Protocol for pull-down capture of ubiquitinated and NEDDylated liver proteins from transgenic biotinylated ubiquitin and NEDD8 mice
Abstract
SUMMARYUbiquitination and NEDDylation post-translational modifications (PTMs) areimportant regulatory mechanisms in liver disease. Here, we describe a protocolfor capturing ubiquitinated and NEDDylated proteins by pull-down assay in liversamples from transgenic mouse models of whole-body biotinylated ubiquitin/NEDD8. We describe steps for sample preparation samples, protein immobilization,pull-down assay, and sample final elution. The identification of the hepaticubiquitome and NEDDylome allows a better understanding of the pathophysiologicalmechanisms underlying liver disease
Full text
Protocol Protocol for pull-down capture of ubiquitinated and NEDDylated liver proteins from transgenic biotinylated ubiquitin and NEDD8 mice Ubiquitination and NEDDylation post-translational modifications (PTMs) are important regulatory mechanisms in liver disease. Here, we describe a protocol for capturing ubiquitinated and NEDDylated proteins by pull-down assay in liver samples from transgenic mouse models of whole-body biotinylated ubiquitin/NEDD8. We describe steps for sample preparation samples, protein immobilization, pull-down assay, and sample final elution. The identification of the hepatic ubiquitome and NEDDylome allows a better understanding of the pathophysiological mechanisms underlying liver disease. Publisher’s note: Undertaking any experimental protocol requires adherence to local institutional guidelines for laboratory safety and ethics. L. Estefanı ´a Zapata-Pavas, Teresa C. Delgado, Marı ´a Luz Martı ´nezChantar [email protected] Highlights Preparation of hepatic proteins from biotinylated ubiquitin (Ub) and NEDD8 mice Immobilization of biotinylated hepatic proteins to streptavidin-enriched agarose beads Pull-down for capture of hepatic biotinylated ubiquitinated and NEDDylated proteins Zapata-Pavas et al., STAR Protocols 6, 103697 June 20, 2025 ª2025 The Author(s). Published by Elsevier Inc. https://doi.org/10.1016/ j.xpro.2025.103697 ll OPEN ACCESS
Protocol Protocol for pull-down capture of ubiquitinated and NEDDylated liver proteins from transgenic biotinylated ubiquitin and NEDD8 mice L. Estefanı ´a Zapata-Pavas, 1,5 Teresa C. Delgado, 2,3 and Marı ´a Luz Martı ´nez-Chantar 1,4,6, * 1 Liver Disease Lab, Center for Cooperative Research in Biosciences (CIC bioGUNE), Basque Research and Technology Alliance (BRTA), 48160 Derio, Spain 2 Metabolic Liver Diseases Laboratory, Biobizkaia Health Research Institute, 48093 Barakaldo, Spain 3 IKERBASQUE, Basque Foundation for Science, 48009 Bilbao, Spain 4 Centro de Investigacio ´n Biome ´dica en Red de Enfermedades Hepa ´ticas y Digestivas (CIBERehd), Carlos III National Health Institute, 28029 Madrid, Spain 5 Technical contact 6 Lead contact *Correspondence: [email protected] https://doi.org/10.1016/j.xpro.2025.103697 SUMMARY Ubiquitination and NEDDylation post-translational modifications (PTMs) are important regulatory mechanisms in liver disease. Here, we describe a protocol for capturing ubiquitinated and NEDDylated proteins by pull-down assay in liver samples from transgenic mouse models of whole-body biotinylated ubiquitin/ NEDD8. We describe steps for sample preparation samples, protein immobilization, pull-down assay, and sample final elution. The identification of the hepatic ubiquitome and NEDDylome allows a better understanding of the pathophysiological mechanisms underlying liver disease. For complete details on the use and execution of this protocol, please refer to Gil-Pitarch et al. 1 BEFORE YOU BEGIN Institutional permissions All animal experiments were performed according to the ARRIVE guidelines, following instructions from the European Research Council for animal care, after approval by the CIC bioGUNE Institutional Animal Welfare and Ethics Committee. The bio Ub, bio NEDD8 and BirA animals are transgenic mouse models currently bred at the CIC bioGUNE institution’s animal facilities. CRITICAL: This is a reminder to readers that it is necessary to acquire permissions from the relevant institutions ahead of time as any experiments on live vertebrates or higher invertebrates must follow relevant institutional and national guidelines and regulations. Generation of the bio Ub transgenic mice The bio Ub mouse model generation was described in an earlier publication. 2 Briefly, the (bioUb) 3 -BirA construct was prepared as previously described. 3 This was subcloned into the pCAG564 vector (which includes the CAG promoter, composed of the CMV immediate enhancer, b-actin and b-globin promoter sequences) between EcoRI and ClaI sites using the oligos bioUb f (CGTTAACAGATCTGCTCTT CACCATGGGTTTGAATGAC), and bioUb r (GTCATTCAAACCCATGGTGAAGAGCAGATCTGTT AACG). (C57Bl6xCBA) F1 3(C57Bl6xCBA) F1 pronuclear zygotes were injected with 2ng/mLofpurified STAR Protocols 6, 103697, June 20, 2025 ª2025 The Author(s). Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). 1 ll OPEN ACCESS
