Full text
CANCER IMMUNOLOGY RESEARCH | RESEARCH ARTICLE NEDDylation Regulates CD8 + T-cell Metabolism and Antitumor Immunity Borja Jim´ enez-Lasheras 1 , Paloma Velasco-Beltr´ an 1 , Leire Egia-Mendikute 1 , Lorena P´ erez-Guti´ errez 1 , So Young Lee 1 , Ander de Blas 1 , Ana Garc´ ıa-del R´ ıo 1 , Samanta Romina Zanetti 1 , Asier Antoñana-Vildosola 1 , Adri´ an Barreira-Manrique 1 , Alexandre Bosch 1 , Jone Etxaniz-D´ ıaz de Durana 1 , Endika Prieto-Fern´ andez 2 , Marina Serrano-Maci´ a 3,4 , Naroa Goikoetxea-Usandizaga 3,4 , Mikel Azkargorta 5 , F´ elix Elortza 5 , Thomas Gruber 6 , Sebastian Peer 6,7 , Gottfried Baier 6 , Ashwin Woodhoo 8 , Mar´ ıa Luz Mart´ ınez-Chantar 3,4 , and Asis Palazon 1,9 � ABSTRACT NEDDylation is a posttranslational modification whereby the ubiquitin-like molecule NEDD8 is attached to protein substrates in a process dependent on NEDD8-activating enzyme regulatory subunit (NAE1). NEDDylation is emerging as a regulator of cancer biology, but its precise role in antitumor immunity has not been thoroughly characterized. In this study, we examine the impact of NEDDylation in CD8 + T cell–mediated antitumor responses. Analysis of publicly available single-cell RNA sequencing databases revealed that CD8 + tumor-infiltrating lymphocytes showed increased expression of NEDD8 during their differentiation into effector memory cells. In vitro activation of mouse and human CD8 + T cells drove the upregulation of the NEDDylation enzymatic pathway, resulting in an enrichment of NEDDylated proteins. In vivo tumor challenge assays demonstrated that CD8 + T cells lacking NAE1 exhibited reduced antitumor capability and a less activated phenotype with compromised differentiation into effector cells. Upregulating NEDDylation by knocking out deNEDDylase sentrin-specific protease 8 increased the in vitro cytotoxic capability of CD8 + CAR T cells. In addition, LC MS/MS proteomic analyses of NAE1-deficient CD8 + T cells and CD8 + T cells treated with the NEDDylation inhibitor MLN4924 showed a pronounced impairment in metabolic pathways, including glycolysis and oxidative phosphorylation. In this context, we validated lactate dehydrogenase A, α-enolase, and hexokinase 1, which are relevant glycolytic enzymes, as NEDD8 targets. In line with this, NEDDylation-deficient CD8 + T cells demonstrated reduced transcription, protein expression, and enzymatic activity of lactate dehydrogenase. In summary, we uncover NEDDylation as a critical regulator of CD8 + T cell– mediated antitumor immunity. Introduction Posttranslational modifications (PTM) are central regulators of immune responses in the tumor microenvironment (1). The most extensively studied PTMs include those that trigger signaling pathways [e.g., phosphorylation cascades triggered by T-cell receptor (TCR) engagement] and those that maintain protein homeostasis, such as ubiquitination (2, 3). The latter refers to the conjugation of ubiquitin units to substrate proteins, whereas similar PTMs, including NEDDylation and SUMOylation, utilize other substrates called ubiquitin-like proteins to modify target proteins. Given that PTMs are recognized as key regulators of T-cell function (4), we aimed to study the role of NEDDylation in CD8 + T cell– mediated antitumor immunity. NEDDylation involves the covalent attachment of the ubiquitinlike protein NEDD8 to target proteins (5). This reaction is mediated by the formation of an isopeptide bond between the carboxy-terminal glycine of NEDD8 (Gly76) and a lysine residue on the target protein (6). NEDDylation is regulated by NEDD8-activating enzyme (NAE), which is comprised of two subunits: an E1 catalytic subunit referred to as UBA3 and an E1 regulatory subunit identified as NAE1. NAE is responsible for activating NEDD8, which can then be transferred to an E2 conjugating enzyme, such as NEDD8-conjugating enzyme 1 Cancer Immunology and Immunotherapy Laboratory, Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Derio, Spain. 2 Tumor Immunology and Immunotherapy Laboratory, Vall d’Hebron Institute of Oncology (VHIO), Vall d’Hebron Barcelona Hospital Campus, Barcelona, Spain. 3 Liver Disease Laboratory, Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Derio, Spain. 4 CIBERehd, Instituto de Salud Carlos III, Madrid, Spain. 5 Proteomics Platform, Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Carlos III Networked Proteomics Platform (ProteoRed-ISCIII) Derio, Spain. 6 Department for Genetics, Institute of Cell Genetics, Medical University Innsbruck, Innsbruck, Austria. 7 Internal Medicine V, Medical University Innsbruck, Innsbruck, Austria. 8 Gene Regulatory Control in Disease Laboratory, Center for Research in Molecular Medicine and Chronic Diseases (CIMUS), Instituto de Investigaci´ on Sanitaria de Santiago de Compostela (IDIS), University of Santiago de Compostela, A Coruña, Spain. 9 Ikerbasque, Basque Foundation for Science, Bilbao, Spain. B. Jim´ enez-Lasheras and P. Velasco-Beltr´ an contributed equally to this article. Corresponding Author: Asis Palazon, Cancer Immunology and Immunotherapy Lab, Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), Bizkaia Science and Technology Park, Building 801A, Derio 48160, Bizkaia, Spain. E-mail: [email protected] Cancer Immunol Res 2025;13:1004–21 doi: 10.1158/2326-6066.CIR-24-0127 This open access article is distributed under the Creative Commons AttributionNonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0) license. ©2025 The Authors; Published by the American Association for Cancer Research AACRJournals.org | 1004
UBC12 (UBE2M) or NEDD8-conjugating enzyme UBE2F, which load NEDD8 into an E3 ligase complex (7). The most described targets of NEDD8 are cullin–RING ligases (CRL), whose primary role is to tag ubiquitin to specific proteins for degradation by the proteasome. This process is regulated by NEDDylation, because NEDD8 ligation to CRLs leads to a conformational change that activates the CRL complex (8, 9). Finally, deNEDDylases, such as SENP8 (also called NEDP1), are responsible for removing NEDD8 from NEDDylated substrates in a dynamic and tightly regulated cycle (10). In addition to CRLs, NEDDylation can act on alternative protein substrates. Notably, NEDDylation can reduce the activity of the tumor suppressor P53 and promote the degradation of EGFR (11, 12). Conversely, NEDD8 attachment can increase the stability of certain proteins, such as TGF-β receptor 2 (13). Therefore, NEDDylation effects are variable and substrate-dependent (14), including protein stabilization or degradation, intracellular cell trafficking, modulation of enzymatic activity, or regulation of DNA damage response and metabolism (15–18). As such, uncovering additional NEDDylation targets beyond CRLs is critical if we are to fully understand its role in health and disease. In the context of cancer, the NEDDylation pathway has been described to be upregulated in several tumor types (19–22), and it is considered a poor prognostic marker (23). The dysregulation of NEDDylation in cancer cells presents an opportunity for the development of cancer therapies (24). MLN4924 (pevonedistat) is a first-inclass small-molecule inhibitor of the E1-activating enzyme NAE, which blocks NEDDylation, disrupting protein turnover, reducing angiogenesis and proliferation, and inducing apoptotic death of tumor cells (25, 26). NAE is an adequate target for therapies that only aim to regulate NEDDylation because it exclusively interacts with NEDD8, whereas other enzymes of the NEDDylation cycle can also use ubiquitin as substrate. Currently, MLN4924 is being evaluated in clinical trials for the treatment of various cancer types (27, 28). However, the phase III clinical trial evaluating the efficacy of MLN4924 for the treatment of myelodysplastic syndromes or acute myeloid leukemia failed in 2022 to meet the primary endpoint (29). Similarly, the NAE inhibitor TAS446 also failed to complete phase I clinical trial testing against hematologic cancers (ClinicalTrials.gov identifier: NCT02978235). Given the relevance of the immune system in these pathologies (30–32), elucidating the role of NEDDylation on immune cell function is of relevance, but few studies have looked into it (33, 34). Within current knowledge, NEDDylation regulates macrophage function in the context of responses to checkpoint receptor blockade (35). Inhibition of NEDDylation suppresses the function of dendritic cells, limiting inflammatory responses (36), and reduces the activity of CD4 + T cells against blood-stage Plasmodium infection. The suppression of NEDDylation is also being explored as a method to alleviate COVID-19–associated inflammation (37) and multiple sclerosis (38). These insights reveal that modulating NEDDylation could be key in devising new treatments for immune-mediated conditions. The precise role of NEDDylation on regulating the function of CD8 + T-cell subsets, such as effector or exhausted T cells, is not fully understood. In this study, we report that the use of a combination of in vitro, in vivo, and computational approaches showed that NEDDylation is necessary for CD8 + T-cell proliferation and differentiation into effector cells. Furthermore, abrogating NEDDylation by both genetic deletion and pharmacologic inhibition of NAE1, as well as increasing NEDDylation by the deletion of deNEDDylase SENP8 in CD8 + T cells, uncovered its critical role in regulating CD8 + T-cell fate, metabolism, and antitumor function. Materials and Methods Mice C57/BL6 female mice were purchased from Charles River Laboratories, whereas dLCK-Cre mice (C57/BL6 background) were purchased from The Jackson Laboratory (strain #:012837). NAE1 fl/fl mice (C57/BL6 background) were kindly provided by Dr. Ashwin Whoodoo (University of Santiago de Compostela, Spain; ref. 39). dLCK-Cre and NAE1 fl/fl mice were crossed to obtain NAE1 knockout (KO) mice. Cre negative littermates were used as controls. OT-I mice were obtained from The Jackson Laboratory (strain #:003831, C57/ BL6 background) and were crossed with NAE1-KO mice to generate NAE1-KO-OT-I mice, which were used for antigen-specific assays. Animal procedures were performed following the ethical guidelines established by the Biosafety and Welfare