scieee AI-readable full text Open interactive document viewer

Four new species of Trichoderma (Hypocreaceae, Hypocreales) discovered in the staple food bamboo of pandas

Wang, Feihu; Xu, Xiulan; Liu, Feng; Xiang, Shasha; Li, Xinyue; Liu, Yinggao; Yang, Chunlin

Abstract

Trichoderma fungi are significant saprophytic resources in nature, with only a minority of species documented as pathogenic fungi. Due to their widespread distribution, this genus of fungi has attracted considerable attention in recent years. During an investigation of fungal resources within the staple food bamboo species for giant pandas in China conducted from 2023 to 2024, a high diversity of Trichoderma species was observed. In this study, eight collected specimens were compared morphologically with known species, and DNA sequence analysis was performed using a multi-gene (ITS, tef1-α, and rpb2) dataset to establish phylogenetic relationships, ultimately leading to the identification of four Trichoderma species. The research uncovered four novel Trichoderma species: Trichoderma bashania, T. fargesia, T. mianyangensis and T. yaanensis. Phylogenetic analysis revealed that each of these new species forms a distinct lineage, with Trichoderma bashania, T. fargesia, T. mianyangensis and T. yaanensis all belonging to the Koningii section. All these newly identified species were isolated from the litter of the staple food bamboo species for giant pandas. This study provides morphological descriptions and illustrations of these four new species, along with DNA phylogenetic relationships based on the analysis of the multi-gene dataset. The findings indicate that Trichoderma fungi are widely present in the ecosystem of the staple food bamboo species for giant pandas and warrant close attention.

Full text

227 Four new species of Trichoderma (Hypocreaceae, Hypocreales) discovered in the staple food bamboo of pandas Feihu Wang1,2,3, Xiulan Xu4, Feng Liu1,2,3 , Shasha Xiang1,2,3, Xinyue Li1,2,3, Yinggao Liu1,2,3, Chunlin Yang1,2,3 1 College of Forestry, Sichuan Agricultural University, Chengdu, Sichuan, 611130, China 2 Forest Ecology and Conservation in the Upper Reaches of the Yangtze River Key Laboratory of Sichuan Province, Chengdu 611130, Sichuan Province, China 3 Sichuan Mt. Emei Forest Ecosystem National Observation and Research Station, Chengdu 611130, Sichuan Province, China 4 Forestry Research Institute, Chengdu Academy of Agricultural and Forestry Sciences, Chengdu 611130, Sichuan Province, China Corresponding authors: Yinggao Liu ([email protected]); Chunlin Yang ([email protected]) Copyright: © Feihu Wang et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract Trichoderma fungi are significant saprophytic resources in nature, with only a minority of species documented as pathogenic fungi. Due to their widespread distribution, this genus of fungi has attracted considerable attention in recent years. During an investigation of fungal resources within the staple food bamboo species for giant pandas in China conducted from 2023 to 2024, a high diversity of Trichoderma species was observed. In this study, eight collected specimens were compared morphologically with known species, and DNA sequence analysis was performed using a multi-gene (ITS, tef1-α, and rpb2) dataset to establish phylogenetic relationships, ultimately leading to the identification of four Trichoderma species. The research uncovered four novel Trichoderma species: Trichoderma bashania, T. fargesia, T. mianyangensis and T. yaanensis. Phylogenetic analysis revealed that each of these new species forms a distinct lineage, with Trichoderma bashania, T. fargesia, T. mianyangensis and T. yaanensis all belonging to the Koningii section. All these newly identified species were isolated from the litter of the staple food bamboo species for giant pandas. This study provides morphological descriptions and illustrations of these four new species, along with DNA phylogenetic relationships based on the analysis of the multi-gene dataset. The findings indicate that Trichoderma fungi are widely present in the ecosystem of the staple food bamboo species for giant pandas and warrant close attention. Key words: Morphology, multi-gene, pandas, phylogenetic analyses, staple food bamboo, taxonomy, Trichoderma Introduction The giant panda (Ailuropoda melanoleuca), an endemic and rare species in China, is hailed as a “living fossil” and “China’s national treasure”. It also serves as the ambassador for the World-Wide Fund for Nature (WWF) and is a flagship species for global biodiversity conservation, as well as one of the most beloved wild animals worldwide (Ran et al. 2009). Although giant pandas are classified as carnivores and still retain the digestive system of carnivores, their diet is extremely narrow, with bamboo constituting the vast majority of their Academic editor: Jian-Kui Liu Received: 26 June 2025 Accepted: 6 October 2025 Published: 3 November 2025 Citation: Wang F, Xu X, Liu F, Xiang S, Li X, Liu Y, Yang C (2025) Four new species of Trichoderma (Hypocreaceae, Hypocreales) discovered in the staple food bamboo of pandas. MycoKeys 124: 227–248. https://doi.org/10.3897/ mycokeys.124.163233 MycoKeys 124: 227–248 (2025) DOI: 10.3897/mycokeys.124.163233 228 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China food intake. As a highly specialized species in terms of diet, bamboo resources account for over 99% of their food resources (Zhang et al. 2014). Based on fossil records, giant pandas have been exclusively bamboo-eaters for at least 2 million years. Scientists have never ceased their research into how giant pandas have adapted to a bamboo diet (Hansen et al. 2010; Senshu et al. 2014; He et al. 2020). However, not all bamboo species in nature can serve as food for giant pandas, and this singular food source makes giant pandas particularly vulnerable. Therefore, the study of the staple