Euroscaptor darwini sp. nov., a new species of mole (Mammalia, Eulipotyphla, Talpidae) from the north-central mountains in Vietnam

239 Euroscaptor darwini sp. nov., a new species of mole (Mammalia, Eulipotyphla, Talpidae) from the north-central mountains in Vietnam Son Truong Nguyen1,2* , Hai Tuan Bui3, Vinh Quang Dau4, Phuong Dinh Le5, Yen Huong Vu1,3* 1 Institute of Biology, Vietnam Academy of Science and Technology (VAST), 18 Hoang Quoc Viet Road, Hanoi, Vietnam 2 Graduate University of Science and Technology, Vietnam Academy of Science and Technology (VAST), 18 Hoang Quoc Viet Road, Hanoi, Vietnam 3 Faculty of Biology, Hanoi University of Science, Vietnam National University (VNU), 334 Nguyen Trai Road, Hanoi, Vietnam 4 Hong Duc University, 565 Quang Trung Road, Thanh Hoa, Vietnam 5 Pu Luong Nature Reserve, Thanh Hoa, Vietnam Corresponding authors: Yen Huong Vu ([email protected]); Son Truong Nguyen ([email protected]) Copyright: © Son Truong Nguyen et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract A new species of fossorial mole (Eulipotyphla, Talpidae, Euroscaptor) is described from Pu Luong Nature Reserve, north-central Vietnam, based on distinct genetic and morphological characteristics. The species inhabits a geographically small and isolated upland patch (900–1100 m a.s.l.), sharply bounded by a nearly vertical escarpment. The new taxon is diagnosed by an extremely reduced tail both externally and osteologically, comprising only six or seven caudal vertebrae, the lowest number documented in the genus to date. The species differs further from known congeners in Southeast Asia by its slender cranium, narrow rostrum, elongated inner zygomatic arches, and significantly smaller anterior dentition. Phylogenetic analyses of the mitochondrial Cyt b gene indicate genetic distances of 5.41–6.35% from its closest relative, E. subanura, and clarify the evolutionary placement of the species within the genus. Multivariate analyses of 36 craniodental measurements identified key variables contributing to interspecific differentiation among Vietnamese moles, including breadth between infraorbital foramina, length of zygomatic arch, upper incisor–canine length, premolars length, and lower incisor–canine length. Specimens from the type locality show that females are larger than males. The discovery of this new Euroscaptor species currently raises the total number of recognized species in the genus to eleven worldwide and brings the number of fossorial mole species recorded in Vietnam to six. It highlights both the underestimated mammalian diversity of Vietnam and the importance of continued integrative surveys in montane landscapes, where micro-endemic and evolutionarily distinct taxa remain insufficiently documented and vulnerable to environmental change. Key words: Annamite Range, Darwin, mitochondrial gene, PCA, small mammal, taxonomy Introduction Vietnam, situated on the eastern boundary of the Indochinese peninsula and forming part of the Indo–Burma biodiversity hotspot, is recognized as one of the most biodiverse countries in Southeast Asia. This biodiversity is principally attributed to the country’s highly varied topography, complex climatic Academic editor: Alessio Iannucci Received: 14 June 2025 Accepted: 25 August 2025 Published: 10 October 2025 ZooBank: https://zoobank. org/3C3E0CF2-85BF-4F5C-B4D39140F0BE2BC9 Citation: Nguyen ST, Bui HT, Dau VQ, Le PD, Vu YH (2025) Euroscaptor darwini sp. nov., a new species of mole (Mammalia, Eulipotyphla, Talpidae) from the north-central mountains in Vietnam. ZooKeys 1255: 239–274. https://doi.org/10.3897/ zookeys.1255.161942 ZooKeys 1255: 239–274 (2025) DOI: 10.3897/zookeys.1255.161942 * These authors contributed equally and share first and corresponding authorship. 240 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam regimes, and biogeographic position within the transitional zone between the subtropics and tropics (Sterling and Hurley 2005; Sterling et al. 2006; Dang et al. 2008; Tordoff et al. 2012). Stretching more than 1650 km from north to south in a characteristic “S-shaped” configuration, Vietnam encompasses a mosaic of ecological regions, including river deltas, karst limestone formations, tropical lowland forests, and isolated high-elevation mountain ranges, each harboring distinct faunal assemblage (Bain and Hurley 2011). This habitat complexity, together with historical geological activity and limited faunal dispersal across rugged terrain, has led to significant biogeographic fragmentation and elevated levels of endemism terrestrial vertebrates (Sterling and Hurley 2005; Badgley et al. 2017). Among small insectivorous mammals, fossorial mole species are especially sensitive to geographical barriers due to their highly specialized subterranean lifestyle and low dispersal capacity (Nevo 1985, 1999). These characteristics promote population isolation and localized divergence, making these insectivores an excellent model system for studying the effects of geographic isolation in driving genetic, morphological differentiation and speciation (Huxley 1938; Kottler 1978; Barrow and MacLeod 2008; Pérez et al. 2017). In Vietnam, the role of ecological gradients, especially altitudinal zonation, has been proposed as a major driver of both intraspecific and interspecific diversification in mammals (Motokawa and Lin 2002; Asahara et al. 2012; Bui et al. 2020a). The eastern mountain systems of Vietnam, particularly the Hoang Lien Son Range and Annamite Range, represent ancient montane landscapes that not only provide climatic and elevational refugia but also function as long-standing biogeographical barriers. These areas are highly conducive to allopatric speciation in limited dispersing taxa. In particular, montane habitats above 1000 meters have consistently yielded genetically and morphologically distinct populations, many of which have been overlooked in traditional faunal surveys due to their cryptic behaviors (Zemlemerova et al. 2016; Bui et al. 2020a). The genus Euroscaptor Miller, 1940 (Talpini, Talpidae) is a taxonomically complex lineage of fossorial mammals, characterized by cryptic species and a broad distribution across East and Southeast Asia (Hutterer 2005; He et al. 2014; Kryštufek and Motokawa 2018; Burgin et al. 2020). Members of this genus are highly adapted to a subterranean lifestyle and typically inhabit forested mountain environments and moist montane habitats, across a wide elevational range. Despite their broad distribution, Euroscaptor species remain among the least known small mammals in Asia, having been historically under-sampled due to their elusive behaviors, cryptic habits, limited surface activity and morphologically conservative adaptations to underground niches. Euroscaptor was originally established to accommodate a group of Asian moles exhibiting primitive dental characters and specialized fossorial morphologies (Kawada 2016). At present, it is recognized as the second largest genus of the family Talpidae (Kryštufek and Motokawa 2018; Burgin et al. 2020), comprising ten extant species, including: E. micrura (Hodgson, 1841), E. longirostris (Milne-Edwards, 1870), E. klossi (Thomas, 1929), E. grandis Miller, 1940, E. parvidens Miller, 1940, E. malayana (Chasen, 1940) (see Kawada et al. 2008), E. subanura Kawada et al., 2012, E. kuznetsovi Zemlemerova et al., 2016, E. orlovi Zemlemerova et al., 2016, and E. ngoclinhensis 241 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Zemlemerova et al., 2016 (see Bui et al. 2020a). Based on cranial morphology and dental characters, Euroscaptor species have been classified into two major clades: a western group and an eastern group (Kawada et al. 2009, 2012). The western group comprises E. micrura, E. klossi, and E. malayana, while the eastern group includes northern Vietnamese populations previously assigned to E. longirostris, which have now been reclassified into two separate species: E. kuznetsovi and E. orlovi (Zemlemerova et al. 2016), along with E. parvidens, E. ngoclinhensis, and E. subanura. Vietnam represents the highest diversity for the genus, currently harboring five recognized Euroscaptor species: E. kuznetsovi, E. orlovi, E. parvidens, E. ngoclinhensis, and E. subanura. Four of these species: E. parvidens, E. ngoclinhensis, E. kuznetsovi and E. subanura, are only restricted to Vietnam. Phylogenetically, Euroscaptor forms a distinct clade within Talpinae, separate from other talpine genera such as Mogera, Parascaptor, and Talpa (Zemlemerova et al. 2013, 2016; Bannikova et al. 2015a). Recent advances in molecular systematics have revealed that Euroscaptor encompasses considerable cryptic diversity (He et al. 2014). Multilocus phylogenies based on mitochondrial