Fungicidal action of endophytic fungi, obtained from Justicia carnea, against multidrug-resistant Candida albicans

Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly Medical Research Mediterr J Med Res Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 179 ORGINAL RESEARCH article Fungicidal action of endophytic fungi, obtained from Justicia carnea, against multidrug-resistant Candida albicans Miriam G.U. Nwaneri 1 , Loveline N. Umeugoji 1 , and Udochi A. Ugo 2 * 1 Department of Pharmaceutical Microbiology and Biotechnology, Faculty of Pharmaceutical Sciences, Nnamdi Azikiwe University, Awka 420112, Anambra State, Nigeria 2 Department of Pharmaceutical Microbiology and Biotechnology, Faculty of Pharmaceutical Sciences, University of Nigeria, Nsukka, Enugu State, Nigeria * Author to whom correspondence should be addressed Received: September 02, 2025, Accepted: October 25, 2025, Published online: October 27, 2025 HOW TO CITE THIS Nwaneri MGU, et al. Fungicidal action of endophytic fungi, obtained from Justicia carnea, against multidrug-resistant Candida albicans. Mediterr J Med Res. 2025; 2(4): 179-185. [Article number: 23]. https://doi.org/10.5281/zenodo.17449274 Keywords: DNA sequence, endophytic fungi, multi-drug resistant, Sordariomycetes Abstract: Candida albicans causes high morbidity and mortality and is becoming a danger to public health. The problem created by its high occurrence and the treatment failures cannot be overstated. Endophytes derived from some medicinal plants serve as a new source of drug discovery. This study is aimed at evaluating the fungicidal potential of endophytic fungi obtained from Justicia carnea against multidrug-resistant Candida albicans. Candida albicans were obtained from clinical samples at Nnamdi Azikiwe Teaching Hospital in Anambra State, Nigeria. The susceptibility study to isolate multi-drug-resistant Candida albicans with antifungal agents was determined using the Kirby-Bauer technique. The isolation and extraction of fungal metabolites were carried out. The fungicidal activity of the metabolites against multi-drug-resistant Candida albicans was studied using in vitro method. Molecular characterization of endophytic was carried up to the species level. The findings have established that Candida albicans species are becoming resistant to fluconazole, followed by miconazole, within the environment. The leaves of Justicia carnea produced a high yield of secondary metabolites. These metabolites have significant antifungal effects against the isolates of multi-drug-resistant Candida albicans up to a concentration of 18.8 mg/ml. The DNA sequence of the endophytic fungi isolate is the same as Sordariomycetes sp. This study indicates that Justicia carnea harbors endophytic fungi with biosynthetic capacities for a new bioactive agent. Introduction Candida albicans is a versatile and opportunistic fungus that normally exists in the human microbiome without causing harm [1]. However, under specific conditions, it can lead to various infections, from minor skin issues to severe systemic infections [2-4]. It causes high morbidity and mortality globally [5-7] and is becoming a serious threat to public health [8]. Candida albican is becoming resistant to many antifungals [3, 9, 10], and the obtainability of antifungal drugs to treat people with candida infections is inadequate [11]. The problem created by the rising occurrence of Candida albican and failures in the treatment of its infections cannot be overestimated. As such, there is a need for the development of an alternative therapy that is easily accessible to support the antifungal agent. In a continuous search of new products, a study of endophytic fungi isolated from Justicia carnea, a flamingo plant, was carried out. This study is aimed at evaluating the fungicidal potential of endophytic fungi gotten from Justicia carnea against multidrug-resistant candida albicans. Copyright© 2025. This open-access article is distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly Medical Research Mediterr J Med Res Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 180 Materials and methods Plant material: Fresh and healthy leaves of Justicia carnea were harvested in February 2022 from the botanical garden of the Faculty of Pharmaceutical Sciences, Nnamdi Azikiwe University, Agulu