plasmid by QIAGEN PCR column. Positive founders of each line were identified by PCR using the previous primers (Figure 1). Generation of bio NEDD8 transgenic mice The bio NEDD8 mice transgenic models were described in an earlier publication. 4 Briefly, the pCAG564 vector was subcloned with bio NEDD8 human sequence or BirA using oligos: BirA f (50-GAGCCGACAAGGTGAGAGTG-30), BirA r (50-TTGATTCCGGCTCCGATCAC-30), bioNEDD8 f (50-GATATCGCTGCGCTGGTC-30), and bioNEDD8 r (50-CATCGATCCCCAAGAAAACC-30). Using QIAGEN vector purification columns, the plasmids were purified and subsequently injected in pronuclear zygotes (C57Bl6xCBA) with 2 ng/mL of each. Animals that were positive to the plasmid were used to establish the mice colony (Figure 1). Liver injury models in transgenic mice expressing bio Ub, bio NEDD8 and in the BirA control reporter mouse Note: Group size depends on the type of injury and the disease model to study. The number of animals to use for each group depends on the biological variability associated with the different models of liver injury, and past literature and power analysis should be used to select the number of animals per group. According to our experience, at least 5 animals per group are recommended. The BirA mice, transgenic mice with genomic insertion of the BirA enzyme but without the bioUb or bioNEDD8 sequence fused, are used as a control mouse report, to exclude unspecific ubiquitinated or NEDDylated proteins from our analysis. Otherwise, the bio Ub mice are transgenic mice that express biotinylated ubiquitin, allowing the selective capture of the ubiquitinated proteins in the liver using the strength of the biotin and streptavidin (NeutrAvidin) interaction. Likewise, the bio NEDD8 Figure 1. Schematic illustration of the transgenic constructs for the biotinylated ubiquitin ( bio Ub) and biotinylated NEDD8 ( bio NEDD8) and BirA mice The transgenes contain the CAG promoter (CMV, ß actin, and globin), the open reading frame, and the SV40 polyadenylation signal. Restriction sites used for construct insertion are indicated. The control BirA mouse expresses the bacterial BirA enzyme only, while the bio Ub mice express a single polypeptide encoding three tagged ubiquitin chains fused to BirA. The bio NEDD8 mice express a single polypeptide encoding one tagged NEDD8 chain fused to BirAOPT (encodes the same protein as BirA WT, but the gene is human-codon-optimized whereas the gene encoding BirA WT is a bacterial sequence). ll OPEN ACCESS 2STAR Protocols 6, 103697, June 20, 2025 Protocol
mice express biotinylated NEDD8, allowing the selective capture of the ubiquitinated proteins in the liver using the strength of the biotin and streptavidin (NeutrAvidin) interaction. The BirA, bio Ub and the bio NEDD8 mice present phenotypes similar to wild-type ageand body-weight-matched mice and are equally susceptible to suffering from liver disease after a well-described stimulus. To date, the following stimuli have been studied in these animal models and are described in the respective publications: Carbon tetrachloride (CCl 4 )-induced liver fibrosis, 5 acetaminopheninduced liver injury, 1 and metabolic stress. 4 In vivo: 4 weeks of a diet deficient in choline and methionine (a mouse model of metabolic-dysfunction associated steatotic liver disease (MASLD) (unpublished data), 360 mg/kg of intraperitoneal injection of acetaminophen (APAP) to induce drug-induced liver injury (DILI), 1 caloric restriction 4 and 6 weeks of intraperitoneal injection of carbon tetrachloride (CCl 4 ) to induce liver fibrosis. 5 In vitro: Treatment to isolated mouse hepatocytes with APAP for 24 h. 1 In addition, we can evaluate theeffectofdifferentdrugsontheremodelingoftheliverubiquitomeandNEDDylomeonthese models of liver injury. 1. House bio Ub, bio NEDD8andBirAmiceinacageof4–5micepercageinatemperature-controlled (20C–22C) room on a 12-h light/dark cycle. Collection of liver samples from transgenic bio Ub, bio NEDD8 and BirA mice Timing: 15 min At the experimental endpoint, the bio Ub, bio NEDD8 and BirA mice are euthanized by humane methods for the collection of the liver tissues. 2. Anesthetize animals in an isoflurane anesthesia chamber (1.5% isoflurane in O 2 ) and euthanize them by cervical dislocation. Alternatives: Animals can be euthanized by CO 2 inhalation. 3. Transfer the mouse from the anesthesia chamber to the dissection table in the supine position. 4. Perform celiotomy to expose the internal organs. 5. Use surgical scissors to cut the liver away from the diaphragm. Work your way back to the dorsal side, cutting the liver away from other abdominal organs and from the dorsal side of the abdominal wall. 6. Rapidly, place the mouse liver on a petri dish and carefully remove the gallbladder. 7. Take a piece of the liver and place it in a labeled cryotube immediately submerging it in liquid nitrogen for rapid freezing. CRITICAL: At least 200 mg of liver sample should be used for the pull-down assay. From our experience, we have realized that it is easier to weigh the piece of liver in fresh tissue and then freeze the separated and weighted piece of tissue in a labeled cryotube, registering the exact weight. Note: Usually, it is preferable to use liver samples from the same lobe and in this case, the most attractive option is the left and largest lobe due to its size. 8. Liversamplescanbekeptat80C until further analysis. ll OPEN ACCESS STAR Protocols 6, 103697, June 20, 2025 3 Protocol