Committee at CIC bioGUNE and the recommendations from Association for Assessment and Accreditation of Laboratory Animal Care International. These experiments have been approved by the Committee on Bioethics and Animal Welfare (CBBA) and by the government of Bizkaia (Spain) under license numbers “P-CBG-CBBA-0319” and “P-CBG-CBBA-521.” In vitro assays Culture of mouse and human primary CD8 + T cells For the isolation of mouse CD8 + T cells, individual spleens from NAE1-KO and NAE1-KO-OT-I mice were homogenized using a syringe plunger in 20 mL of RPMI 1640 Glutamax medium (Gibco, cat. #: 11875093), and a 70 µm strainer was used for further dissociation. The single-cell suspension was centrifuged (5 minutes at 600 g, 4°C). Red blood cells were lysed by resuspending the pellet in 3 mL of ammonium-chloride-potassium (ACK) lysis buffer (Thermo Fisher Scientific, cat. #: A1049201). After 3 minutes, 10 mL of RPMI 1640 Glutamax medium were added, and the cell suspension was centrifuged (5 minutes at 600 g, at 4°C). Splenocytes were resuspended in RoboSep buffer (Stemcell Technologies, cat. #: 20104) and counted. CD8 + T cells were magnetically isolated using EasySep Mouse CD8 + T cell isolation Kit (Stemcell Technologies, cat. #: 19853A). Isolated CD8 + T cells were activated using plate-bound anti-CD3 (5 μg/mL, Thermo Fisher Scientific, cat. #: 16-0031-85) and soluble anti-CD28 (1 μg/mL, Thermo Fisher Scientific, cat. #: 16-0281-85). Cell culture medium consisted of 1640 RPMI Glutamax medium supplemented with β-mercaptoethanol (50 μmol/L, Thermo Fisher Scientific, cat. #: 31350010) and HEPES (25 mmol/L, Thermo Fisher Scientific, cat. #: 15630056). CD8 + T-cell culture density was 1.5 �10 6 cells per well (24-well plates) or 0.2 �10 6 per well (96-well plates) at a concentration of 10 6 cells/mL. DMSO was added to control wells. After 3 days of culture, CD8 + T cells were washed three times and reseeded with cell culture medium supplemented with IL2 (20 ng/mL, BioLegend cat. #: 575404). When indicated, NEDDylation inhibitor MLN4924 (MedChemExpress, cat. #: HY-70062) was added at 0.2 μmol/L or 0.4 μmol/L concentrations. When mentioned, galactose (10 mmol/L, Sigma-Aldrich, cat. #: 5388-100G) was added to noglucose RPMI medium (Gibco cat. #: 11879020). For the analysis of thymocytes, thymi were harvested and homogenized with a syringe plunger in RPMI 1640 Glutamax medium. For the analysis of inguinal lymph nodes, these were homogenized with a syringe plunger in RPMI 1640 Glutamax medium. Cells were directly stained and analyzed by flow cytometry. For the isolation of human CD8 + T cells, buffy coats were provided by the Basque Biobank (www.biobancovasco.org) and processed following standard operation procedures with appropriate AACRJournals.org Cancer Immunol Res; 13(7) July 2025 1005 NEDDylation Regulates CD8 + T-cell Function
approval of ethical and scientific committees (code CEIC E19-75). Human peripheral blood mononuclear cells were isolated from buffy coats using Ficoll-Paque Plus (Cytiva, cat. #: 17144003) density centrifugation at 1,200 g for 10 minutes at room temperature (RT) using SepMat-50 tubes (Stemcell Technologies, cat. #: 85450). CD8 + T cells were magnetically isolated using EasySep Human CD8 + T Cell Isolation Kit (Stemcell Technologies, cat. #: 17953RF) in an automated RoboSep cell separator (Stemcell Technologies) according to the manufacturer’s indications. Human cD8 + T cells were stimulated on culture plates coated with anti-CD3 (5 μg/mL, BD Biosciences, cat. #: 567118) and soluble anti-CD28 (1 μg/mL, Thermo Fisher Scientific, cat. #: 16-0289-81) in OpTmizer CTS medium (Thermo Fisher Scientific, cat. #: A1048501) supplemented with CTS Immune Cell Serum Replacement (Thermo Fisher Scientific, cat. #: A2596101). Cells were also stimulated with phorbol 12-myristate-13-acetate (PMA, 200 ng/mL, Sigma-Aldrich, cat. #: P8139) and ionomycin (200 ng/mL, Sigma-Aldrich, cat. #: I0634). Cells were seeded at a density of 10 6 cells/mL of medium. DMSO was added in control wells. After 3 days, CD8 + T cells were washed three times and refreshed with new media. When indicated, MLN4924 was added at 0.2 or 0.4 μmol/L concentrations. Cell lines LLC (cat. #: CRL-1642; 2019) and B16 cells (cat. #: CRL-6475; 2019) were purchased from the ATCC, cultured in DMEM (Gibco cat. #: 41966029), and passaged every 2 days. The B16-OVA cell line was a gift from Dr. Ignacio Melero (Centro de Investigaci´ on M´ edica Aplicada, University of Navarra, Spain) and passaged every 2 days. The rest of the ovalbumin (OVA) and GFP luciferase-expressing cell lines were generated through lentiviral infection. HEK 293 cells (Takara Bio Inc., cat. #: 632180; 2020) were cultured in DMEM (Gibco, cat. #: 41966029) and passaged every 2 days. YUMMER 1.7H2B-GFP5 cells were purchased from Sigma-Aldrich (cat. #: SCC245; 2024), cultured in DMEM-F12 (Gibco cat. #: 11320033) plus nonessential amino acids (Gibco, cat. #: 11140035), and passaged every 3 days. RAMOS cells were generously provided by Dr. Francisco Borrego (Biobizkaia Health Research Institute, Spain), cultured in RPMI 1640 Glutamax medium, and passaged every 2 days. Jurkat (clone E6-1) cells (cat. #: TIB-152, 2019) were purchased from the ATCC, cultured in RPMI 1640 Glutamax medium, and passaged every 2 days. The JE6.1 triple parameter reporter (Jurkat TPR) cell line was generously provided by Dr. Peter Steinberger (Medical University of Vienna, Austria), cultured in RPMI 1640 Glutamax medium, and passaged every 2 days. Jurkat TPR cells are genetically modified to encode fluorescent proteins under the control of response elements for transcription factors like NF-κB (eCFP proteins), NFAT (eGFP proteins), or AP-1 (mCherry proteins). All cell lines were cultured in media supplemented with 10% FBS (Thermo Fisher Scientific, cat. #: 10270106) and 1% penicillin– streptomycin (Thermo Fisher Scientific, cat. #: 15140122) and tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza, cat. #: LT27-221) following the manufacturer’s instructions. Microscopic examination to check cell shape, size, and growth patterns was performed daily. Cells were maintained in an incubator at 37°C in a 5% CO 2 atmosphere and cultured for a maximum of 10 passages. Plasmid design and cloning Plasmid encoding OVA was a gift from Maria Castro (University of Michigan, United States, Addgene plasmid # 25097; http://n2t. net/addgene:25097; RRID: Addgene_25097), and the OVA region was cloned into MSCV-pLV lentiviral plasmid by GenScript Biotech (resulting plasmid: cOVA-puro-MSCV-pLV). For CAR T-cell generation, we used CAR constructs which included the CD8α signaling peptide (UniProt entry: P01732), the anti-CD19 scFv derived from the FMC63 mAb (40), the CD8α hinge/transmembrane domain (UniProt entry: P01732), the 4-1BB costimulatory domain (UniProt entry: Q07011), the CD3ζ intracellular domain (UniProt entry: P20963-3), and a truncated form of the nerve growth factor receptor (NGFRt) as a selection marker (UnipPot entry: P08138). NGFRt was expressed separately to the CAR via a T2A self-cleaving peptide. This construct was cloned into the third-generation lentiviral vector pCCL (41), under the control of the EF1a constitutive promoter and synthesized by Genscript, resulting in the plasmid FMC63-BBz-NGFRt pCCL (item no. U2706FF040-10). For SENP8-KO plasmid production, plasmid encoding “lentiCRISPR v2” was a gift from Feng Zhang (Broad Institute, United States; Addgene plasmid cat. #: 52961). The guide RNAs against human AAVS1 (safe harbor gene used as control: GGGGCCACTAGGGACAGGAT) and SENP8 (AACTCAGTTCACGCAAAGC; ref. 42) were cloned into this vector by GenScript Biotech, resulting in plasmids “hAAVS1 KO_(ctrl)_LentiCRISPRv2” and “NEDP1_2_GFP_PURO_Lenticrisprv2,” respectively. GFP as a visualization marker and the puromycin resistance gene as a selection marker were also included in the plasmid. The heat shock method was used to incorporate plasmids into 15 μL of One Shot TOP10 (Thermo Fisher Scientific, cat. #: C404003) bacteria. Briefly, 0.3 μg of plasmid was added to 15 μL of bacteria and left 20 minutes on ice. After this, cells were heated to 42°C for 1.5 minutes and then incubated on ice for an additional 5 minutes. Bacteria were grown overnight for 16 hours in agar plates with ampicillin (100 μg/mL, Sigma-Aldrich, cat. #: A9518) as the selection antibiotic. The selected colony was used to inoculate a starter culture, which was grown overnight for 16 hours. Subsequently, the starter culture was used to inoculate a larger culture for maxiprep during additional 16 hours. Then, DNA was isolated using HiPure PureLink Maxiprep Isolation Kit (Thermo Fisher Scientific, cat. #: K210007). Lentivirus generation and T-cell transductions To generate lentiviral particles, 5 �10 6 HEK 293T cells were seeded in 10-cm plates and transfected on the next day using jetPEI Kit (Polyplus Transfection, cat. #: 101-10N) using packaging plasmids psPAX2 (4 μg, a gift from Didier Trono, ´ Ecole Polytechnique F´ ed´ erale de Lausanne, Switzerland, Addgene plasmid cat. #: 12260), and VSV-G (1.5 μg, a gift from Tannishtha Reya, Columbia University, United States, Addgene plasmid cat. #: 14888). For the rest of the plasmids, 5 μg per transfection plate was used. Viral particles were harvested from the supernatant 48 hours after transfection, centrifuged, and filtered through a 0.45-μm filter (VWR cat. #: 5140063). Virus used for T-cell transductions was concentrated using a Lenti-X concentrator (Takara Bio, cat. #: 631232) and titrated on Jurkat cells. Briefly, 5 �10 4 Jurkat cells were seeded in 96-well plates with 8 μg/mL of polybrene (Sigma-Aldrich, cat. #: TR-1003). A serial dilution of the used virus was added to the wells. Each dilution was assayed in duplicate. After 2 days, the efficiency of infection was analyzed by flow cytometry. Only the range of 5% to 20% of infection was used to quantify the amount of active viruses per μL. Generation of stable cell lines through lentiviral infection For the generation of stable cell lines, LLC, B16, and B16-OVA cells were seeded in a 6-well plate, and 24 hours later, 1006 Cancer Immunol Res; 13(7) July 2025 CANCER IMMUNOLOGY RESEARCH Jimenez-Lasheras et al.