campus, Anambra State, South-Eastern Nigeria. The leaves were identified and authenticated by a plant taxonomist at the Department of Pharmacognosy and Traditional Medicine in the same University. Culture media and drugs: Sabouraud dextrose agar (SDA), potato dextrose agar and sabouraud dextrose broth (Titan Biotech. Limited, India) were the culture media used. These media were prepared according to the manufacturer’s instructions. Miconazole (2.0 mg), fluconazole (2.0 mg) and chloramphenicol (500 mg/L) (Titan Biotech. Ltd; India) were the antifungal and antibacterial agents used. Test organism: A total of 20 isolates of Candida albicans were obtained from clinical samples at Nnamdi Azikiwe Teaching Hospital in Anambra State. An approval for these samples was obtained from the hospital Committee. The isolates were obtained from high vaginal swabs. Each of these strains were reconfirmed by macroscopy, microscopy and biochemical test, such as sugar utilization test/Glucose test and Germ tube test [12-14] and stored in Sabouraud dextrose broth at 25oC. Isolation of multi-drug-resistant Candida albicans: The susceptibility study of the Candida albicans isolates with the antifungal agents was determined using the Kirby-Bauer technique as follows. 0.1 ml of standardized Candida albicans cultures was diluted with distilled water to get the turbidity match of 0.5 McFarland standards and dispersed evenly into SDA plates using a sterile swab stick to make a lawn. Inoculated plates were allowed to dry. A sterile cork borer was used to bore five wells of size 8.0 mm in the plates. Using a micropipette, 80 µl of each concentration was put into the wells and the plates were allowed for a period of 30 min and then incubated at 25°C for two days. The zone of inhibition was observed, and the diameter of the zone was measured and recorded (Figure 1). The organisms that showed resistance to the antifungal agents were isolated as MDR Candida albicans [15]. Figure 1: Inhibition zones produced by Sordariomycetes spp crude extract against Candida spp. A B C Key: A: Isolate 1; B: Isolate 2; C: Isolate 3 Isolation of endophytic fungi: The leaves of Justicia carnea were washed with water, disinfected with 2.5% sodium hypochlorite and 70.0% ethanol. They were aseptically cut to 2.0 cm and inoculated onto sterile PDA plates containing chloramphenicol. These plates were incubated for five days at 25oC while observing the development of mycelium. Isolation of pure cultures was attained by continuous sub-culturing of isolates on fresh PDA. Colonial/morphological characteristics of the fungal isolates were carried out by observing the colony texture, color and pigmentation [16, 17]. Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly Medical Research Mediterr J Med Res Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 181 Extraction of metabolites: Each pure fungal isolate was grown in 1.0 L Erlenmeyer flasks with sterilized rice medium, previously autoclaved for one hour at 121ºC at 15 psi [13]. The fermentation flasks were sealed and incubated under static conditions for 21 days at 28°C. Extraction of the fungal metabolites was attained using ethyl acetate. The filtrates were concentrated by evaporating the solvent at 40ºC using a rotary evaporator. Determination of fungicidal activity: The antifungal effects of the endophytic fungal extracts were tested in vitro against a test culture of multidrug-resistant Candida albicans as follows. The suspensions of test organisms were adjusted to 0.5 McFarland turbidity standards and inoculated onto previously sterile SDA plates using sterile cotton swabs. A sterile cork borer was used to make five wells (8.0 mm in diameter) on each of the SDA plates. Aliquots of 80 μl of each dilution of the extract reconstituted in DMSO at different concentrations were put in each of the wells. Fluconazole (100 mg/mL) served as the positive control. The plates were then incubated at 25oC for 48 hrs. The antimicrobial potential for each extract was determined by measuring the zone of inhibition around each well. The assay was carried out in duplicates and the mean IZD was used [18]. Isolation of DNA and polymerase chain reaction (PCR): DNA isolation and amplification was done to characterize the endophytic fungi up to the species level. The genomic DNA of