genes (Cyt b, 12S rRNA) and nuclear loci (BRCA1, RAG1, ApoB) have revealed the several morphologically similar but genetically distinct lineages exist in this genus. These lineages often correspond to discrete geographic regions or elevational zones, suggesting allopatric speciation driven by mountainous topography and ecological barriers (Bannikova et al. 2015a, 2015b; Shinohara et al. 2015; Zemlemerova et al. 2016). Morphologically, Euroscaptor species are characterized by external features associated with their underground-living lifestyle: a cylindrical body, robust forelimbs for digging, shovel-like claws, greatly reduced or absent external pinnae, minute and concealed eyes. Their rostrum is typically elongated and narrow, often with prominent sensory vibrissae (Kawada et al. 2012; Bui et al. 2020a). While external morphological characters are often conservative and overlapping among species, craniodental traits have proven to be more informative for species delimitation, when analyzed in combination with cytogenetic and molecular data (Kawada et al. 2012; Shinohara et al. 2015; Bui et al. 2020a). The skulls of Euroscaptor spp. are typically flat and elongated, with slender rostra, narrow interorbital widths, and highly variable palatal and braincase breadths. The genus retains a primitive dental formula: I3/3, C1/1, P4/4, M3/3 = 44 (Kawada et al. 2012). Interspecific distinctions often rely on subtle diagnostic features, such as the shape and alignment of molar cusps, the degree of triangularization of the upper molars, the presence or absence of the hypoconulid on lower molars, and the configuration of the zygomatic arches. In the present study, we found five new specimens of Euroscaptor from montane forests above 1000 m in Pu Luong NR, north-central Vietnam. The new taxon is defined by a remarkably short tail, which is the most reduced among known congeners both in absolute length and in vertebral segmentation. Phylogenetic analyses based on Cyt b and 12S rRNA genes confirmed its distinct lineage, with genetic divergences falling within the expected range for interspecific differences in Talpidae. Multivariate analyses and morphometric comparisons of Vietnamese Euroscaptor populations were also conducted to assess morphological variation and further corroborate their taxonomic identity. Herein, we describe this newly discovered population as a new Euroscaptor species. 242 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Materials and methods Study locality and sampling methods Pu Luong Nature Reserve (Pu Luong NR), situated in the northwestern region of Thanh Hoa Province, north-central Vietnam (20°21'–20°34'N, 105°02'– 105°20'E) (see Fig. 1) (Le et al. 2015), is recognized as one of the key protected areas within the Indo–Burma Biodiversity Hotspot (BirdLife International Vietnam Programme and FIPI 2001; Tordoff et al. 2004). The reserve is characterized by a distinctive landscape formed by two parallel mountain ridges running northwest to southeast, separated by a central lowland valley, which is excluded from the core protected zone. The northeastern ridge consists primarily of highly dissected limestone karst formations, forming a geologic continuum with the karst system of Cuc Phuong NP and extending further northwest ward to Son La Province, whereas the southwestern ridge is characterized predominantly by typical non-karstic (soil-based) mountain terrain. Elevations within Pu Luong range from ca 60 m to more than 1700 m a.s.l., harboring diverse microhabitats from lowland tropical broadleaf forests to montane evergreen ecosystems (Center for Nature Conservation and Development 2005). Our field surveys targeting small mammals, particularly fossorial moles, were conducted along the trail to the summit of Pu Luong Mountain, with the assistance of a local guide across two periods: the first from 5–12 November 2024, and the second from 4–10 April 2025. Sampling was concentrated along the southwestern ridge of Pu Luong Mountain, with survey effort directed toward forest habitats between 900 m and 1100 m a.s.l., during the dry season. Sampling was conducted using specialized tunnel traps, a standard method Figure 1. a. Map of Vietnam showing the location of Pu Luong NR in Thanh Hoa Province (highlighted in red); b. Black dot enclosed within teal triangle marks the type locality, distributed along altitudinal transects (600–1100 m a.s.l.). The map was generated using QGIS 3.38.3 (https://www.qgis.org) and edited in Adobe Photoshop 2023. 243 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam for capturing fossorial mammals (Sikes et al. 2011; Kawada et al. 2012). Each tunnel trap consisted of a cylindrical plastic tube (~4.5 cm in diameter and ~8.5 cm in length), with a central chamber fitted with a spring-loaded mechanism. Traps were checked daily early morning to ensure proper functioning and to promptly retrieve captured specimens. During each survey, eleven tunnel traps were deployed at six trapping stations along forest trails and areas with fresh molehills, targeting locations with soft, moist soils indicative of recent mole activity. The stations were established at ~950 m a.s.l. in a relatively flat area beyond an almost vertical slope (Figs 1, 2a), which corresponding to the site where the first unknown mole specimen, an adult male, was discovered in November 2024 (Fig. 1). During the follow-up field survey in April 2025, the research team collected two additional individuals from the same locality where the first male had been obtained, and two others from the elevation of ca1000 m a.s.l. (Fig. 2b–d). All specimens were captured using tunnel traps placed along altitudinal range (950–1100 m) across various habitat types. Geographic coordinates and elevations were recorded using the Gaia GPS mobile application (WGS84 datum) (Fig. 2e). Following processing, captured individuals were retained as voucher specimens for taxonomic identification and further examination. All voucher specimens were initially fixed in 95% ethanol for the first 30 days, and then transferred to 70% ethanol for long-term storage. The skull, pelvic bone, and caudal vertebrae were extracted from the specimen and thoroughly cleaned. Liver tissue samples were separately preserved in absolute ethanol for subsequent genetic analysis. Voucher specimens and associated tissue samples of new taxon are currently deposited in the collections of the Department of Zoology, Institute of Biology (IB), VAST, Hanoi. Molecular data and phylogenetic analyses DNA was isolated from liver tissue samples preserved in 99% ethanol using the DNeasy® Blood and Tissue Kit (Qiagen, Hilden, Germany), following the manufacturer’s standard protocol. The mitochondrial Cyt b gene was selected due to its demonstrated effectiveness in resolving species-level identification. Amplification of the Cyt b fragment was performed using the primer pair SoriF (5′–CCATCTCTGGTTTACAAGAC–3′) and SoriR (5′ TGACATGAAAAATCATCGTTG–3′) (Bui et al. 2020b). In addition, the partial mitochondrial 12S ribosomal RNA (12S rRNA) gene was included in the analysis to provide complementary phylogenetic resolution. This fragment was amplified using the primer pair L–613 (5′–ACACAAAGCATGGCACTGAA–3′; Mindell et al. 1991) and H–1478 (5′–TGACTGCAGAGGGTGACGGGCGGTGTGT–3′; Kocher et al. 1989). PCR reactions were conducted using the PCR Master Mix (Phusa Genomics, Can Tho, Vietnam) under the following thermal cycling conditions: an initial denaturation at 95 °C for 5 min; followed by 35 cycles of 95 °C for 30 s, annealing at 56 °C for 50 s, and extension at 72 °C for 2 min; with a final extension at 72 °C for 10 min. Amplified products were then purified and sequenced by 1st BASE (Selangor, Malaysia) using Sanger sequencing protocols. Forward and reverse chromatograms of both Cyt b and 12S rRNA sequences were manually edited and assembled into consensus sequences using 244 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Chromas Pro (Technelysium Pty Ltd., Australia), MEGA 11 (Tamura et al. 2021) and BioEdit (Hall 1999), with manual verification for base-calling accuracy and alignment consistency. Multiple sequence alignment was performed using the MUSCLE algorithm (Edgar 2004) implemented in MEGA 11. The final alignment lengths were 1140 base pairs for Cyt b and 846 base pairs for 12S rRNA. No insertions or deletions (indels) were detected across any of the ingroup sequences. The concatenated alignment of Cyt b and 12S rRNA gene fragments was constructed using SequenceMatrix v. 1.8 (Vaidya et al. 2011), based on aligned sequences with matching taxon labels. Intraspecific and interspecific pairwise uncorrected divergences (p–distances) for Cyt b sequences were computed in MEGA 11, applying pairwise deletion of gaps/missing sites and variance estimates via bootstrap with 10000 replicates. Figure 2. Habitat characteristics and sampling localities in Pu Luong NR. a. Tropical evergreen forest at ~935 m a.s.l., representing the type locality of the holotype; b–d. Typical microhabitats where paratypes were captured. Sampling points (red markers) correspond to trapping stations along the altitudinal transect; e. Topographic trail map and elevational profile (581–995 m a.s.l.) of the sampling route, generated using the Gaia GPS mobile application. 