Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Diversity in the Scopariinae and Crambinae of the Philippines (Lepidoptera: Crambidae)
Abstract
Léger, Théo (2024): Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Diversity in the Scopariinae and Crambinae of the Philippines (Lepidoptera: Crambidae). Bulletin of the Society of Systematic Biologists 3 (2): 1-93, DOI: 10.18061/bssb.v3i2.9527, URL: https://doi.org/10.18061/bssb.v3i2.9527
Full text
Monographs This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International License (CCBY-4.0). View this license’s legal deed at http://creativecommons.org/licenses/by/4.0 and legal code at http://creativecommons.org/licenses/by/4.0/legalcode for more information. Léger, T. (n.d.). Half of the diversity undescribed: integrative taxonomy reveals 32 new species and a high cryptic diversity in the Scopariinae and Crambinae of the Philippines (Lepidoptera: Crambidae). Bulletin of the Society of Systematic Biologists. https://doi.org/10.18061/bssb.v3i2.9527 Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Diversity in the Scopariinae and Crambinae of the Philippines (Lepidoptera: Crambidae) Théo Léger1 1Museum fuer Naturkunde Berlin, Leibniz-Institut fuer Evolutionsund Biodiversitaetsforschung https://doi.org/10.18061/bssb.v3i2.9527 Bulletin of the Society of Systematic Biologists Abstract The Crambinae and Scopariinae (Lepidoptera: Crambidae) of the Philippines are revised here using DNA barcoding and morphology. In the Scopariinae, 20 species are reported from the Philippines, of which 14 are described as new: Scoparia abo sp. n. , S. aenea sp. n., S. bicornuta sp. n. , S. fulvida sp. n. , S. ifugaoensis sp. n. , S. luzonensis sp. n. , S. masiita sp. n. , S. negrosensis sp. n. , S. tenuispina sp. n. , Eudonia penicula sp. n. , Micraglossa kianganensis sp. n. , and Micraglossa polisensis sp. n. In the Crambinae, 42 species are found in the Philippines, with half of them described here as new: Calamotropha anacantha sp. n. , Calamotropha philippinensis sp. n. , Catoptria philippinensis sp. n. , Culladia pseudoscoparia sp. n. , Gargela aculea sp. n. , Gargela acutibrachium sp. n. , Gargela bidentella sp. n. , Glaucocharis altissima sp. n. , Glaucocharis hamulus sp. n. , Glaucocharis kayumanggi sp. n. , Glaucocharis kabundukanis sp. n. , Glaucocharis negrosensis sp. n. , Glaucocharis uncusellus sp. n. , Glaucocharis sungay sp. n. , Metaeuchromius makintabus sp. n. , Metaeuchromius rizali sp. n. , Microchilo bundoki sp. n. , Microchilo cebuano sp. n., Microchilo imminutela sp. n. , and Microchilo spinosus sp. n. Scoparia philippinensis (Hampson, 1917) and Metaeuchromius micralis (Hampson, 1919) comb. nov. as well as female genitalia of Calamotropha obliterans (Walker, 1863) are redescribed, and first descriptions of male genitalia of Glaucocharis clytia (Błeszyński, 1966) and Calamotropha unicolorellus (Zeller, 1863) are provided. Euchromius brunnealis (Hampson, 1919) syn.nov. is synonymized with Metaeuchromius micralis comb. nov. Culladia tonkinella (Walker, 1865), Eudonia barbipennis (Hampson, 1897), Gargela minuta Song, Chen & Wu, 2009, Gargela polyacantha Li, 2019, Gargela xanthocasis (Meyrick, 1897), Glaucocharis lathonia (Błeszyński, 1966) and Glaucocharis clytia (Bleszynski, 1966) are reported here for the first time from the Philippines. DNA barcodes of 359 specimens indicate a perfect match with the Molecular Operational Taxonomy Unit (“MOTU”) in 45 of the 66 morphospecies (68%), while nineteen of the morphospecies included one or more MOTUs, and three MOTUs were shared among more than one morphospecies. Forty MOTUs represented by females only suggest further unrecognized species in these groups. An apparent endemism rate of 95% is observed in mountain-dwelling Scopariinae, while the Crambinae show a lower endemism rate of roughly 50% presumably due to the occurrence of many lowland species. Further expeditions to undersampled islands and mountains will surely reveal additional species. Introduction With some 16,000 described species, the Pyraloidea represent the third most species-rich superfamily of Lepidoptera after Noctuoidea and Geometroidea (Nuss et al., 2003–2023). Crambinae and Scopariinae represent the 3rd and 5th subfamilies in rank of species diversity in the Crambidae and have been found to represent a monophyletic clade together with the two small subfamilies Erupinae and Heliothelinae (Léger et al., 2021; Regier et al., 2012). The subfamily Scopariinae encompasses 587 described species concentrated in the two species-rich genera Eudonia and Scoparia and show their highest diversity in temperate and tropical mountains (Nuss, 1999). A third genus from Eastern and South-East Asia, Micraglossa, shows a substantial amount of diversity within this region, with a large propor-
tion of undescribed species (Munroe, 1958). With 2085 described species, the Crambinae represent the third largest subfamily of pyraloid moths (Nuss et al., 2003–2023). The bulk of their diversity is found in the Holarctic region, but a few genera are distributed in tropical forests in South-East Asia (e.g., Glaucocharis, Gargela, Microchilo). Both subfamilies share the moss-feeding habit otherwise rare in Lepidoptera; Eudonia, Scoparia, and Micraglossa in Scopariinae as well as Glaucocharis in Crambinae are known to feed on moss. Other Crambinae feed predominantly on Poaceae, with few exceptions (Léger et al., 2019). With over 7,000 islands, the Philippines archipelago represents one of the 25 biodiversity hotspots on Earth (Myers et al., 2000). Seventy to eighty percent of the species of mammals, amphibians, and reptiles are endemic to the archipelago (Ong et al., 2002). A similar rate of endemism is assumed for insects but remains limited due to the few groups that have been thoroughly studied (Ong et al., 2002). In Lepidoptera, an endemism of 