Isolation of hepatocytes from transgenic bio Ub, bio NEDD8 and BirA mice Timing: 1.5 h for hepatic perfusion Timing: Hepatocyte sub-culture time depends on the experimental protocol of choice Although the information on the whole liver ubiquitome and NEDDylome is relevant, quite often it is important to understand the specific role of the hepatocyte ubiquitome and NEDDylome in driving liver disease. For this purpose, we can isolate primary mouse hepatocytes from the in vivo animal models of liver injury in the bio Ub and bio NEDD8 mice or in the alternative, isolate hepatocytes from bio Ub and bio NEDD8 without any treatment, treat them in vitro with our compounds of interest (e.g., Ethanol, APAP, and others) and then capture the hepatocytes’ specific ubiquitome and NEDDylome by pull-down assay. Moreover, other hepatic cell types can be isolated and used, although we have to take into consideration the number of cells that can be isolated from each animal and the usually large number of cells that are necessary to obtain a quantifiable amount of ubiquitin or NEDD8-modified proteins after the pull-down assay. Liver collagenase perfusion 9. Anesthetize animals in an isoflurane anesthesia chamber (1.5% isoflurane in O 2 ). 10. Transfer the mouse from the anesthesia chamber to the perfusion table in the supine position. 11. Placethenoseofthemouseintoanoseconeandtapethepawsdown. 12. Perform a toe pinch test to confirm the absence of all pain reflexes. 13. Perform celiotomy to expose the internal organs. 14. Use a cotton-tipped applicator to clear the small and large intestines covering the portal vein. 15. Cannulate the portal vein with a 22G catheter. CRITICAL: When inserting the catheter, keep the bevel pointed up. Enter the portal vein at no more than a 15angle. Secure the catheter carefully, or sutures could be placed to secure the catheter. 16. Start liver perfusion with 20 mL of buffer I. Note: Buffer I is kept in a water bath at a temperature around 38C–40C so that the buffer temperature at the extremity of the perfusion pump is 37C. a. Immediately cut the vena cava. b. Perfuse the liver with 30–50 mL buffer II for washing and then 30–50 mL of buffer III. Note: Buffers II and III are kept in a water bath at a temperature around 38C–40Csothatthe buffer temperature at the extremity of the perfusion pump is 37ºC. c. Hold the perfusion rate constant at 1.7 mL/min. Alternatives: The vena cava can be cannulated and the portal vein cut, obtaining the same yield of hepatocytes. CRITICAL: During the infusion of buffer I, it is important to observe a change in the color of the liver to confirm that the portal vein is correctly catheterized. Finally, with buffer III perfusion containing collagenase, the liver is digested, and the perfusion’s ending point depends on the perfused liver’s initial state. As a general rule, perfusion should be ended when a mark imposed by forceps impression in the perfused liver is not recovered (Figure 2). ll OPEN ACCESS 4STAR Protocols 6, 103697, June 20, 2025 Protocol
17. Place the liver in a Petri dish after careful removal and the gall bladder is withdrawn. 18. Disaggregate the liver with forceps in complete cell media maintained in ice. 19. Filter the digested liver through sterile gauze. 20. Transfer the digested liver to a 50 mL sterile tube. 21. Place the tube with the cells on ice. Hepatocyte isolation from digested liver and hepatocyte culture conditions After finishing liver perfusion in the animal facilities, the 50 mL tubes containing the cells were placed in ice and taken to the cell culture room for the next steps. From now on all the protocol is carried out in cell culture laminar flow hoods. 22. Centrifuge digested livers at 31 g for 4 min at 25C. 23. Remove the supernatant. 24. The pellet composed of hepatocytes is resuspended in fresh complete cell media kept on ice. 25. Perform two additional washes with complete media followed by centrifugations at 48 g at 25C for 5 min. 26. Count the hepatocytes by using a Neubauer chamber and the light microscope. 27. Plate the hepatocytes on collagen-coated plates (*) using complete cell media. CRITICAL: Hepatocytes should be kept in the complete medium until attachment to the plate (usually 2–3 h) before changing to other experimental media or potential treatments depending on the study protocol. For longer studies, hepatocytes should be cultured with supplements that halt the dedifferentiation process (e.g., insulin and corticoids). For obtaining an amount of protein extract from hepatocytes suitable for the pull-down assay, at least 5-10 310 5 hepatocytes should be used for each experimental condition. In our hands, we usually use 100 mm cell dishes where we plate 5-10 310 5 hepatocytes in 2 mL cell media. The number of experimental replicas depends on the biological variability of the model of study. Usually, at least three replicas are used for experimental conditions. Note: Usually, from a healthy adult mouse, 50 to 70 million hepatocytes can be recovered after liver perfusion. Under these circumstances, cell viability superior to 90%, as assessed by Figure 2. Representation of the different steps involved in liver perfusion (A) First schematic representation of the animal is placed in a supine position. (B) The vena cava is cannulated. (C) Change of liver color after starting the buffers perfusion. (D) Example picture of perfused liver in the Petri dish and disaggregation. ll OPEN ACCESS STAR Protocols 6, 103697, June 20, 2025 5 Protocol