245 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Phylogenetic reconstruction was inferred using both Maximum Likelihood (ML) and Bayesian Inference (BI) methods. The ML analysis was conducted using IQ–TREE v. 1.6.12 (Nguyen et al. 2015), with the optimal substitution model for each dataset determined by the Bayesian Information Criterion (BIC) via ModelFinder (Kalyaanamoorthy et al. 2017), as implemented in IQ– TREE. Model selection identified HKY+I as the best-fit model for the Cyt b, GTR+G+I for the 12S rRNA, and TN93+G for the concatenated alignment. ML trees were generated with 10000 ultrafast bootstrap replicates (UFBoot, Hoang et al. 2018) to evaluate branch support. Bayesian phylogenetic inference was performed using MrBayes v. 3.2.7 (Ronquist et al. 2012). Substitution models for each partition were selected using Kakusan4 (Tanabe 2011) under Akaike Information Criterion (AIC). Each analysis consisted of two independent runs of four Markov Chain Monte Carlo (MCMC) chains each (one cold and three heated) for 10 million generations, sampling every 1000 generations. A 50% majority-rule consensus tree was constructed after discarding the first 25% of trees as burn-in, and Bayesian posterior probabilities (PP) were calculated for all nodes. The resulting phylogenetic trees were visualized using FigTree v. 1.4.4 and represented graphically in Adobe Illustrator 2023. Morphological examination All five captured individuals were photographed after capture using a Canon EOS Kiss X7 digital camera equipped with a Canon EF-S 18–55 mm f/3.5–5.6 kit lens. Standard morphometric measurements were recorded, followed procedures in Kawada et al. (2012). The following measurements were obtained: body length (HB), tail length (T), hind foot length with claws (HF), forefoot width (FFW), and forefoot length without claws (FFL), along with data on sex, and reproductive status. Craniodental measurements were taken under a stereoscopic microscope (SMZ 745, Nikon, Japan) using an electronic digital caliper (NTD12–15PMX, Mitutoyo, Japan) with a precision of 0.01 mm. A total of 36 craniodental measurements were taken for each specimen, including 15 metrics following the method of Kawada et al. (2007), and an additional 21 measurements recorded in this study (Fig. 3). Detailed descriptions of each measurement are provided in Suppl. material 1. The dataset comprised measurements from 65 adult skulls, including five skulls of new Euroscaptor and 60 comparative skulls from other Euroscaptor species recognized in Vietnam (Suppl. material 2). All the measurements are in millimeters. Statistical analyses Minimum, maximum, mean values, and standard deviations for measurements were calculated using Microsoft® Excel version Office 2021 (Microsoft, Redmond, WA, USA). Multivariate analyses of craniodental morphology among Vietnamese fossorial moles were conducted to evaluate interspecific morphometric variations, including Principal Component Analysis (PCA) and Multivariate Analysis of Variance (MANOVA) based on log-transformed measurements. Differences in the mean values between groups were 246 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Figure 3. Dorsal (a), ventral (b), and lateral (c) views of the cranium; d. Lateral view of the mandible showing craniodental measurements. Diagram constructed based on the craniodental morphology of the new male specimen by VHY. 247 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam examined using t-tests, preceded by F-tests to assess homogeneity of variances (P < 0.05). Analysis of variance (One-way ANOVA) followed by Tukey’s honestly significant difference (HSD) (significant at P < 0.05) was used for pairwise comparisons within taxa. All these analyses were performed using the PAST software v. 4.13 (Hammer et al. 2001). Results Phylogenetic analyses The concatenated phylogenetic tree reconstructed using both ML and BI methods generated congruent topologies with strong statistical support across all major nodes. ML tree is presented in Fig. 4a, with support values indicated as ML bootstrap (MLBS) and Bayesian posterior probabilities (PP). The genus Euroscaptor was recovered as a well-supported monophyletic group, clearly distinguished from the outgroup Mogera latouchei in Vietnam. All recognized species-level clades exhibit high support values (MLBS ≥ 90%). The newly collected specimens from Pu Luong NR represent a genetically distinct and maximally supported monophyletic lineage (MLBS = 100%, PP = 1.0). This clade is positioned as the sister group to the E. subanura, from which it is separated by strong branch support and considerable Figure 4. Maximum likelihood (ML) phylogenetic tree constructed based on a. The concatenated mitochondrial Cyt b and 12S rRNA gene sequences (1,986 bp); b. Cyt b sequences (1,140 bp) of the Euroscaptor spp. Nodal support values are indicated as Maximum Likelihood Bootstrap Support/Bayesian Posterior Probability (MLBS/BPP). Representatives of the genus Mogera were included as the outgroup. Each terminal taxon is labelled with its corresponding voucher number, sampling locality, and GenBank Accession Number of both Cyt b and 12S gene listed in Suppl. material 5. 254 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Cranium morphology. The cranium is diminutive, lightly built, and slender in profile, with a greatest length (GLS) of 30.51 mm falling within the lower size range documented for Euroscaptor species in Vietnam (Table 4). The rostrum is proportionally short and gradually tapered anteriorly, forming a triangular outline in dorsal view. In lateral aspect, the rostral region is straight and only slightly arched dorsally. The braincase is moderately inflated with a smoothly domed dorsal surface. The interorbital region is nearly parallel-sided, maintaining consistent height from the frontals to the parietals. The sagittal crest is absent, and the lambdoidal crest is low and rounded, contributing to the smooth contour of the posterior cranial vault. The zygomatic arches are poorly developed, lacking the thickened and laterally expanded morphology seen in larger species (Fig. 5c). The infraorbital foramina are small and positioned close to the anterior margin of the maxillae. The auditory bullae are dorsoventrally flattened, not extending beyond the posterior margin of the skull, and lacking any significant lateral inflation. The occipital region is gently rounded, with no prominent ridges or projections. Figure 9. Bivariate scatterplots of the 1st, 2nd, and 3rd principal component scores derived from log-transformed craniodental measurements for Euroscaptor species in Vietnam. a. Scatterplot of PC1 vs PC2 showing differentiation among E. darwini (red squares), E. subanura (asterisks), E. kuznetsovi (triangles), E. orlovi (circles), E. ngoclinhensis (gray squares), and E. parvidens (diamonds); b, c. Plot of PC1 vs PC2 and PC2 vs PC3 for E. darwini (red color) and E. subanura (teal color); d, e. Plot of PC1 vs PC2 and PC2 vs PC3 for E. darwini (red color) and six E. subanura populations in Vietnam (teal color). 