bamboo species for giant pandas is warranted (Tian et al. 2019). Currently, research on the staple bamboo species for giant pandas is limited to nutritional component analysis, while studies on microorganisms within the ecosystem of staple bamboo species remain largely unexplored (Helander et al. 2013; Jin et al. 2020). Research indicates that most plants are surrounded by a stable and complex microbial community, and changes in these microorganisms may trigger alterations in plants’ growth, development, health status, stress resistance, and other aspects. (Shang et al. 2024; Yang et al. 2024). Consequently, studying the fungi associated with the staple bamboo species for giant pandas is of great importance. The genus Trichoderma (Hypocreaceae, Hypocreales, Sordariomycetes) was originally established by Persson in 1794. Trichoderma species are saprophytic fungi, commonly found in soil, wood, and litter (Hasan et al. 2012; Abo-Elyousr et al. 2014; Poveda et al. 2019; Zhao et al. 2023). Additionally, some Trichoderma species are significant pathogenic fungi, serving as key pathogens causing green mold disease and leading to the decay of a large number of cultivated mushrooms (Savoie and Mata 2003; Komon-Zelazowska et al. 2007; Tarafder et al. 2024). Finally, an increasing body of research indicates that Trichoderma species also function as important plant endophytes, playing crucial roles in the growth and development of plants (Lorito et al. 2010; Harman et al. 2021). Consequently, due to their economic and ecological significance, Trichoderma has evolved into a genus with a rich diversity of species. Currently, more than 500 species have been reported and recognized (http://www.indexfungorum. org). Meanwhile, species within this genus have been widely utilized, exerting a profound impact on humanity. They are efficient producers of bio-enzymes, important sources of biocontrol agents against plant pathogens, and key participants in environmental remediation, thus possessing extremely high economic value (Tripathi et al. 2013; Abdel-Mageed et al. 2022; Zhang et al. 2023). Initially, the identification of Trichoderma relied solely on the different colors of ascospores in its sexual stage for differentiation (Rifai 1969). During its sexual stage, Trichoderma can produce ascospores of two distinct colors: hyaline (transparent) and green. Early research was based on these two-color variations for classification purposes (Bissett 1991). Chaverri and Samuels (2004) took the lead in conducting a comprehensive study on Trichoderma species with green ascospores. Although this provided early insights into the study of Trichoderma, the accuracy of identification was far from sufficient. Subsequently, Jaklitsch and Voglmayr (2015a) proposed an integrated classification system primarily based on molecular phylogenetic analysis rather than ascospore color, dividing the genus into six subclades: the Ceratocladosporium subclade, the Viride subclade, the Harzianum subclade, the Helicum subclade, the Asperellum subclade, and the Strictipile subclade. Currently, the identification of Trichoderma is gradually becoming standardized. The widespread use 229 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China of DNA barcoding, such as the rpb2 and tef1-α coding genes, for identification purposes has enhanced the accuracy and standardization of the process (Cai and Druzhinina 2021; Zheng et al. 2021). Species of the genus Trichoderma are extensively distributed across most regions worldwide, with their survival range spanning high-latitude areas from the far north to the far south. They demonstrate remarkable ecological adaptability, with their presence traced in ecosystems ranging from humid tropical and subtropical rainforests to arid deserts, temperate grasslands, and even northern boreal ecosystems (Cai and Druzhinina 2021). The rich biodiversity exhibited by this group, along with the continuous discovery and exploration of novel resources within it, has successfully garnered the attention of numerous researchers globally. Similarly, China has also shown a high level of interest in this group. However, in previous studies, most species were isolated from soil, and the majority of research was reported based on cultured strains (Zhang et al. 2022; Zhao et al. 2021, 2025). In this study, three sexual morph specimens and one asexual morph specimen were collected from four staple bamboo species for giant pandas, namely Bashania faberi, Fargesia qinlingensis, Phyllostachys sulphurea, and Bambusa emeiensis. The phylogeny of the four species were reconstructed using the gene sequences of ITS, tef1-α, and rpb2. The results met the criteria for identifying new species of Trichoderma (Cai and Druzhinina 2021). Materials and methods Specimen collection and isolation This study involved collecting litter samples from the staple bamboo species for giant pandas in China (Sichuan Province and Shaanxi Province) between 2023 and 2024. The samples were collected using plastic sealing bags and transported back to the laboratory for subsequent experiments. The samples were examined and sectioned using a Leica stereo microscope (EZ 4). Single spore isolation was performed following the method described by Chomnunti et al. (2014). Hand-sectioning techniques were employed to prepare slide specimens of the fruiting bodies. Morphological structures were photographed using an Olympus BX53 microscope. All measurements of structural components were conducted using Tarosoft Image Framework software (version IFW 0.97). The type specimens have been deposited at the Herbarium of Sichuan Agricultural University (SICAU) in Wenjiang, Sichuan, China. All live cultures are preserved at the Strain Collection of Sichuan Agricultural University (SICAUCC). Based on the method provided by Jayasiri et al. (2015) for obtaining facial login numbers (http://www.facesoffungi.org/), all