nonconcentrated lentiviral particles were added in the presence of polybrene at 5 µg/mL for LLC and 10 µg/mL for B16 and B16OVA. After 2 days, the expression of the desired antigen was checked by flow cytometry. For luciferase-expressing cells (B16GFP-luciferase and B16-GFP-luciferase-OVA), transduced cells were sorted using a BD FACSAria Fusion sorter (BD Biosciences, purity >95%). For OVA-expressing LLC cells (LLC-OVA), puromycin selection was performed (2 µg/mL, Thermo Fisher Scientific, cat. #: A1113803). T-cell lentiviral transduction Human CD8 + T cells isolated from healthy blood donors were activated with anti-CD3 and anti-CD28 Dynabeads (1:1 ratio, Thermo Fisher Scientific, cat. #: 11132D) at 10 6 cells/mL with the mentioned human T-cell medium supplemented with IL2 (100 IU/mL, Miltenyi Biotech, cat. #: 130-097-746). On day 1 of activation, 0.5 �10 6 cells were seeded in 24-well plates and transduced with concentrated lentivirus. First, hAAVS1-KO (control) or SENP8-KO viral infection was performed at a multiplicity of infection of 6. The medium mentioned above contained polybrene at 8 μg/mL. Spinoculation was performed (2,000 RPM for 1 hour at 32°C). At day 3 of activation, transduced cells were selected with puromycin (1 μg/mL) for 3 days. Dynabeads were removed after 6 days. Every 2 days, IL2 was replenished with fresh media and cells were left at 0.5 �10 6 cells/mL. After 15 days of culture, cells were reactivated with anti-CD3 and anti-CD28 Dynabeads following the same protocol as stated before. After 1 day of activation, CD8 + T cells were infected with anti-CD19 CAR virus at a multiplicity of infection of 3. Cells were expanded for 15 days, after which they were purified using the NGFR positive selection kit (Stemcell Technologies, cat. #: 17849), obtaining purities greater than 80%. After 2 days, SENP8-KO anti-CD19 CAR T cells were used for the cytotoxicity assay. In vitro T-cell cytotoxicity assay For the mouse OT-I–based cytotoxicity assay, OT-I CD8 + T cells from control or NAE1-KO OT-I mice were magnetically isolated from the spleen and were activated in vitro for 3 days. At day 2, 2 �10 4 B16-luciferase-OVA cells were seeded in a white 96-well plate (PerkinElmer, cat. #: 6005680). At day 3, activated OT-I CD8 + T cells were washed and added to the culture at the indicated effector cell:T cell ratios for 24 hours. For the human SENP8-KO anti-CD19 CAR T cell cytotoxicity assay, 2.5 �10 4 RAMOS-luciferase cells were seeded in the same plates as the previous experiments. On the same day, hAAVS1 or SENP8-KO anti-CD19 CAR T cells were added to each well at the indicated effector cell:T cell ratios for 24 hours. In both assays, at endpoint 50 μL of D-Luciferin (3 mg/mL, PerkinElmer, cat. #: 122799) were added to each well, and the luminescence signal corresponding to alive cells was measured using a multimode plate reader (PerkinElmer Victor Nivo). In vitro T-cell exhaustion For the in vitro T-cell exhaustion model, we followed the protocol previously established by Scharping and colleagues (43). Briefly, splenic CD8 + T cells were isolated from control and NAE1-KO mice. Cells were activated at 1 �10 6 cells/mL using anti-CD3 and anti-CD28 Dynabeads in a 1:1 ratio, in RPMI 1640 Glutamax medium supplemented with 10% FBS, 1% penicillin–streptomycin, 25 ng/mL IL2, and 10 ng/mL IL12 (Miltenyi Biotech, cat. #: 130096-708). After 24 hours (day 1), beads were magnetically removed, and the cells were divided into two conditions: acute activation (without Dynabeads) and chronic activation (by readding Dynabeads). Fresh media supplemented with 25 ng/mL of IL2 was added. On days 3 and 5, the cells were split in half with fresh IL2 supplemented media. Finally, on day 6, the cells were analyzed. Measurement of IFNγ production IFNγ levels in cell culture supernatants were quantified after all the stimulations of the T-cell exhaustion protocol using a sandwich ELISA kit according to the manufacturer’s protocol (R&D Systems, cat. #: DY485). Lactate dehydrogenase activity assay The activity of lactate dehydrogenase (LDH) in cell culture supernatants was quantified on day 3 of activation according to the manufacturer’s colorimetric protocol (Sigma-Aldrich, cat. #: MAK066). Flow cytometry Single-cell suspensions were seeded in V-shaped 96-well plates (Thermo Fisher Scientific, cat. #: 249570). If cells were to be fixed, they were first stained with fixable LIVE/DEAD viability dyes for 30 minutes at 4°C protected from light. Then, cells were incubated with TruStain FcX blocker for 10 minutes at RT protected from light. After this, cells were stained with fluorochrome-conjugated antibodies in staining buffer (Thermo Fisher Scientific, cat. #: 00-4222-26) for 30 minutes at 4°C in the dark. After staining, if cells were to be fixed, they were resuspended in paraformaldehyde at 0.5% and acquired no more than 5 days later in a BD FACSymphony A3 flow cytometer. If cells were not fixed, 40,6-diamidino-2-phenylindole (DAPI,1:10,000 dilution, Thermo Fisher Scientific, cat. #: D1306) was added as a viability marker. Analysis was performed using FlowJo v10 or Cytobank Premium software. All centrifugation steps were performed at 450 g for 5 minutes at 4°C. The antibodies used are listed in Supplementary Table S1. Specific staining procedures are detailed in the corresponding sections of “Materials and Methods.” Cell proliferation and viability assay Absolute cell numbers of mouse or human CD8 + T cells were obtained by using CountBright absolute counting beads (Thermo Fisher Scientific, cat. #: C36995) after acquisition in a BD FACSymphony A3 flow cytometer. For the carboxyfluorescein diacetate succinimidyl ester (CFSE) dilution assay of mouse CD8 + T cells, 10 6 CD8 + T cells were resuspended in RPMI medium supplemented with FBS and P/S and were incubated with 5 μmol/L CFSE (Thermo Fisher Scientific, cat. #: C34554) for 5 minutes at RT in the dark. Cells were washed three times and 3.5 �10 5 CD8 + T cells were activated with plate-bound anti-CD3 and soluble anti-CD28 in round-shaped 96-well plates. At day 3, cells were acquired in a BD FACSymphony A3 flow cytometer. For the CFSE dilution assay of human CD8 + T cells, 10 6 CD8 + T cells were resuspended in PBS and incubated with 5 μmol/L CFSE for 7 minutes at 37°C in the dark. Five mL of ice-cold RPMI were added to the cells, and the cells were incubated for 5 minutes and washed twice. Then, 1.75 �10 5 CD8 + T cells were activated with plate-bound anti-CD3 and soluble anti-CD28 in a round-shaped 96well plate and acquired in a BD FACSymphony A3 flow cytometer at day 4 of activation. For the annexin V viability assay, activated mouse CD8 + T cells were harvested after 3 days of culture and stained with 3 µL of annexin V-BV421 in 100 µL of binding buffer (BD Biosciences, cat. #: 556454). After incubating for 5 minutes in the dark, 2 µL of 7aminoactinomycin D (7AAD) in 100 µL of binding buffer were AACRJournals.org Cancer Immunol Res; 13(7) July 2025 1007 NEDDylation Regulates CD8 + T-cell Function
15 A B C D FG 6 4 10 Lymphocytes B 5 0 Lymphocytes T Myeloid cells UMAP2 Endothelial cells 2 0 –5 Fibroblasts NEDD8 expression Cancer cells –10 10 UMAP1 –10 0 Lung adenocarcinoma **** Melanoma Hepatocarcinoma **** **** 2.1 1.50 1.9 1.25 2.0 1.7 81.8 1.00 1.5 NEDD8 expression NEDD8 expression NEDD8 expression 0.75 81.6 1.3 0.50 CD8+ Naїvelike CD8+ Effector memory CD8+ Naїvelike CD8+ Effector memory CD8+ Naїvelike CD8+ Effector memory DAPI CD3 CD3 NEDD8NEDD8 Nedd8 Nae1 Ube2m ENEDD8 NAE1 UBE2M 1.5 1 5 4 3 2 1 0 10 12 1.5 12 8 6 4 10 10 8 6 4 8 6 1.0 0.5 0.5 Relative expression Relative expression Relative expression 2 0 Relative expression Relative expression Relative expression 2 0 4 2 00.0 0 Day 0 Day 2 Day 0 Day 0 Day 3 Day 0 Day 3 Day 0 Day 3 Day 2 Day 0 Day 2 Day 0 Day 2 Day 0 Day 2 Day 0 Day 2 Mouse Human 95–105 kDa NEDDylated cullins 95–105 kDa NEDDylated cullins 60 kDa NAE1 60 kDa NAE1 9 kDa Free NEDD8 9 kDa Free NEDD8 42 kDa -actin -actin -actin 42 kDa 25 kDa UBC12 (UBE2M) 25 kDa UBC12 (UBE2M) 42 kDa ****** Lymphocytes B Lymphocytes T Myeloid cells Endothelial Fibroblasts Cancer cells 1008 Cancer Immunol Res; 13(7) July 2025 CANCER IMMUNOLOGY RESEARCH Jimenez-Lasheras et al.