30% is observed in butterflies (Treadaway & Schröder, 2012). The archipelago has a unique geological history, combining oceanic elements such as Luzon, the Visayas, and Mindanao, that have never been connected to other neighboring regions, with other geologically older elements such as Palawan and Mindoro that drifted from the Eurasian continental crust (Hall, 1998; Treadaway, 1998). The Pleistocene Ice age resulted in the lowering of the sea-level that revealed four major–partial or complete–land bridges connecting the Philippines to neighboring regions: the Palawan bridge that connected Palawan to Borneo, the Sulu archipelago land bridge connecting Borneo to Western Mindanao, the land bridge over the Sangir and Sarangani islands connecting Sulawesi to South Mindanao, and finally a bridge over Batanes that connected Taiwan to the North of Luzon (de Jong & Treadaway, 1993; Treadaway, 1998). Unfortunately, the region has experienced a severe clearing of its forest cover, especially in the lowlands, resulting in an estimated 7% of its primary vegetation currently remaining (Myers et al., 2000; Posa et al., 2008). While its butterfly diversity is fairly well-known (Treadaway, 1995; Treadaway & Schröder, 2012), the Pyraloidea fauna remains largely unknown. One reason that could explain the poor knowledge of pyraloid moths in the Philippines is the scarcity of material found in museum collections (Diakonoff, 1968). The most significant collections of Microlepidoptera from the Philippines are those of Alfred Ernest Wileman at the Natural History Museum of London and those of Charles Fuller Baker at the Smithsonian in Washington. Nowadays, the Museum für Naturkunde, Berlin, Germany, completes the picture with a large amount of material collected on various islands of the Philippines during several expeditions led by Wolfram Mey in the late 1990s. This material has been used in group-specific studies, e.g., in the Scopariinae (Nuss, 1998), the Acentropinae (Speidel, 1998, 2003), and the Hoploscopinae (Léger et al., 2020). In the Scopariinae, only two species, Eudonia homogenes (Meyrick, 1894) and Scoparia philippinensis (Hampson, 1917), were known until the 1990s. The papers of Nuss (Nuss, 1998, 2002) presented revisional notes of the group for South-East Asia and described five new species from the Philippines: Scoparia meyi Nuss, 1998, Scoparia monticola Nuss, 1998, Scoparia noacki Nuss, 2002, Scoparia spadix Nuss, 1998, and Micraglossa tagalica Nuss, 1998. Nuss subsequently described a single species from the Philippines, Scoparia noacki (Nuss, 2002). In Crambinae, only sixteen species are reported from the Philippines: Ancylolomia orchidea Bleszynski, 1970, A. westwoodi Zeller, 1863, Chilo auricilius (Dudgeon, 1905), C. infuscatellus (Snellen, 1890), C. luteellus (Motschulsky, 1866), C. pulverata (Wileman & South, 1917), C. sacchariphagus (Bojer, 1856), C. suppressalis (Walker, 1863), Culladia hastiferalis (Walker, 1866), C. evae Bleszynski, 1970, C. suffusella Hampson, 1896, Calamotropha atkinsoni Zeller, 1863, C. obliterans (Walker, 1863), C. unicolorellus (Zeller, 1863), Eschata chrysargyria (Walker, 1865), and Euchromius micralis (Hampson, 1919; Błeszynski, 1961; Bleszynski, 1970a, 1970b, 1970c; https://www.cabi.org/isc/datasheet/12855). The 145 species described with Philippines as type locality (Nuss et al., 2003–2023) suggest a large proportion of endemics still awaiting description. Here, an integrative approach is used: the material was sorted using morphology first, and the mitochondrial cytochrome oxidase subunit I 5’ region (DNA barcode COI-5P) was subsequently amplified and sequenced for a subsample of the morphospecies. Thirty-two species are newly described here, and seven species are reported from the Philippines for the first time. Discrepancy between the morphology and DNA barcodes suggest several cases of cryptic geographical lineages. Material & Methods Morphological investigations The material from the Philippine islands stored at the Museum für Naturkunde was sorted into morphospecies based on the wing pattern, followed by examination of male and female genitalia. Images of the specimens were taken with a Sony 7R camera with MP-E 65 mm lens equipped with a Stackshot system operated by Capture 1 software (version 21) controlling a motorized platform; stacking was achieved using montages of 30-45 shots using Helicon Focus software (version 8.2.2). The genitalia were mounted following Robinson (1976). Photographs of genitalia were taken with a Nikon Eclipse 90i at the Senckenberg Museum für Tierkunde, Dresden. In some cases, genitalia were directly drawn from the original publications using Adobe Illustrator CS6. Measurements were undertaken using ImageJ (Schneider et al., 2012). Morphological characters were listed and scored in Mesquite (Maddison & Maddison, 2017). Institution acronyms The investigated material is stored in the following institutions, with the acronym in use between brackets: Museum für Naturkunde, Leibniz-Institut für Biodiversitätsund Evolutionsforschung, Berlin (MfN); Senckenberg MuHalf of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 2