255 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Mandible and dentition. The mandible of holotype is delicate and moderately arched, with a slender ascending ramus and a weakly developed angular process. The lower border of the mandible is gently concave; the coronoid process is narrow and slightly recurved. The mandibular condyle is small, and the mandibular symphysis is short and tightly fused. The species retains the primitive fossorial mole dental formula: I3/3, C1/1, P4/4, M3/3 = 44. The first upper incisor (I1) slightly recurved posteriorly and has a prominent cutting edge. I2 and I3 are slightly smaller than I1, closely aligned, and gradually taper in height and volume. In the lower jaw, the first incisor (i1) is small and curves slightly forward, Table 3. Comparative statistics of external measurements (in millimeters) between E. darwini sp. nov. and other fossorial mole species. (*) indicates shared measurements between E. parvidens and E. ngoclinhensis; (#) indicates shared measurements between E. kuznetsovi and E. orlovi. Species Reference (n) HB T HF FFW FFL Tail ratio = T/ HB (%) E. darwini sp. nov. This study (holotype ♂) 115.71 2.11 14.51 13.88 13.29 1.82 This study (4 paratypes ♀) 122.21–127.93 125.52 ± 2.86 2.67–3.74 3.33 ± 0.47 14.86–15.38 15.03 ± 0.24 14.02–14.51 14.21 ± 0.22 13.64–14.11 13.86 ± 0.28 2.18–2.92 2.64 ± 0.32 This study (both sexes) 115.71–127.93 123.56 ± 5.04 2.11–3.74 3.08 ± 0.68 14.51–15.38 14.93 ± 0.31 13.88–14.51 14.14 ± 0.24 13.29–14.11 13.79 ± 0.41 1.82–2.92 2.48 ± 0.46 E. subanura Kawada et al. (2012) (8) 113.0–130.0 122.88 ± 5.51 4.0–5.0 4.38 ± 0.44 13.5–15.5 14 ± 0.38 15.0–16.5 14.38 ± 0.38 14.0–15.5 14.75 ± 0.46 3.6 Kawada (2016) (28) 113.0–131.5 125.48 ± 3.95 2.5–5.0 3.80 ± 0.79 13.0–14.5 13.70 ± 0.49 13.0–15.5 14.21 ± 0.55 13.0–15.5 14.27 ± 0.62 1.96–4.24 3.04 ± 0.65 Bui (2022) (42) 107.0–130.5 121.89 ± 5.61 2.50–5.00 3.76 ± 0.73 12.0–16.5 14.02 ± 0.87 13.0–15.5 14.29 ± 0.55 13.80–18.00 14.80 ± 0.84 2.33–3.85 3.08 ± 0.56 E. parvidens Kawada et al. (2012) (10) * 135.0–148.5 143.75 ± 3.75 5.5–9.0 6.95 ± 1.09 13.5–15.5 14.6 ± 0.66 15.0–16.5 15.4 ± 0.61 14.5–16.5 15.3 ± 0.63 4.8 Kawada (2016) (18) * 135.0–150.0 144.89 ± 3.77 5.5–10.5 7.42 ± 1.30 13.5–16.0 14.92 ± 0.69 14.0–17.5 15.47 ± 0.88 14.5–18.0 15.75 ± 0.93 4.07–7.07 5.11 ± 0.83 Bui (2022) (42) 130–165.5 150.9 ± 10.71 5.5–10.0 7.9 ± 1.48 12.0–17.74 16.01 ± 1.18 14.15–16.96 15.65 ± 0.54 14.7–17.6 16.03 ± 0.80 4.23–6.06 5.23 ± 0.0.75 E. ngoclinhensis Bui (2022) (30) 120.0–150.0 137.87 ± 9.01 5.50–10.0 7.50 ± 1.18 12.0–16.0 14.15 ± 0.93 12.27–17.0 14.66 ± 1.34 13.20–18.00 15.02 ± 1.09 4.58–6.67 5.44 ± 0.86 E. kuznetsovi Kawada et al. (2012) (19) # 133.0–144.0 138.45 ± 3.39 14.0–17.0 15.37 ± 1.01 14.5–16.5 15.55 ± 0.50 14.5–17.0 15.95 ± 0.71 15.0–17.5 16.26 ± 0.77 11.1 Kawada (2016) (27) # 122.0–144.0 136.85 ± 4.97 10.0–17.0 14.69 ± 2.00 14.5–16.5 15.46 ± 0.46 14.5–17.0 15.91 ± 0.72 15.0–17.5 16.24 ± 0.74 8.19–11.81 10.73 ± 0.93 Zemlemerova et al. (2016) 132–136 11.4–12.5 Kryštufek and Motokawa (2018) 117–136 14–17 14.5–16.5 11.6–14.5 Bui (2022) (24) 115.4–144 137.37 ± 5.74 14–17.5 15.65 ± 1.09 14.5–18.4 15.73 ± 0.77 14.5–17 15.82 ± 0.69 15–17.9 16.36 ± 0.80 11.33–12.57 12.05 ± 0.4 E. orlovi Zemlemerova et al. (2016) 115–129 12.6–13.7 Kryštufek and Motokawa (2018) 106–129 15–17.5 15.5 12.5–15.1 Bui (2022) (6) 115–137.62 127 ± 7.40 11.76–19.28 16 ± 2.29 13.43–15.5 14.87 ± 0.92 14–16.5 15.15 ± 0.73 15–16.5 15.83 ± 0.76 10.63–13.57 12.45 ± 0.67 E. longirostris Smith and Xie (2008) 90–145 11.0–25 14–23 E. klossi Kawada et al. (2012) (2) 130.0–135.5 9.5–10.5 15 16 16.0–16.5 7.5 Kawada (2016) (4) 115.0–135.5 127.63 ± 8.81 9.5–13 11.25 ± 1.55 15.0–16.0 15.38 ± 0.48 16.0–17.0 16.38 ± 0.48 15.5–16.5 16.13 ± 0.48 7.01–11.30 8.91 ± 1.84 Smith and Xie (2008) 115–135.5 9.5–13 15–16 7–11.3 E. malayana Kawada et al. (2008) 124–134.5 4.5–8.5 14–16.5 15–17 15–19 3.35–6.59 Kawada (2016) (10) 128.5–134.5 131.15 ± 1.94 4.5–8.5 5.70 ± 1.09 14.5–16.5 15.50 ± 0.62 15.5–17.0 16.40 ± 0.57 15.0–16.5 15.80 ± 0.42 3.34–6.58 4.35 ± 0.86 Smith and Xie (2008) 128.5–134.5 4.5–8.5 14.5–16.5 3.3–6.6 E. grandis Miller (1940) 150 9.6 18 15 E. micrurus Smith and Xie (2008) 128–135 5–9 15–16 256 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Table 4. Craniodental measurements of the Euroscaptor species in Vietnam. For measurements abbreviations, see Materials and methods section. The complete list of specimens included in the craniodental analysis is provided in Suppl. material 2. Character Species (n) E. darwini sp. nov. (5) E. subanura (21) E. ngoclinhensis (4) E. parvidens (13) E. kuznetsovi (11) E. orlovi (3) GLS 30.51–31.01 30.88 ± 0.21 29.49–31.69 30.71 ± 0.55 31.83–33.03 32.53 ± 0.54 33.53–34.76 34.07 ± 0.41 31.75–34.72 33.74 ± 0.73 32.87–33.91 33.50 ± 0.56 BB 13.77–14.26 14.02 ± 0.22 13.44–14.67 14.01 ± 0.29 14.37–14.76 14.59 ± 0.17 14.11–15.32 14.78 ± 0.33 14.71–15.67 15.22 ± 0.32 15.22–16.04 15.51 ± 0.46 IOB 6.72–6.87 6.82 ± 0.06 6.53–7.31 6.83 ± 0.2 6.72–7.21 6.98 ± 0.2 6.41–7.01 6.78 ± 0.16 6.67–7.58 7.04 ± 0.22 7.19–7.31 7.25 ± 0.06 BIOF 5.41–5.77 5.62 ± 0.14 6.07–6.46 6.25 ± 0.27 6.16–6.46 6.36 ± 0.14 6.53–6.76 6.64 ± 0.12 6.18–6.92 6.55 ± 0.21 6.26–6.37 6.32 ± 0.06 RB 4.12–4.27 4.19 ± 0.06 3.84–4.41 4.09 ± 0.14 4.06–4.34 4.20 ± 0.12 4.28–4.74 4.58 ± 0.13 4.13–4.47 4.33 ± 0.1 4.21–4.36 4.30 ± 0.08 LZA 7.88–8.22 8.01 ± 0.13 6.83–7.74 7.33 ± 0.26 8.11–8.72 8.31 ± 0.28 8.69–9.51 9.06 ± 0.27 8.38–9.08 8.62 ± 0.36 8.18–8.39 8.31 ± 0.11 PZRW 10.09–10.37 10.21 ± 0.11 9.19–10.18 9.87 ± 0.3 10.54–10.77 10.64 ± 0.1 10.02–11.15 10.57 ± 0.29 10.53–11.32 11.03 ± 0.27 10.44–10.79 10.64 ± 0.18 ACRB 6.93–7.19 7.06 ± 0.11 7.01–7.28 7.18 ± 0.07 6.66–6.74 6.70 ± 0.04 6.39–6.54 6.46 ± 0.05 7.25–7.45 7.32 ± 0.06 6.68–6.81 6.76 ± 0.07 FMW 3.35–3.54 3.43 ± 0.07 3.27–3.75 3.53 ± 0.16 3.81–4.02 3.89 ± 0.09 3.62–4.23 3.88 ± 0.18 3.55–4.09 3.76 ± 0.17 3.45–3.92 3.68 ± 0.24 CCoL 21.41–21.88 21.59 ± 0.17 20.75–22.43 21.62 ± 0.51 23.07–23.65 23.23 ± 0.28 23.21–24.86 24.1 ± 0.41 22.68–24.38 23.96 ± 0.48 23.55–24.02 23.85 ± 0.26 PL 11.61–12.16 11.92 ± 0.23 11.31–12.6 12.05 ± 0.37 12.58–12.97 12.75 ± 0.16 12.74–13.69 13.31 ± 0.3 12.92–14.18 13.64 ± 0.34 13.31–13.65 13.52 ± 0.19 I1–M311.51–12.02 11.75 ± 0.23 11.19–12.72 11.81 ± 0.41 12.17–12.44 12.30 ± 0.11 12.51–13.24 12.81 ± 0.21 12.55–13.61 13.19 ± 0.34 12.85–13.21 13.03 ± 0.18 I1–P47.15–7.53 7.35 ± 0.16 6.73–7.79 7.28 ± 0.3 7.29–7.72 7.45 ± 0.19 7.67–8.37 7.95 ± 0.2 7.75–8.37 8.04 ± 0.21 8.05–8.19 8.12 ± 0.07 I1–P35.72–6.07 5.92 ± 0.14 5.16–6.06 5.7 ± 0.28 5.47–5.88 5.75 ± 0.19 5.84–6.45 6.15 ± 0.15 5.95–6.65 6.31 ± 0.21 6.27–6.54 6.40 ± 0.14 I1–C 2.94–3.17 3.03 ± 0.11 2.62–3.09 2.90 ± 0.15 3.02–3.21 3.11 ± 0.08 3.22–3.76 3.46 ± 0.17 3.01–3.39 3.22 ± 0.13 3.29–3.46 3.35 ± 0.09 C–M310.13–10.44 10.25 ± 0.14 9.76–11.21 10.34 ± 0.41 10.69–10.99 10.79 ± 0.14 10.63–11.58 11.07 ± 0.27 11.04–11.83 11.49 ± 0.24 11.21–11.43 11.30 ± 0.11 C–P45.51–5.93 5.69 ± 0.2 5.27–6.27 5.71 ± 0.31 5.59–5.97 5.74 ± 0.17 5.72–6.61 6.09 ± 0.25 5.89–6.45 6.18 ± 0.17 6.13–6.25 6.17 ± 0.07 P4–M35.91–6.18 6.10 ± 0.11 5.71–6.58 6.14 ± 0.24 6.34–6.78 6.63 ± 0.2 6.39–6.87 6.67 ± 0.12 6.61–7.21 6.93 ± 0.2 6.62–6.77 6.68 ± 0.08 P1–P43.99–4.11 4.06 ± 0.05 4.13–4.29 4.21 ± 0.07 4.01–4.14 4.08 ± 0.06 3.83–4.57 4.35 ± 0.21 4.44–4.87 4.58 ± 0.11 4.36–4.59 4.48 ± 0.12 M1–M34.54–5.03 4.75 ± 0.19 4.34–5.21 4.73 ± 0.25 4.94–5.28 5.12 ± 0.14 4.86–5.23 5.06 ± 0.1 4.79–5.62 5.24 ± 0.23 5.09–5.34 5.19 ± 0.13 M2–M2W6.71–7.17 6.96 ± 0.22 6.65–7.81 7.06 ± 0.27 7.41–7.68 7.57 ± 0.12 7.01–7.82 7.35 ± 0.2 7.14–7.71 7.44 ± 0.19 7.27–7.59 7.44 ± 0.16 CCW 3.64–3.85 3.74 ± 0.09 3.41–3.79 3.59 ± 0.11 3.57–3.79 3.65 ± 0.1 3.79–4.41 4.03 ± 0.18 3.69–4.04 3.88 ± 0.12 3.77–3.98 3.88 ± 0.11 PWCC 2.27–2.42 2.36 ± 0.06 2.16–2.54 2.32 ± 0.1 2.31–2.49 2.40 ± 0.1 2.32–2.69 2.52 ± 0.1 2.25–2.62 2.43 ± 0.12 2.36–2.73 2.50 ± 0.2 PWM2M23.81–3.93 3.90 ± 0.05 3.48–4.18 3.84 ± 0.18 3.91–4.06 4.00 ± 0.07 3.67–4.21 3.93 ± 0.15 3.64–4.07 3.86 ± 0.14 3.88–3.95 3.91 ± 0.04 PWM3M33.91–4.06 3.98 ± 0.06 3.67–4.35 4.06 ± 0.17 4.12–4.45 4.28 ± 0.17 3.94–4.46 4.21 ± 0.15 3.79–4.43 4.21 ± 0.21 4.26–4.31 4.28 ± 0.03 ML 18.93–19.37 19.19 ± 0.16 18.33–20.28 19.24 ± 0.53 19.91–21.01 20.38 ± 0.48 20.61–22.02 21.42 ± 0.39 20.31–22.03 21.44 ± 0.44 21.04–21.46 21.21 ± 0.22 CAL 8.09–8.24 8.15 ± 0.06 7.69–8.49 8.15 ± 0.21 8.47–9.27 9.05 ± 0.38 8.61–9.53 9.24 ± 0.29 8.69–9.65 9.31 ± 0.26 9.05–9.17 9.09 ± 0.07 MH 5.73–5.84 5.78 ± 0.05 5.31–6.31 5.80 ± 0.26 6.01–6.21 6.14 ± 0.09 6.17–6.81 6.39 ± 0.19 6.03–6.81 6.49 ± 0.23 6.25–6.67 6.43 ± 0.22 i1–m310.88–11.45 11.16 ± 0.23 10.47–11.87 11.14 ± 0.45 11.43–11.74 11.57 ± 0.13 11.77–12.36 12.04 ± 0.18 11.86–12.94 12.5 ± 0.33 11.96–12.36 12.22 ± 0.23 257 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam while i2 and i3 are smaller and aligned along the lateral mandibular toothrow. The upper canines (C1) are moderate in size, conical, and do not protrude strongly beyond the adjacent teeth, while the lower canines (c1) are similar in shape to the three lower incisors. The premolars (P1–P4 / p1–p4) are asymmetrical in size. In the upper jaw, P2 is the smallest of the series, whereas P4 is the largest and more robust in overall dimensions—nearly 2.5 times the size of P2. P1 and P3 are almost equal in crown height. In the lower jaw, there is a clear size progression, with p4 being the largest. The p1 and p4 are subequal, while p2 is slightly reduced. The upper molars (M1–M3) exhibit a narrow lingual margin, and instead of hypocones, they possess well-developed metaconules, especially on P2 and P1, which are clearly visible from the lingual view. M3 displays a triangular occlusal outline, with a prominent trigon and an anteriorly shifted protocone. The lower molars (m1–m3) lack hypoconulids, and cuspid separation is relatively weak. Pelvic