trypan blue staining, is usually considered an indication of successful liver perfusion. However, under some conditions of liver injury, hepatocytes are injured and do not survive the perfusion stress, and a lower yield of hepatocytes is expected. For these cases, it is often recommended to perform a Percoll centrifugation to eliminate the dead cells before counting and plating. Alternatives: (*) Collagen-coated plates can be commercially available or in alternative regular cell dishes can be collagenized in house with the collagen solution (0.1% (w/v) collagen in 0.1 M acetic acid). Briefly: a. Add 1 mL to this solution to 100 mm cell dishes in the cell hood. b. Leave cell dishes closed with the collagen solution for 1 h in the cell hood at 25C. c. Aspirate the collagen solution. d. Wash once with 13PBS. e. Aspirate the 13PBS. f. Let dry the opened cell plates in the cell hood for 30 min at 25C. g. Close the cell plates. The closed sterile collagen-coated plates are ready to use and can be kept at 4Cforone month. 28. Transfer the plated hepatocytes to a cell culture incubator at 37Cand5%CO 2 . Alternatives: Hepatocytes can be placed in incubators with different conditions or hypoxia chambers in case this is of interest for the proposed study. Note: After the treatment of choice, depending on the model used to induce liver damage (e.g., treatment with cell media rich in fat, sugars or deprived of amino acids, 6 stimulation with acetaminophen 7 or alcohol, 8 among others), cells are washed with 13PBS and after aspiration cells can be frozen until further analysis. KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-biotin, HRP-linked (1:500 dilution) Cell Signaling Technology Cat# 7075S Experimental models: Cell lines Primary mouse hepatocytes isolated from bio Ub and bio NEDD8 mice As described in the protocol N/A Experimental models: Organisms/strains Mouse: bio Ub (homozygous genotypes; gender and age depending on the study) In-house 1 N/A Mouse: bio NEDD8 (homozygous genotypes; gender and age depending on the study) In-house 1 N/A Mouse: BirA (homozygous genotypes; gender and age depending on the study) In-house 1 N/A Other Homogenization microtubes (micro packaging vial + MPV closure, low profile green) Thermo Scientific Cat# 342800-0020; Cat# 362821-0114 1.4 mm zirconium oxide beads Bertin Technologies Cat# P000927-LYSK0-A.0 Precellys 24 tissue homogenizer Bertin Technologies RRID:SCR_022979 High capacity NeutrAvidin agarose resin Thermo Scientific Cat# 29204 PD-10 columns containing Sephadex G-25 Cytiva Cat# 170851101 0.8 mm polyethersulfone (PES) clarifying filters (Vivaclear MINI) Sartorius Stedim Cat# VK01P042 Tissue-culture treated culture dishes Corning Cat# CLS430167 Bottle-top vacuum filter system Corning Cat# CLS431153 Counting chamber Neubauer pattern BRAND Cat# BR718605 (Continued on next page) ll OPEN ACCESS 6STAR Protocols 6, 103697, June 20, 2025 Protocol
MATERIALS AND EQUIPMENT Before preparing the key buffers outlined in the protocol, it is essential to prepare stock solutions for the necessary buffers. These include 10% phosphate-buffered saline (PBS), sodium n-dodecyl sulfate (SDS), and 0.05% Tween-PBS. These stock solutions are used for the preparation of the following buffers and their previous preparation will streamline the buffer preparation process and facilitate an efficient workflow in the laboratory. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Lab roller rotator ‘‘Orbit’’ J.P. Selecta Cat# 3000445 Microcentrifuge Heraeus Biofuge Pico Refrigerated microcentrifuge Beckman Coulter Microfuge 22R Centrifuge Beckman Coulter Allegra X-22 Cell scrapers Corning Cat# CLS3010 Collagenase, type 1 Worthington Biochemical Cat# LS004196 N-ethylmaleimide (NEM) Sigma-Aldrich Cat# 04260 Protease inhibitor cocktail (PI) Sigma-Aldrich Cat# P8340 Fetal bovine serum (FBS) Gibco Cat# A5670701 Minimum essential medium (MEM) Gibco Cat# 11090081 Antibiotic-antimycotic (1003) Gibco Cat# 15240062 L-glutamine (1003) Gibco Cat# 25030081 10% phosphate-buffered saline (PBS) Reagent Amount Final concentration NaCl (Sodium chloride) 80 g 1.37 M KCl (Potassium chloride) 2 g 0.027 M Na 2 HPO 4 (Sodium phosphate dibasic, anhydrous) 14.4 g 0.1 M KH 2 PO 4 (Potassium phosphate monobasic) 2.4 g 0.018 M MilliQ-H 2 O up to 1 L N/A Total 1 L 103 Store at room temperature for up to 6 months or at 4C for up to 1 year. It is essential to adjust the pH to 7.4. Filter the solution using 0.22 mm filters after preparation. 20% sodium n-dodecyl sulfate (SDS) Reagent Amount Final concentration SDS (Sodium Dodecyl Sulfate) 20 g 20 g/L MilliQ-H 2 O up to 100 mL N/A Total 100 mL 20% Store at room temperature for up to 1 year. If SDS does not dissolve readily at room temperature, you can heat the solution gently (do not exceed 60C). Avoid boiling. Filter the solution using 0.22 mm filters after preparation. Tween-PBS Reagent Amount Final concentration Tween 100 0.05 mL (50 mL) 0.05 g/mL PBS up to 100 mL 13 Total 100 mL 0.05% Store at room temperature for up to 1 or 2 weeks. For extended storage, the solution can last up to 1 month at 4C. Filter the solution using 0.22 mm filters after preparation. ll OPEN ACCESS STAR Protocols 6, 103697, June 20, 2025 7 Protocol