added to samples, which were kept in ice until acquisition in a BD FACSymphony A3 flow cytometer. For human CD8 + T cells, DAPInegative cells were considered alive cells. Data analysis was performed with FlowJo v10 or Cytobank software programs. Western blot Total cell lysates were collected using lysis buffer (50 mmol/L Tris, pH 8.0, 150 mmol/L NaCl, 1% Triton X-100, and 2 mmol/L EDTA) supplemented with protease inhibitors (cOmplete EDTAfree tablets, EASYPack, Roche, cat. #: 04693132001), phosphatase inhibitors (PhosSTOP EASYpack, Roche, cat. #: 04906837001), phenylmethylsulfonyl fluoride (Cell Signaling Technologies, cat. #: 8553), and deNEDDylase inhibitor 2-iodoacetamide (2 mg/mL, Sigma-Aldrich, cat. # 8047440025). Protein quantification was performed using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific, cat. #: 23227). Samples were mixed with LDS sample buffer (Thermo Fisher Scientific, cat. #: NP0007) containing ditiothreitol (DTT; Melford, cat. #: MB1015), heated for 10 minutes at 95°C, and resolved in a 7.5% or 4% to 15% Mini-PROTEAN TGX precast protein gels (Bio-Rad, cat. #: 4561023 and cat. #: 4561085, respectively) with 1X Tris/glycine/SDS electrophoresis buffer (Bio-Rad, cat. #: 1704156) and PageRuler Plus Prestained Protein Ladder (Thermo Fisher Scientific, cat. #: 26619). Protein transfer to 0.2 µm PVDF membranes (Bio-Rad, cat. #: 1704156) was carried out in a Trans-Blot Turbo transfer system (Bio-Rad). Membranes were blocked for 5 minutes in EveryBlot Blocking Buffer (Bio-Rad, cat. #:12010020), washed in T-PBS (0.5% Tween-20, Sigma-Aldrich, cat. #: P2287), and incubated overnight with primary antibodies (Supplementary Table S1). The following day, membranes were washed and incubated with the corresponding secondary HRP-conjugated antibodies for 1 hour (Supplementary Table S1). Chemiluminescence detection was performed using Clarity Max Western ECL Substrate (Bio-Rad, cat. #: 170506) in an iBright CL1500 system (Thermo Fisher Scientific). Densitometric quantifications were performed using ImageJ–Fiji software. When a membrane was reprobed with an additional antibody, it was incubated overnight and developed immediately after probing with the specific antibody, following the same methodology as previously described. RT-qPCR Total RNA was isolated from CD8 + T cells using NucleoSpin RNA Kit (Macherey-Nagel, cat. #: 740955.250). A total of 325 ng of RNA were used to synthesize the cDNA with the M-MLV reverse transcriptase (Thermo Fisher Scientific, cat. #: 28025-013) and random oligos (Thermo Fisher Scientific, cat. #: 58875). qPCR reactions were performed in triplicate in a ViiA 7 Real-Time PCR system (Thermo Fisher Scientific) from 1 μL of cDNA using PerfeCTa SYBR Green SuperMix Reagent (Quantabio cat. #: 95056500) and gene-specific primers (Supplementary Table S1). The 2 �ΔΔCt method was used to calculate the relative gene expression considering the 18S or Rplp0 genes as housekeeping genes for human and mouse species, respectively. Immunofluorescence For immunofluorescence, subcutaneous LLC tumors were harvested and flash-frozen in optimal-cutting-temperature medium at �80°C. Sections of 8 μm were made with a Leica CM 1860 UV cryostat and fixed with 4% paraformaldehyde (Thermo Fisher Scientific, cat. #: J61899.AP) for 10 minutes. Slides were washed twice with PBS and permeabilized with 0.1% Triton X-100 (SigmaAldrich, cat. #: T9284) for 10 minutes. After washing, tissue slides were incubated with 2.5% normal goat blocking serum (Vector Laboratories, cat. #: S-1012-50) for 30 minutes at RT to reduce nonspecific staining. Serum was washed, and samples were incubated at 4°C overnight with primary antibodies against NEDD8, CD3, or Ki-67 (Supplementary Table S1). The next day, slides were washed five times with PBS and stained for 45 minutes with secondary antibodies at RT (goat anti-rat Alexa Fluor 488 and goat anti-rabbit Alexa Fluor 647; Supplementary Table S1). Slides were washed again, stained with DAPI for 10 minutes at RT, and mounted with Prolong Gold Antifade reagent (Thermo Fisher Scientific, cat. #: P36930). Images were obtained using a confocal microscope (Leica SP8 Lightning, HC PL APO objective lens with 100X magnification) and analyzed using LasX software. Seahorse XF assay Human CD8 + T cells were activated and cultured with MLN4924 at the indicated doses as stated in the Cell Culture section. Mouse control and NAE1-KO mouse CD8 + T cells were activated and cultured as stated in the “Culture of mouse and human primary CD8 + T cells” section of this article. At day 3, cells were washed and resuspended in Seahorse XF RPMI medium (Agilent, cat. #: 103576100) supplemented with 10 mmol/L glucose (Agilent, cat. #: 103577100), 1 mmol/L sodium pyruvate (Agilent, cat. #: 103578-100), 2 mmol/L L-glutamine (Gibco, cat. # 25030-024), and MLN4924 at the indicated doses. Seahorse XF24 Cell Culture Microplates were Figure 1. NEDD8 expression is upregulated during the activation and differentiation into effector memory TILs. A, Uniform Manifold Approximation and Projection (UMAP) plot of immune and nonimmune cell populations generated by analyzing publicly available scRNA-seq data of patients with lung cancer (left). Violin plots showing NEDD8 expression in the different immune and nonimmune cell populations associated with lung cancer microenvironment (right). B, Dot plots showing the mean expression levels of NEDD8 in 5-cell interactions (n ¼50) across the indicated types of cancer and phenotypes. Cells with zero expression of NEDD8 were not considered in this analysis. C, Representative immunofluorescence images showing NEDD8 expression in mouse CD3 + TILs (n ¼3, scale bar ¼10 μm; scale bar for zoomed image ¼2 μm). D, Relative RNA expression levels of NEDD8, Ube2m, and Nae1 in mouse primary CD8 + T cells upon activation with anti-CD3 and anti-CD28 antibodies, at the indicated timepoints, measured by RT-qPCR using Rplp0 as housekeeping gene (n ¼3, each sample was assessed in triplicate). E, Relative RNA expression levels of NEDD8, UBE2M, and NAE1 in human primary CD8 + T cells upon activation with anti-CD3 and anti-CD28 antibodies, at the specified timepoints, measured by RT-qPCR, using 18S as housekeeping gene (n ¼4, two independent experiments, each sample was assessed in triplicate). F, Western blot showing the expression of NEDDylated cullins, NAE1, free NEDD8, β-actin, and UBC12 (UBE2M) in mouse CD8 + T cells, under the described activation conditions (n ¼3, two independent experiments). The same membrane was sequentially probed and developed after each incubation with the following antibodies: 1°, anti-NAE1 (top half membrane)/anti-UBC12 (bottom half membrane); 2°, anti–β-actin; 3°, anti-NEDD8. The loading control was run on the same blot as the experimental samples. G, Western blot showing the expression of NEDDylated cullins, NAE1, free NEDD8, β-actin, and UBC12 (UBE2M) in human primary CD8 + T cells under the indicated activation conditions (n ¼3, two independent experiments). Two separate membranes were used. The first membrane was sequentially probed and developed after each incubation with the following antibodies: 1°, anti-NAE1; 2°, anti-NEDD8; and 3°, anti–β-actin. A second membrane, loaded with the same protein samples, was used to detect: 1°, UBC12; 2°, β-actin. In both membranes, the loading control was run on the same blot as the experimental samples. Data represented as the mean ± SEM, and analyzed using an unpaired t test. *, P ≤ 0.05; ***, P ≤ 0.001; ****, P ≤ 0.0001. AACRJournals.org Cancer Immunol Res; 13(7) July 2025 1009 NEDDylation Regulates CD8 + T-cell Function
MLN4924 NAE1MLN4924 Mouse Control KO Human Control 0.2 μmol/L 0.4 μmol/L Distal Lck Cre recombinase NEDDylated cullins NEDDylated cullins loxP NAE1 loxP 100 kDa 100 kDa 42 kDa -actin 60 kDa NAE1 loxP NAE1 loxP MLN4924 NAE142 kDa -actin -actin T cell–specific NAE1-KO Control KO 60 kDa NAE1 42 kDa F ED L IJK AB C 80 80 100 100 500 ** ** ** ** ** * 80 80 60 60 *** *** 400 60 60 40 Day 3 % of cells Day 6 % of cells Day 3 % of alive cells Day 6 % of alive cells % of day 0 seeded cells 40 40 20 0 40 ** 300 200 20 0 20 0 20 0 100 0 Alive Late apoptotic Alive Late apoptotic Control MLN4924 0.2 μmol/L Control MLN4924 0.2 μmol/L Day 1 Day 2 Day 3 Day 6 NAE1-KO MLN4924 0.4 μmol/L Control MLN4924 0.2 μmol/L NAE1-KO NAE1MLN4924 Control KO 0.2 μmol/L 100 kDa WEE-1 0.5 55 kDa -tubulin 1.5 **** 1.0 Number of events Normalized division index GH 3.5 P = 0.07 * 3.0 2.5 Cell count Division index 2.0 1.5 1.0 0.5 0.0 CFSE 0.0 CFSE Control MLN4924 0.2 μmol/L NAE1-KO Control MLN4924 0.2 μmol/L MLN4924 0.4 μmol/L MNO 6,000 5,000 * *** 60 **** 50 **** 4,000 40 4,000 3,000 40 30 CD69 gMFI 2,000 0 2,000 % of eCFP+ cells (NF-кB activity) % of eGFP+ cells (NFAT activity) 20 0 20 CD69 gMFI (12 hours) 1,000 0 10 0 Control MLN4924 0.2 μmol/L Control MLN4924 0.2 μmol/L Control NAE1-KO MLN4924 0.4 μmol/L MLN4924 0.4 μmol/L 0.2 μmol/L 0.2 μmol/L Figure 2. NEDDylation promotes the survival and proliferation of CD8 + T cells. A, Schematic representation of the generation of T cell–specific NAE1-KO mouse model. B, Western blot showing the reduction of NEDDylated cullins as a result of the deletion of NAE1 or the pharmacologic inhibition with MLN4924 in mouse CD8 + T cells activated for 3 days (n ¼5, four independent experiments). Two separate membranes were used. The first membrane was sequentially probed and developed after each incubation with the following antibodies: 1°, anti-NEDD8; 2°, anti–β-actin. A second membrane, loaded with the same protein samples, was sequentially probed and developed after each incubation with the following antibodies: 1°, anti-NAE1; 2°, anti–β-actin. In both membranes, the loading control was run on the same blot as the experimental samples. C, Western blot showing the reduction of NEDDylated cullins as a result of the pharmacologic inhibition with MLN4924 in CD8 + T cells at the defined doses and activated for 3 days (n ¼5, four independent experiments). The same membrane was sequentially probed and developed after each incubation with the following antibodies: 1°, anti-NAE1; 2°, anti-NEDD8; 3°, anti–β-actin. The loading control was run on the same blot as the experimental samples. D, Percentage of alive (7AAD � annexin V � ) and late apoptotic (7AAD + annexin V + ) mouse CD8 + T cells at day 3 (left) and day 6 (right) of activation (n ¼3, unpaired parametric t test). E, Percentage of alive human CD8 + T cells (DAPI-negative) at day 3 (left) and day 6 (right) of activation, treated with MLN4924 at the specified doses and analyzed by flow cytometry (n ¼3, ordinary one-way ANOVA). F, Percentage of increase in cell count of mouse CD8 + T cells, at the defined timepoints, in control, NAE1-KO or MLN4924-treated CD8 + T cells (n ¼3, unpaired parametric t test). G, Representative histograms showing the proliferation of control, NAE1-KO, or MLN4924-treated mouse CD8 + T cells, measured by a CFSE dilution assay at day 3 of activation (n ¼3). H, Division index corresponding to the CFSE dilution assay shown in (G) (n ¼3, unpaired parametric t test). I, Western blot showing the protein levels of WEE-1 and α-tubulin in control, NAE1-KO, and MLN4924-treated mouse CD8 + T cells, activated for 3 days (n ¼4, two independent experiments). The same membrane was sequentially probed and developed after each incubation with the following antibodies: 1°, anti-WEE-1; 2°, anti-β-ACTIN. The loading control was run on the same blot as the experimental samples. J, Representative histograms showing the proliferation of control and MLN4924-treated human CD8 + T cells, measured by a CFSE dilution assay at day 5 of activation (n ¼4). K, Division index corresponding to the CFSE dilution assay shown in (I) (n ¼4, ordinary one-way ANOVA). L, CD69 expression measured by flow cytometry (gMFI) at day 3 of activation in control (n ¼13) and NAE1-KO (n ¼14) CD8 + T cells (Continued on the following page.) (four independent experiments, unpaired parametric t test. M, CD69 expression measured by flow cytometry (gMFI) 1010 Cancer Immunol Res; 13(7) July 2025 CANCER IMMUNOLOGY RESEARCH Jimenez-Lasheras et al.