morphology. The pelvic girdle is slender and reduced in overall robustness. The ischia are shortened and thin, contributing to a narrow pelvic outlet (Fig. 5). The sacral vertebrae articulate weakly with the ilia, and the pelvis shows no evidence of expanded muscle attachment sites. Female secondary sexual characters. The adult female paratype (NTS.2025. PL.02) exhibits clearly identifiable sexual characteristics indicative of reproductive maturity (Fig. 6). External morphological inspection reveals the presence of two pairs of inguinal mammae, symmetrically positioned along the lower abdomen. The nipples are well-developed and slightly protruding, with the surrounding fur slightly parted. The most prominent external feature is a conspicuous pale-yellow ventral pattern, extending longitudinally from the lower thoracic region to the pelvic area. The streak is localized along the midline, forming a contrast with the darker grey–brown ventral pelage, and is absent in male and non-breeding female specimens examined in the series. This individual was confirmed to be gravid at the time of capture, based on visible abdominal distension and the presence of developing embryos upon dissection. Variation. The holotype displays a uniformly dark greyish–black dorsum with a faint silvery sheen, while the ventral surface is only marginally lighter, resulting in a nearly unicolored appearance. In contrast, female paratypes show more pronounced ventral pallor, especially in the throat and pelvic regions, sometimes accompanied by a brownish tinge around the chest. The pregnant female (NTS.2025.PL.02) has a distinct pale-yellow fur area on the mid-ventral surface. Character Species (n) E. darwini sp. nov. (5) E. subanura (21) E. ngoclinhensis (4) E. parvidens (13) E. kuznetsovi (11) E. orlovi (3) p1–m38.99–9.43 9.21 ± 0.18 8.48–9.76 9.15 ± 0.37 9.29–9.57 9.44 ± 0.12 9.18–9.91 9.58 ± 0.18 9.74–10.55 10.23 ± 0.25 9.82–10.14 10.01 ± 0.17 p4–m36.07–6.47 6.28 ± 0.16 5.85–6.68 6.28 ± 0.28 6.51–6.89 6.70 ± 0.21 6.16–6.89 6.65 ± 0.2 6.72–7.47 7.14 ± 0.23 6.62–6.94 6.78 ± 0.16 i1–p46.11–6.27 6.21 ± 0.06 6.16–6.33 6.23 ± 0.06 6.25–6.31 6.27 ± 0.03 6.53–6.71 6.64 ± 0.06 6.78–7.06 6.93 ± 0.08 6.67–6.81 6.75 ± 0.07 m1–m34.89–5.29 5.05 ± 0.16 4.62–5.49 5.01 ± 0.27 4.98–5.42 5.27 ± 0.2 5.17–5.59 5.36 ± 0.1 5.27–6.18 5.68 ± 0.28 5.34–5.53 5.45 ± 0.1 i1–c 1.54–1.63 1.59 ± 0.04 1.65–1.88 1.76 ± 0.08 1.68–1.96 1.79 ± 0.13 1.93–2.27 2.11 ± 0.09 1.83–2.16 1.96 ± 0.11 1.74–1.81 1.77 ± 0.04 i1–p12.95–3.19 3.04 ± 0.09 2.77–3.34 3.09 ± 0.15 3.05–3.16 3.12 ± 0.05 3.52–3.88 3.68 ± 0.12 3.29–3.71 3.47 ± 0.14 3.37–3.54 3.48 ± 0.1 p1–p43.97–4.19 4.10 ± 0.09 3.63–4.39 4.00 ± 0.19 3.91–4.14 3.99 ± 0.1 3.94–4.41 4.18 ± 0.16 4.27–4.69 4.46 ± 0.13 4.41–4.58 4.49 ± 0.09 258 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Table 5. Craniodental measurements (in mm) of type specimens of Euroscaptor darwini sp. nov. (Voucher: 1♂ NTS.2024. PL.01; 4♀♀ NTS.2025.PL.02–NTS.2025.PL.05) and E. subanura (Voucher: 4♂♂ SIK0882, SIK0884, SIK0875, SIK0876; 1♀ SIK0883), as well as additional specimens representing three other Vietnamese populations of E. subanura from Pu Huong NR (Nghe An Province), Na Hang (Tuyen Quang Province), and Xuan Son NP (Phu Tho Province). Character E. darwini sp. nov. E. subanura E. subanura E. subanura E. subanura Pu Luong NR (Thanh Hoa) pop. Tam Dao (Tuyen Quang) pop. Pu Huong NR (Nghe An) pop. Na Hang (Tuyen Quang) pop. Xuan Son NP (Phu Tho) pop. Male (1) Female (4) Male (4) Female (1) Female (1) Male (2) Male (3) Female (6) GLS 30.51 30.94–31.01 30.97 ± 0.03 30.44–30.96 30.66 ± 0.22 31.41 31.33 30.75–31.69 31.22 ± 0.66 30.49–30.98 30.78 ± 0.26 29.96–31.02 30.48 ± 0.57 BB 13.76 13.84–14.26 14.08 ± 0.21 13.44–14.23 13.75 ± 0.34 14.44 14.33 13.93–14.67 14.30 ± 0.52 13.91–14.47 14.15 ± 0.29 13.58–14.19 13.92 ± 0.23 IOB 6.72 6.83–6.87 6.85 ± 0.02 6.57–6.86 6.77 ± 0.14 6.97 6.74 7.13–7.14 7.14 ± 0.01 6.59–7.05 6.79 ± 0.24 6.53–7.13 6.82 ± 0.21 BIOF 5.41 5.59–5.77 5.68 ± 0.09 6.13–6.21 6.17 ± 0.04 6.21 6.27 6.27–6.35 6.31 ± 0.06 6.12–6.22 6.16 ± 0.05 6.16–6.38 6.29 ± 0.08 RB 4.12 4.17–4.27 4.21 ± 0.04 3.84–4.29 4.10 ± 0.19 4.21 4.26 3.99–4.41 4.20 ± 0.3 3.96–4.16 4.03 ± 0.11 4.04–4.28 4.13 ± 0.09 LZA 8.22 7.88–8.02 7.96 ± 0.06 7.24–7.61 7.43 ± 0.16 7.68 7.63 7.01–7.54 7.28 ± 0.37 7.15–7.51 7.28 ± 0.2 7.11–7.51 7.28 ± 0.17 PZRW 10.23 10.09–10.37 10.21 ± 0.13 10.01–10.17 10.09 ± 0.08 10.13 9.85 9.96–10.18 10.07 ± 0.16 9.19–9.64 9.44 ± 0.23 9.34–10.16 9.78 ± 0.36 ACRB 6.92 6.98–7.19 7.09 ± 0.11 7.12–7.26 7.19 ± 0.07 7.29 7.18 7.27–7.35 7.31 ± 0.06 7.01–7.16 7.11 ± 0.08 7.11–7.28 7.21 ± 0.07 FMW 3.35 3.38–3.54 3.45 ± 0.07 3.27–3.71 3.46 ± 0.19 3.27 3.67 3.35–3.58 3.47 ± 0.16 3.51–3.67 3.57 ± 0.09 3.45–3.75 3.63 ± 0.13 CCoL 21.41 21.54–21.88 21.64 ± 0.16 21.42–21.83 21.68 ± 0.2 22.31 22.26 21.49–22.13 21.81 ± 0.45 20.92–21.48 21.05 ± 0.45 21.15–21.91 21.52 ± 0.42 PL 11.61 11.81–12.16 12 ± 0.17 11.55–12.53 12.03 ± 0.4 12.6 12.32 11.72–12.51 12.12 ± 0.56 11.98–12.38 12.12 ± 0.22 12.11–12.69 12.38 ± 0.31 I1–M311.51 11.59–12.02 11.81 ± 0.22 11.86–12.14 11.98 ± 0.12 12.72 12.16 11.89–12.33 12.11 ± 0.31 11.43–12.02 11.67 ± 0.31 11.58–12.21 11.84 ± 0.35 I1–P47.15 7.23–7.53 7.38 ± 0.17 7.17–7.36 7.25 ± 0.08 7.79 7.27 7.53–7.58 7.56 ± 0.04 6.73–7.68 7.21 ± 0.39 7.23–7.44 7.33 ± 0.11 I1–P35.92 5.72–6.07 5.92 ± 0.16 5.56–5.88 5.69 ± 0.16 6.03 5.78 5.95–6.06 6.01 ± 0.08 5.16–5.97 5.61 ± 0.35 5.68–5.95 5.85 ± 0.15 I1–C 3.12 2.94–3.17 3.01 ± 0.11 2.62–3.04 2.84 ± 0.17 2.92 2.99 2.97–3.09 3.03 ± 0.08 2.76–3.09 2.96 ± 0.17 2.68–3.09 2.88 ± 0.17 C–M310.13 10.14–10.44 10.28 ± 0.15 10.47–10.76 10.58 ± 0.13 11.21 10.55 10.24–10.69 10.47 ± 0.32 10.03–10.55 10.24 ± 0.28 9.76–10.76 10.17 ± 0.44 C–P45.51 5.56–5.93 5.72 ± 0.21 5.56–5.71 5.65 ± 0.07 6.27 5.49 5.63–5.79 5.71 ± 0.11 5.81–6.08 5.95 ± 0.14 5.31–6.05 5.70 ± 0.37 P4–M35.91 6.12–6.18 6.15 ± 0.03 6.27–6.41 6.32 ± 0.06 6.58 6.39 6.28–6.45 6.37 ± 0.12 5.81–6.11 5.92 ± 0.17 5.71–6.26 5.99 ± 0.2 P1–P43.99 4.02–4.11 4.07 ± 0.05 4.19–4.23 4.21 ± 0.02 4.27 4.25 4.16–4.25 4.21 ± 0.06 4.18–4.29 4.23 ± 0.06 4.13–4.29 4.21 ± 0.07 M1–M34.54 4.65–5.03 4.80 ± 0.17 4.81–4.98 4.92 ± 0.08 5.21 4.91 4.75–5.01 4.88 ± 0.18 4.43–4.71 4.54 ± 0.15 4.34–4.87 4.55 ± 0.23 M2–M2W6.69 6.72–7.17 7.02 ± 0.2 7.01–7.33 7.12 ± 0.14 7.81 7.14 7.02–7.26 7.14 ± 0.17 6.71–7.06 6.86 ± 0.18 6.65–7.29 6.96 ± 0.22 CCW 3.71 3.64–3.85 3.75 ± 0.1 3.57–3.71 3.64 ± 0.07 3.73 3.74 3.71–3.76 3.74 ± 0.04 3.49–3.61 3.55 ± 0.06 3.41–3.79 3.56 ± 0.13 PWCC 2.41 2.27–2.42 2.35 ± 0.06 2.17–2.37 2.31 ± 0.09 2.41 2.54 2.31–2.36 2.34 ± 0.04 2.29–2.33 2.31 ± 0.02 2.16–2.47 2.29 ± 0.13 PWM2M23.91 3.81–3.93 3.90 ± 0.06 3.57–3.96 3.80 ± 0.16 4.15 3.95 3.95–3.99 3.97 ± 0.03 3.69–3.89 3.80 ± 0.1 3.56–3.94 3.83 ± 0.14 PWM3M33.91 3.92–4.06 3.99 ± 0.06 3.92–4.09 4.03 ± 0.07 4.35 4.11 4.07–4.21 4.14 ± 0.1 3.67–4.19 3.98 ± 0.27 3.91–4.17 4.07 ± 0.12 ML 18.93 19.21–19.37 19.26 ± 0.07 19.1–19.47 19.32 ± 0.17 20.28 19.77 19.07–20.18 19.63 ± 0.78 18.33–19.86 18.89 ± 0.55 18.91–19.69 19.35 ± 0.4 CAL 8.14 8.09–8.24 8.15 ± 0.07 8.05–8.33 8.15 ± 0.12 8.33 8.29 7.81–8.29 8.05 ± 0.34 7.69–8.36 8.05 ± 0.27 8.16–8.41 8.31 ± 0.13 259 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Particularly, female paratypes (n = 4) exhibit significantly larger craniodental dimensions than the male holotype (Fig. 5, Table 4). Female specimens show greater GLS (≤31.01 mm), maxillary toothrow length, and mandibular length in size. However, the overall dental morphology remains conserved across sexes. Variation is also apparent in tail vertebrae counts. The holotype male possesses only six caudal vertebrae, which corresponds to its externally vestigial tail. In the four female paratypes, three individuals (NTS.2025.PL.03, NTS.2025.PL.04, NTS.2025.PL.05) also exhibit six caudal vertebrae, but the pregnant female (NTS.2025.PL.02) differs in having seven (Fig. 5g). Etymology. The specific epithet darwini honors the eminent naturalist Charles Darwin, whose foundational contributions to evolutionary biology have profoundly influenced modern systematics and the understanding of speciation. Darwin’s insights have had a particularly strong impact on the authors of this study. We propose “Darwin’s mole” as the English common name, and “Chuột chũi Darwin” as the Vietnamese common name, reflecting the most prominent morphological trait and honoring the individual commemorated. Distribution. Euroscaptor darwini sp. nov. is currently known only from its type locality within Pu Luong NR, Thanh Hoa Province, north-central Vietnam. All known specimens were collected along a forested elevational transect on the southwestern ridge of Pu Luong Mountain, at altitudes ranging from 900 to 1100 meters a.s.l. Ecological habitat