103perfusion stock buffer Reagent Amount Final concentration D-Glucose 39.7 g 3.97% NaCl (Sodium chloride) 71.4 g 7.14% KCl (Potassium chloride) 3.7 g 0.37% NaHCO 3 (Sodium bicarbonate) 21 g 13 MilliQ-H 2 O up to 1 L N/A Total 1 L 103 Store at 4C for up to 1 month. Filter the solution using 0.22 mm filters after preparation. 13perfusion stock buffer – perfusion buffer II Reagent Amount Final concentration 103Perfusion Stock Buffer 50 mL 13 0.2 M KH 2 PO 4 (potassium dihydrogen phosphate) 3 mL 1.2 mM 0.2 M MgSO 4 (7H 2 O) (magnesium sulfate heptahydrate) 4 mL 1.6 mM MilliQ-H 2 O up to 500 mL N/A Total 500 mL 13 Do not store, prepared immediately to use. To speed up the process, the preparation can be placed in a water bath or heated to 37C under stirring to ensure complete solubilization. Adjust the pH to 7.4 at 37C. Filter the solution using 0.22 mm filters after preparation. Perfusion buffer I Reagent Amount Final concentration 13Perfusion Stock Buffer 160 mL 13 5 mM EGTA 200 mL 6.25 mM Total 160 mL N/A Do not store, prepared immediately to use. Adjust the pH to 7.4 at 37C. Filter the solution using 0.22 mm filters after preparation. Perfusion buffer III Reagent Amount Final concentration 13Perfusion Stock Buffer 160 mL 13 CaCl 2 (Calcium chloride) 0.045 g 0.003 M Collagenase type I 50 mg 0.05 mg/mL Total 100 mL N/A Do not store, prepared immediately to use. Adjust the pH to 7.4 at 37C. Filter the solution using 0.22 mm filters after preparation. Add the collagenase type I prior to use and after filtration. Hepatocytes complete cell media Reagent Amount Final concentration Minimum Essential Medium (MEM) 450 mL N/A Fetal Bovine Serum (FBS) 50 mL 10% L-Glutamine (1003) 5 mL 1% Antibiotic-Antimycotic (1003) 5 mL 1% Total 500 mL N/A Store supplemented media at 2C–8C for up to 4–6 weeks, or aliquot and freeze at 20C (or 80C for long-term storage), avoiding repeated freeze-thaw cycles. Filter the solution using 0.22 mm filters after preparation. Wash buffer 1 Reagent Amount Final concentration Urea 153 g 8.4 M 103PBS 30 mL 13 (Continued on next page) ll OPEN ACCESS 8STAR Protocols 6, 103697, June 20, 2025 Protocol
Protein immobilization Timing: 3 h This part of the protocol explains how to immobilize the proteins in the lysed samples to the NeutrAvidin agarose beads. 38. Add the NeutrAvidin agarose beads suspended in the binding buffer to the tubes containing the samples (derived from step 24 for liver tissues or step 30 for cell samples), mixing slightly by inversion. Note: In the case of tissues these will be 15 mL Falcon tubes and for cells add to the Eppendorf tubes (see problem 4,troubleshooting section). 39. Place the Falcons or the Eppendorf tubes in the lab roller rotator rotating at 10 rotations per minutefor2hat25 C. Alternatives: Immobilization can be done by rotation at 10 rotations per minute for 16 h at 4C. Note: Use this time to prepare three sets of Eppendorf tubes: one set labeled as flow-through (FT), another as pull-down (PD), and one unlabeled but numbered. Place the polyether sulfone (PES) on top of each Eppendorf tube labeled with numbers - see problem 3,troubleshooting section). 40. Centrifugethe15mLFalcontubesat630gfor5minat25 C. 41. Transfer 1 mL of the supernatant in the case of tissues and 50 mL of the supernatant in the case of cells to FT labeled Eppendorf tube and discard the rest. Note: ThisFTfractioncanbeusedtoconfirmthatbiotinylated proteins are not lost in the immobilization process and that a great majority of the biotin-tagged proteins are immobilized to our NeutrAvidin agarose beads at this step. Pull-down assay (washing step) Timing: Approximately 2 h (depending on the number of samples and persons involved in the sample handling) The pull-down assay is used for the isolation of specific proteins. In our case, we immobilize the biotinylated proteins in the NeutrAvidin agarose beads and then proceed to a series of stringent washing steps to remove non-biotinylated proteins and take advantage of the strength between streptavidin and biotin. The washing process consists of discarding the supernatant, adding the appropriate buffer, resuspending or mixing by inversion (without foaming), centrifuging at 630 g for 1 min twice (1 min on one side, then rotating the Eppendorf 180and centrifuging for another minute to ensure the pellet is upright). Note: From this point, all the centrifugations are carried out at 25C. 42. Add 1 mL WB1 to the samples by using a P1000 pipette in the falcons or Eppendorf tubes and resuspend the pellet. ll OPEN ACCESS STAR Protocols 6, 103697, June 20, 2025 15 Protocol