seum für Tierkunde, Dresden (MTD); National History Museum, London (NHMUK); Philippines National Museum (PNM); State Museum of Natural History Stuttgart (SMNS). Molecular data generation For each morphospecies, at least one specimen from each locality was considered for DNA barcoding. Abdomens were removed and placed into a 96-well plate and placed for lysis overnight at 37°. The lysis product was pipetted onto a new plate and DNA was extracted from the 96-well plates on the QIAcube HT/QIAxtractor at the Museum für Naturkunde. Few additional samples were extracted using the NucleoSpin Tissue kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s protocol. Two protocols were followed for the PCR and sequencing. In the first Sangerbased protocol applied to the first four plates (MFNLEPPYRALPHIL01, MFNLEP-PYRALPHIL07 to 09), the COI barcode was amplified in two parts referred to as COI fragment 1a and 1b using the pairs of primers LCO (GGTCAACAAATCATAAAGATATTGG) and K699 (WGGGGGGTAAACTGTTCATCC) for COI1a and primers COI_f220 (CCYGAYATAGCYTTYCCMCGAA) and Nadia (CCRAARAATCAAAATARRTGTTG) for COI1b. PCR-mix consisted of 17.8 μl ddH2O, 2.5 μl 10× Puffer, 1 μl Mg (25 mM), 0.5 μl dNTP Mix, 0.5 μl of each primer, 0.2 μl of Taq polymerase (New England Biolabs, Ipswich, USA), and 2 μl of the DNA sample, totalling a volume of 25 μl. PCR program was that of Léger et al. (2020). PCR product cleaning and sequencing were performed by MACROGEN (Netherlands). For the plates MFNLEP-PYRALPHIL10 and MFNLEP-PYRALPHIL11, the last 313bp of the COI barcode (referred to as “minibarcode”) was amplified on plates using a combination of primers 5’-GGWACWGGWTGAACWGTWTAYCCYCC-3’ and 5’-TANACYTCNGGRTGNCCRAARAAYCA-3’ from Geller et al. (2013) bearing 13 bp tags at the 5’ end. PCR reaction mix consisted of 7 μl Mastermix (CWBIO 2xTaq MasterMix, CW0682), 1 μl bovine serum albumin (1 mg/ml), 1 μl of each primer (10 μM) and 4 μl of the DNA voucher, totalling a volume of 14 μl. PCR program consisted of an initial denaturation step at 95 °C (5 min), followed by 35 cycles of denaturation at 94 °C (1 min), annealing at 45 °C (30 sec) and extension at 72 °C (1 min), succeeded by final extension of 72 °C (5 min). PCR amplification success was checked by analyzing a subset of the amplicons on gel. Pooling of the amplicons, library preparation and sequencing with the Oxford Nanopore Technology (ONT) MinION follow the methods described in Srivathsan et al. (2021). Data analyses Sequence processing was done with Geneious Prime 2021.1.1 (https://www.geneious.com). Primers were automatically trimmed and ambiguous bases were corrected using the “Find heterozygotes” plug-in with 80% peak similarity and peak detection height of 20%. Amplicons were assembled into the final consensus sequences after alignment against a reference COI sequence. Sequences were blasted on BOLD and removed from the final dataset if bringing incongruent results. Phylogenetic analyses were performed on RAxML (Stamatakis, 2006), with Rapid Bootstrap Search stopped after 400 replicates. P-distances were used here as advised in Srivathsan & Meier (2012). They were calculated with the dist.dna function of the R-package ape 5.6 (Paradis et al., 2019), and maximum intraspecific distances were retrieved using the maxInDist function of the R-package spider 1.5.0 (S. D. Brown et al., 2012). Haplotype networks were calculated under PopArt (http://popart.otago.ac.nz) using Median-joining networks (Bandelt et al., 1999). Additional sequences were retrieved from the Barcoding of Life Database (BOLD). The distance-based method ASAP (Puillandre et al., 2021) was used in order to delineate Molecular Operational Taxonomic Units (“MOTU”) in the dataset. A detrimental effect was observed when short, non-compliant DNA barcode sequences (< 487 bp) were included together with fulllength DNA barcodes in the ASAP analysis. Similar behaviour was observed using the method ABGD (Puillandre et al., 2012) in an earlier work (Léger et al., 2020). Here, the algorithm would merge all clusters containing non-compliant DNA barcodes. Other DNA barcode compliant sequences were grouped into clusters matching estimates from morphology and ML analysis. The ASAP calculation was performed on the 313 bp COI1b fragment of the DNA barcode region. P-distances were used for the ASAP calculation. The match-ratio between morphospecies and MOTUs was calculated following the formula of Ahrens et al. (2016): match ratio = 2∗N match /(N MOTUs + N morph). Distribution map and collecting intensity heatmap were generated with ggmap v. 3.0.1 (Kahle & Wickham, 2013). Systematics and data treatment An integrative workflow was followed; each molecular operational taxonomic unit (MOTU) was investigated for morphological diagnostic characters. Species with an unambiguous diagnosis and at least one male specimen available were subsequently considered for description. An exception was made for the genus Microchilo where two species were described from females because the separation from the other species on the wing pattern was straightforward. All the material investigated is reported on Supplementary Table S1 deposited on Dryad under the permanent link: https://doi.org/10.5061/dryad.b8gtht7mh. To save space, only the last six unique characters of the specimen identifiers are reported in the main text for the paratypes, the universal prefix “coll.mfn-berlin.de_u_” being omitted. Type specimens and genitalia slides of type specimens of South-East Asian species of Scopariinae were photographed during a stay at the Natural History Museum, London (NHMUK). Results Molecular work Of the 491 specimens used for molecular work, 435 yielded partial or complete DNA barcode sequences (success rate = Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 3