notes. Euroscaptor darwini sp. nov. was encountered in closed-canopy primary evergreen forest at the Pu Luong NR. The forest at the collection sites exhibits a dense, stratified structure with an upper canopy dominated by large dipterocarp and Fagaceae trees, an understory layer of palms, shrubs, and saplings, and a ground layer covered in deep leaf litter, decomposing organic material, and fine root networks. The soil is dark brown to reddish, loamy to clay-loam in texture, moist but well-drained, and free of surface rocks or exposed limestone. Specimens were collected along narrow animal paths, under thick vegetation, and beside moss-covered tree bases, where soil is particularly soft and cool. All trapping sites were located in non-karst areas with friable, humus-rich forest soils, and deep, organic substrates. Character E. darwini sp. nov. E. subanura E. subanura E. subanura E. subanura Pu Luong NR (Thanh Hoa) pop. Tam Dao (Tuyen Quang) pop. Pu Huong NR (Nghe An) pop. Na Hang (Tuyen Quang) pop. Xuan Son NP (Phu Tho) pop. Male (1) Female (4) Male (4) Female (1) Female (1) Male (2) Male (3) Female (6) MH 5.84 5.73–5.83 5.76 ± 0.05 5.72–6.01 5.81 ± 0.13 6.03 6.26 5.64–6.08 5.86 ± 0.31 5.53–6.07 5.76 ± 0.19 5.78–6.31 6.00 ± 0.28 i1–m310.88 11.01–11.45 11.23 ± 0.19 10.69–11.57 11.18 ± 0.37 11.87 11.67 11.38–11.59 11.49 ± 0.15 11.05–11.33 11.19 ± 0.14 10.51–11.65 10.95 ± 0.46 p1–m38.99 9.16–9.43 9.23 ± 0.21 9.24–9.39 9.32 ± 0.08 9.76 9.56 9.21–9.52 9.37 ± 0.22 8.63–9.54 8.99 ± 0.34 9.03–9.31 9.17 ± 0.14 p4–m36.07 6.22–6.47 6.33 ± 0.13 6.39–6.54 6.46 ± 0.07 6.67 6.68 6.26–6.48 6.37 ± 0.16 5.91–6.28 6.14 ± 0.2 5.85–6.49 6.13 ± 0.25 i1–p46.11 6.21–6.27 6.24 ± 0.03 6.22–6.29 6.25 ± 0.03 6.24 6.19 6.32–6.37 6.35 ± 0.04 6.16–6.24 6.21 ± 0.04 6.17–6.32 6.21 ± 0.06 m1–m34.89 4.97–5.29 5.09 ± 0.15 5.15–5.25 5.20 ± 0.04 5.34 5.49 5.09–5.29 5.19 ± 0.14 4.68–5.06 4.84 ± 0.2 4.62–5.28 4.84 ± 0.25 i1–c 1.54 1.56–1.63 1.60 ± 0.03 1.72–1.81 1.74 ± 0.09 1.86 1.88 1.77–1.79 1.78 ± 0.01 1.68–1.86 1.74 ± 0.1 1.69–1.88 1.77 ± 0.07 i1–p12.98 2.95–3.19 3.06 ± 0.1 3.05–3.17 3.10 ± 0.05 3.02 3.22 3.34–3.39 3.37 ± 0.04 2.77–3.22 3.05 ± 0.18 3.11–3.17 3.13 ± 0.03 p1–p43.97 4.07–4.19 4.10 ± 0.1 3.87–4.12 3.99 ± 0.11 4.15 3.94 4.08–4.12 4.10 ± 0.03 3.79–4.23 3.98 ± 0.16 3.93–4.25 4.1 ± 0.16 260 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Comparisons. The new species is distinguished from its close congeners by its truncated tail, along with distinctive cranial morphology, including a slender zygomatic arch and a narrow pelvic structure. Euroscaptor darwini sp. nov. is most similar morphologically to E. subanura, with which it shares a markedly reduced tail length and compact body proportions. However, they differ in both craniodental morphology and external characters. Interestingly, despite the significantly narrower breadth across the interorbital foramina (BIOF: 5.41–5.77 mm in E. darwini vs 6.07–6.46 mm in E. subanura), the lateral zygomatic arch (LZA) in E. darwini is remarkably elongated (7.88–8.22 mm), exceeding that of E. subanura (6.83–7.74). This associated with differences in the shape of the zygomatic arch: in E. darwini, the arch is slender and tapers posteriorly toward the palatine, whereas in Table 6. Character factor loadings for log-transformed measurements (PCs 1, 2, 3) among all taxa and between E. darwini sp. nov. and E. subanura. CharacterAll taxa E. darwini and E. subanura PC 1 PC 2 PC 3 PC 1 PC 2 PC 3 GLS 0.17 –0.05 –0.05 0.09 –0.03 0.01 BB 0.12 0.04 –0.06 0.06 0.00 0.06 IOB 0.04 0.13 0.01 0.08 0.05 0.01 BIOF 0.09 0.02 0.24 –0.01 0.44 0.17 RB 0.14 –0.17 –0.16 0.10 –0.17 0.19 LZA 0.27 –0.24 –0.35 0.05 –0.45 0.00 PZRW 0.14 0.06 –0.18 0.06 –0.18 0.17 ACRB –0.07 0.32 0.17 0.02 0.08 0.05 FMW 0.14 –0.19 0.00 –0.04 0.18 –0.07 CCoL 0.18 –0.02 –0.08 0.12 –0.01 0.02 PL 0.20 0.08 0.01 0.12 0.02 –0.05 I1–M30.18 0.12 0.02 0.21 0.03 0.07 I1–P40.17 0.08 0.10 0.22 0.03 –0.22 I1–P30.17 0.13 0.11 0.26 –0.08 –0.37 I1–C 0.23 –0.30 –0.12 0.10 –0.21 –0.07 C–M30.17 0.17 0.01 0.23 0.05 0.03 C–P40.15 0.13 0.15 0.24 0.11 –0.38 P4–M30.18 0.13 –0.09 0.19 0.00 0.31 P1–P40.11 0.12 0.25 0.02 0.15 –0.36 M1–M30.17 0.19 –0.14 0.29 –0.03 0.29 M2–M2W0.10 0.06 –0.11 0.18 0.06 0.14 CCW 0.16 –0.13 –0.14 0.11 –0.18 0.04 PWCC 0.12 –0.12 –0.16 0.06 –0.10 0.13 PWM2M20.04 0.00 –0.11 0.18 0.01 0.11 PWM3M30.09 –0.02 –0.04 0.13 0.15 0.21 ML 0.19 0.01 –0.06 0.15 –0.02 0.01 CAL 0.22 –0.04 –0.16 0.07 –0.04 0.05 MH 0.20 0.02 –0.06 0.19 0.00 –0.10 i1–m30.18 0.13 0.06 0.23 0.04 –0.06 p1–m30.15 0.24 0.01 0.24 0.01 –0.04 p4–m30.17 0.25 –0.08 0.25 –0.01 0.14 i1–p40.14 0.07 0.09 0.04 0.04 –0.01 m1–m30.18 0.22 –0.04 0.31 –0.04 0.20 i1–c 0.26 –0.39 0.59 0.02 0.55 0.08 i1–p10.27 –0.19 0.30 0.21 0.18 –0.25 p1–p40.15 0.27 0.10 0.24 0.02 –0.28 % variance 67.70 9.37 4.12 42.37 16.10 8.74 261 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam E. subanura, the anterior part zygomatic arch is slightly expanded laterally, resulting in a more parallel configuration between the left and right arches (Fig. 7). This zygomatic difference is further supported by comparative measurements across multiple E. subanura populations. All examined populations of E. subanura—from Tam Dao, Na Hang, Xuan Son, Ba Vi, and Pu Huong—exhibit consistently shorter LZA values (Fig. 8, Table 5). The E. darwini displays shorter crown heights and weaker cuspid development, particularly on p4, m1, m2, m3. In dorsal view, the rostral portion of E. darwini appears narrower and more tapered anteriorly, with the interorbital region slightly more constricted. The snout breadth and palatal length are both consistently narrower in E. darwini, showing a slender craniofacial profile (Figs 7, 8). This is supported by the shorter maxillary premolar length (P1–P4: 3.99– 4.11 mm in E. darwini vs 4.13–4.29 mm in E. subanura) and the compact mandibular incisor row length (i1–c: 1.54–1.63 mm in E. darwini vs 1.65–1.88 mm in E. subanura) (Table 4). Furthermore, dental spacing and size differentiation are pronounced: I1 in E. darwini is medium size and curved, but smaller than that of E. subanura, and the spacing between I2 and I3 is more compressed. The lower incisors and premolars also follow a progressive enlargement posteriorly, but are overall less massive and vertically developed in E. darwini, contributing to a reduced masticatory apparatus. In terms of external measurements, E. darwini displays a shorter tail than E. subanura, with tail lengths ranging from 2.11–3.74 mm compared to 2.5– 5.0 mm as reported by Kawada (2016) and Bui (2022). This difference occurs despite overlapping head–body lengths: 115.71–127.93 mm in E. darwini vs 113.0–131.5 mm and 107.0–130.5 mm in E. subanura (Kawada 2016, Bui 2022), resulting in a lower tail to body length ratio (1.82–2.92%) compared to E. subanura (1.96–4.24% and 2.33–3.85%) (Table 3). This external truncation is supported by osteological evidence: E. darwini possesses only six or seven caudal vertebrae, whereas E. subanura retains nine or ten. Euroscaptor darwini possesses an overall smaller skull compared to E. ngoclinhensis, as reflected by shorter measurements in GLS (30.51–31.01 mm vs 31.83–33.03 mm), LZA (7.88–8.22 mm vs 8.11–8.72 mm), and mandibular length (ML: 18.93–19.37 mm vs 19.91–21.01 mm). It also has a narrower interorbital breadth (BIOF: 5.41–5.77 mm vs 6.16–6.46 mm) and a shorter lower post third-premolar toothrow (p4–m3: 6.07–6.47 mm vs 6.51–6.89 mm). The upper toothrow (I1–M3) is reduced in length (11.51–12.02 mm in E. darwini vs 12.17–12.44 mm in E. ngoclinhensis, and up to 13.0 mm in E. parvidens and E. kuznetsovi). The distance between lower incisor-canine (i1–c) is also shorter (1.54–1.63 mm), representing the smallest value recorded within the genus. Table 7. Measurement variables showing significant pairwise differences between Euroscaptor darwini and other Euroscaptor species in Vietnam, based on Tukey’s test for the most influential loadings on PC1–PC3. E. darwini sp. nov.Character E. subanura E. ngoclinhensis E. parvidens E. kuznetsovi E. orlovi Cranium BIOF, LZA BIOF, LZA, CAL, FMW BIOF, LZA, CAL BIOF, LZA, CAL, PL BIOF, CAL, PL, MH, FMW Maxillary dentition P1–P4, C–P4, P4– M3, C–M3, M1–M3 P1–P4, PWCC, P1–P4, C–P4, I1–C, CCW, PWCC, PWM2M2, PWM3M3 I1–C, CCW, PWCC, PWM2M2, PWM3M3 P1–P4, C–P4, I1–C, I1–M3, M1–M3, M2–M2W, CCW, PWCC Mandibular dentition i1–c, m1–m3, p4– m3, p1–m3, p1–p4 i1–c, m1–m3, p1–p4i1–p1i1–c, m1–m3, p4–m3, i1–p1 i1–c 262 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Compared to E. parvidens, the cranium of E. darwini is more slender, with a narrower basal breadth and reduced palatal length. GLS is significantly shorter (30.51–31.01 mm vs 33.53–34.76 mm), BB is narrower (13.77–14.26 mm vs 14.11–15.32 mm), and the width