coated with poly-L-lysine (50 μg/mL, Sigma-Aldrich, cat. #: P8920) for 2 hours. A total of 10 5 or 2 �10 5 CD8 + T cells were seeded per well for the Seahorse XF Glycolytic Rate Assay (Agilent, cat. #: 103344-100) and Seahorse XF Cell Mito Stress Test, respectively. After centrifuging at 400 g for 5 minutes, cells were left 15 minutes resting at 37°C in a non-CO 2 incubator. A measure of 400 μL of supplemented medium were very carefully added to each well. For the Seahorse XF Glycolytic Rate Assay, rotenone and antimycin A (0.5 μmol/L) and 2-deoxy-D-glucose (2-DG, 500 mmol/L) were used. Basal and compensatory glycolysis calculations were made through the Seahorse Analytics software. For the Seahorse XF Cell Mito Stress Test, the following drugs were used: oligomycin (1.5 μmol/L, Sigma-Aldrich, cat. #: O4876), BAM15 (2.5 μmol/L, MedChemExpress, cat. #: HY-110284), and rotenone (0.5 μmol/L, Merck, cat. #: 557368) and antimycin A (0.5 μmol/L, Sigma-Aldrich, cat. #: A8674). Basal, maximal respiration and spare respiratory capacity were calculated through the Seahorse Analytics software. Both assays were run in the Seahorse XF24 Extracellular Flux Analyzer (Agilent Technologies). Immunoprecipitation For each immunoprecipitation (IP) reaction, 1.5 mg of protein lysate and 10 μg of antibody were used (anti-NEDD8 or IgG Isotype control, listed in Supplementary Table S1). Human CD8 + T cells isolated from buffy coats from healthy donors were activated in vitro. Various healthy donors were used in each IP assay, and no donors were repeated in each assay. Activated CD8 + T cells were lysed according to the protocol stated in the “Western blot” section of this article. Antibodies were coupled to Protein G magnetic Sepharose beads (50 μL, Cytiva, cat. #: 28951379) for 1 hour at 4°C. After this, antibodies were cross-linked to the beads with BS3 compound (Thermo Fisher Scientific, cat. #: 21580) according to the manufacturer’s protocol. Protein lysates were precleaned with Protein G magnetic Sepharose beads coupled to 5 μg of IgG antibody (not cross-linked) during 1 hour at 4°C. Following this, lysates were incubated with the cross-linked bead–antibody complex overnight at 4°C. Subsequently, beads were washed six times, eluted in 30 μL of LDS sample buffer (Thermo Fisher Scientific, cat. #: NP0007) containing DTT (Melford, cat. #: MB1015), and boiled at 95°C for 10 minutes. Eluates were analyzed by Western blotting or by mass spectrometry (MS). In the case of MS analysis, lysis buffer did not include 2-Iodoacetamide. Proteomic analyses IP: SDS-PAGE followed by in-gel tryptic digestion Immunoprecipitated protein samples were boiled in a buffer containing 50 mmol/L Tris, pH 6.8, 5% glycerol, 1.67% β-mercaptoethanol, 1.67% SDS, and 0.0062% bromophenol blue for 5 minutes and resolved in 4% to 12% gradient acrylamide gels (NuPAGE Bis-Tris gels 1.0 �12 well, Thermo Fisher Scientific) using an XCell SureLock Mini-Cell Electrophoresis System (Thermo Fisher Scientific). A constant voltage of 150 V was applied for 45 minutes. Gels were fixed in a solution containing 10% acetic acid and 40% ethanol for 30 minutes and stained overnight in SYPRO Ruby (Bio-Rad). Gels were then washed in a solution containing 10% ethanol and 7% acetic acid for 30 minutes, and the image was acquired using a Chemidoc gel imager system (Bio-Rad). Each lane was subjected to tryptic digestion. Gel bands were washed in Milli-Q water. Reduction and alkylation were performed using 10 mmol/L DTT in 50 mmol/L ammonium bicarbonate at 56°C for 20 minutes, followed by iodoacetamide (50 mmol/L iodoacetamide in 50 mmol/L ammonium bicarbonate) for another 20 minutes in the dark. Gel pieces were dried and incubated with trypsin (12.5 μg/mL in 50 mmol/L ammonium bicarbonate) for 20 minutes on ice. After rehydration, the trypsin supernatant was discarded. Gel pieces were hydrated with 50 mmol/L ammonium bicarbonate and incubated overnight at 37°C. After digestion, acidic peptides were cleaned with TFA 0.1% and dried out in a RVC2 25 speedvac concentrator (Christ). Peptides were resuspended in 10 μL 0.1% FA and sonicated for 5 minutes prior to LC-MS/MS analysis. General proteomic analysis: sorting for alive cells followed by insolution tryptic digestion Activated mouse CD8 + T cells were sorted to isolate alive cells using a BD FACS Aria fusion sorter. Total protein from activated alive mouse CD8 + T cells was extracted by incubating the extracts in a buffer containing 7 mol/L urea, 2 mol/L thiourea, and 4% CHAPS. Samples were incubated in this buffer for 30 minutes at RT with agitation and digested following the FASP protocol described by Wisniewski and colleagues (44) in 2009 with minor modifications. Trypsin was added in 50 mmol/L ammonium bicarbonate to a trypsin:protein ratio of 1:10, and the mixture was incubated for overnight at 37°C. Peptides were dried out in an RVC2 25 speedvac concentrator (Christ) and resuspended in 0.1% FA. Peptides were desalted and resuspended in 0.1% FA using C18 stage tips (Millipore) prior to acquisition. MS analysis Samples were analyzed in a timsTOF Pro with PASEF (Bruker Daltonics) coupled online to an Evosep ONE liquid chromatograph (Evosep). timsTOF was operated in data-dependent acquisition mode, and the data were acquired using the default data-dependent acquisition PASEF-standard_1.1sec_cycletime method provided by Bruker. Data were acquired in positive mode. Scan range was established between 100 and 1700 m/z, and 1/K0 was between 0.60 and 1.60 V�s/ cm 3 , with a total ramp and accumulation time of 100 ms (100% duty cycle). Collison energies applied were 20 and 59 eV for the lower and upper limits of the mobility range, respectively. Charge states between 0 and 5 were specifically selected for analysis. Total PASEF ramps were 10, to a final cycle time of 1.16 seconds. A total of 200 ng were directly loaded onto the Evosep ONE and resolved using the default 30 samples-per-day protocol (44 minutes gradient flow and 48 minutes total cycle time). The analytic column was equilibrated at 1,500 nL/minute, and the gradient flow was 500 nL/minute, increased to 1,500 nL/minute for washing. Solvents A and B were water with 0.1% formic acid (FA) and acetonitrile with 0.1% FA, respectively. Protein identification and quantification was carried out using PEAKS X software (Bioinformatics solutions) or MaxQuant. (Continued.) 12 hours after activation in control and NAE1-KO CD8 + T cells (ordinary one-way ANOVA. N, NF-κB activity measured in Jurkat TPR cells treated with MLN4924 at the indicated doses, upon activation with anti-CD3 and anti-CD28 for 1 day, and analyzed by flow cytometry (n ¼6, two independent experiments, ordinary one-way ANOVA). O, NFAT activity measured in Jurkat TPR cells in the same conditions as in (J) (n ¼6, two independent experiments, ordinary one-way ANOVA). Data are represented as the mean ± SEM. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; ****, P ≤ 0.0001. gMFI, geometric mean fluorescence intensity. AACRJournals.org Cancer Immunol Res; 13(7) July 2025 1011 NEDDylation Regulates CD8 + T-cell Function
600 A F K OP Q R LM N GHI J BCDE 1,500 LLC 400 250 YUMMER1.7 - GFP 1,000 300 200 800 200 400 200 0 1,000 500 0 CD4+/mg of tumor CD8+/mg of tumor 150 100 600 400 Tumor volume (mm3) Tumor volume (mm3) 100 0 50 00 Tumor volume (mm3) 200 (Day) 6 8101214 (Day) 12 14 16 Control NAE1-KO Control NAE1-KO Control NAE1-KO 100 * ** 100 100 100 100 80 80 80 60 80 Central Naїve ** ** ** *60 50 memory 60 40 Effector ** 60 40 40 40 20 00 20 0 20 20 00 % of T-bet+ CD4+ T cells % of CD8+ T cells % of PD-1+ TIM-3+ TIGIT+ CD8+ T cells % of CD39+ TIM-3+ CD8+ T cells % of TCF7+ in CD44high PD-1+ CD8+ T cells % of CD44high PD-1+ CD8+ T cells % of granzyme B + CD8 + T cells Control Control NAE1-KO Control Control NAE1-KO NAE1-KO NAE1-KO 2,000 2,000 1,500 100 100 80 80 1,500 1,000 60 60 1,000 40 40 500 0 OT-1 injection OT-1 injection 20 0 20 0 Tumor volume (mm3) Tumor volume (mm3) 500 0(Days) 9 (Days) 36 Days after tumor challenge Control NAE1-KO Days after tumor challenge Untreated Control - OT-I NAE1 - KO-OT-I Untreated Control - OT-I NAE1-KO - OT-I 0 3,000 100 ns 90 80 100 70 60 95 kDa Control SENP8 KO 80 50 40 30 % of lysed tumor cells 2,000 1,000 Tumor volume (mm3) Percentage of survival 20 OT-1 injection NEDD8 60 40 10 020 0 10 20 30 40 50 Untreated Days after tumor challenge 10 kDa (E:T) 1:1 1:2 1:4 1:8 Control - OT-I NAE1-KO - OT-I Control CAR-T Untreated *** Control - OT-I ns *** NAE1-KO - OT-I 20 kDa SENP8 SENP8 KO CAR-T 42 kDa -actin * *** **** ** ** ** ** ** **** 48 ns 1110 12 13 14 15 16 17 18 19 20 4542393633302724211815129 Figure 3. Deletion of NAE1 accelerates tumor growth and decreases the number of TILs, impairing their differentiation into effector CD8 + cells. A, Mean tumor volume of control (n ¼14) and NAE1-KO (n ¼11) mice after the subcutaneous injection of the LLC tumor cell line (three independent experiments, unpaired nonparametric Mann–Whitney test). B, Tumor volume measurement of control (n ¼14) and NAE1-KO (n ¼11) mice at endpoint day after subcutaneous injection of the LLC tumor cell line (unpaired nonparametric Mann–Whitney test). C, Absolute number of CD4 + T cells per milligram of tumor at endpoint day in control (n ¼14) and NAE1-KO (n ¼11) mice after subcutaneous injection of the LLC tumor cell line, analyzed by flow cytometry (unpaired nonparametric Mann–Whitney test). D, Absolute number of CD8 + T cells per milligram of tumor, in the same conditions as in (C). E, Mean tumor volume of control (n ¼11) and NAE1-KO (n ¼12) mice after the subcutaneous injection of YUMMER 1.7-GFP tumor cell line (two independent experiments, unpaired nonparametric Mann–Whitney test). F, Percentage of T-bet + CD4 + T cells (unpaired nonparametric Mann–Whitney test). G, Intratumoral CD8 + T-cell phenotype of control (n ¼4) and NAE1-KO (n ¼6) mice analyzed by flow cytometry (effector: CD44 + CD62L � ; central memory: CD44 + CD62L + ; na¨ ıve: CD44 � CD62L + , unpaired nonparametric Mann–Whitney test). H, Percentage of intratumoral CD8 + T cells triple-positive for PD-1, TIM-3, and TIGIT (unpaired nonparametric Mann–Whitney test). I, Percentage of intratumoral CD8 + T cells double-positive for CD39 and TIM-3 (unpaired nonparametric Mann–Whitney test). J, Percentage of intratumoral CD8 + T cells double-positive for (Continued on the following page.) CD44 high and PD-1 (unpaired nonparametric Mann–Whitney test). K, Percentage of TCF7 + cells in intratumoral CD8 + 1012 Cancer Immunol Res; 13(7) July 2025 CANCER IMMUNOLOGY RESEARCH Jimenez-Lasheras et al.