endophytic fungi was extracted and quantified using Quick-DNATM Fungal/Bacterial Miniprep Kit (Zymo Research), as laid-out in the endorsed protocols with minor modification. The PCR amplifications were undertaken in a 25.0 μl reaction volume (reaction mixture) comprising of 12.5 μl of One Taq Quick-Load 2X Master Mix with standard buffer, 0.5 μl each of forward and reverse primers, 9.0 µl of Nuclease free water and 3.0 μl es of DNA template. The reaction was gently mixed and transferred to a thermal cycler. The PCR cycling conditions were in the order: Initial denaturation at 94oC lasted for 30 sec, followed by 35 cycles of denaturation at 94oC for 20 sec, primer annealing at 54oC for 45 sec and strand extension at 72oC for one minute. Final extension at 72oC for five min on an Eppendorf Nexus gradient Mastercycler. PCR products were separated on a 1.5% agarose gel and DNA bands were visualized with ethidium bromide [15]. Sequencing: PCR products were cleaned using EXOSAP protocol whereby EXOSAP mix was prepared by the addition of Exonuclease 1 (20.0 U/μl 50.0 μl) and shrimp alkaline phosphatase (1.0 U/μl 200 μl). Amplified PCR product 10.0 μl EXOSAP and 2.5 μl were mixed and incubated at 37oC for 15 min. The reaction was stopped by heating the mixture at 80oC for 15 min. Fragments were sequenced using Nimagen, Brilliant Dye Terminator cycle sequencing kit, according to the manufacturer’s instructions. Results Susceptibility study of the isolates with antifungal agents: The sensitivity of Candida albicans to these two standard drugs (Fluconazole and Miconazole) revealed that the drugs have no activity on most of the isolates, indicating the resistance of the organisms to these drugs (Tables 1 and 2). Table 1: Inhibition zone diameter of miconazole against isolates of Candida albicans Concentration (µg/mL) Isolates 1 2 3 4 5 6 7 300 8±0 4±0 0±0 0±0 0±0 0±0 0±0 150 5±0 0±0 0±0 0±0 0±0 0±0 0±0 75 0±0 0±0 0±0 0±0 0±0 0±0 0±0 37.5 0±0 0±0 0±0 0±0 0±0 0±0 0±0 18.8 0±0 0±0 0±0 0±0 0±0 0±0 0±0 Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly Medical Research Mediterr J Med Res Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 182 Table 2: Inhibition zone diameter of fluconazole against isolates of Candida albicans Concentration (µg/mL) Isolates 1 2 3 4 5 6 7 300 0±0 0±0 0±0 0±0 0±0 0±0 0±0 150 0±0 0±0 0±0 0±0 0±0 0±0 0±0 75 0±0 0±0 0±0 0±0 0±0 0±0 0±0 37.5 0±0 0±0 0±0 0±0 0±0 0±0 0±0 18.8 0±0 0±0 0±0 0±0 0±0 0±0 0±0 Extraction of metabolites: The colonial features and yield of endophytic fungi isolated from the leaf blade of Justicia carnea is presented in Table 3. Table 3: Colonial features and yield of fungal extracts Isolate code Colour Texture Pigment Yield (g) PLB White and light green Cottony No pigment 4.0 Key: PLB - Plant leaf blade Determination of fungicidal activity: The antifungal assay results obtained exhibited that the extract has activity on most of the isolates based on their concentrations (Table 4 and Figure 2). Table 4: Inhibition zone diameter of the extract against Candida albicans Concentration (mg/mL) Isolates 1 2 3 4 5 6 150 9±0 13±0.7 13±0 12±0 7±0 12±0.7 75 8±0 12.5±0 12±0.7 7±0 5.5±0.7 4.5±0.7 37.5 5.5±0 9±0.7 10±0 0±0 3.5±0.7 0±0 18.8 2.5±0 4.5±0.7 3.5±0.7 0±0 2.5±0 0±0 9.4 0±0 0±0 0±0 0±0 0±0 0±0 Fluconazole (100 mg/mL) 0±0 0±0 0±0 0±0 0±0 0±0 Figure 2: Molecular characterization of the endophyte as Sordarimycetes sp Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly Medical Research Mediterr J Med Res Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 183 Sequencing: The result of the molecular characterization (Table 5) revealed that the endophytic fungus has a DNA sequence as same to Sordariomycetes. Table 5: Molecular identification of endophytic fungus isolated from the leaf of J. carnea DNA Sequence Name of fungus GenBank accession number >UG1_ITS-1_C06_09 AACCCCATGTTGAACTTATCTCTTTGTTGCCTCGGCGCAAGCTACCC GGGACCTCGTGCCCCGGGCGGCCCGCCGGCGGACAAACCAAACTC TGTTATCTTCGTTGATTATCTGAGTGTCTTATTTAATAAGTCAAAACT TTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCG AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAAT CTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGT TCGAGCGTCATTTCAACCCCTAAGCACAGCTTATTGTTGGGAATCCA CGCCTGTGGTTCCTCAAAGACATTGGCGGAGTGGCAGTAGTCCTCT GAGCGTAGTAATTCTTTATCTCGCTTTTGTTAGGTGCTGCCCCCCCG