between upper canine CCW is reduced (3.64– 3.85 mm vs 3.79–4.41 mm). The mandible is likewise smaller (ML: 18.93– 19.37 mm vs 20.61–22.02 mm), with shortened m1–m3 (4.89–5.29 mm vs 5.17–5.59 mm), i1–p1 (2.95–3.19 mm vs 3.52–3.88 mm) segments, yielding a more compact jaw proportion. Euroscaptor darwini differs from E. orlovi and E. kuznetsovi in having a smaller cranium, shorter palatal length (PL: 11.61–12.16 mm vs 13.31–13.65 mm in E. orlovi), and lesser posterior zygomatic root width (PZRW: 10.09–10.37 mm vs 10.44–10.79 mm). These proportions result in a noticeably more compact and domed neurocranial profile in dorsal view. Furthermore, the upper molars of E. darwini are less transversely expanded than those of E. kuznetsovi, as indicated by a narrower M2–M2 width (6.71–7.17 mm in E. darwini vs ≤ 7.8 mm in E. kuznetsovi). The mandibular symphysis in E. darwini is relatively shorter and more vertically aligned, contributing to a blunter jaw profile compared to the more elongated mandibles seen in larger Euroscaptor. Cranial morphometrics and size differences in Euroscaptor darwini sp. nov. Principal Component Analysis (PCA) of 36 log-transformed craniodental measurements revealed morphometric differentiation in all Vietnamese Euroscaptor taxa (Fig. 9a). The differences among taxa were detected by one-way ANOVA (P < 0.05) with factor loadings for each variable presented in Table 6. PC1, accounting for 67.70% of the total variance, primarily reflects overall size differences, especially in mandibular, maxillary lengths and toothrow proportions. PC2 contributes an additional 9.37% of the variation. Euroscaptor darwini and E. subanura form a tight and completely overlapping cluster in the negative PC1 space. No significant separation is observed between them along PC1 (p = 0.784). Euroscaptor ngoclinhensis occupies a more central position along PC1 and is clearly separated from the E. darwini–E. subanura cluster. PC1 scores of E. darwini are significantly lower than those of larger-bodied taxa, including E. parvidens, E. orlovi, and E. kuznetsovi (One-way ANOVA, P < 0.01). E. parvidens forms a discrete cluster in PC1 and PC2 quadrant, significantly separated from both E. orlovi and E. kuznetsovi (P < 0.01). Meanwhile, E. orlovi and E. kuznetsovi exhibit partial overlap both in PC1 and PC2 (t-test, t = 1.204, p = 0.237), but remain distinct from the smaller-bodied E. darwini–E. subanura group. To clarify the morphological divergence between Euroscaptor darwini and its closest relative E. subanura, PCA analyses were conducted using only specimens of these two species (Fig. 9b–e). The first three PCs explain 67.57% of the total variance, with PC1 accounting 42.73%, PC2: 16.10%, and PC3: 8.74% (Table 6). These components collectively reveal a pattern of subtle yet consistent differentiation between the two taxa. PC1, which reflects overall cranial size and proportions, is primarily influenced by variables associated with premolar and molar row lengths: C–P4 (0.24), M1–M4 (0.29), I1–P3 (0.26), m1–m3 (0.31), and p4–m3 (0.25). PC2 is most influenced by BIOF (0.44) and i1–c (0.55) pointing to differences in infraorbital foramina breadth and mandibular incisor 263 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam spacing. The negative loading of LZA (–0.45) further highlights variation in zygomatic arch length. PC3, which accounts for 9.07% of the variance and contributes to additional separation among taxa, is dominated by C–P4 (–0.38), I1–P3 (–0.37), P4–M3 (0.31) and P1–P4 (–0.36), with the latter contributing negatively to the axis and reflecting differences in premolar spacing and alignment. Multivariate analysis provides quantitative support for the morphological distinctiveness of E. darwini relative to E. subanura. Among the variables contributing most strongly to species separation, length of the zygomatic arch (LZA) and breadth between the infraorbital foramina (BIOF) present the most pronounced divergence. Specimens of E. darwini consistently display a more elongated zygomatic arch (LZA: 7.88–8.22 mm) and noticeably narrower interorbital breadth (BIOF: 5.59–5.77 mm in females, 5.41 mm in the male) compared to E. subanura (BIOF: 6.17–6.21 mm in males, 6.21 mm in the female; Table 5, Fig. 10a, b). In the bivariate plot of BIOF against LZA (Fig. 10b), although BIOF remains relatively consistent across most Euroscaptor species in Vietnam, E. darwini exhibits a distinctly lower value for this trait. This deviation results in a conspicuous leftward shift of the E. darwini cluster in the plot (Fig. 10b), clearly separating it from all other congeners. Several variables including C–P4, I1–P3, I1–M3, P1–P4, and P4–M3, constantly indicated high loadings across multiple PCs (Table 6) and were significantly smaller in E. darwini, reflecting its relatively reduced and compact cranial and dental architecture. Pairwise character comparisons further corroborate these findings (Table 7), which demonstrate significant differentiation between E. darwini and E. subanura in nearly all dental measurements, indicating both cranial and mandibular divergence observed in the PCA results. Besides E. subanura, E. darwini also differs from other Euroscaptor congeners in key variables such as BIOF, LZA, CAL and I1–C (Table 7). Figure 10. a. Boxplots showing range (minimum to maximum, mean value indicated by horizontal lines), interquartile range (represented by the rectangular box) of the most contributing measurements to high factor loadings across multiple PCs; b. Plots of the breadth between infraorbital foramina (BIOF) against the inner length of zygomatic arch (LZA) for the genus Euroscaptor in Vietnam. 270 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Feijó A, Wen Z, Cheng J, Ge D, Xia L, Yang Q (2019) Divergent selection along elevational gradients promotes genetic and phenotypic disparities among small mammal populations. Ecology and Evolution 9(12): 7080–7095. https://doi.org/10.1002/ece3.5273 Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41(2): 95–98. https://doi.org/10.14601/PHYTOPATHOL_MEDITERR-14998U1.29 Hammer Ø, Harper DAT, Ryan PD (2001) PAST: Paleontological statistics software package for education and data analysis. Palaeontologia Electronica 4(1). He K, Shinohara A, Jiang XL, Campbell KL (2014) Multilocus phylogeny of talpine moles (Talpini, Talpidae, Eulipotyphla) and its implications for systematics. Molecular Phylogenetics and Evolution 70: 513–521. https://doi.org/10.1016/j.ympev.2013.10.002 Herring SW (2007) Masticatory muscles and the skull: A comparative perspective. Archives of Oral Biology 52(4): 296–299. https://doi.org/10.1016/j.archoralbio.2006.09.010 Hoang DT, Chernomor O, Haeseler AV, Bui QM, Le SV (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution 35(2): 518–522. https://doi.org/10.1093/molbev/msx281 Hutterer R (2005) Order Soricomorpha. In: Wilson DE, Reeder DM (Eds) Mammal species of the world. A taxonomic and geographic reference, 3rd edn. The Johns Hopkins University Press, Baltimore, 220–311. Huxley JS (1938) Species formation and geographical isolation. Proceedings of the Linnean Society of London 150(4): 253–264. https://doi.org/10.1111/j.1095-8312.1938. tb00182g.x Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285 Kawada SI (2016) Morphological review of the Japanese mountain mole (Eulipotyphla, Talpidae) with the proposal of a new genus. Mammal Study 41(4): 191–205. https:// doi.org/10.3106/041.041.0404 Kawada S, Shinohara A, Kobayashi S, Harada M, Oda S, Lin L-K (2007) Revision of the mole genus Mogera (Mammalia: Lipotyphla: Talpidae) from Taiwan. Systematics and Biodiversity 5(2): 223–240. https://doi.org/10.1017/S1477200006002271 Kawada SI, Yasuda M, Shinohara A, Lim BL (2008) Redescription of the Malaysian Mole as to be a true species, Euroscaptor malayana (Insectivora, Talpidae). Memoirs of the National Science Museum 45: 65–74. Kawada S, Nguyen TS, Dang NC (2009) Moles (Insectivora, Talpidae, Talpinae) of Vietnam. Bulletin of the National Nature and Science Museum. Series A. Zoology: Analysis of Complex Systems, ZACS 35: 89–101. Kawada SI, Nguyen TS, Dang NC (2012) A new species of mole of the genus Euroscaptor (Soricomorpha, Talpidae) from northern Vietnam. Journal of Mammalogy 93(3): 839–850. https://doi.org/10.1644/11-MAMM-A-296.1 Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S, Villablanca FX, Wilson AC (1989) Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences of the United States of America 86(16): 6196–6200. https://doi.org/10.1073/ pnas.86.16.6196 Kottler MJ (1978) Charles Darwin’s biological species concept and theory of geographic speciation: The transmutation notebooks. Annals of Science 35(3): 275–297. https:// doi.org/10.1080/00033797800200251 