88%). In 93 specimens, only partial DNA barcode was amplified and sequenced. Species delimitation The ASAP analysis of the COI1b fragment alignment included all but one morphospecies (Scoparia aenea sp. n.), for which the second COI fragment could not be sequenced. The best partitioning scheme yielded 76 subsets with a threshold distance of 0.047311 (asap-score = 2.00; P- -03 val=6.60*e ). However, this partitioning merged several morphologically distinct species. The second-best partitioning model recognized 98 MOTUs with a threshold of 0.027199 (asap-sc 5.00; P-val=6.16*e-02 ore = ). This partition was hence adopted for further investigations. A perfect match between MOTU and morphospecies was observed in 38 of the 65 morphospecies (58%), while 19 were split in two or more MOTUs (29%). This translates into a match ratio of 0.47 as defined in Ahrens et al. (2016). In fifteen of the morphospecies, at least one MOTU was represented exclusively by female specimens which could not be separated morphologically from conspecific females. Three cases of shared MOTUs were observed: One MOTU was shared between Scoparia noacki Nuss, 2002 and Scoparia bicornuta sp. n.; one MOTU with Glaucocharis kabundukanis sp. n., G. hamulus sp. n., Glaucocharis cf. clytia, and one undescribed, distinct female of Glaucocharis; and one MOTU with Glaucocharis kayumanggi sp. n., G. negrosensis sp. n., and G. sungay sp. n. Systematics SCOPARIINAE Guenée, 1854 Type genus: Scoparia Haworth, 1811 = Eudoraeina Selys-Longchamps, 1844: 20 Scoparia Haworth, 1811 Scoparia Haworth, 1811. Type species: Tinea pyralella Denis & Schiffermüller, 1775. = Caradjaina P. Leraut, 1986: 123–124. Type species: Scoparia ambigualis kwangtungialis Caradja, 1925. Léger et al., 2019, p. 761 (syn.) = Cholius Guenée, 1845: 332. Type species: Pyralis ochrealis Denis & Schiffermüller, 1775. Léger et al., 2019, p. 761 (syn.) = Epileucia Stephens, 1852: 5 = Eudorea J. Curtis, 1827: folio 170. Type species: Tinea pyralella Denis & Schiffermüller, 1775. = Eudoria Chapman, 1912: 507 = Eudoroea Bruand, 1851: 26 = Phegea Gistel, 1848: ix = Scopea Haworth, 1828: 590 = Sineudonia P. Leraut, 1986: 128. Type species: Sineudonia brunnea Leraut, 1986. W. Li et al., 2010, pp. 3–4, 12–13 (syn.) = Tetraprosopus Butler, 1882: 97. Type species: Tetraprosopus meyrickii Butler, 1882. Munroe 1972: 29 (syn.) = Xeroscopa Meyrick, 1884: 349. Type species: Scoparia ejuncida Knaggs, 1867. Meyrick 1899: 246 (syn.) DIAGNOSIS Descriptions of Scoparia are provided in Nuss (1999) and Li, Li & Nuss (2010). In male genitalia, the well-developed sacculus with a free distal process is apomorphic for the genus and separates it from other scopariine genera (Léger et al., 2019; W. Li et al., 2010). Male genitalia further show the following characters: uncus usually narrowly triangular or ovate; gnathos with slender projection; valva ovate; juxta usually ovate; phallus varying in length and diameter; and vesica of most species with one or several cornuti (W. Li et al., 2010; Nuss, 1998; pers. obs.). In female genitalia, the presence of an appendix bursae is apomorphic for Eudonia + Scoparia (Léger et al., 2019). From Eudonia, it is separated by anterior and posterior apophyses usually being shorter (1-3 X tergite VIII length), the shorter intersegmental membrane VIII-IX (usually less than 2 X tergite VIII length), and the conspicuously shorter colliculum and ductus bursae. DISTRIBUTION Distributed on all co lands (Nuss et al., 2003–2023). At least fourteen species are ntinents and many oceanic islands, except on Antarctica. The genus is lacking in tropical lowfound in the Philippines: Scoparia abo sp. n., Scoparia aenea sp. n., Scoparia bicornuta sp. n., Scoparia fulvida sp. n., Scoparia ifugaoensis sp. n., Scoparia luzonensis sp. n., Scoparia masiita sp. n., Scoparia meyi Nuss, 1998, Scoparia monticola Nuss, 1998, Scoparia negrosensis sp. n., Scoparia noacki Nuss, 2002, Scoparia philippinensis (Hampson, 1917), Scoparia spadix Nuss, 1998, and Scoparia tenuispina sp. n. PHYLOGENETIC RELATIONSHIPS Scoparia is sister to the species-rich genus Eudonia (Léger et al., 2019). Scoparia meyi Nuss, 1998 Figs. 02, 58, 120. Scoparia meyi Nuss, 1998, pp. 492–494, figs. 4, 13–16, 25. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_9114be, genitalia on slide GU 750 prep. Nuss 1996). PHILIPPINES: Mindanao, Mt Agtuuganon, 1050 m, 28.v-7.vi.1996, leg. Mey. Paratypes: 5 ♂ (specimen identifiers MTD11416, coll.mfn-berlin.de_u_9cf218, 3a5d91, 4dd260, faeb8a), 1 unsexed (detailed information in Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). Other specimens examined: 11 ♂, 4 ♀ (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Scoparia tenuispina sp. n. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 4
DIAGNOSIS The predominantly white color of the forewing (Fig. 02) separates this species from the other Scoparia species of the Philippines except Scoparia tenuispina sp. n. The latter species has larger forewings lacking the antemedian discoidal and cubital black blotches observed in S. meyi. In male genitalia (Fig. 58), the absent or strongly reduced uncus is unique to this species. The slender, elongate juxta and the group of about 30 large cornuti (150 μm) constitute additional characters to identify this species. In female genitalia (Fig. 120), the antrum is funnel-shaped, the ductus bursae is very short and is sclerotized at corpus opening. In the corpus bursae, the numerous conspicuous spines increasing in length towards corpus opening are unique to this species. DISTRIBUTION PHILIPPINES: Luzon (Laguna, Mountain Province, Nueva Vizcaya), Mindanao (Davao oriental), Mindoro (Occidental Mindoro). Collected at altitudes between 815 and 1650 m. DNA BARCODING Specimens from Luzon, Mindoro, and Negros were recovered in a different MOTU than the one including specimens from Mindanao in the species delimitation analysis. A maximum intraspecific p-distance of 3.1% is found between samples MFNLEP-PYRALPHIL07-G01 from Luzon Nueva and MFNLEP-PYRALPHIL09-B04 from Mindanao Davao. REMARKS The species is newly recorded from Luzon and Mindoro. Scoparia monticola Nuss, 1998 Figs. 03, 59, 121. Scoparia monticola Nuss, 1998, pp. 486–467, figs. 1, 2, 9–10, 24. Type locality: Philippines, Mindanao, Mt Agtuuganon, 1050 m. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_1cbd79). PHILIPPINES: Mindanao, Mt Agtuuganon, 1050 m, 28.v-7.vi.1996, (W. Mey). Paratypes: 7 ♂ (specimen identifiers coll.mfnberlin.de_u_3b82f9, 93e28f, 3e27b1, 3c37a7, 65f297, 8160cf), 6 ♀ (specimen identifiers coll.mfnberlin.de_u_41c7ec, 52c1ca, 854cb9, ed1647, 983640, e3a965), 1 unsexed (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh) Other specimens examined: 7 ♂, 3 ♀, 4 unsexed (detailed information in Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh) DIAGNOSIS This species (Fig. 03) is best separated by examination of the genitalia. In male genitalia (Fig. 59), the single, large, straight cornutus on the vesica separates this species from other Scoparia of the Philippines. In female genitalia (Fig. 121), the colliculum lacks a sclerotized tube-like ring, the ductus bursae is very long, and the corpus bursae bears a narrow elongate signum. DISTRIBUTION CHINA: Jiangxi (W. Li & Liu, 2013); INDONESIA: Sumatra; PHILIPPINES: Luzon (Laguna, Mountain Province), Leyte, Mindanao (Davao oriental), Mindoro. Collected at altitudes between 650 and 1650 m. DNA BARCODING Specimens from Luzon differ from those of Mindanao by a p-distance of 1.6-2.4%. Within Luzon, a p-distance of 1.5% is observed between specimens from Mount Makiling and the specimen from the Cordillera mountain range. A maximum intraspecific p-distance of 3.6% is found between samples MFNLEP-PYRALPHIL09-G02 from Mindoro Oriental and PYRG590-11 from Sumatra. REMARKS The species is recorded here for the first time from the islands of Luzon, Leyte, and Mindoro. Scoparia philippinensis (Hampson, 1917) Figs. 04, 60, 122. Microglossa [sic] philippinensis Hampson, 1917: 279–280. Type locality : Philippines, Negros island. Scoparia philippinensis Sasaki, 1998, p. 193 Scoparia philippinensis Nuss, 1998, pp. 488–489 MATERIAL Lectotype: ♂ (genitalia on slide PyralidaeNHMUK Slide N° 3590). “Negros I.| 6000 ft. Philippines 1896 | Whitehead,” “1909-42” (NHMUK). Lectotype designated by M. Nuss. Paralectotypes: 5 unsexed, same data (NHMUK). Nuss mentions that one of them is not conspecific (Nuss, 1998, p. 489). Other specimens examined: 10 ♂, 24 ♀, 35 unsexed (detailed information in Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh). DIAGNOSIS In male genitalia (Fig. 60), the long uncus, the straight, tubular gnathos as well as the patch of minute cornuti on the vesica separate this species from its congeners. The female genitalia (Fig. 122) has a flattened ductus bursae, straight on basal half, with a short loop at midlength, distally wrinkled. REDESCRIPTION HABITUS (FIG. 04) Forewing length 6-8 mm in males (n = 5), 6-9 mm in females (n = 17), ground color greyish white, basal area scattered with white and brown scales. Antemedian dark brown band running from basal ¼ of costa to middle of dorsum; Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 5
basal edge well-marked, wavy; distal edge fuzzy. Median area marked with white scales. Distal discoidal stigma dark brown. Postmedian and subterminal white lines forming an X. Margin greyish white. Fringes chequered white and grey. Hindwing dirty white. MALE GENITALIA (FIG. 60) Uncus ¾ X tegumen arm length, distal half ventrally densely setose, apex pointed. Gnathos projection about 2/3 of uncus length, straight, tubular, with apex pointing downwards. Valva dorsal margin convex, sclerotized, ventral process marked, apex rounded. Juxta base rounded, apex conspicuously indented. Vesica with a group of about 30 tiny cornuti. FEMALE GENITALIA (FIG. 122) Antrum forming a pouch covered with tiny sclerotized spicules. Colliculum about 4.5 X length of tergite VIII, flattened. Ductus bursae as long as colliculum, straight, with one tight loop shortly after colliculum junction, slightly enlarged in distal half before corpus opening. Corpus bursae globular, one half densely covered with spines, the other one reticulate, with one large sclerotized patch. DISTRIBUTION PHILIPPINES: Luzon (Benguet, Ifugao, Mountain Province), Mindanao (Davao Oriental), Mindoro (Oriental Mindoro), Negros. Collected at altitudes between 1300 and 2350 m. DNA BARCODING The species delimitation analysis recovered six different MOTUs within specimens of S. philippinensis from Luzon (Ifugao, Mountain Province), Negros (one MOTU each), as well as Mindanao and Mindoro (two MOTUs each). Three MOTUs were represented by females only. A maximum intraspecific p-distance of 9.3% is found between samples MFNLEP-PYRALPHIL07-A06 from Mindoro and MFNLEP1179 from Negros. REMARKS In Sasaki (1998), male genitalia of S. philippinensis is represented with a glabrous vesica. However, inspection of the genitalia slide from the holotype confirms the presence of the patch of minute cornuti on the vesica. Scoparia luzonensis Léger, sp. n. https://zoobank.org/9F5D3C71-24CE-4FDBAB32-1FCD944FE442 Figs. 05, 61, 123. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_be7bb, DNA voucher MFNLEP-PYRALPHIL01-E09, genitalia on slide TL979♂; BOLD sample ID PYPHI043-21, Genbank Accession Number PP196733). PHILIPPINES: Luzon, Ifugao, Mount Polis, 2000 m, 13/11/ 1997 (K. Ebert, W. Mey, M. Nuss). Deposited in MfN. Paratypes: 19 ♂ (specimen identifiers MfN: coll.mfnberlin.de_u_1f5a2a, f2427, ccf84f, 399d98, 2123f8, 48e851, 2664cd, 392215, 6db250, 70088d, be444f, d1b364, 45b21f, 49ebf8, e7bbc5; PNM: id.bioseasia.org_u_02359a, 023599; NHMUK: NHMUK013706263, NHMUK013706264), 8 ♀ (specimen identifiers MfN: coll.mfn-berlin.de_u_3b7485, 3de18e, 4ceba8, 777de6, b8659d, d4c409; PNM: id.bioseasia.org_u_0235a4, 0235a3) (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). Other material: 4 unsexed (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). DIAGNOSIS Scoparia luzonensis sp. n. is best identified by examination of the genitalia: the long and slender uncus with narrow spatulate apex as well as the row of tiny cornuti on the vesica in male genitalia (Fig. 61) and the pouch at base of ductus bursae in female genitalia (Fig. 123) are unique to this species. HABITUS (FIG. 05) Forewing length 5.5-6.0 mm (males, n = 2), 5.5-6.5 mm (females, n = 6); relatively narrow, ground color black, markings white. Basal area sprinkled with white scales. Antemedian line white, running from