In this context, we show that NEDDylation favors the acquisition of a glycolytic phenotype by T cells. Specifically, we demonstrate that NEDDylation-deficient CD8 + T cells are characterized by reduced LDHA transcript levels, protein expression, and enzymatic activity. This finding aligns with the dysregulation of MYC and HIF1-α signaling pathways, known regulators of LDHA and the associated metabolic reprogramming that drives T-cell activation (65, 71). In fact, metabolic reprogramming is a central feature of the robustness of immune responses (72). In the tumor microenvironment, effector T cells rely on LDHA for their differentiation and function (73), a finding consistent with our observation of impaired differentiation in vivo during tumor-challenge assays. This mechanism can offer opportunities for therapeutic intervention by modulating the NEDDylation of these glycolytic enzymes and metabolic pathways to enhance the metabolic fitness and antitumor capabilities of T cells. We identified the glycolytic enzymes LDHA, HK-1, and ENO1 as NEDD8 targets in activated CD8 + T cells, suggesting another layer of regulation of metabolism by NEDDylation, similar to that observed with other cell types (74, 75). PTMs are known to regulate multiple members of the same signaling pathway (61), suggesting that NEDDylation could control glycolysis acting on several enzymes of this pathway. Determining whether these enzymes are regulated posttranslationally by NEDD8 is a critical area of investigation that requires further elucidation. The specific regulation of these NEDD8 targets is of particular interest, and the substrate specificity of E3 ligases can aid in this purpose (76). Identifying the E3 ligases involved in the specific NEDDylation of these substrates can avoid the negative outcomes of overall NEDDylation inhibition and unlock new ways to manipulate protein–protein interactions, such as using proteolysis-targeting chimeras. In a similar manner, the extension of PTM strategies into the field of adoptive cell therapies is a novel approach. For example, engineering of CAR T cells to circumvent CAR ubiquitination enhances their antitumor effectiveness and endurance within the host (77, 78). In this study, we propose an approach wherein knocking out the deNEDDylase SENP8 confers superior antitumor characteristics to CD8 + CAR T cells. This strategy involves upregulating NEDDylation in CD8 + T cells, serving as a mechanism to optimize a variety of adoptive cell therapies, including engineered CAR and TCR approaches. An alternative approach was recently proposed by Liao and colleagues (79), based on the inhibition of cullin 5 in CAR T cells. Notably, adoptive cell therapies provide an opportunity to specifically treat engineered T cells without requiring systemic administration of the tested agent, which can be useful to regulate NEDDylation to keep its beneficial outcomes while avoiding its deleterious effects. In conclusion, our study highlights NEDDylation as a critical regulatory mechanism in CD8 + T-cell metabolism and antitumor immunity, delineating the dual role of NEDDylation in tumor cells and immune cells, and exploring molecular pathways supporting potential therapeutic strategies that harness this pathway for cancer immunotherapy. Authors’ Disclosures B. Jim´enez-Lasheras reports a patent for EP21382780 pending. A. Palazon reports a patent for EP21382780 pending. No disclosures were reported by the other authors. Authors’ Contributions B. Jim´ enez-Lasheras: Conceptualization, resources, formal analysis, validation, investigation, visualization, methodology, writing–original draft, writing–review and editing. P. Velasco-Beltr´ an: Conceptualization, resources, formal analysis, validation, investigation, visualization, methodology, writing–original draft, writing– review and editing. L. Egia-Mendikute: Resources, formal analysis, supervision, validation, investigation, visualization, methodology, writing–review and editing. L. P´ erez-Guti´ errez: Resources, formal analysis, validation, investigation, visualization, methodology, writing–review and editing. S.Y. Lee: Resources, formal analysis, validation, investigation, visualization, methodology. A. de Blas: Resources, formal analysis, validation, investigation, visualization, methodology. A. Garc´ ıa-del R´ ıo: Resources, formal analysis, validation, investigation, visualization, methodology. S.R. Zanetti: Formal analysis, validation, investigation, visualization, methodology. A. Antoñana-Vildosola: Resources, formal analysis, validation, investigation, visualization, methodology. A. Barreira-Manrique: Resources, formal analysis, validation, visualization, methodology. A. Bosch: Resources, Formal analysis, validation, investigation, visualization, methodology. J. Etxaniz-D´ ıaz de Durana: Resources, formal analysis, validation, investigation, visualization, methodology. E. PrietoFern´andez: Resources, data curation, software, formal analysis, validation, investigation, visualization, methodology. M. Serrano-Maci´ a: Resources, formal analysis, validation, investigation, visualization, methodology. N. Goikoetxea-Usandizaga: Resources, formal analysis, methodology. M. Azkargorta: Resources, data curation, software, formal analysis, methodology. F. Elortza: Resources, data curation, software, formal analysis, methodology. T. Gruber: Resources, formal analysis, validation, investigation, visualization, methodology. S. Peer: Resources, formal analysis, validation, investigation, visualization, methodology. G. Baier: Resources, supervision, funding acquisition. A. Woodhoo: Resources, formal analysis, validation. M.L. Mart´ ınez-Chantar: Conceptualization, resources, formal analysis, supervision, validation, investigation, visualization, methodology. A. Palazon: Conceptualization, resources, formal analysis, supervision, funding acquisition, validation, investigation, visualization, methodology, writing–original draft, project administration, writing– review and editing. Acknowledgments This research was supported by the following: Ministerio de Ciencia, Innovaci´on y Cultura (MICIU)/Agencia Española de Investigaci´on (AEI; 10.13039/501100011033) financed “PID2019-107956RA-I00” project (A.P); MICIU/AEI/10.13039/501100011033 and European Union Next Generation EU/ PRTR financed “PDC2022-133300-I00” (A. Palazon), “TED2021-129433B-C21” (A. Palazon) and “JDC2022-048612-I” (L. P´erez-Guti´errez) projects; MICIU/AEI (10.13039/501100011033) and “Fondo Europeo de Desarrollo Regional (FEDER)”/UR financed “PID2022-139344OB-I00” project (A. Palazon); MICIU/AEI/10.13039/ 501100011033 and “El Fondo Social Europeo (FSE) invierte en tu futuro” financed “RYC2018-024183-I” (A. Palazon) and “PRE2020-092342” (P. Velasco-Beltr´ an) grants; AEI financed “RYC2021-031213-I” grant (E. Prieto-Fern´andez), FSE + financed “PRE2022-104817” (J. Etxaniz-D´ ıaz de Durana) predoctoral grant; Ministerio de Ciencia, Innovaci´on y Universidades MICINN: PID2023-146933OB-100 funded by MCIU /AEI /10.13039/501100011033/FEDER, UE, as part of Plan Estatal de Investigaci´on Cient´ıfica y T´ecnica e Innovaci´on (M.L. Mart´ınez-Chantar); MCIN/AEI/ 10.13039/501100011033 financed the grant CEX2021-001136-S (M.L. Mart´ ınezChantar); the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation program financed grant agreement “no 804236” (A. Palazon); the ERC awarded to G. Baier with “ERC-2018-ADG 786462-HOPE” grant; the Provincial Section of Bizkaia and of the Scientific Foundation of the Spanish Association against cancer (AECC) financed “PRDVZ21640DEBL” (A. de Blas) and “PRDVZ1900BOSCH” (A. Bosch) predoctoral grants; the Scientific Foundation of AECC financed “LABAE211744PALA” project (A. Palazon); “La Caixa” Foundation financed the “HR21-00925” (A. Palazon); “La Caixa” Foundation under the program of INPhINIT fellowships financed Doctoral INPhINIT Fellowship – Retaining under the code “LCF/BQ/DR20/11790022” (A. Antoñana-Vildosola); “XVI” BECA FERO (A. Palazon); the Basque Government financed “PRE_2019_1_0320” predoctoral grant (B. Jim´enez-Lasheras) through the “Programa Predoctoral de Formaci´on de Personal Investigador No doctor del Departamento de Educaci´ on,” “2023333027” project (A. Palazon) through the “Programa Ayudas a proyectos de investigaci´on y desarrollo en salud del Departamento de Salud,” and “AF-W1-2019-00012” through Programa Bikaintek (A. Garc´ıa-del R´ıo). Note Supplementary data for this article are available at Cancer Immunology Research Online (http://cancerimmunolres.aacrjournals.org/). Received March 25, 2024; revised January 20, 2025; accepted April 17, 2025; posted first April 22, 2025. AACRJournals.org Cancer Immunol Res; 13(7) July 2025 1019 NEDDylation Regulates CD8 + T-cell Function