Note: For the tissue samples that are on falcons, transfer samples to sterilized labeled Eppendorf tubes, carefully transferring all the beads. After transferring the whole samples and NeutrAvidin agarose beads, add 1 mL of WB1 to the respective 15 mL Falcon tube to ensure that all beads that may remain are transferred to the corresponding Eppendorf tube and resuspend by inversion. CRITICAL: Best to cut the tip ends of P200 or use the P1000 large tips. 43. Centrifuge at 630 g for 1 min. a. Rotate the tubes. b. Centrifuge again. 44. Discard the supernatant. 45. Add1mLofWB1totherespective15mLFalcontubetoensurethatallbeadsthatmayremain are transferred to the corresponding Eppendorf tube, and resuspend by inversion – Centrifuge at 630 g for 1 min. 46. Discard the supernatant. CRITICAL: All the washes from now on follow the same protocol: add buffer, centrifugation, and supernatant removal. 47. Add the buffer for the next wash. From now on, all washes will include WBn, and the steps are as follows: a. WB1 x2. b. WB2 x3. c. WB3 x1. Note: At this point, take out the aliquot of DTT to thaw. d. WB4 x3. e. WB1 x1. f. WB5 x1. Note: Prepare the elution buffer at this moment. g. WB6 x3. h. WB7 x1. CRITICAL: Step h is optional and should only be done if samples are going to be analyzed by mass spectrometry. Note: Turn on the Thermoblock at 95C. 48. After the last wash, remove as much supernatant as possible with a pipette. Sample final elution Timing: 45 min This corresponds to the last step of the pull-down assay where we obtain the pull-down (PD) fraction uniquely enriched in biotinylated proteins. For this we have to separate the agarose beads from the attached biotinylated proteins, which is achieved by using an elution buffer and heat, followed by a filter separation. ll OPEN ACCESS 16 STAR Protocols 6, 103697, June 20, 2025 Protocol
49. Add 125 mL of the Elution Buffer per tissue sample and 50 mL of the Elution Buffer per cell sample. 50. Mix by inversion. 51. Place it on the lab rotator at 10 rotations per minute at 25C for 10 min. 52. Centrifuge at 4000 g for 1 min at 25C. 53. Place Eppendorf tubes containing the samples and agarose beads in the Thermoblock at 95C for 5 min. 54. Transfer the volume to the previously PES filters placed in the Eppendorf tubes. CRITICAL: Do this next to the Thermoblock using a P1000 or P200 with the tip cut off, placing the volume over the filter (see problem 4,troubleshooting section). 55. Centrifuge at 13250 g for 10 min to separate the eluted proteins from the beads. 56. Remove the filter and close the Eppendorf tube. Note: This pull-down (PD) fraction can be used directly for running Western blot or sent for mass spectrometry analysis or, or it can be kept at 80C until further analysis. EXPECTED OUTCOMES The bio Ub and the bio NEDD8 mice are transgenic mice that express either biotinylated ubiquitin or NEDD8. As the ubiquitinated and NEDDylated modified proteins in these mice are biotinylated, this allows us to take advantage of the strength of the streptavidin-biotin to selectively capture the ubiquitinated or NEDDylated proteins in the liver. Moreover, as these animals are susceptible to liver injury, we can induce injury in these transgenic mice, for example, through the administration of diets or toxicological agents, and in this way profile the liver ubiquitome and NEDDylome rearrangement underlying liver disease. This is important to obtain a better knowledge of the pathological mechanisms that trigger and drive liver disease progression and also to gain knowledge on novel biomarkers and potential therapeutic targets. With the pull-down assay protocol described here, we obtain a series of samples that are INPUT, flow-through (FT), and PD (pull-down). The efficacy of the pull-down assay can be evaluated by undertaking a Western blot of biotin and comparing the smear of biotin. Theoretically, the FT fraction should be without a biotin label and the PD fraction with a higher enrichment than the INPUT fraction. In Figure 3A we can find a representation of the Western blot for biotin in input, flow-through, and elution samples for a pull-down performed in liver tissues. An enrichment in biotin in the elution sample is observed. In this case, liver tissues are derived from bio NEDD8 mice implying that the biotinylated material isolated corresponds to proteins that are NEDDylated. For the pull-down assay, it is important to have replicas to account for the biological variability of the mouse models. In addition, a parallel pull-down in samples of mice where ubiquitin and NEDD8 are not tagged with biotin is important to remove unspecific proteins that may attach to the agarose beads without being biotinylated. Finally, for the analysis of the ubiquitinated proteome and NEDDylome, we can look for a specific protein of interest by performing a Western blot analysis with the antibody of interest in the elution end samples or by performing mass spectrometry analysis to identify a molecular signature in the elution samples (Figures 3B and 3C). Even though these techniques are out of the scope of this protocol is important to mention them as an application of the protocol. LIMITATIONS Pull-down assays show intra-assay some variability. Thus, samples must be compared when the pulldown assay is performed simultaneously to avoid differences attributable to small variations in the protocol. This implies some limitations with the number of samples one can manage simultaneously. ll OPEN ACCESS STAR Protocols 6, 103697, June 20, 2025 17 Protocol
