyping aagtcaaacaatccagtaacatcactaaagcctcccattgagctctcgtaagatcgatatacgtcatggcagtttccaggacttcacttgtcatt ctttcttctctttccgtatatgttggagggagtttttggagtattgcgtggaaatcttccggtgaaaagtagttatttat 149_CC1_1911 17SEL1LM IVb CC1 ST1 100 DNA-IVb gatgtgcaaatttttcaggggttcgatagtgtcataggagaaaataataacttaaatgcgattgcattgagtgctggaaataaggttattgaaga taaattaccaatattgaatagagagctagaagcgttaaatgatgag 149_CC2_8868 17SEL376LM IVb CC2 ST2 109 DNA-IVb ataaaaatacaagccagatttgtcccttattcaatctctcttttcaaattttcaatttctaatggtgatagaatagtcgataacttaggatgtttggca agttttttctgtaaactagaattcaagtgcatcattaaatctgctaacatc 4711_CC3_6907 10CEB88LM IIb CC3 ST3 119 DNA-IIb ttttcatttctttttgcaaaacccaaatagatcaaagcattactataatagtcgctttgacgaatatcaaactcacaaatttttgctaactcatttttatt cataggtatttttatatactcaagaatagagagaatccgtcccatgctatttgcctgag 4711_CC4_3572 17SEL543LM IVb CC4 ST4 129 DNA-IVb attcttctgtattccttatacatcgtagccttttcatcatattgcctcctaccaactgtactgaaggattggcagggagggccacctattactaaatc aatattagaatactcaatctcatgattatctaaataatcctcggttagttccgttatactacaatttaacat 4711_CC5_9574 16SEL667LM IIb CC5 ST5 99 DNA-IIb aagtctaataaattgagaatccttgctagcttctgtagatataaatttacttaaagacacattaatttccgcttggcaaagctggatggcgcgtgc tagtttgtctgtaaaagtaccttcagaaactaatatttcttcgg 149_CC6_4418 17SEL82LM IVb CC6 ST6 127 DNA-IVb aggaatgcaccatataccccggcagtgtttgatacatgggaaacggattctattaaacacgcaagcaaatagcaatattcattgtagttaatca attctttattaaaccattcttccactgtttgtctaaagtaatctattctaccagcatttttttcgttgaaatac 258_CC7_6968 16SEL17LM IIa CC7 ST691 138 DNA-IIa-A tctcataattaacttgtctagaacctatattttgaggcattataactgcaactccagagtcaacataatctgacttgtgaagttgggttccgaatgg gccagtgattatttttgctacctcacctagagaagtagaaatccatttactcatatttcacctttttcaattgttctaaaat 258_CC8_952 17SEL12LM IIa CC8 ST8 117 DNA-IIa-A tatgagtatccttaggatatggtacgggtagttttgttaaagtcacagaaacttctaagccggaagtgtttttctcatgtaatgacataatatctttg attcctaaaaagtcaggaactttcacttcattgaaaaggctcatgtcatttaaatcattc Référence : LSA-INS-1517 - revision 4 24 / 26 ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex Lmo1118, 258_CC9_5506 17SEL375LM IIc CC9 ST622 170 Molecular_serotyping agtttaaagatttcttgttccttagtattccaggatttaagacccctacctttatcttctcctgagtgtatacgcctcataatgaaaaaagcatcctct tcatctgttattaagcattcaatttgagagagatttatttttgaaggagtgtcacttttcatttttttgattcgatcaatttggttctttggtaaaaaactaa atttttctg 111_ CC451_9204 20SEL24LMLM IIa CC11 ST451 167 DNA-IIa-B tctattgtcataaagattaagatgggagttaatgattttatggataatagtttaagactcgcgcatgttgctgtgcacaaagttcatctttgttttaaa aatgaaatgattggagaatatactattacagaatgggacaataaaaaattgattgatgatcttctgtataatcaagaaagaataggtgtttttaag cactctgctggaa 258_SNP_LMO002932_ST14 17SEL22LM IIa CC14 ST91 132 DNA-IIa-A gaaaatatgagtaaaacaacgatgcaactgctattaggaaaaatgtatcaggacaaatcagtgcatttggccatcacggcaggctctacacc taagcgaatgtacgaactattagtggaagaaatgaaa 258_CC18_7946 17SEL4LM IIa CC18 ST18 148 DNA-IIa-A gtgcttagattgtaattcaagtcacattggttatatttcaagttcagacaaaaacttcacattcgatgtctcaactacagaagttcgaggtcagatt attgattctattaaggaaaaaattgcttcttacacagaggagttagataaacaaactagtgaaataaacctgtatcagttacaaatccagaa 111-Lmo01705_CC19-ST398_1 21SEL232LM (164 LNR HU) IIa CC19 ST398 134 DNA-IIa-B ctggatcatttttagaatgtcttgcttccgctgatatcaatgactcacgtgcaaatgaactttcggcgttagtttatcaatacgtcgcaactttagct acggccgaagatgaatggcatgacaaatttgcgcaagtttctgaccgtgtttgggacgaattaatgaaacaaaatgg 21322_CC20_1143 08CEB286LM IIa CC20 ST20 121 DNA-IIa-B tttttttcgtcttttttcgttgtcctaatagtgtaagcaaatttctagcctgttcaatttcttgattggatataacattttttaaagcaggaacgttttcaca gtaaaaatatctaaaattctttagttgttcattttcacgaaatgcatctccaagaaaaa 21322_CC21_5690 17SEL88LM IIa CC21 ST21 111 DNA-IIa-B aatctgcttcttcatcacctgcaactaaaataactatctcaacttctttattataaaaatcaactttgcttgttttaaaccaagaataatcaaattctaa