GCCGTAAAACCCCCAATTTTTTCTGGTTGACCTCGGATCAGGTAGG AATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA Sordariomycetes spp. KP306960.1 Discussion The findings of the current study provide compelling insights into the antifungal resistance patterns of Candida albicans and the potential of endophytic fungi from Justicia carnea as alternative therapeutic agents. The susceptibility profile revealed a concerning resistance of Candida albicans isolates to two commonly used antifungal agents-fluconazole and miconazole. This aligns with global reports of increasing antifungal resistance [19], particularly among immunocompromised patients and those with recurrent candidiasis. The lack of activity observed in most isolates suggests possible overuse or misuse of these agents in clinical settings, leading to selective pressure and resistance development. These findings underscore the urgent need for alternative antifungal strategies and routine susceptibility testing to guide effective treatment. The successful isolation of endophytic fungi from the leaf blade of Justicia carnea, as evidenced by distinct colonial features and metabolite yield, highlights the plant’s potential as a reservoir of bioactive compounds. Endophytes are known to produce secondary metabolites that mimic or enhance the host plant’s pharmacological properties. The antifungal assay demonstrated that the crude extract from the isolated endophyte exhibited significant fungicidal activity against most Candida albicans isolates, with efficacy dependent on concentration. This dose-dependent response suggests the presence of potent bioactive compounds within the extract. The ability of the extract to inhibit resistant strains further supports its therapeutic potential and warrants further purification and characterization of the active constituents. Molecular sequencing revealed that the isolated endophytic fungus shares a DNA sequence with members of the class Sordariomycetes. Sordariomycetes are one of the largest classes of ascomycota that comprises a highly diverse range of fungi. They include many important pathogens, as well as saprobes, endophytes, epiphytes, coprophilous and fungicolous, lichenized taxa. They are found in terrestrial, marine and freshwater habitats globally. They are commonly isolated as endophytes from various plants [20], and known for their rich biosynthetic capabilities, including the production of antimicrobial and antifungal compounds. The identification of Sordariomycetes as the source organism strengthens the hypothesis that the observed antifungal activity is linked to its metabolic profile. Conclusion: This study highlights the resistance of Candida albicans to standard antifungals, the promising activity of Justicia carnea-derived endophytes, and suggests a valuable avenue for developing novel antifungal agents. Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly Medical Research Mediterr J Med Res Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 184 References 1. Gow NAR, Yadav B. Microbe profile: Candida albicans: A shape-changing, opportunistic pathogenic fungus of humans. Microbiology. 2017; 163: 1145-1147. doi: 10.1099/mic.0.000499 2. Anejionu MG, Nweze EI, Dibua EU, Esimone CO. Efficacy of two commonly used antifungal herbs in Nigeria against clinical isolates of fungi. Microbiology Journal. 2012; 1-16. doi: 10.3923/mj.2012.70.85 3. Kabir MA, Hussain MA, Ahmad Z. Candida albicans: A model organism for studying fungal pathogens. ISRN Microbiology. 2012; 5: 538694. doi: 10.5402/2012/538694 4. Mayer FL, Wilson D, Hube B. Candida albicans pathogenicity mechanisms. Virulence. 2013; 4(2): 119-128. doi: 10.4161/viru.22913 5. Matthaiou DK, Christodoulopoulou T, Dimopoulos G. How to treat fungal infections in ICU patients. BMC Infectious Diseases. 2015; 15: 205. doi: 10.1186/s12879-015-0934-8 6. Pfaller MA, Andes DR, Diekema DJ, Horn DL, Reboli AC, Rotstein C, et al. Epidemiology and outcomes of invasive candidiasis due to non-albicans species of Candida in 2,496 patients: Data from the prospective antifungal therapy (PATH) registry 2004-2008. PLoS One. 2014; 9(7): e101510. doi: 10.1371/journal.pone. 0101510 7. Pappas PG, Kauffman CA, Andes DR, Clancy CJ, Marr KA, Ostrosky-Zeichner L, et al. Clinical practice guideline for the management of candidiasis: 2016 update by the Infectious disease Society of America. Clinical Infectious Diseases. 