In our experience, simultaneously handling 24 samples (the usual maximum capacity of bench centrifuges) is feasible. The elution samples of the models of interest should be compared amongst conditions and after correction by using an animal model without enrichment in biotinylated ubiquitin or NEDD8, such as wild-type animals or the BirA animals, as previously explained. In addition, this protocol does not consider the genomic copies of Ubiquitin and NEDD8 which might also be attached to the cellular proteins and go undetected since they won’t bind streptavidin. And finally, at the moment, our reported studies have been limited to drug administration and dietary or surgical animal models. The crossing of bio Ub or bio NEDD8transgenicmicewithothertransgenic mouse models has not been optimized by our group. TROUBLESHOOTING Problem 1: Optimization of buffer preparation The preparation of the buffers is time-consuming due to the high amount and complexity of each solution to prepare and the number of solutions necessary. Figure 3. Summary figure of the expected outcomes from a protocol to isolate the hepatic ubiquitinated/ NEDDylated proteome by streptavidin bead pull-down assay of liver samples from transgenic mice with biotinylated Ubiquitin/NEDD8 (A) The pull-down assay results in enrichment in biotinylated samples in the elution fraction of the bio Ub mice relative to the BirA mice. After performing a pull-down assay in bio NEDD8 mice subjected to different stimuli, in this case, acetaminophen (APAP) stimulation versus treatment with a pharmacological NEDDylation inhibitor MLN4924 we can perform untargeted mass spectrometry analysis to identify the NEDDylated proteins that are differentially expressed, here represented as a heatmap (B) and then validate these findings, namely for the protein TAM41 by Western blot analysis (C). These results were recently published in a manuscript by Gil-Pitarch et al. 1 ll OPEN ACCESS 18 STAR Protocols 6, 103697, June 20, 2025 Protocol
Potential solution Prepare the necessary buffers the day before the experiment, except for the reagents that have to be added before use as highlighted in the tables in the materials and equipment section. Problem 2: Difficulties with the preparation of the buffers Buffer 1 containing high amounts of urea is difficult to solubilize. Potential solution Washing buffer 1 is difficult to solubilize due to the high amounts of urea. It is preferable to prepare this buffer in a crystal vase or bottle so it can be heated with a hot plate to facilitate the urea dissolution. Alternatively, urea can be solubilized by leaving the buffer on agitation for a long period. Problem 3: Labeling of the tubes The pull-down protocol is characterized by multiple washing steps, including washing with buffers containing alcohol (washing buffer 4), which can result in the erasing of each tube labeling. Potential solution To limit the chance of erasing the labeling, it is best to use alcohol-proof permanent markers to label the plastic tubes. Moreover, it is best to keep it simple and just number the tubes as 1, 2, 3, .instead of writing a complete description of each sample. Under these circumstances, a list of samples should be written and saved properly. Problem 4: An erroneous amount of streptavidin beads added to each sample The streptavidin beads are provided as a slurry solution, which is difficult to pipette. This sometimes results in an inaccurate number of beads distributed for each sample. Potential solution Always prepare an extra quantity of streptavidin beads for each experiment. As a working rule, consider the number of samples you have (n) and prepare the beads for (n+1). To pipette the slurry bead solution, it is best to use a P1000 pipette or cut the P200 pipette tip end. Problem 5: Not enough material in the elution Not always the amount of isolated biotinylated material give a good yield. This is particularly true for the bio NEDD8micemodelsduetothelowabundanceofNEDDylatedproteinscomparedtothe ubiquitinated proteins in biological samples. See an example of an SDS-PAGE gel after trypsin digestion for samples isolated from the bio Ub and the bio NEDD8mice.Thenumberofisolatedproteins in the samples derived from the bio NEDD8 mice is very reduced as compared to the proteins observed in the Coomassie stain of the samples from the bio Ub mice (Figures 4A and 4B). Potential solution Under these circumstances, the step of the column purification may be dismissed as material is sometimes lost in this process. Alternatively, we can increase the amount of material used for the pull-down assay, both mouse liver tissue and cell hepatocytes. This means that incasewedon’tobtainsufficientbiotinylated proteins we can increase the amount of liver tissue used or use larger cell dishes that can take more than 10 310 5 hepatocytes. ll OPEN ACCESS STAR Protocols 6, 103697, June 20, 2025 19 Protocol