ctcaccaaaaacttcatcagtaattttcatccataatacttcctttcttatt 3511_CC26_4338 09CEB411LM IIa CC26 ST26 131 DNA-IIa-B tttgcagcttattaaagaaaacacgacgtatgactttaaatcagacataatgaatcatggacgcttcttaaaaattttgtctaaaagaataaagaa gccaaacaaactaaatatcataacaacaaactacgatactctgtttgaagatgctggtgaacaactaaactttaca 3511_CC29_2081 17SEL50LM IIa CC29 ST849 114 DNA-IIa-B ttcaaaaacggaacttcaaaaacggctattaaacggagatattgacgctgaacttgctaatgcactatttaccaaaaaaggtattcgtactcga cttgattctaataatatttcaccaactgtagtaactttgccagatgattatattcatccct 1610_CC31_8696 17SEL370LM IIa CC31 ST31 148 DNA-IIa-A ctgggtaacagaatgatccggagtgtatggcatatgaaagttttcatctttattcattttatgaaatcctaaattacaaaatgtaagccaaactttat ttttaaaaagcaattgaggagatttagctcgtttcatttttattaaagattttaattctctatcaacgatccatccatcaatctcatactc 1610_CC37_4509 17SEL105LM IIa CC37 ST37 114 DNA-IIa-A tgatgtagcagaaaaagaagccagagaatggctagatactcaggcagcacttcataatccagatcagattgcaggaggaaaagcagatat aattggtggtatgggtgataaaggtatcaattcttctattggttcccaatggaaatatagaattg 1_CC54_731 19SEL881LM IVb CC54 ST54 102 DNA-IVb ttgggaacagcgtaagttagaggacatattagatgttcgttctggacgtgactataaacatctggattcaggtgatataccggtttacggtacg ggaggctatatgctaagtgttggtgaagcattatcttatgaagaggatg 359_ CC59_5912 17SEL517LM IIb CC59 ST59 123 DNA-IIb gtatgtttaaagaaactgatcagcaaaagacagcagataaatttttaaaaagaatctccgacgaaacgcttgcaattcctatagattacaagaa tgaaaaatttgctgtgtcagaaaaagtaagtaaatttatttattctggcttatctgattcgcctattgat 359_CC77_3146 09CEB593LM IIb CC77 ST77 141 DNA-IIb tttgatgtggatggaaaaaccacgaatcaaactgtgaactatcaggatctgttgacagaaccaattcctccaaccaaagaagggtacaaattc attggttggtatgatgcaaaaacaaacggaactaagtgggaattcaacattgataaaatgcctgcgaagaatatcactttatacgcgca 258_CC87_8655 17SEL107LM IIb CC87 ST87 124 DNA-IIb ttcttgaaccgaaatagagggtgacaccatgtaaatctcgattcgcaaaatcctttgagtgataaacatcgcctactcgaaaagttgaatgaaa ttcccgccatgctccaacacatattttaaataatcattccaagttttctgcatagcttttaaccaatcagc 21322_SNP_LMO00485_CC101 03EB425LM IIa CC101 ST775 100 DNA-IIa-B aatgtggtcttccaaaagaaatggcacttgaattattcaaaccatttgttatgaaagaactagttggacgcggcttagcacataacattaagagt gctaaacgtaaaatcgaacgtatggctccagaaatctgggacgtat Reference : LSA-INS-1517 - revision 4 25 /26 © Anses – 14, rue Pierre et Marie Curie - 94701 Maisons-Alfort Cedex ANSES/PR3/7/01-04 [version d] ANSES/FGE/0139 258_CC121_3159 17SEL63LM IIa CC121 ST121 146 DNA-IIa-A cagcaaacttggccaattatatggctactgaatatatccccatatatcaaggctatgatggaaaaaatgttacacattttggatatattacagctt ctaaaattggcggtagtagcaatctaaaaaaaatagtacatacagctagaacatataatgataaattccgagttaatggttttttaatttc 1610_CC155_5334 17SEL412LM IIa CC155 ST155 133 DNA-IIa-A agataggtgtaccaaaagttgtcagagtcgaattcattaaaaaggcaaaagcaaaatcacatcaatctaaaattgttgatttattctcagtcact gaaaatttagcgcaaatagggatggattctgaatattcaatacttttgaaaattccagattcagaaaatatgaacatga 3511_CC193_5118 11CEB245LM IIa CC193 ST193 133 DNA-IIa-B agaaaaacccctgtcatgtgttatccttgacaggggtttttgatgaggaaccatatcatttccaatgaaatcaaacattttacagtagaaaaacat tgatttatcggtattccccattcatgttatattgactcgttattcccactcaaccgtagctggtggcttactcgtaat 111_CC199_711 20SEL79LM IIa CC199 ST199 193 DNA-IIa-B aatgagtattaatgaatttttcggagcattcactatatcatttacaagcatgattaatctagactctccacttccagcaaacgcttctgtataattac gacccgatttcctcattaaaattgtctttagtggtcggacaatattttttcgcgcgtagaatttatgtgatactatttgaatttcatcatatttttggtcta acatccaactgaccacatttttgacttcatcaga 258_CC204_2959 17SEL510LM IIa CC204 ST204 101 DNA-IIa-A acttcaaaatctcatttgatcctcttggtacttctaaattatcattcttatcaatctcaaattgtggacaactttctctaatttcatctaataaaataacat tgggataatcttcggctctgattcctaactcaacatattt 359_CC224_7283 10CEB615LM IIb CC224 ST224 106 DNA-IIb tcaaagaaaagtcaaatagagaaggatttattagaaatgaaagtagtaaattatttaaagatttacttacgataatagtgaaacaatttggacaa gataggtattcagctactagagagatacgttcaaaaattcaatctttaaaaa