strains in this study have been registered in the Fungi Index (2025, http://www.indexfungorum.org/). DNA extraction, PCR amplification and nucleotide sequencing Using a sterile stainless-steel spoon, fungal hyphae were scraped from Potato Dextrose Agar (PDA) and placed into a centrifuge tube containing steel beads. The hyphae were then thoroughly ground using a freeze-grinding in- 230 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China strument. The ground fungal hyphae were subjected to total genomic DNA extraction using a novel rapid extraction kit for plant genomic DNA (Aidilai Biotechnology Company, China). Three genetic regions were amplified, namely the Internal Transcribed Spacer (ITS) rRNA, Translation Elongation Factor 1-alpha (tef1-α), and RNA polymerase II subunit (rpb2). The amplified genetic markers and their corresponding primers are listed in (Table 1). Polymerase Chain Reaction (PCR) was performed in a 25 µL reaction mixture containing 12.5 µL of MasterMix (Beijing, China), 9.5 µL of deionized water 1 µL of DNA template, and 1 µL of each forward and reverse primer. The amplification conditions are shown in (Table 2). The PCR products were sequenced by Qingke Biotechnology Co., Ltd. in China. The newly generated sequences have been deposited in GenBank (Table 3). Sequence alignment and phylogenetic analyses A phylogenetic analysis of the genus Trichoderma was conducted based on ITS, tef1-α, and rpb2 sequence data. In this study, the strain T. hamatum (DAOM 167057) and T. asperellum (GJS 04-217) were selected as the outgroup for phylogenetic analysis. The sequences generated in this study were examined and assembled using BioEdit v.7.0.9 (Hall 1999). Sequence alignment was performed using MAFFT v.7 online software (https://mafft.cbrc.jp/alignment/ server/) (Katoh and Standley 2013). Based on the combined dataset, phylogenetic analyses were conducted using Maximum Likelihood (ML) and Bayesian Inference (BI), were constructed as described in Zhao et al. (2025). The phylogenetic trees were viewed using FigTree v1.4.3 (Rambaut and Drummond 2016) and edited using Adobe Illustrator 2021 (version 2.6.0.44) and Adobe Photoshop CS6 software (Adobe Systems, USA). Table 1. Sequences of primers used in this study. Gene markers Primers Sequences of Primers 5'-3' References ITS ITS5 GGAAGTAAAAGTCGTAACAAGG White et al. 1990 ITS4 TCCTCCGCTTATTGATATGC tef1-α 728F CATCGAGAAGTTCGAGAAGG Carbone and Kohn 1999 EF2 GGARGTACCAGTSATCATG O’Donnell et al. 1998 rpb2 5F GAYGAYMGWGATCAYTTYGG Liu et al. 1999 7CR CCCATRGCTTGYTTRCCCAT Table 2. Primers and PCR protocols used in this study. Gene markers Primers Optimized PCR Protocols References ITS ITS5 94 °C 3 min; 35 cycles of 94 °C 30 s, 55 °C 50 s, 72 °C 1 min; 72 °C 10 min; 4 °C on hold White et al. 1990 ITS4 tef1728F 94 °C 3 min; 35 cycles of 94 °C 30 s, 55 °C 50 s, 72 °C 1 min; 72 °C 10 min; 4 °C on hold Carbone and Kohn 1999 EF2 rpb2 5F 95 °C 5 min; 35 cycles of 95 °C 1 min, 52 °C 2 min, 72 °C 90 s; 72 °C 10 min; 4 °C on hold Liu et al. 1999 7CR 231 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China Table 3. Specimen information and GenBank accession numbers of the sequences used in this study. Species Strain GenBank Accession Numbers ITS rpb2 tef1α Trichoderma albofulvopsis W.T. Qin & W.Y. Zhuang 9930T /KU529138 KU529127 Trichoderma amoenum Z.F. Yu & Y.F. Lv YMF 1.06209T /MT052192 MT070146 Trichoderma arenarium F. Cai, M.Y. Ding & Druzhin TUCIM 10301T /MT242310 MT242303 Trichoderma asperellum Samuels, Lieckf. & Nirenberg GJS 04-217 DQ381957 DQ333564 DQ381958 Trichoderma atroviride P. Karst GJS 02-134 DQ315466 /DQ307547 Trichoderma austrokoningii Samuels & Druzhin GJS 99-146T DQ323423 DQ367716 DQ307561 Trichoderma bashania Feihu Wang & C.L. Yang SICAU 25-0179 PV789471 PV828316 PV828324 Trichoderma bashania Feihu Wang & C.L. Yang SICAU 25-0180T PV789472 PV828317 PV828325 Trichoderma caribbaeum Samuels & Schroers GJS 97-3T DQ313131 DQ328607 DQ284977 Trichoderma changiae Y.H. Wei & S.S. Tzean BCRC 24F0002T PP265989 PP273695 PP273697 Trichoderma dingleyae Samuels & Dodd GJS 02-50T DQ333548 DQ367718 DQ284978 Trichoderma dorothopsis A.A. Tomah & J.Z. Zhang HZA5ET /MH647795 MK850827 Trichoderma erinaceum Bissett, C.P. Kubicek & Szakács DIS 8 DQ313147 DQ323450 DQ284970 Trichoderma fargesia Feihu Wang & C.L. Yang SICAU 25-0185T PV789477 PV828320 PV828328 Trichoderma fargesia Feihu Wang & C.L. Yang SICAU 25-0186 PV789478 PV828321 PV828329 Trichoderma hamatum (Bonord.) Bainier DAOM 167057T Z48816 DQ111962 AF456911 Trichoderma hongkuii C.L. Zhang GDMCC 3.1017T /OR779477 OR779504 Trichoderma istrianum Jaklitsch & Voglmayr CBS 130539T /KJ665281 KJ665523 Trichoderma intricatum Samuels & Dodd GJS 97-88T AY380913 AY376684 AY376060 Trichoderma koningii Oudem CBS 457.96T Z79628 DQ341180 AF456909 Trichoderma koningiopsis Samuels, Carm. Suárez & H.C. Evans GJS 93-20 /DQ381954 DQ284966 Trichoderma merleae merleae Y.P. Tan, Minns, Valter, Marney & E. Lacey MST FP3586T PQ570877 PQ572711 PQ572712 Trichoderma mianyangensis Feihu Wang & C.L. Yang SICAU 25-0183T PV789475 PV828322 PV828330 Trichoderma mianyangensis Feihu Wang & C.L. Yang SICAU 25-0184 PV789476 PV828323 PV828331 Trichoderma neohongkuii C.L. Zhang GDMCC 3.1018T /OR779481 OR779508 Trichoderma ovalisporum Samuels & Schroers DIS 70aT /AY376671 AY376037 Trichoderma parahamatum C.L. Zhang GDMCC 3.1020T /OR779474 OR779501 Trichoderma parahongkuii C.L. Zhang GDMCC 3.1019T /OR779476 OR779503 Trichoderma petersenii Samuels, Dodd & Schroers GJS 04-355T /DQ333570 DQ284980 Trichoderma rogersonii Samuels GJS 04-158T /DQ333567 DQ307563 Trichoderma stilbohypoxyli Samuels & Schroers CBS 992.97T /DQ111967 DQ109546 Trichoderma taiwanense Samuels & M.L. Wu GJS 95-93T DQ313141 /DQ284973 Trichoderma viride Pers CBS 433.34 AF456922 /AF456905 Trichoderma gamsii Samuels & Druzhin GJS 04-09 DQ315459 /DQ307541 Trichoderma vinosum Samuels GJS 