costal 1/5 to dorsum 1/ 3, broadly arched. Median discoidal spot X-shaped, forming with cubital and dorsal markings with ill-defined white patch; distally with two marked blotches. Postmedian and subterminal lines meeting near costa, forming X-shaped pattern. Margin with 6-7 white spots. Fringe dirty white, with thin dark brown line medially. Hindwing dirty white. MALE GENITALIA (FIG. 61) Uncus 1.6 X tegumen arm length, narrowing in basal half, slender on distal half, laterally setose, apex spatulate. Gnathos projection ca ¾ X uncus length, dorso-apically with small teeth, apex tip pointing downwards. Valva dorsal margin convex, sclerotized; ventral process marked; apex rounded. Juxta with rounded base, apex conspicuously indented. Vesica with about 14 tiny cornuti displayed in a row, with a group of three cornuti apart. FEMALE GENITALIA (FIG. 123) Antrum membranous. Colliculum 3.5 X length of tergite VIII, lightly sclerotized. Ductus bursae 9-10 X length of tergite VIII, forming at base a membranous pouch, sinuate, narrow, enlarging towards corpus opening on distal ¼. Corpus bursae globular. Signum absent. DISTRIBUTION PHILIPPINES: Luzon (Ifugao, Laguna, Mountain Province), Mindoro. Collected at altitudes between 650 and 2100 m DNA BARCODING The specimen with identifier coll.mfn-berlin.de_u_2123f8 from Mount Banahaw differs from the other specimens of Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 6
North Luzon by 1.9-2.5%. This male specimen shows slight differences on the vesica: a subgroup of cornuti is observed in the specimen from the Laguna. A maximum intraspecific p-distance of 3.2% is found between samples MFNLEPPYRALPHIL01-E09 from Luzon (Ifugao) and MFNLEPPYRALPHIL01-H08 from Mindoro. ETYMOLOGY Referring to Luzon, where the species is predominantly encountered. Scoparia abo Léger, sp. n. https://zoobank.org/C2EA5E50-7EDC-40B9-8A3EB62837FDC5C0 Figs. 06, 62. MATERIAL Holotype: ♂ (DNA voucher MFNLEP1178, genitalia on slide TL1487♂; BOLD sample ID PYPHI090-21, Genbank Accession Number PP196776). PHILIPPINES: Negros, Mt Talinis, shore of lake Nailig, 9.247706° N, 123.174851° E, 1580 m, 10-11.08.2012 (collector unknown). Deposited in SMNS. SIMILAR SPECIES Scoparia philippinensis (Hampson, 1917). DIAGNOSIS The grey forewing with the marked postmedian white Xshaped pattern is similar to that of S. philippinensis. In male genitalia, the two long, slender cornuti allow to separate this species from other Scoparia from the Philippines. No female specimen could confidently be assigned to this species. HABITUS (FIG. 06) Forewing length 6.5 mm (n = 1), ground color dark brown. Base white. Two antemedian white lines originating from costal 1/5, one running down to dorsum 1/5, the other one running down to dorsum 1/3. Large median transverse white patch. Postmedian line white, forming marked Xshaped pattern with median and subterminal markings. Subterminal area with marked patch near apex and tornus. Margin white. Fringes chequered white and light brown. MALE GENITALIA (FIG. 62) Uncus 3/4 X tegumen arm length, triangular, laterally setose, apex pointed. Gnathos projection about 4/3 of uncus length, slender, with tip pointing downwards. Valva dorsal margin slightly convex, ventral process marked, apex rounded. Vesica with two large cornuti of 430 μm. FEMALE GENITALIA Unknown. DISTRIBUTION PHILIPPINES: Mindanao (Davao Oriental: Mt Agtuuganon). Collected at an altitude of 1050 m. DNA BARCODING Three MOTUs for Scoparia abo were identified in the species delimitation analysis for Mindanao, Mindoro, and Negros. The MOTU from Mindoro, which includes specimens superficially resembling S. abo sp. n. , is represented by one single female. The maximum intraspecific p-distance of 7.6% is found between samples MFNLEP-PYRALPHIL07-C01 from Mindanao (Davao Oriental) and the two specimens from Negros. ETYMOLOGY From the Tagalog “abo,” ash, referring to the color of the forewings. REMARKS Female specimen with identifier coll.mfnberlin.de_u_822d89 from Mindoro looks very similar in wing pattern. Examination of male specimens from this locality is needed in order to confirm whether this haplotype is conspecific or not. Scoparia masiita Léger, sp. n. https://zoobank.org/ DF360063-8168-4821-97A0-367925843EA6 Figs. 07, 63, 124. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_dfb222, DNA voucher MFNLEP-PYRALPHIL07-B05, genitalia on slide TL1039♂; BOLD sample ID PYPHI082-21, Genbank Accession Number PP196823). PHILIPPINES: Panay, Antique, San Reminigio, Aningalan, 09-10.04.1995 (W. Mey). Deposited in MfN. Paratypes: 2 ♀ (specimen identifiers coll.mfnberlin.de_u_c39589, cdeb6d) (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). DIAGNOSIS Scoparia masiita sp. n. exhibits slender forewings devoid of any conspicuous markings (Fig. 07). In male genitalia (Fig. 63), the strongly protruding ventral process of the valva as well as the six cornuti of increasing length separates this species from its congeners. In female genitalia (Fig. 125), the pouch covered with sclerotized teeth at the base of ductus bursae is unique to this species. HABITUS (FIG. 07) Forewing length 5-7 mm (n = 3); ground color dark brown, markings dirty white. Antemedian area white, scattered with few brown scales. Median area with broad transverse band running from costal half to dorsal 3/4. Postmedian area with two white bands crossing in the middle, forming Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 7