References 1. Li W, Li F, Zhang X, Lin H-K, Xu C. Insights into the post-translational modification and its emerging role in shaping the tumor microenvironment. Signal Transduct Target Ther 2021;6:422. 2. Shah K, Al-Haidari A, Sun J, Kazi JU. T cell receptor (TCR) signaling in health and disease. Signal Transduct Target Ther 2021;6:412. 3. Liu J, Cheng Y, Zheng M, Yuan B, Wang Z, Li X, et al. Targeting the ubiquitination/deubiquitination process to regulate immune checkpoint pathways. Signal Transduct Target Ther 2021;6:28. 4. Friend SF, Deason-Towne F, Peterson LK, Berger AJ, Dragone LL. Regulation of T cell receptor complex-mediated signaling by ubiquitin and ubiquitin-like modifications. Am J Clin Exp Immunol 2014;3:107–23. 5. Sun Y, Wei W, Jin J. Cullin-RING ligases and protein neddylation. Singapore: Springer; 2020. VIII. p. 372. 6. Rabut G, Peter M. Function and regulation of protein neddylation. ‘protein modifications: beyond the usual suspects’ review series. EMBO Rep 2008;9: 969–76. 7. Zhou L, Jiang Y, Luo Q, Li L, Jia L. Neddylation: a novel modulator of the tumor microenvironment. Mol Cancer 2019;18:77. 8. Duda DM, Borg LA, Scott DC, Hunt HW, Hammel M, Schulman BA. Structural insights into NEDD8 activation of cullin-RING ligases: conformational control of conjugation. Cell 2008;134:995–1006. 9. Petroski MD, Deshaies RJ. Function and regulation of cullin-RING ubiquitin ligases. Nat Rev Mol Cell Biol 2005;6:9–20. 10. Bailly AP, Perrin A, Serrano-Macia M, Maghames C, Leidecker O, Trauchessec H, et al. The balance between monoand NEDD8-chains controlled by NEDP1 upon DNA damage is a regulatory module of the HSP70 ATPase activity. Cell Rep 2019;29:212–24.e8. 11. Xirodimas DP, Saville MK, Bourdon J-C, Hay RT, Lane DP. Mdm2-mediated NEDD8 conjugation of p53 inhibits its transcriptional activity. Cell 2004;118: 83–97. 12. Oved S, Mosesson Y, Zwang Y, Santonico E, Shtiegman K, Marmor MD, et al. Conjugation to Nedd8 instigates ubiquitylation and down-regulation of activated receptor tyrosine kinases. J Biol Chem 2006;281:21640–51. 13. Zuo W, Huang F, Chiang YJ, Li M, Du J, Ding Y, et al. c-Cbl-mediated neddylation antagonizes ubiquitination and degradation of the TGF-beta type II receptor. Mol Cell 2013;49:499–510. 14. Kim S, Kwon M, Hwang Y, Yoon J, Park S, Kang HC. Stress-induced NEDDylation promotes cytosolic protein aggregation through HDAC6 in a p62dependent manner. iScience 2021;24:102146. 15. Xie P, Peng Z, Chen Y, Li H, Du M, Tan Y, et al. Author Correction: neddylation of PTEN regulates its nuclear import and promotes tumor development. Cell Res 2021;31:374. 16. Xie P, Zhang M, He S, Lu K, Chen Y, Xing G, et al. The covalent modifier Nedd8 is critical for the activation of Smurf1 ubiquitin ligase in tumorigenesis. Nat Commun 2014;5:3733. 17. Guo Z, Wang S, Xie Y, Han Y, Hu S, Guan H, et al. HUWE1-dependent DNAPKcs neddylation modulates its autophosphorylation in DNA damage response. Cell Death Dis 2020;11:400. 18. Lu X, Kong X, Wu H, Hao J, Li S, Gu Z, et al. UBE2M-mediated neddylation of TRIM21 regulates obesity-induced inflammation and metabolic disorders. Cell Metab 2023;35:1390–405.e8. 19. Olaizola P, Lee-Law PY, Fernandez-Barrena MG, Alvarez L, Cadamuro M, Azkargorta M, et al. Targeting NAE1-mediated protein hyper-NEDDylation halts cholangiocarcinogenesis and impacts on tumor-stroma crosstalk in experimental models. J Hepatol 2022;77:177–90. 20. Salon C, Brambilla E, Brambilla C, Lantuejoul S, Gazzeri S, Eymin B. Altered pattern of Cul-1 protein expression and neddylation in human lung tumours: relationships with CAND1 and cyclin E protein levels. J Pathol 2007;213:303–10. 21. Chairatvit K, Ngamkitidechakul C. Control of cell proliferation via elevated NEDD8 conjugation in oral squamous cell carcinoma. Mol Cell Biochem 2007; 306:163–9. 22. Soucy TA, Dick LR, Smith PG, Milhollen MA, Brownell JE. The NEDD8 conjugation pathway and its relevance in cancer biology and therapy. Genes Cancer 2010;1:708–16. 23. Yu J, Huang W-L, Xu Q-G, Zhang L, Sun S-H, Zhou W-P, et al. Overactivated neddylation pathway in human hepatocellular carcinoma. Cancer Med 2018;7: 3363–72. 24. Zhao Y, Morgan MA, Sun Y. Targeting Neddylation pathways to inactivate cullin-RING ligases for anticancer therapy. Antioxid Redox Signal 2014;21: 2383–400. 25. Brownell JE, Sintchak MD, Gavin JM, Liao H, Bruzzese FJ, Bump NJ, et al. Substrate-assisted inhibition of ubiquitin-like protein-activating enzymes: the NEDD8 E1 inhibitor MLN4924 forms a NEDD8-AMP mimetic in situ. Mol Cell 2010;37:102–11. 26. Shi C-S, Kuo K-L, Lin W-C, Chen M-S, Liu S-H, Liao S-M, et al. Neddylation inhibitor, MLN4924 suppresses angiogenesis in huvecs and solid cancers: in vitro and in vivo study. Am J Cancer Res 2020;10:953–64. 27. Torka P, Thiruvengadam SK, Chen L, Wang X, Chen C, Vuong D, et al. Pevonedistat, a Nedd8-activating enzyme inhibitor, in combination with ibrutinib in patients with relapsed/refractory B-cell non-Hodgkin lymphoma. Blood Cancer J 2023;13:9. 28. Saliba AN, Kaufmann SH, Stein EM, Patel PA, Baer MR, Stock W, et al. Pevonedistat with azacitidine in older patients with TP53-mutated AML: a phase 2 study with laboratory correlates. Blood Adv 2023;7:2360–3. 29. Ad` es L, Girshova L, Doronin VA, D´ ıez-Campelo M, Valc´ arcel D, Kambhampati S, et al. Pevonedistat plus azacitidine vs azacitidine alone in higher-risk MDS/chronic myelomonocytic leukemia or low-blast-percentage AML. Blood Adv 2022;6:5132–45. 30. Austin R, Smyth MJ, Lane SW. Harnessing the immune system in acute myeloid leukaemia. Crit Rev Oncol Hematol 2016;103:62–77. 31. Khaldoyanidi S, Nagorsen D, Stein A, Ossenkoppele G, Subklewe M. Immune biology of acute myeloid leukemia: implications for immunotherapy. J Clin Oncol 2021;39:419–32. 32. Peng X, Zhu X, Di T, Tang F, Guo X, Liu Y, et al. The yin-yang of immunity: immune dysregulation in myelodysplastic syndrome with different risk stratification. Front Immunol 2022;13:994053. 33. Wang X, Chen C, Vuong D, Rodriguez-Rodriguez S, Lam V, Roleder C, et al. Pharmacologic targeting of Nedd8-activating enzyme reinvigorates T-cell responses in lymphoid neoplasia. Leukemia 2023;37:1324–35. 34. Best S, Lam V, Liu T, Bruss N, Kittai A, Danilova OV, et al. Immunomodulatory effects of pevonedistat, a NEDD8-activating enzyme inhibitor, in chronic lymphocytic leukemia-derived T cells. Leukemia 2021;35:156–68. 35. Li Y, Zhou H, Liu P, Lv D, Shi Y, Tang B, et al. SHP2 deneddylation mediates tumor immunosuppression in colon cancer via the CD47/SIRPα axis. J Clin Invest 2023;133:e162870. 36. Cheng M, Hu S, Wang Z, Pei Y, Fan R, Liu X, et al. Inhibition of neddylation regulates dendritic cell functions via Deptor accumulation driven mTOR inactivation. Oncotarget 2016;7:35643–54. 37. Serrano-Maci´a M, Lachiondo-Ortega S, Iruzubieta P, Goikoetxea-Usandizaga N, Bosch A, Egia-Mendikute L, et al. Neddylation tunes peripheral blood mononuclear cells immune response in COVID-19 patients. Cell Death Discov 2022;8:316. 38. Kim K, Pr¨obstel A-K, Baumann R, Dyckow J, Landefeld J, Kogl E, et al. Cell type-specific transcriptomics identifies neddylation as a novel therapeutic target in multiple sclerosis. Brain 2021;144:450–61. 39. Palomo-Irigoyen M, P´erez-Andr´es E, Iruarrizaga-Lejarreta M, BarreiraManrique A, Tamayo-Caro M, Vila-Vecilla L, et al. HuR/ELAVL1 drives malignant peripheral nerve sheath tumor growth and metastasis. J Clin Invest 2020;130:3848–64. 40. Castella M, Boronat A, Mart´ın-Ib´añez R, Rodr´ıguez V, Suñ´e G, Caballero M, et al. Development of a novel anti-CD19 chimeric antigen receptor: a paradigm for an affordable CAR T cell production at academic institutions. Mol Ther Methods Clin Dev 2018;12:134–44. 41. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, et al. A thirdgeneration lentivirus vector with a conditional packaging system. J Virol 1998; 72:8463–71. 42. Vogl AM, Phu L, Becerra R, Giusti SA, Verschueren E, Hinkle TB, et al. Global site-specific neddylation profiling reveals that NEDDylated cofilin regulates actin dynamics. Nat Struct Mol Biol 2020;27:210–20. 43. Scharping NE, Rivadeneira DB, Menk AV, Vignali PDA, Ford BR, Rittenhouse NL, et al. Mitochondrial stress induced by continuous stimulation under hypoxia rapidly drives T cell exhaustion. Nat Immunol 2021;22:205–15. 44. Wi´sniewski JR, Zougman A, Nagaraj N, Mann M. Universal sample preparation method for proteome analysis. Nat Methods 2009;6:359–62. 45. Prazanowska KH, Lim SB. An integrated single-cell transcriptomic dataset for non-small cell lung cancer. Sci Data 2023;10:167. 46. Perez-Riverol Y, Bai J, Bandla C, Garc´ ıa-Seisdedos D, Hewapathirana S, Kamatchinathan S, et al. The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res 2022;50: D543–52. 1020 Cancer Immunol Res; 13(7) July 2025 CANCER IMMUNOLOGY RESEARCH Jimenez-Lasheras et al.