RESOURCE AVAILABILITY Lead contact Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Marı ´a Luz Martı ´nez-Chantar ([email protected]). Technical contact Technical questions on executing this protocol should be directed to and will be answered by the technical contact, L. Estefanı ´a Zapata-Pavas ([email protected]). Materials availability The transgenic bio Ub and bio NEDD8 mice are currently bred at the CIC bioGUNE animal facilities and their availability for collaborative studies can be consulted with the lead contact. Date and code availability This study did not generate/analyze datasets/codes. ACKNOWLEDGMENTS L.E.Z.-P. is funded by PhD fellowship PRDVZ233980ZAPA from the Provincial Section of Bizkaia from the Scientific Foundation of the Spanish Association Against Cancer. T.C.D. is funded by ‘‘Ayuda RYC2020-029316-I financiada por MCIN/ AEI/10.13039/501100011033 y por El FSE invierte en tu future.’’ This work was supported by grants from the Ministerio de Ciencia, Innovacio´ n y Universidades (MICINN: PID2020-117116RB-I00, CEX2021-001136-S, and PID2023146933OB-100 funded by MCIU/AEI/10.13039/501100011033/FEDER, UE, as part of Plan Estatal de Investigacio´ n Cientı ´fica y Te´ cnica e Innovacio´ n) (to M.L.M.-C.); project funded by CIBEREHD; La Caixa Scientific Foundation (HR17-00601) (to M.L.M.-C.); Instituto Carlos III, Spain (to M.L.M.-C.); and the Scientific Foundation of the Spanish Association Against Cancer within the coordinated projects program 2022 through the project IGTP-AECC_2022-042/PRYCO223102ARME: ‘‘Precision medicine for hepatoblastoma: identification of novel therapies and predictive biomarkers using a unique EU biorepository (PMed4HB).’’ This work was also supported by a grant from the Ministerio de Ciencia, Innovacio´nyUniversidades (MICINN: PID2022-139395OB-100 integrado en el Plan Estatal de Investigacio´ n Cientı ´fica y Te´ cnica e Innovacio´ n, con Fondos FEDER) and the Gilead Sciences Research Scholars Program in Global Liver (to T.C.D.). And finally, we acknowledge financial support from ‘‘Proyectos de investigacio´ n y desarrollo (I + D) de Potenciacio´ n de la investigacio´nensaluddecara´cter estrate´ gico, presentadas a la Convocatoria 2023’’ with reference 2023333001 from the Health Department of the Basque Country (to T.C.D. and M.L.M.-C.). AUTHOR CONTRIBUTIONS L.E.Z.-P., T.C.D., and M.L.M.-C. participated in the writing, reviewing, and editing. Figure 4. Coomassie blue staining of gels, where we can detect the proteins isolated by streptavidin pull-down assay From liver extracts of (A) bio Ub mice and (B) bio NEDD8 mice. ll OPEN ACCESS 20 STAR Protocols 6, 103697, June 20, 2025 Protocol
DECLARATION OF INTERESTS The authors declare no competing interests. REFERENCES 1. Gil-Pitarch, C., Serrano-Macia ´, M., Simon, J., Mosca, L., Conter, C., Rejano-Gordillo, C.M., Zapata-Pavas, L.E., Pen ˜a-Sanfe ´lix, P., Azkargorta, M., Rodrı ´guez-Agudo, R., et al. (2024). Neddylation inhibition prevents acetaminophen-induced liver damage by enhancing the anabolic cardiolipin pathway. Cell Rep. Med. 5, 101653. https://doi.org/10. 1016/j.xcrm.2024.101653. 2. Lectez, B., Migotti, R., Lee, S.Y., Ramirez, J., Beraza, N., Mansfield, B., Sutherland, J.D., Martinez-Chantar, M.L., Dittmar, G., and Mayor, U. (2014). Ubiquitin profiling in liver using a transgenic mouse with biotinylated ubiquitin. J. Proteome Res. 13, 3016–3026. https://doi.org/ 10.1021/pr5001913. 3. Franco, M., Seyfried, N.T., Brand, A.H., Peng, J., and Mayor, U. (2011). A novel strategy to isolate ubiquitin conjugates reveals wide role for ubiquitination during neural development. Mol. Cell. Proteomics 10, M110.002188. https://doi. org/10.1074/mcp.M110.002188. 4. Gonzalez-Rellan, M.J., Fernandez, U., Parracho, T., Novoa, E., Fondevila, M.F., da Silva Lima, N., Ramos, L., Rodriguez, A., Serrano-Macia, M., Perez-Mejias, G., et al. (2023). Neddylation of phosphoenolpyruvate carboxykinase 1 controls glucose metabolism. Cell Metab. 35, 1630– 1645.euv5. https://doi.org/10.1016/j.cmet.2023. 07.003. 5. Mercado-Gomez, M., Lopitz-Otsoa, F., Azkargorta, M., Serrano-Macia, M., LachiondoOrtega, S., Goikoetxea-Usandizaga, N., Rodriguez-Agudo, R., Fernandez-Ramos, D., Bizkarguenaga, M., Juan, V.G., et al. (2020). Multi-Omics Integration Highlights the Role of Ubiquitination in CCl4-Induced Liver Fibrosis. Int. J. Mol. Sci. 21, 9043. https://doi.org/10.3390/ ijms21239043. 6. Simon, J., Nunez-Garcia, M., Fernandez-Tussy, P., Barbier-Torres, L., Fernandez-Ramos, D., Gomez-Santos, B., Buque, X., Lopitz-Otsoa, F., Goikoetxea-Usandizaga, N., Serrano-Macia, M., et al. (2020). Targeting Hepatic Glutaminase 1 Ameliorates Non-alcoholic Steatohepatitis by Restoring Very-Low-Density Lipoprotein Triglyceride Assembly. Cell Metab. 31, 605– 622.e10. https://doi.org/10.1016/j.cmet.2020. 01.013. 7. Barbier-Torres, L., Fortner, K.A., Iruzubieta, P., Delgado, T.C., Giddings, E., Chen, Y., Champagne, D., Ferna ´ndez-Ramos, D., Mestre, D., Gomez-Santos, B., et al. (2020). Silencing hepatic MCJ attenuates non-alcoholic fatty liver disease (NAFLD) by increasing mitochondrial fatty acid oxidation. Nat. Commun. 11, 3360. https://doi.org/10.1038/s41467-020-16991-2. 8. Rodriguez-Agudo, R., Gonzalez-Recio, I., Serrano-Macia, M., Bravo, M., Petrov, P., Blaya, D., Herranz, J.M., Mercado-Gomez, M., Rejano-Gordillo, C.M., Lachiondo-Ortega, S., et al. (2024). Anti-miR-873-5p improves alcohol-related liver disease by enhancing hepatic deacetylation via SIRT1. JHEP Rep 6, 100918. https://doi.org/10.1016/j.jhepr.2023. 100918. ll OPEN ACCESS STAR Protocols 6, 103697, June 20, 2025 21 Protocol