a broad X-shaped pattern. Subterminal area with subtriangular patch medially. Margin dirty white, basal edge dentate. Fringe chequered dirty white and dark brown. Hindwing dirty white. MALE GENITALIA (FIG. 63) Uncus about 2/3 of tegumen arm length, triangular, laterally and apically setose, apex pointed. Gnathos projection about 5/6 of uncus length, slender, with tip pointing downwards. Valva dorsal margin conspicuously convex, ventral margin straight, with ventral process reaching valva apex posteriorly, valva apex conspicuously rounded. Juxta short, base rounded, apex broad, truncate. Phallus slightly curved. Vesica with six cornuti of increasing length from 50 to 200 μm. FEMALE GENITALIA (FIG. 124) Antrum elongate, membranous. Colliculum lightly sclerotized, flattened. Ductus bursae bent at base, forming a pouch covered with small sclerotized spines on basal 1/4, medially narrow, distally enlarging towards corpus opening. Corpus bursae small, globular, barely delimited from corpus. Signum forming one large sclerotized patch. DISTRIBUTION PHILIPPINES: Luzon (Benguet), Panay (Antique). Collected at altitudes between 800 and 2350 m. DNA BARCODING A maximum intraspecific p-distance of 0.7% is found between samples MFNLEP-PYRALPHIL01-A02 and MFNLEPPYRALPHIL07-A01, both from Benguet, Luzon. ETYMOLOGY From the Ilonggo masiit, “spiny,” referring to the six cornuti observed on the vesica as well as the spines found in the ductus pouch. Scoparia tenuispina Léger, sp. n. https://zoobank.org/ 48745E1F-0313-4724-9724-0D1A5A95E1C1 Figs. 08, 64. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_8d160d, DNA voucher MFNLEP-PYRALPHIL07-G04, genitalia on slide TL1037♂; BOLD sample ID PYPHI138-21, Genbank Accession Number PP196823). PHILIPPINES: Mindanao, Mount Agtuuganon, 1050 m, 28.05-07.06.1996 (W. Mey). Deposited in MfN. Paratypes: 2 ♂ (specimen identifiers coll.mfnberlin.de_u_3d2f97, a471a9), 1 specimen with sex unknown (specimen identifier coll.mfn-berlin.de_u_9a94b7) (detailed information in Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh). DIAGNOSIS The short and large white forewings with dark brown markings (Fig. 08) separate this species from other Scopariinae from the Philippines. In male genitalia (Fig. 64), the duckbeak shaped apex of the uncus, the slender valva, and the thin tubular cornutus on the vesica easily separates this species from its congeners. No female specimen could confidently be assigned to this species. HABITUS (FIG. 08) Forewing length 5 mm (n = 2), rather large (width = 0.45 X length), white, sprinkled with dark brown scales, markings dark brown. Base dark brown. Antemedian line running from costal 1/4 to dorsal half, curved outwards, basally well-delimited. Median area with one costal subquadriangular and one discoidal X-shaped patch. Postmedian line white, edged with dark brown, running from costal 3/4 to 5/6 of dorsum, arch-shaped. Subterminal area dark brown, distally with three white patches on costal half; one large subquadriangular white spot between CuA1-CuA2. Marginal band white, well-marked, distally with 6-7 dark brown spots. Fringes dirty white. Hindwing white. MALE GENITALIA (FIG. 65) Uncus 5/4 X tegumen arm length, medially narrowed, apex broad, duck-beak shaped. Gnathos projection 4/5 X uncus length, slender, with apical tip pointing downwards. Valva slender, narrow on basal 1/4, dorsal margin slightly convex, apex rounded; ventral process marked, slightly protruding downwards. Juxta diamond-shaped, with base slightly indented. Phallus straight. Vesica with one thin tubular cornutus with rounded tip. FEMALE GENITALIA Unknown. DISTRIBUTION PHILIPPINES: Mindanao (Davao oriental: Mount Agtuuganon). Collected at an altitude of 1050 m. DNA BARCODING The species delimitation analysis recovered three different MOTUs from Luzon (Camarines Sur, Mountain Province), Leyte and Mindanao (one MOTU each). Unfortunately, the MOTU from Luzon contains only one female, precluding direct comparison with the MOTU from Mindanao (three males). The abdomen of the specimen from Leyte was lost in the DNA extraction. Hence only specimens from Mindanao are confidently assigned to this species. ETYMOLOGY The name originates from the Latin tenuis, e: narrow, slender and spina, ae: spine, referring to the thin cornutus on the vesica. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 8
Figs 01-07. Wings of Scoparia species. 01*. Scoparia spadix* Nuss, 1998, ♂, holotype, specimen coll.mfnberlin.de_u_dbcbce, right half. Fig. 02. Scoparia meyi Nuss, 1998, specimen coll.mfn-berlin.de_u_3a25b5, ♂, right wing. Fig. 03. Scoparia monticola Nuss, 1998, ♂, paratype, specimen coll.mfn-berlin.de_u_3c37a7, right wing. Fig. 04. Scoparia philippinensis (Hampson, 1917), ♀, specimen coll.mfn-berlin.de_u_2c9686, right wing. Fig. 05. Scoparia luzonensis sp. n. , ♀, paratype, specimen coll.mfn-berlin.de_u_9b56e6, right wing. Fig. 06. Scoparia abo sp. n. , specimen coll.mfnberlin.de_u_f2eda9, right wing. Fig. 07. Scoparia masiita sp. n. , ♀, paratype, specimen coll.mfn-berlin.de_u_c39589, right wing. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 9
FEMALE GENITALIA (FIG. 128) As in S. philippinensis. DISTRIBUTION PHILIPPINES: Negros. Collected at altitudes between 1580 and 1820 m. DNA BARCODING All five specimens sequenced yielded identical DNA barcodes. ETYMOLOGY Derived from Negros island where the species is encountered. Scoparia aenea Léger, sp. n. https://zoobank.org/ B682EF2F-0FA7-4E09-A783-CEA7C77D5CC8 Figs. 14, 71, 129. MATERIAL Holotype: ♀ (specimen identifier coll.mfnberlin.de_u_b5fc86, DNA voucher MFNLEP-PYRALPHIL01-B03, TL937♀ ; BOLD sample ID PYPHI009-21). PHILIPPINES: Luzon, Benguet, Mount Tabayoc, 2300 m, 24/ 11/1997 (K. Ebert, W. Mey, M. Nuss). Deposited in MfN. Paratype: 8 ♂ (specimen identifiers MfN: coll.mfnberlin.de_u_b91b52, 769e53, 258b3c, cff08d, 6df9fc, 9fe285, cca059; PNM: id.bioseasia.org_u_02358b), 12 ♀ (specimen identifiers MfN: coll.mfn-berlin.de_u_db426, dabc97, 3bdf36, d35462, 4d7c43, b119ca, b8a016, f77651, 4d13e4, d455c5; PNM: id.bioseasia.org_u_02357c, 023579) (detailed information in Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh). SIMILAR SPECIES Scoparia ifugaoensis sp. n. DIAGNOSIS The conspicuous copper-colored subterminal area of the forewing (Fig. 14) separates