02-54 DQ315447 /DQ307528 Trichoderma viride Pers GJS 04-353 DQ323418 /DQ307551 Trichoderma texanum Q.V. Montoya, L.A. Meirelles, P. Chaverri & A. Rodrigues LESF551T HQ608136 KT278920 KT278988 Trichoderma tibetica Z.F. Yu & X. Du YMF 1.05583T MK779177 MK779178 MK779179 Trichoderma yaanensis Feihu Wang & C.L. Yang SICAU 25-0181T PV789473 PV828318 PV828326 Trichoderma yaanensis Feihu Wang & C.L. Yang SICAU 25-0182 PV789474 PV828319 PV828327 Notes: superscript T represents ex-type or ex-epitype isolates. “/” means that the sequence is missing or unavailable. The new sequence is displayed in bold red. 232 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China Genealogical concordance phylogenetic species recognition analysis Genealogical Concordance Phylogenetic Species Recognition (GCPSR) is a pivotal and unique method in the field of biological research for model validation. It can efficiently and precisely detect significant recombination events within datasets (Taylor et al. 2000). In this study, we employed the powerful SplitsTree V4 software and conducted an in-depth analysis of the data using the pairwise homoplasy index (PHI) test. This test meticulously examines genetic similarities, enabling us to accurately determine the recombination levels among closely related species. When the pairwise homoplasy index falls below the threshold of 0.05 (Φw < 0.05), it clearly indicates the presence of significant recombination events in the dataset. To ensure the accuracy and comprehensiveness of the analysis results, the study selected a concatenated multi-gene dataset encompassing all closely related species. This comprehensive dataset provides a more reliable genetic foundation for the research. Based on this dataset, a split graph was constructed using the LogDet transformation and split decomposition options to visually present the complex genetic relationships. Results Phylogenetic analyses This dataset comprises composite sequences formed by concatenating ITS, tef1-α and rpb2 gene sequences. These sequences are employed to elucidate and determine the phylogenetic position of the new species within the genus Trichoderma. The phylogenetic tree was performed for placement determination. 41 strains were included in the combined analyses, which comprised 3705 characters (1831 characters for tef1-α, 672 characters for ITS and 1202 characters for rpb2, including alignment gaps). The tree was rooted with T. hamatum DAOM 167057 and T. asperellum GJS 04-217. The best scoring RAxML tree had a fnal likelihood value of -16267.318033. The matrix had 1213 distinct alignment patterns, with 47.89% of undetermined characters and gaps. Estimated base frequencies were: A = 0.228333, C = 0.285248, G = 0.235065, T = 0.251354; substitution rates AC = 1.085759, AG = 2.939729, AT = 1.067672, CG = 0.871080, CT = 4.506612, GT = 1.000000; gamma distribution shape parameter α = 0.458789. The Bayesian inference analyses was implemented by MrBayes v.3.2.2 with the best-fit model (HKY+I+G for tef1-α; GTR+I+G for ITS and rpb2) of evolution estimated with MrModeltest 2.2. The maximum likelihood (ML) and Bayesian methods (BI) for phylogenetic analyses resulted in trees with similar topologies, and the result of ML analysis is shown in Fig. 1. Taxonomy Trichoderma bashania Feihu Wang & C.L. Yang, sp. nov. Index Fungorum number: IF904040 Fig. 3 Etymology. Named after the genus of the host plant from which the holotype was collected, Bashania faberi. 233 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China Figure 1. Phylogram generated from maximum likelihood analysis based on combined ITS, tef1-α and rpb2 sequence data of Trichoderma (koningii species complex) taxa. The species determined in this study are indicated in bold red. Bootstrap values (BS) from maximum likelihood (MLBS, left) higher than 70 BS and Bayesian posterior probabilities (BYPP, right) greater than 0.90 are given at the nodes. Hyphens (-) represent support values less than 70 MLBS/0.90 BYPP. The ex-type strains are in T. Outgroups koningii 234 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China Holotype. SICAU 25-0179. Habitat. On the culm of Bashania faberi. Description. Sexual morph: Stromata scattered, sparsely spreading, growing on the side adjacent to the ground surface, base narrow, pulvinate or discoidal. Color of stromata pale orange-yellow when fresh, brown when mature, with a diameter of 1–4 mm and a thickness of 1–2 mm. Immature, surface of stromata finely velvety, upon maturity, tuberculate with fine granules or slightly rugose. Outline circular, oblong or irregularly lobed. Surface smooth, tubercular or rugose, when young finely velvety. Ascomata 120–190 × 80–140 μm (x – = 145 × 115 μm, n = 30), numerous, with 10–30 ascomata present, and are sub-globose or pear-shaped in form. Ostioles flush with the surface, 18–30 μm wide at the apex, 26–38 μm high (n = 20). Peridium 13–24 μm (n = 60) thick at the base, composed of hyaline textura globosa. Asci 60–90 × 3.5–6 μm (x – = 85 × 4.5 μm, n = 30), short stipe, containing 13-ascospores, apex not thickened, hyaline, cylindrical. Ascospores 3–6 × 2.5–4.5 μm (x – = 4.5 × 3 μm, n = 50), hyaline, containing 1–2 oil droplets, single-celled, non-septate, and sub-globose. Asexual morph: Conidiophores simple structure, with 1–3 solitary phialides borne at the tips of lateral branches. Phialides measure 4–18 × 1.5–3 μm (x – = 14 × 2.5 μm, n = 20), mostly lageniform, less commonly subfusiform, and typically do not thicken near the base. Conidia vary in size and shape, measuring 2.5–4.5 × 2–4 μm (x – = 4 × 3 μm, n = 50), oval, ellipsoid, and hyaline, smooth-surfaced. Material examined. China • Sichuan Province, Chengdu City, Dujiangyan, Primitive Forest of Bashania faberi (31°12'8.63"N, 103°42'49.96"E, Alt. 1212 m), 11 December 2023, Feihu Wang, WFH202312013, (SICAU 25-0179, holotype), ex-type culture SICAUCC 25-0151. ibid. WFH202312013B (SICAU 25-0180, paratype), living culture SICAUCC 25-0152. GenBank accession numbers. SICAUCC 25-0151 (ITS: PV789471; tef1-α: PV828324; rpb2: PV828316); SICAUCC 25-0152 (ITS: PV789472; tef1-α: PV828325; rpb2: PV828317). Culture characters. This fungal strain exhibits optimal growth on all tested media at 30 °C, whereas growth is restricted or completely inhibited at 35 °C. On PDA, at 30 °C, the colony slowly covers a 60-mm Petri dish within 10 days, displaying a grayish-white color with a radial growth pattern and fluffy texture. Conidiation initiates after 15 days, producing numerous white conidia that aggregate into irregularly margined patches. On SNA, growth is the slowest among the three media; at 30 °C, the colony reaches a radius of 50 mm after 10 days, remaining white with a radial pattern and sparse hyphae. Conidiation begins 15 days post-inoculation, forming white, irregularly margined conidial patches composed of aggregated conidia. No odor or pigment diffusion is detected. On MEA, at 30 °C, the colony rapidly covers the entire 60-mm dish within 7 days, featuring a well-defined border, radial growth, and creamy-white mycelium with dense, abundant aerial hyphae. No distinct odor or diffusing pigment is observed. Notes. Phylogenetically, Trichoderma bashania (SICAU 25-0179) and (SICAU 25-0179) formed a distinct clade and is related to T. dorothopsis (HZA5E) in the Koningii clade, but the similarities of rpb2 and tef1-α between these two species were only 95.3% and 98.3%, respectively. From a morphological perspective, only the asexual stage of T. dorothopsis has been described, and there are differences in conidia between these two Trichoderma species. The conidia of T. bashania are elliptical or ovoid, whereas those of T. dorothopsis are globose to subglobose 235 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China (Tomah et al. 2020). Phylogenetic analysis indicates that the new taxon T. bashania (SICAU 25-0179) is closely related to T. dorothopsis (HZA5E) (Fig. 1). However, our strain exhibits nucleotide differences from T. dorothopsis in the rpb2 region amounting to 4.7% (39/822, 3 gaps), 1.7% (13/753, 0 gap) differences in tef1-α. The PHI test revealed no significant recombination event between our strain and the closely related taxa (Φw = 1.00) (Fig. 2). These differences also support the classification of T. bashania as a distinct species separate from T. dorothopsis. Trichoderma fargesia Feihu Wang & C.L. Yang, sp. nov. Index Fungorum number: IF904041 Fig. 4 Etymology. Named after the genus of the host plant from which the holotype was collected, Fargesia qinlingensis. Holotype. SICAU 25-0185. Habitat. On the culm of Fargesia qinlingensis. Description. Sexual morph: Stromata scattered or aggregated in small numbers, lenticular to pulvinate in shape. Centrally attached, free margins, rounded, angular, or irregular in outline. Color ranges from light reddish-brown to dark reddish-brown, Figure 2. The PHI test results for Trichoderma bashania, T. fargesia, T. mianyangensis, T. yaanensis, and closely related species were obtained using both LogDet transformation and splits decomposition methods. The PHI test did not find any statistically significant recombination (Φw = 1) in the data set. The new strains are represented in red and bold. “T” represents the type strain. 242 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China Figure 6. Trichoderma yaanensis (SICAU 25-0181, holotype). a. Culture on PDA (15 days); b. Cultures on SNA (15 days at 25 °C); c. Cultures on MEA (15 days at 25 °C); d–i. Conidiophores and phialides (PDA 30 days at 25 °C); j. Conidia (PDA 30 days at 25 °C). Scale bars: 20 µm (d, e); 15 µm (f); 10 µm (g–i); 5 µm (j). 243 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China margins. Sporulation initiated after 10 days, forming fan-shaped patterns, no odor or pigment was observed. Notes. Phylogenetically, Trichoderma yaanensis strain SICAU 25-0181 and strain SICAU 25-0182 formed a distinct clade and is related to T. merleae (MST FP3586) in the Koningii clade, but the similarities of rpb2 and tef1-α between these two species were only 97.9% and 99.5%, respectively. Trichoderma yaanensis is classified within the Koningii clade and is phylogenetically closely related to T. merleae. Currently, there is no available morphological description for T. merleae, only molecular data have been documented, thereby rendering morphological comparisons infeasible. Phylogenetic analysis reveals that the new taxon, Trichoderma yaanensis (SICAU 25-0181), is closely related to T. merleae (MST FP3586), with strong statistical support (Fig. 1). However, our strain differs from T. merleae in the ITS region amounting to 11.7% (67/572, 32 gap), 2.1% (17/807, 0 gap) differences in rpb2, 0.5% (5/921, 0 gap) differences in tef1-α. Pairwise nucleotide comparisons further support the distinction of T. yaanensis. The PHI test revealed no significant recombination event between our strain and the closely related taxa (Φw = 1.00) (Fig. 2). Therefore, based on the phylogenetic differences, T. yaanensis is introduced as a new species within Trichoderma. Discussion Based on ITS, tef1-α, and rpb2 DNA sequence datasets as well as morphological evidence, this study describes four new species within the genus Trichoderma, classifying them as Trichoderma bashania, T. fargesia, T. mianyangensis and T. yaanensis. Phylogenetic analysis revealed their distinct genetic relationships and positions within the family Trichoderma. Species of this genus are widely distributed globally, and have been reported in various plants, soil, water, as well as in the air. (Liu et al. 2012; Li et al. 2013; Jambhulkar et al. 2024). The discovery of these new species is significant for understanding the species diversity, classification, and geographical distribution of Trichoderma. Bamboo holds extremely high