47. Andreatta M, Corria-Osorio J, M¨uller S, Cubas R, Coukos G, Carmona SJ. Interpretation of T cell states from single-cell transcriptomics data using reference atlases. Nat Commun 2021;12:2965. 48. Kim N, Kim HK, Lee K, Hong Y, Cho JH, Choi JW, et al. Single-cell RNA sequencing demonstrates the molecular and cellular reprogramming of metastatic lung adenocarcinoma. Nat Commun 2020;11:2285. 49. Jerby-Arnon L, Shah P, Cuoco MS, Rodman C, Su M-J, Melms JC, et al. A cancer cell program promotes T cell exclusion and resistance to checkpoint blockade. Cell 2018;175:984–97.e24. 50. Ma L, Hernandez MO, Zhao Y, Mehta M, Tran B, Kelly M, et al. Tumor cell biodiversity drives microenvironmental reprogramming in liver cancer. Cancer Cell 2019;36:418–30.e6. 51. Zhang Y, Shi C-C, Zhang H-P, Li G-Q, Li S-S. MLN4924 suppresses neddylation and induces cell cycle arrest, senescence, and apoptosis in human osteosarcoma. Oncotarget 2016;7:45263–74. 52. Rosskopf S, Leitner J, Paster W, Morton LT, Hagedoorn RS, Steinberger P, et al. A Jurkat 76 based triple parameter reporter system to evaluate TCR functions and adoptive T cell strategies. Oncotarget 2018;9:17608–19. 53. Battin C, Kaufmann G, Leitner J, Tobias J, Wiedermann U, R¨olle A, et al. NKG2A-checkpoint inhibition and its blockade critically depends on peptides presented by its ligand HLA-E. Immunology 2022;166:507–21. 54. Jutz S, Leitner J, Schmetterer K, Doel-Perez I, Majdic O, GrabmeierPfistershammer K, et al. Assessment of costimulation and coinhibition in a triple parameter T cell reporter line: simultaneous measurement of NF-κB, NFAT and AP-1. J Immunol Methods 2016;430:10–20. 55. Doi TS, Takahashi T, Taguchi O, Azuma T, Obata Y. NF-kappa B RelAdeficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J Exp Med 1997;185:953–61. 56. Vaeth M, Feske S. NFAT control of immune function: New Frontiers for an Abiding Trooper. F1000Res 2018;7:260. 57. Voisin A, Grinberg-Bleyer Y. The many-sided contributions of NF-κB to T-cell biology in health and disease. Int Rev Cell Mol Biol 2021;361:245–300. 58. Meeth K, Wang JX, Micevic G, Damsky W, Bosenberg MW. The YUMM lines: a series of congenic mouse melanoma cell lines with defined genetic alterations. Pigment Cell Melanoma Res 2016;29:590–7. 59. Wang J, Perry CJ, Meeth K, Thakral D, Damsky W, Micevic G, et al. UVinduced somatic mutations elicit a functional T cell response in the YUMMER1.7 mouse melanoma model. Pigment Cell Melanoma Res 2017;30: 428–35. 60. Kassouf T, Shrivastava R, Meszka I, Bailly A, Polanowska J, Trauchessec H, et al. Targeting the NEDP1 enzyme to ameliorate ALS phenotypes through stress granule disassembly. Sci Adv 2023;9:eabq7585. 61. Lobato-Gil S, Heidelberger JB, Maghames C, Bailly A, Brunello L, Rodriguez MS, et al. Proteome-wide identification of NEDD8 modification sites reveals distinct proteomes for canonical and atypical NEDDylation. Cell Rep 2021;34: 108635. 62. Palazon A, Goldrath AW, Nizet V, Johnson RS. HIF transcription factors, inflammation, and immunity. Immunity 2014;41:518–28. 63. Curtis VF, Ehrentraut SF, Campbell EL, Glover LE, Bayless A, Kelly CJ, et al. Stabilization of HIF through inhibition of Cullin-2 neddylation is protective in mucosal inflammatory responses. FASEB J 2015;29:208–15. 64. Zhao Y, Xiong X, Jia L, Sun Y. Targeting Cullin-RING ligases by MLN4924 induces autophagy via modulating the HIF1-REDD1-TSC1mTORC1-DEPTOR axis. Cell Death Dis 2012;3:e386. 65. Weidemann A, Johnson RS. Biology of HIF-1alpha. Cell Death Differ 2008;15: 621–7. 66. The Gene Ontology Consortium. The Gene Ontology Resource: 20 years and still GOing strong. Nucleic Acids Res 2019;47:D330–8. 67. Cao J, Liao S, Zeng F, Liao Q, Luo G, Zhou Y. Effects of altered glycolysis levels on CD8 + T cell activation and function. Cell Death Dis 2023;14:407. 68. Soucy TA, Smith PG, Milhollen MA, Berger AJ, Gavin JM, Adhikari S, et al. An inhibitor of NEDD8-activating enzyme as a new approach to treat cancer. Nature 2009;458:732–6. 69. Zhou L, Lin X, Zhu J, Zhang L, Chen S, Yang H, et al. NEDD8-conjugating enzyme E2s: critical targets for cancer therapy. Cell Death Discov 2023;9:23. 70. Jin H-S, Liao L, Park Y, Liu Y-C. Neddylation pathway regulates T-cell function by targeting an adaptor protein Shc and a protein kinase Erk signaling. Proc Natl Acad Sci U S A 2013;110:624–9. 71. Ma S, Ming Y, Wu J, Cui G. Cellular metabolism regulates the differentiation and function of T-cell subsets. Cell Mol Immunol 2024;21:419–35. 72. Giannone G, Ghisoni E, Genta S, Scotto G, Tuninetti V, Turinetto M, et al. Immuno-metabolism and microenvironment in cancer: key players for immunotherapy. Int J Mol Sci 2020;21:4414. 73. Dai M, Wang L, Yang J, Chen J, Dou X, Chen R, et al. LDHA as a regulator of T cell fate and its mechanisms in disease. Biomed Pharmacother 2023;158: 114164. 74. Gonzalez-Rellan MJ, Fern´andez U, Parracho T, Novoa E, Fondevila MF, da Silva Lima N, et al. Neddylation of phosphoenolpyruvate carboxykinase 1 controls glucose metabolism. Cell Metab 2023;35:1630–45.e5. 75. Zhou Q, Li H, Li Y, Tan M, Fan S, Cao C, et al. Inhibiting neddylation modification alters mitochondrial morphology and reprograms energy metabolism in cancer cells. JCI Insight 2019;4:e121582. 76. Li Y, Zhang R, Hei H. Advances in post-translational modifications of proteins and cancer immunotherapy. Front Immunol 2023;14:1229397. 77. Li W, Qiu S, Chen J, Jiang S, Chen W, Jiang J, et al. Chimeric antigen receptor designed to prevent ubiquitination and downregulation showed durable antitumor efficacy. Immunity 2020;53:456–70.e6. 78. Harris MJ, Chen H, Cai T, Yi Y, Deng Q, Yao Y, et al. Generation of allogeneic CAR T cells through specific degradation of the T cell antigen receptor by E3 ubiquitin ligase fusion proteins. ACS Synth Biol 2022;11:2029–35. 79. Liao X, Li W, Zhou H, Rajendran BK, Li A, Ren J, et al. The CUL5 E3 ligase complex negatively regulates central signaling pathways in CD8 + T cells. Nat Commun 2024;15:603. AACRJournals.org Cancer Immunol Res; 13(7) July 2025 1021 NEDDylation Regulates CD8 + T-cell Function