2016; 62(4): e1-50. doi: 10.1093/cid/civ933 8. Hoque M. Toenail fungal infection: A case report. Mediterranean Journal of Pharmacy and Pharmaceutical Sciences. 2023; 3(4): 80-82. doi: 10.5281/zenodo.10373051 9. Prasad R, Nair R, Banerjee A. Multidrug transporters of Candida species in clinical azole resistance. Fungal Genetics and Biology. 2019; 132: 103252. doi: 10.1016/j.fgb.2019.103252 10. Bhattacharya S, Sae-Tia S, Fries BC. Candidiasis and mechanisms of antifungal resistance. Antibiotics. 2020; 9(6): 312. doi: 10.3390/antibiotics9060312 11. El Magrahi HS, Ben Ashur AM, Agha SM, Khaleel SA, Mousa AM, Atia AE, Abuagela MO, et al. Evaluation of the antifungal activity of Miswak (Salvadora persica) and toothpaste against oral cavity candida species. Mediterranean Journal of Pharmacy and Pharmaceutical Sciences. 2023; 3(1): 70-76. doi: 0.5281/zenodo. 7771715 12. Cheesbrough M. District laboratory practice in tropical countries. 2009; 2nd Ed., Cambridge University Press. doi: 10.1017/CBO9780511543470 13. Okezie UM, Eze PM, Okoye FBC, Ikegbunam MN, Ugwu MC, Esimone CO. Secondary metabolites from an endophytic fungus of Vernonia amygdalina. African Journal of Pharmaceutical and Research and Development. 2017; 9(1): 24-26. doi: Nil. 14. Moya-Salazar J, Rojas R. Comparative study for identification of Candida albicans with germ tube test in human serum and plasma. Clinical Microbiology and Infectious Diseases. 2018; 3(3): 1-4. doi: 10.15761/CMID. 1000143 15. Anejionu MGU, Oli AN, Ezeudu CE, Ezejiofor OI, Ezeogu J, Attama AA, Okore VC. Methicillin-resistant Staphylococcus aureus may also be resistant to clindamycin and vancomycin. Journal of Biosciences and Medicines. 2022; 10: 1-13. doi: 10.4236/jbm.2022.108001 16. Okezie UM, Obi MC, Morikwe UC, Ebenebe IN, Nwaneri MGU. Antimicrobial and antioxidant potentials of crude extracts of culturally dissimilar endophytic fungi. GSC Biological and Pharmaceutical Sciences. 2023; 22(02): 187-195. doi: 10.30574/gscbps.2023.22.2.0475 17. Senanayake IC, Rathnayaka AR, Marasinghe DS, Calabon MS, Gentekaki E, Lee HB, et al. Morphological approaches in studying fungi: Collection, examination, isolation, sporulation and preservation. Mycosphere. 2020; 11(1): 2678-2754. doi: 10.5943/mycosphere/11/1/20 18. Ebenebe IN, Nedum CH, Okezie UM, Egbuna NR, Obasi CC, Nwaneri MGU. Comparative assessment of Solanum melongena (Eggplant) against multi-drug-resistant Staphylococcus aureus and Pseudomonas aeruginosa. Mediterranean Journal of Pharmacy and Pharmaceutical Sciences. 2024; 4(4): 33-40. doi: 10.5281/ zenodo.14176439 19. Maiken, TGR, Wiederhold NP, Vallor AC, Villareal NC, Lewis JS, Patterson TF. Development of caspofungin resistance following prolonged therapy for invasive candidiasis secondary to Candida glabrata infection. Antimicrobial Agents and Chemotherapy. 2008; 52: 3783-3785. doi: 10.1128/AAC.00473-08 20. Kumar V, Soni R, Jain L, Dash B, Goel R. Endophytic fungi: Recent advances in identification and explorations. In: Advances in Endophytic Fungal Research; Springer: Berlin/Heidelberg, Germany. 2019; 267-281. doi: 10.1007/978-3-030-03589-1_13 Mediterranean Journal of ISSN: 2789-1895 https://mrj.org.ly Medical Research Mediterr J Med Res Nwaneri MGU, et al (2025) Mediterr J Med Res. 2(4): 179-185. Page 185 Acknowledgments: The authors are thankful to the Faculty of Pharmaceutical Sciences, Nnamdi Azikiwe University Awka, Anambra State, Nigeria. Author contribution: MGUN conceptualized and designed the study. Data collection was done by LNU. Data analysis was done by MGUN & LNU while writing, editing, and proofreading was done by MGUN & UAU. All the authors read and approved the manuscript. Conflict of interest: The authors declare the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Ethical issues: The authors completely observed ethical issues including plagiarism, informed consent, data fabrication or falsification, and double publication or submission. Data availability statement: The raw data that support the findings of this article are available from the corresponding author upon reasonable request. Author declarations: The authors confirm that they have followed all relevant ethical guidelines and obtained any necessary IRB and/or ethics committee approvals.