economic, ecological, and cultural values, and the bamboo species that serve as the staple food for giant pandas are imbued with even more unique significance. China is the only country in the world that has wild giant pandas, and the bamboo species that constitute their primary diet are exclusively distributed within this region. The staple bamboo species that giant pandas rely on for food are facing severe challenges, which will lead to food shortages for giant pandas and further accelerate their extinction. Currently, the staple bamboo species for giant pandas are confronted with numerous threats, including global warming, human-induced harvesting of bamboo shoots, grazing, infrastructure development, as well as pests and diseases (Liu et al. 2014; Xiang et al. 2024). Fungi play a crucial role in the ecosystem of the staple bamboo species for giant pandas. They facilitate the growth of the staple bamboo, enhance its resistance to adverse conditions, and participate in the nutrient cycling beneath the bamboo forest. Through mechanisms such as decomposing organic matter, providing nutrients, and promoting the development of bamboo roots, fungi indirectly influence the growth and quality of the bamboo, thereby affecting the food source for giant pandas. In contrast, pathogenic fungi can directly cause the death of the staple bamboo. Research demonstrates that when Trichoderma colonizes bamboo as an endophytic fungus, it substantially enhances the plant’s 244 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China resistance mechanisms. Following bamboo senescence, this versatile fungus transitions to a saprophytic lifestyle, efficiently decomposing lignocellulosic residues and facilitating nutrient cycling within bamboo ecosystems (Bhunjun et al. 2024). Therefore, Trichoderma plays a crucial role in the bamboo forest ecosystem. Currently, research on fungi associated with the staple bamboo species for giant pandas is still remains largely unexplored. Therefore, conducting extensive surveys and sampling will contribute to enriching the fungal resources associated with the staple bamboo species for giant pandas. Among the four newly discovered species, three originate from Sichuan. This phenomenon is primarily due to the fact that the staple bamboo species for giant pandas are predominantly distributed in this region. The increasing discovery of fungal species offers new clues for exploring the biodiversity of this area and also provides crucial information for the conservation of its ecosystems. All these species are distributed within the Koningii clade, a branch that encompasses multiple economically significant species (Han et al. 2023; Xiang et al. 2024). Some of these species are important pathogens, while others have been developed into biological agents. Therefore, further research on these species is necessary. Additional information Conflict of interest The authors have declared that no competing interests exist. Ethical statement No ethical statement was reported. Use of AI No use of AI was reported. Funding This work was supported by the Science and Technology Department of Sichuan Province (Grant No. 2024NSFSC1192). Author contributions Conceptualization: Feihu Wang, Yinggao Liu, and Chunlin Yang; Data curation: Feihu Wang, Xiulan Xu, and Feng Liu; Funding acquisition:Yinggao Liu and Chunlin Yang; Investigation: Feihu Wang; Project administration: Yinggao Liu; Resources: Yinggao Liu and Chunlin Yang; Supervision: Yinggao Liu and Chunlin Yang; Writing––original draft: Feihu Wang; Writing—review and editing: Feihu Wang, Shasha Xiang, Xinyue Li, Yinggao Liu, and Chunlin Yang. All authors have read and agreed to the published version of the manuscript. Author ORCIDs Xiulan Xu https://orcid.org/0000-0002-6832-5421 Feng Liu https://orcid.org/0000-0003-4580-7169 Chunlin Yang https://orcid.org/0000-0002-3854-8835 Data availability All of the data that support the findings of this study are available in the main text. 245 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China References Abdel-Mageed HM, Barakat AZ, Bassuiny RI, Elsayed AM, Salah HA, Abdel-Aty AM, Mohamed SA (2022) Biotechnology approach using watermelon rind for optimization of α-amylase enzyme production from Trichoderma virens using response surface methodology under solid-state fermentation. Folia Microbiologica 67(2): 253–264. https://doi.org/10.1007/s12223-021-00929-2 Abo-Elyousr KA, Abdel-Hafez SI, Abdel-Rahim IR (2014) Isolation of Trichoderma and evaluation of their antagonistic potential against Alternaria porri. Journal of Phytopathology 162(9): 567–574. https://doi.org/10.1111/jph.12228 Bhunjun CS, Chen YJ, Phukhamsakda C, Boekhout T, Groenewald JZ, McKenzie EHC, Francisco EC, Frisvad JC, Groenewald M, Hurdeal VG, Luangsa-ard J, Perrone G, Visagie CM, Bai FY, Błaszkowski J, Braun U, de Souza FA, de Queiroz MB, Dutta AK, Gonkhom D, Goto BT, Guarnaccia V, Hagen F, Houbraken J, Lachance MA, Li JJ, Luo KY, Magurno F, Mongkolsamrit S, Robert V, Roy N, Tibpromma S, Wanasinghe DN, Wang DQ, Wei DP, Zhao CL, Aiphuk W, Ajayi-Oyetunde O, Arantes TD, Araujo JC, Begerow D, Bakhshi M, Barbosa RN, Behrens FH, Bensch K, Bezerra JDP, Bilański P, Bradley CA, Bubner B, Burgess TI, Buyck B, Čadež N, Cai L, Calaça FJS, Campbell LJ, Chaverri P, Chen YY, Chethana KWT, Coetzee B, Costa MM, Chen Q, Custódio FA, Dai YC, Damm U, de Azevedo Santiago ALCM, De Miccolis Angelini RM, Dijksterhuis J, Dissanayake AJ, Doilom M, Dong W, Alvarez-Duarte E, Fischer M, Gajanayake AJ, Gené J, Gomdola D, Gomes AAM, Hausner G, He MQ, Hou L, Iturrieta-González I, Jami F, Jankowiak R, Jayawardena RS, Kandemir H, Kiss L, Kobmoo N, Kowalski T, Landi L, Lin CG, Liu JK, Liu XB, Loizides M, Luangharn T, Maharachchikumbura SSN, Makhathini Mkhwanazi GJ, Manawasinghe IS, Marin-Felix Y, McTaggart AR, Moreau PA, Morozova OV, Mostert L, Osiewacz HD, Pem D, Phookamsak R, Pollastro S, Pordel