271 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Kryštufek B, Motokawa M (2018) Family Talpidae (Moles, Desmans, Star–nosed moles and Shrew moles). In: Wilson DE, Mittermeier RA (Eds) Handbook of the mammals of the world. Vol. 8. Insectivores, Sloths and Colugos. Lynx Editions, 552–619. Le VK, Nguyen XH, Nguyen TN (2015) Zoogeography. Vietnam National University Press, Hanoi, 403 pp. [In Vietnamese] Mayr E (1942) Systematics and the origin of species from the viewpoint of a zoologist. Columbia University Press, New York, 334 pp. https://ia801404.us.archive. org/13/items/in.ernet.dli.2015.20284/2015.20284.Systematics-And-The-Origin-Of-Species.pdf Miller GS (1940) Notes on some moles from Southeastern Asia. Journal of Mammalogy 21(4): 442–444. https://doi.org/10.2307/1374883 Mindell DP, Dick CW, Baker RJ (1991) Phylogenetic relationships among megabats, microbats, and primates. Proceedings of the National Academy of Sciences of the United States of America 88(22): 10322–10326. https://doi.org/10.1073/pnas.88.22.10322 Motokawa M, Lin L-K (2002) Geographic variation in the mole–shrew Anourosorex squamipes. Mammal Study 27(2): 113–120. https://doi.org/10.3106/mammalstudy.27.113 Nevo E (1985) Speciation in action and adaptation in subterranean mole rats: Patterns and theory. Bollettino di Zoologia 52(1–2): 65–95. https://doi. org/10.1080/11250008509440344 Nevo E (1999) Mosaic evolution of subterranean mammals: Regression, progression, and global convergence. Oxford University Press, Oxford, UK, 413 pp. https://doi. org/10.1093/oso/9780198575726.001.0001 Nguyen LT, Schmidt HA, von Haeseler A, Bui QM (2015) IQ–TREE: A fast and effective stochastic algorithm for estimating maximum–likelihood phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300 Okabe S, Motokawa M (2024) Geographic variation of Dymecodon pilirostris (Eulipotyphla, Talpidae) with an insight into mountain island in Japan. Mammal Study 49(4): 345–357. https://doi.org/10.3106/ms2023-0013 Partha R, Chauhan BK, Ferreira Z, Robinson JD, Lathrop K, Nischal KK, Chikina M, Clark NL (2017) Subterranean mammals show convergent regression in ocular genes and enhancers, along with adaptation to tunneling. eLife 6: e25884. https://doi. org/10.7554/eLife.25884 Pérez MJ, Barquez RM, Díaz MM (2017) Morphology of the limbs in the semi-fossorial desert rodent species of Tympanoctomys (Octodontidae, Rodentia). ZooKeys 710: 77–96. https://doi.org/10.3897/zookeys.710.14033 Pujolar JM, Blom MPK, Reeve AH, Kennedy JD, Marki PZ, Korneliussen TS, Freeman BG, Sam K, Linck E, Haryoko T, Iova B, Koane B, Maiah G, Paul L, Irestedt M, Jønsson KA (2022) The formation of avian montane diversity across barriers and along elevational gradients. Nature Communications 13(1): 268. https://doi.org/10.1038/ s41467-021-27858-5 Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029 Sansalone G, Colangelo P, Loy A, Raia P, Wroe S, Piras P (2019) Impact of transition to a subterranean lifestyle on morphological disparity and integration in talpid moles (Mammalia, Talpidae). BMC Evolutionary Biology 19(1): 179. https://doi.org/10.1186/ s12862-019-1506-0 272 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Sharp AC, Dutel H, Watson PJ, Gröning F, Crumpton N, Fagan MJ, Evans SE (2023) Assessment of the mechanical role of cranial sutures in the mammalian skull: Computational biomechanical modelling of the rat skull. Journal of Morphology 284(3): e21555. https://doi.org/10.1002/jmor.21555 Shinohara A, Kawada SI, Nguyen TS, Koshimoto C, Endo H, Dang NC, Suzuki H (2014) Molecular phylogeny of East and Southeast Asian fossorial moles (Lipotyphla, Talpidae). Journal of Mammalogy 95(3): 455–466. https://doi.org/10.1644/13-MAMM-A-135 Shinohara A, Kawada SI, Nguyen TS, Dang NC, Sakamoto SH, Koshimoto C (2015) Molecular phylogenetic relationships and intra–species diversities of three Euroscaptor spp. (Talpidae, Lipotyphla, Mammalia) from Vietnam. The Raffles Bulletin of Zoology 63: 366–375. Sikes RS, Gannon WL, Animal Care and Use Committee of the American Society of Mammalogists (2011) Guidelines of the American Society of Mammalogists for the use of wild mammals in research. Journal of Mammalogy 92(1): 235–253. https://doi. org/10.1644/10-MAMM-F-355.1 Smith AL, Grosse IR (2016) The biomechanics of zygomatic arch shape. The Anatomical Record: Advances in Integrative Anatomy and Evolutionary Biology 299(12): 1734– 1752. https://doi.org/10.1002/ar.23484 Smith AT, Xie Y (Eds.) (2008) A Guide to the Mammals of China. Princeton University Press, Princeton, New Jersey, 544 pp. Sterling EJ, Hurley MM (2005) Conserving biodiversity in Vietnam: applying biogeography to conservation research. Proceedings of the California Academy of Sciences 56(Suppl. I, 9): 98–114. Sterling EJ, Hurley MM, Le DM (2006) Vietnam: a natural history. Yale University Press, New Haven & London, [xviii +] 423 pp. https://doi.org/10.12987/9780300128215 Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular evolutionary genetics analysis version 11. Molecular Biology and Evolution 38(7): 3022–3027. https://doi. org/10.1093/molbev/msab120 Tanabe AS (2011) Kakusan 4 and Aminosan: Two programs for comparing nonpartitioned, proportional and separate models for combined molecular phylogenetic analyses of multilocus sequence data. Molecular Ecology Resources 11(5): 914–921. https://doi.org/10.1111/j.1755-0998.2011.03021.x Tordoff AW, Tran QB, Nguyen TD, Le MH (2004) Source Book of Existing and Proposed Protected Areas in Vietnam. Vol. 1, Second Edition. BirdLife International Indochina, Hanoi. https://thiennhienviet.org.vn/ Tordoff AW, Baltzer MC, Fellowes JR, Pilgrim JD, Langhammer PF (2012) Key biodiversity areas in the Indo–Burma hotspot: Process, progress and future directions. Journal of Threatened Taxa 4(8): 2779–2787. https://doi.org/10.11609/JoTT.o3000.2779-87 Vaidya G, Lohman DJ, Meier R (2011) SequenceMatrix: Concatenation software for the fast assembly of multi–gene datasets with character set and codon information. Cladistics: The International Journal of the Willi Hennig Society 27(2): 171–180. https:// doi.org/10.1111/j.1096-0031.2010.00329.x Zemlemerova ED, Bannikova AA, Abramov AV, Lebedev VS, Rozhnov VV (2013) New data on molecular phylogeny of the East Asian moles. Doklady Biological Sciences: Proceedings of the Academy of Sciences of the USSR, Biological Sciences Sections 451(1): 257–260. https://doi.org/10.1134/S0012496613040200 Zemlemerova ED, Bannikova AA, Lebedev VS, Rozhnov VV, Abramov AV (2016) Secrets of the underground Vietnam: An underestimated species diversity of the Asian moles (Lipotyphla, Talpidae, Euroscaptor). Trudy Zoologicheskogo Instituta 320(2): 193– 220. https://doi.org/10.31610/trudyzin/2016.320.2.193 273 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Supplementary material 1 Morphological Authors: Son Truong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu Data type: docx Explanation note: List of craniodental measurements used in this study. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/zookeys.1255.161942.suppl1 Supplementary material 2 List of skull specimens, morphological Authors: Son Truong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu Data type: docx Explanation note: List of Euroscaptor skull specimens from Vietnam examined in this study. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/zookeys.1255.161942.suppl2 Supplementary material 3 List of Cyt b sequences, phylogenetic Authors: Son Truong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu Data type: docx Explanation note: The list of Cyt b sequences used for pairwise comparisons. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/zookeys.1255.161942.suppl3 274 ZooKeys 1255: 239–274 (2025), DOI: 10.3897/zookeys.1255.161942 Son Truong Nguyen et al.: New species of the genus Euroscaptor (Talpidae) in Vietnam Supplementary material 4 Phylogenetic Authors: Son Truong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu Data type: xlsx Explanation note: The raw p–distance matrix of Cyt b sequences used for comparisons between E. darwini and E. subanura population. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/zookeys.1255.161942.suppl4 Supplementary material 5 List of DNA accession number, phylogenetic, genomic Authors: Son Truong Nguyen, Hai Tuan Bui, Vinh Quang Dau, Phuong Dinh Le, Yen Huong Vu Data type: docx Explanation note: Euroscaptor specimens with DNA Accession Number used in the Phylogenetic analyses based on concatenated mitochondrial Cyt b and 12S rRNA gene sequences. Asterisks indicate holotype (*) and hash sign indicate paratype (#) specimens of both E. darwini and E. subanura. Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/zookeys.1255.161942.suppl5