Laboratory of Antibiotic Resistance and Microbial Metabolomics

Gabriela Balíková Novotná Laboratory of Antibiotic Resistance and Microbial Metabolomics, IMIC CAS Decoding Resistance: ABCF Proteins Tailor Bacterial Responses to Antibiotic Type and Concentration Institute of Microbiology Academy of Sciences of the Czech Republic WP 1 RO 1-1 This research has been supported by the Ministry of Education, Youth and Sports of the Czech Republic grant Talking microbes - understanding microbial interactions within One Health framework (CZ.02.01.01/00/22_008/0004597) WP1 - Words and Sentences (i.e., chemical signals and their combinations) involved in the microbe-microbe or microbe-host interactions. RO1-1-3: Antibiotic-driven ribosomal cascades in the dynamics of bacterial communities RO1-1 Bacterial Signalling in its appropriate ecological context Kamenik & Balikova Novotna Lab Roles of antibiotics in the environment Mann 2022 Nat. Comm. Westhoff 2021 mBio Abrudan 2015 PNAS Hibbing 2010 Nat. Rev. Microbiol. Competition Antibiotic producing bacteria Competitor Signaling ? We discovered a new language where antibiotics are WORDS and ABCF proteins are TRANSLATORS How widespread is ABCF-mediated signaling? What is the mechanism? Antibiotic resistance (responsive) ABCF displace antibiotic from the ribosome Resistance to: Lincosamides, Streptogramins A, Pleuromutilins (LSaP) (Crowe-McAuliffe, C.; PNAS, 2018; Nat. Com. 2021) EttA Uup ARE7 YfmM YdiF AAF6 YbiT YheS YdiF Eucaryotic ABCFs YdiF LSaP antibiotics inhibit first peptide bond synthesis Lincosamides Streptogramins A Pleuromutilins Ribosome LmrC induces premature production of lincomycin in Streptomyces lincolnensis in response to clindamycin addition 44h seed culture 164h antibiotic production WT CLI addition (8h) LIN production 0 1 2 3 4 5 6 7 44h 164h 44h 164h No ATB CLI (8 h) Lincomycin (μg.ml-1) WT dC crispr 0 1 2 3 4 5 6 7 44h 164h 44h 164h No ATB CLI (8 h) Lincomycin (μg.ml-1) WT dC crispr 0.5 µg ml-1 ΔlmrCcrispr 44h seed culture 164h antibiotic production WT ΔlmrCcrispr LmrC induces premature production of lincomycin in only in response to lincosamides 0 1 2 3 4 5 6 7 8 No atb CLI 0.5 LIN 4 ERY 0.5 PIIA 4 TIA 0.125 Lincomycin (μg.ml-1) Induction of LIN production by antibiotics 42 h 132 h 0 1 2 3 4 5 6 7 8 No atb CLI 0.5 LIN 4 ERY 0.5 PIIA 4 TIA 0.125 Lincomycin (μg.ml-1) Induction of lincomycin production by antibiotics 42 h 132 h LmrC induces premature production of lincomycin in only in response to lincosamides LIN CLI PIIA TIA ERY lmrC lmbU GUS reporter Streptomyces coelicolor Streptomyces lincolnensis Erythromycin 2 mg/lLincomycin 8 mg/l Tiamulin 8 mg/l 84 h 24 h 0 1 2 3 4 5 6 -10 -5 0 5 10 -Log p log2 FC LIN 8/no atb. 0 1 2 3 4 5 6 -10 -5 0 5 10 -Log p log2 FC ERY 2/no atb. Are5sc 0 1 2 3 4 5 6 -10 -5 0 5 10 -Log p log2 FC TIA 8/no atb. 0 1 2 3 4 5 6 -10 -5 0 5 10 -Log p log2 FC ERY 2/no atb. 0 1 2 3 4 5 6 -10 -5 0 5 