A, Poyntner C, Phillips AJL, Phonemany M, Promputtha I, Rathnayaka AR, Rodrigues AM, Romanazzi G, Rothmann L, Salgado-Salazar C, Sandoval-Denis M, Saupe SJ, Scholler M, Scott P, Shivas RG, Silar P, Souza-Motta CM, Silva-Filho AGS, Spies CFJ, Stchigel AM, Sterflinger K, Summerbell RC, Svetasheva TY, Takamatsu S, Theelen B, Theodoro RC, Thines M, Thongklang N, Torres R, Turchetti B, van den Brule T, Wang XW, Wartchow F, Welti S, Wijesinghe SN, Wu F, Xu R, Yang ZL, Yilmaz N, Yurkov A, Zhao L, Zhao RL, Zhou N, Hyde KD, Crous PW (2024) What are the 100 most cited fungal genera? Studies in Mycology 108: 1–411. https://doi. org/10.3114/sim.2024.108.01 Bissett J (1991) A revision of the genus Trichoderma. II. Infrageneric classification. Canad. J. Bot 69(11): 2357–2372. https://doi.org/10.1139/b91-297 Cai F, Druzhinina IS (2021) In honor of John Bissett: Authoritative guidelines on molecular identification of Trichoderma. Fungal Diversity 107(1): 1–69. https://doi. org/10.1007/s13225-020-00464-4 Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91(3): 553–556. https://doi.org/10.1080/0027 5514.1999.12061051 Chaverri P, Samuels GJ (2004) Hypocrea/Trichoderma (Ascomycota, Hypocreales, Hypocreaceae): Species with green ascospores. Studies in Mycology 48: 1–116. Chomnunti P, Hongsanan S, Aguirre-Hudson B, Tian Q, Peršoh D, Dhami MK, Alias AS, Xu J, Liu X, Stadler M, Hyde KD (2014) The sooty moulds. Fungal Diversity 66: 1–36. https://doi.org/10.1007/s13225-014-0278-5 246 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China Hall TA (1999) BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucleic Acids Symposium Series 41: 95–98. https:// doi.org/10.1021/bk-1999-0734.ch008 Han WY, Wu ZS, Zhong ZH, Williams J, Jacobsen SE, Sun ZD, Tang Y (2023) Assessing the biosynthetic inventory of the biocontrol fungus Trichoderma afroharzianum T22. Journal of Agricultural and Food Chemistry 71(30): 11502–11519. https://doi. org/10.1021/acs.jafc.3c03240 Hansen RL, Carr MM, Apanavicius CJ, Jiang PP, Bissell HA, Gocinski BL, Maury F, Himmelreich M, Beard S, Ouellette JR, Kouba AJ (2010) Seasonal shifts in giant panda feeding behavior: relationships to bamboo plant part consumption. Zoo Biology 29(4): 470–83. https://doi.org/10.1002/zoo.20280 Harman GE, Doni F, Khadka RB, Uphoff N (2021) Endophytic strains of Trichoderma increase plants’ photosynthetic capability. Journal of Applied Microbiology 130(2): 529–546. https://doi.org/10.1111/jam.14368 Hasan MM, Rahman S, Kim GH, Abdallah E, Oh DH (2012) Antagonistic potentiality of Trichoderma harzianum towards seed-borne fungal pathogens of winter wheat cv. Protiva in vitro and in vivo. Journal of Microbiology and Biotechnology 22(5): 585– 591. https://doi.org/10.4014/jmb.1107.07063 He X, Hsu WH, Hou R, Yao Y, Xu Q, Jiang DD, Wang LQ, Wang HR (2020) Comparative genomics reveals bamboo feeding adaptability in the giant panda (Ailuropoda melanoleuca). ZooKeys 923(923): 141–156. https://doi.org/10.3897/zookeys.923.39665 Helander M, Jia R, Huitu O, Sieber TN, Jia J, Niemelä P, Saikkonen K (2013) Endophytic fungi and silica content of different bamboo species in giant panda diet Symbiosis 61(1): 13–22. https://doi.org/10.1007/s13199-013-0253-z Jaklitsch WM, Voglmayr H (2015a) Biodiversity of Trichoderma (Hypocreaceae) in southern Europe and Macaronesia. Studies in Mycology 80(1): 1–87. https://doi. org/10.1016/j.simyco.2014.11.001 Jambhulkar PP, Singh B, Raja M, Ismaiel A, Lakshman DK, Tomar M, Sharma P (2024) Genetic diversity and antagonistic properties of Trichoderma strains from the crop rhizospheres in southern Rajasthan, India. Scientific Reports 14(1): 8610. https://doi. org/10.1038/s41598-024-58302-5 Jayasiri SC, Hyde KD, Ariyawansa HA, Bhat J, Buyck B, Cai L, Dai YC, Abd-Elsalam KA, Ertz D, Hidayat I, Jeewon R, Jones EBG, Bahkali AH, Karunarathna SC, Liu JK, Luangsa-ard JJ, Lumbsch HT, Maharachchikumbura SSN, McKenzie EHC, Moncalvo JM, Ghobad-Nejhad M, Nilsson H, Pang KA, Pereira OL, Phillips AJL, Raspé O, Rollins AW, Romero AI, Etayo J, Selçuk F, Stephenson SL, Suetrong S, Taylor JE, Tsui CKM, Vizzini A, Abdel-Wahab MA, Wen TC, Boonmee S, Dai DQ, Daranagama DA, Dissanayake AJ, Ekanayaka AH, Fryar SC, Hongsanan S, Jayawardena RS, Li WJ, Perera RH, Phookamsak R, de Silva NI, Thambugala KM, Tian Q, Wijayawardene NN, Zhao RL, Zhao Q, Kang JC, Promputtha I (2015) The Faces of fungi database: fungal names linked with morphology, molecular and human attributes. Fungal Diversity 74: 3–18. https://doi.org/10.1007/s13225-015-0351-8 Jin L, Wu DF, Li CW, Zhang AY, Xiong YW, Wei RP, Zhang GQ, Yang SZ, Deng WW, Li T, Li B, Pan X, Zhang ZZ, Huang Y, Zhang HM, He YG, Zou LK (2020) Bamboo nutrients and microbiome affect gut microbiome of giant panda. Symbiosis 80(16): 293–304. https://doi.org/10.1007/s13199-020-00673-0 Katoh K, Standley DM (2013) Mafft multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. https://doi.org/10.1093/molbev/mst010 247 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China Komon-Zelazowska M, Bissett J, Zafari D, Hatvani L, Manczinger L, Woo S, Lorito M, Kredics L, Kubicek CP, Druzhinina IS (2007) Genetically closely related but phenotypically divergent Trichoderma species cause green mold disease in oyster mushroom farms worldwide. Applied and Environmental Microbiology 73(22): 7415– 7426. https://doi.org/10.1128/AEM.01059-07 Li QR, Tan P, Jiang YL, Hyde KD, Mckenzie EH, Bahkali AH, Wang Y (2013) A novel Trichoderma species isolated from soil in Guizhou, T. guizhouense. Mycological Progress 12(2): 167–172. https://doi.org/10.1007/s11557-012-0821-2 Liu YJ, Whelen S, Hall BD (1999) Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Molecular Biology and Evolution 16(12): 1799–1808. https://doi.org/10.1093/oxfordjournals.molbev.a026092 Liu M, Liu J, Wang WM (2012) Isolation and functional analysis of Thmfs1, the first major facilitator superfamily transporter from the biocontrol fungus Trichoderma harzianum. Biotechnology Letters 34(10): 1857–1862. https://doi.org/10.1007/s10529-012-0972-x Liu C, Wang Y, Pan K, Li W, Zhang L, Shen X, Liu L, Den M (2014) Responses of the antioxidant defense system to drought stress in the leaves of Fargesia denudata seedlings, the staple food of the giant panda. Russian Journal of Plant Physiology 61(3): 374–383. https://doi.org/10.1134/S1021443714020083 Lorito M, Woo SL, Harman GE, Monte E (2010) Translational Research on Trichoderma: From’omics to the field. Annual Review of Phytopathology 48(1): 395–417. https:// doi.org/10.1146/annurev-phyto-073009-114314 O’Donnell K, Kistler HC, Cigelnik E, Ploetz RC (1998) Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the USA 95: 2044–2049. https://doi.org/10.1073/pnas.95.5.2044 Poveda J, Hermosa R, Monte E, Nicolás C (2019) Trichoderma harzianum favours the access of arbuscular mycorrhizal fungi to non-host Brassicaceae roots and increases plant productivity. Scientific Reports 9(1): 11650. https://doi.org/10.1038/s41598-019-48269-z Rambaut A, Drummond A (2016) FigTree: Tree figure drawing tool, version 1.4.3. http:// tree.bio.ed.ac.uk/software/figtree Ran JH, Du BB, Yue BS (2009) Conservation of the Endangered giant panda Ailuropoda melanoleuca in China: successes and challenges. Oryx 43(2): 176–178. https://doi. org/10.1017/S0030605309432010 Rifai MA (1969) A revision of the genus Trichoderma, CMI, Kew, Surrey, United Kingdom, 54 pp. Senshu T, Miyata K, Ohya A, Mikogai J, Morita M, Nakao T, Imazu K, Fei LS, Niu LL, Zhao B, Yu XM, Lu WQ, Wang CD, Liu XZ, Li XB, Li MX, Lan JC (2014) Procedure and Mechanisms of Bamboo Cell Wall Digestion in the Giant Panda, Ailuropoda melanoleuca. Mammal Study 39(4): 219–228. https://doi.org/10.3106/041.039.0405 Savoie JM, Mata G (2003) Trichoderma harzianum metabolites pre-adapt mushrooms to Trichoderma aggressivum antagonism. Mycologia. 95(2): 191–199. https://doi.org/1 0.1080/15572536.2004.11833104 Shang XT, Qin WR, Yang B, Dai Q, Pan H, Yang XY, Gu XD, Yang ZS, Zhang ZJ, Zhang L (2024) Integrated framework for dynamic conservation of bamboo forest in giant panda habitat under climate change. Journal of Environmental Management 368: 122052. https://doi.org/10.1016/j.jenvman.2024.122052 Tarafder E, Wenjun Z, Karunarathna SC, Elgorban AM, Huilian M, Nan W, Zeng X, Yong W, Tian FH (2024) Unveiling two new species of Trichoderma (Hypocreales, Hypocreaceae) 248 MycoKeys 124: 227–248 (2025), DOI: 10.3897/mycokeys.124.163233 Feihu Wang et al.: Four New Trichoderma spp. from China that cause green mold disease on Stropharia rugosoannulata from Guizhou Province, China. MycoKeys 110: 36–383. https://doi.org/10.3897/mycokeys.110.134154 Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS, Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genetics and Biology 31: 21–32. https://doi.org/10.1006/fgbi.2000.1228 Tian ZX Liu XH, Fan ZY, Liu JG, Pimm SL, Liu LM, Garcia C, Songer M, Shao XM, Skidmore A, Wang TJ, Zhang YK, Chang YD, Jin XL, Gong MH, Zhou LG, He XB, Dang GD, Zhu Y, Cai Q (2019) The next widespread bamboo flowering poses a massive risk to the giant panda. Biological Conservation 234: 180–187. https://doi.org/10.1016/j. biocon.2019.03.030 Tomah AA, Abd Alamer IS, Li B, Zhang JZ (2020) A new species of Trichoderma and gliotoxin role: A new observation in enhancing biocontrol potential of T. virens against Phytophthora capsici on chili pepper. Biological Control 145: 104261. https://doi. org/10.1016/j.biocontrol.2020.104261 Tripathi P, Singh PC, Mishra A, Chauhan PS, Dwivedi S, Bais RT, Tripathi RD (2013) Trichoderma: A potential bioremediator for environmental clean-up. Clean Technologies and Environmental Policy 15(4): 541–550. https://doi.org/10.1007/s10098-012-0553-7 White TJ, Bruns TD, Lee SB, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR protocols: A guide to methods and applications. Academic Press, New York, 315–322. https://doi.org/10.1016/ B978-0-12-372180-8.50042-1 Xiang J, Zhang N, Li J, Zhu Y, Cao TY, Wang YJ (2024) Unveiling the Hidden Responses: Metagenomic Insights into Dwarf Bamboo (Fargesia denudata) Rhizosphere under Drought and Nitrogen Challenges. International Journal of Molecular Sciences 25(19): 10790–10790. https://doi.org/10.3390/ijms251910790 Yang HB, Zhang DY, Winkler JA, Huang QY, Zhang YB, Wu PH, Liu JG, Ouyang ZY, Xu WH, Chen XD, Wu DF, Zhang JD, Songer M (2024) Field experiment reveals complex warming impacts on giant pandas’ bamboo diet. Biological Conservation 294: 110635. https://doi.org/10.1016/j.biocon.2024.110635 Zhang GZ, Yang HT, Zhang XJ, Zhou FY, Wu XQ, Xie XY, Zhao XY, Zhou HZ (2022) Five new species of Trichoderma from moist soils in China. MycoKeys 87: 133–157. https://doi.org/10.3897/mycokeys.87.76085 Zhang ZJ, Sheppard JK, Swaisgood RR, Wang G, Nie YG, Wei W, Zhao NX, Wei FW (2014) Ecological scale and seasonal heterogeneity in the spatial behaviors of giant pandas. Integrative Zoology 9: 46–60. https://doi.org/10.1111/1749-4877.12030 Zhang S, Zhang CL, Gao ZF, Qiu CW, Shi SH, Chen ZH, Ali MA, Wang F, Wu FB (2023) Integrated physiological and omics analyses reveal the mechanism of beneficial fungal Trichoderma sp. alleviating cadmium toxicity in tobacco (Nicotiana tabacum L.). Ecotoxicology and Environmental Safety 267: 115631. https://doi.org/10.1016/j.ecoenv.2023.115631 Zhao R, Mao LJ, Zhang CL (2023) Three new species of Trichoderma (Hypocreales, Hypocreaceae) from soils in China. MycoKeys 97: 21–40. https://doi.org/10.3897/ mycokeys.97.101635 Zhao R, Chen KY, Mao LJ, Zhang CL (2025) Eleven new species of Trichoderma (Hypocreaceae, Hypocreales) from China. Mycology 16: 180–209. https://doi.org/10 .1080/21501203.2024.2330400 Zheng H, Qiao M, Lv YF, Du X, Zhang KQ, Yu ZF (2021) New species of Trichoderma isolated as endophytes and saprobes from Southwest China. Journal of Fungi 7(6): 467. https://doi.org/10.3390/jof7060467