10 -Log p log2 FC LIN 8/no atb. 0 1 2 3 4 5 6 -10 -5 0 5 10 -Log p log2 FC TIA 8/no atb. WT TiaA TiaA Are5sc WblC regulon ARE5 proteins FDR ≤ 0.05, S0 > 0.1 BGC ARE5 ABCF proteins are the most induced by LSaP antibiotics Germ. -8h 024h 84h Proteomics Proteomics 18-22h low LIN TIA ERY high LIN TIA ERY 196h Metabolomics 108h Time (h) 1 6 36 66 1 6 36 66 1 6 36 66 1 6 36 66 1 6 36 66 3238b NoA 1h 3238b NoA 6 h 3238b NoA 36 h 3238b NoA 66 h 3238b tia 0,125 1 h 3238b tia 0,125 6 h 3238b tia 0,125 36 h 3238b tia 0,125 66 h 3238b tia 8 1 h 3238b tia 8 6 h 3238a tia 8 36 h 3238b tia 8 66 h 3238b lin 0,125 1 h 3238b lin 0,125 6 h 3238b lin 0,125 36 h 3238b lin 0,125 66 h 3238b lin 8 1 h 3238b lin 8 6 h 3238b lin 8 36 h 3238b lin 8 66 h 0 5 10 15 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 245,0283 0 5 10 15 0.125 80.125 8 Tiamulin Lincomycin Concentration (µ/ml) rfu / mg of total protein rfu / mg of total protein are5sc_TL_GUS in WTtiaA_TL_GUS in WT Time (h) 1 6 36 66 1 6 36 66 1 6 36 66 1 6 36 66 1 6 36 66 0.125 80.125 8 Tiamulin Lincomycin Concentration (µ/ml) gus gus are5sc ¼ tiaA ¼ ptiaA pare5sc are5scL1/2 tiaAL The production of ARE5 ABCF proteins is time and concentration-dependent CLINDAMYCIN are5sc tiaA WT TIAMULIN are5sc tiaA WT - + ABCFs effect ABCF fine tuning - + <0.016-0.125 0.032-1 no induction 0.38-˃32 gus gus are5sc ¼ tiaA ¼ ptiaA pare5sc are5scL1/2 tiaAL ARE5 ABCF proteins fine-tunes its own production in response to antibiotics ΔΔ ΔΔ <0.016-0.38 0.094-0.38 <0.125-0.75 0.5 ARE5 defficient strain ARE5 ABCF proteins fine-tune its own production in response to antibiotics RF re at re tran ri ona l ter inator Regulated gene is not transcribed 5´UTR ARE5 ABCF No antibiotic ARE5 ABCF proteins fine-tune its own production in response to antibiotics RF ribo o e arre t Regulated gene is transcribed ARE5 ABCF Antibiotic binds ribosome RF ribo o earre t ARE5 ABCF proteins fine-tune its own production in response to antibiotics ARE5 ABCF Regulated gene is transcribed but not translated Antibiotic binds ribosome uORF RBSRBS ribosome rescue ARE5 ABCF proteins fine-tune its own production in response to antibiotics ARE5 ABCF Regulated gene is translated Antibiotic binds ribosome ABCF-finetuning uORF RBSRBS ribosome rescue ARE5 ABCF proteins fine-tune its own production in response to antibiotics ARE5 ABCF ribosome rescue M V G D D D I S G * AUGGUGGGUGACGACGACAUCUCCGGGUGA 5´3´ tiaA ptiaA 12 bp TSS (194 bp) UUGCUCGUCUGAGGUCCUGA L L V * L R S * 5´3´ 47 bp TSS (232 bp) are5sc pare5sc Ribosome toeprintinguORF prediction MSTSP..... are5 report. 5´UTR_are5sc MLV* are5L MSDAA..... tiaA report. tiaAL 5´UTR_tiaA MVGDDDISG* ARE5 ABCF proteins fine-tune its own production in response to antibiotics ΔΔ WT CLINDAMYCIN MSTSP..... are5 report. 5´UTR_are5sc MAV* are5L MSDAA..... tiaA report. tiaAL 5´UTR_tiaA MAGDDDISG* -+ ABCFs effect ABCF fine tuning ΔΔ WT CLINDAMYCIN -+ ABCF fine tuning