Scoparia aenea sp. n. from congeneric species. Scoparia aenea sp. n. is distinctly larger than other species of the spadix group with copper markings. Male genitalia are similar to those of S. ifugaoensis sp. n., but the three small thorn-shaped cornuti are of equal size in S. aenea sp. n. , while one cornutus is larger than the other two in S. ifugaoensis sp. n. The female genitalia are very similar to those of S. ifugaoensis sp. n. , but the corpus bursae is more markedly globular in S. aenea sp. n. which is rather egg-shaped in S. ifugaoensis sp. n. HABITUS (FIG. 14) Forewing length = 6.5-7.5 mm (n = 4); ground color dark brown, with snow white and copper markings. Antemedian band ocher, edged basally and distally with snow white lines. Median area dark brown, medially with large ill-defined white band originating at cell, running down to dorsum. Two distal discoidal copper patches, distally abutted with white mark. Postmedian and subterminal lines meeting at midlength, forming a “X” shape, white. Subterminal area copper-colored. Margin with 6-7 white spots. Fringe basally striped dirty white and grey, distally greyish. Hindwings dirty white. MALE GENITALIA (FIG. 71) Uncus roughly half of tegumen arm length, triangular, latero-apically setose, apex pointed. Gnathos projection 1.4 X uncus length, slightly curved downwards. Valva dorsal margin conspicuously convex, ventral process marked, valva apex broadly rounded. Juxta elliptical, apico-medially deeply notched. Vesica with three short spine-like cornuti of 82-96 μm. FEMALE GENITALIA (FIG. 129) Antrum spiculose. Colliculum short, sclerotized. Ductus bursae roughly ¾ X length of corpus bursae, slightly sinuate, medially enlarged, enlarging towards corpus opening on distal ¼. Corpus bursae roughly 1.2 of ductus bursae, large, globular, one half covered with spines, other half reticulate; broad lightly sclerotized signum. DISTRIBUTION PHILIPPINES: Luzon (Benguet, Ifugao). Collected at altitudes between 2000 and 2350 m. DNA BARCODING A maximum intraspecific p-distance of 0.7% is found between specimens MFNLEP-PYRALPHIL01-B03 from Luzon (Benguet) and MFNLEP-PYRALPHIL07-H12 from Luzon (Ifugao). Scoparia aenea sp. n. is recovered as sister species to Scoparia ifugaoensis sp. n. in the RaxML tree (BS = 95). ETYMOLOGY From the Latin aeneus, a, um, “copper-colored.” Scoparia spp. MATERIAL Scoparia cf. spadix (Fig. 130): 1 ♀ (specimen identifier coll.mfn-berlin.de_u_2667b0, DNA voucher MFNLEPPYRALPHIL01-F07, genitalia on slide TL961F). PHILIPPINES: Mindoro, Mount Halcon, 1300 m, 15-17.01.1998 (W. Mey, V. Samarita). Scoparia cf. mindanaoensis (Fig. 131): 1 ♀ (specimen identifier coll.mfn-berlin.de_u_822d89, DNA voucher MFNLEP-PYRALPHIL01-D01, genitalia on slide TL901F). PHILIPPINES: Mindoro, Mount Halcon, 1300 m, 15-17.01.1998 (W. Mey, V. Samarita). Scoparia cf. tenuispina (Fig. 132): 1 ♀ (specimen identifier coll.mfn-berlin.de_u_dddbd5, DNA voucher MFNLEPPYRALPHIL01-F06 F, genitalia on slide TL952F). PHILIPPINES: Luzon, Mountain Province, Barlig, 1650 m, 14-15.11.1997 (K. Ebert, W. Mey, M. Nuss). Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 16
REMARKS These specimens could not be confidently associated to known species as they belong to a MOTU containing exclusively female specimens. Eudonia Billberg, 1820 Eudonia Billberg, 1820. Type species: Phalaena mercurella Linnaeus, 1758. = Boiea* Zetterstedt, 1839: 995. Type species: Phalaena mercurella Linnaeus sensu Zetterstedt, 1839. = Borea Stephens, 1852: 2 = Dasyscopa Meyrick, 1894: 464. Type species: Dasyscopa homogenes Meyrick, 1894. Léger et al., 2019, p. 769 (syn.) = Dipleurina Chapman, 1912: 507. Type species: Phalaena crataegella Linnaeus sensu Hübner, 1796. Nuss, 1999, p. 59 (syn.) = Dipluerina Sharp, 1913: 357 = Dipleurinodes P. Leraut, 1989: 14–16. Type species: Dipleurinodes mineti Leraut, 1989. Léger et al., 2019, p. 769 (syn.) = Eudipleurina P. Leraut, 1989: 10–11. Type species: Eudoria (Dipleurina) ankaratella Marion, [1957]. Léger et al., 2019, p. 769 (syn.) = Malageudonia P. Leraut, 1989: 20. Type species: Witlesia malgassicella Marion, 1956, by original designation. Nuss, 1999, pp. 21, 22–23, 59 (syn.) = Vietteina P. Leraut, 1989: 36. Type species: Vietteina ivelonensis Leraut, 1989. Nuss, 1999, p. 59 (syn.) = Witlesia Chapman, 1912: 507. Type species: Eudorea pallida Curtis, 1827. Munroe 1972: 47 (syn.) = Wittlesia Chapman, 1912: 507, 518, pl. 40, 44 DIAGNOSIS Descriptions of Eudonia are provided in Nuss (1999) and Li, Li & Nuss (2012). The presence of an appendix bursae in female genitalia is an apomorphy for Eudonia + Scoparia (Léger et al., 2019). The gnathos tip directed posterad or upwards as well as the absence of cornuti on vesica in male genitalia is apomorphic for Eudonia (Léger et al., 2019; Nuss, 1999). The following characters of male genitalia further characterize the genus: uncus broad and short; valva rather simple, lacking the free distal process of the sacculus. In female genitalia, the following characters are characteristic for Eudonia: anterior and posterior apophyses usually long (over 3 X tergite length); intersegmental membrane IX-X long (over 2 X tergite length), colliculum long, tubular, sclerotized; ductus bursae long, always membranous, corpus bursae with a signum, devoid of appendix bursae (Léger et al., 2019; W. Li et al., 2012). DISTRIBUTION Distributed on all continents and many oceanic islands, including subantarctic islands (W. Li et al., 2012; Nuss et al., 2003–2023). Two species are found in the Philippines: Eudonia penicula sp. n. and Eudonia barbipennis (Hampson, 1897). PHYLOGENETIC RELATIONSHIPS Eudonia is sister to Scoparia (Léger et al., 2019). Eudonia penicula Léger, sp. n. https://zoobank.org/5CF78E1FF445-4109-B03A-7FAA260DD005 Figs. 15, 72, 133. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_d58c00, DNA voucher MFNLEP-PYRALPHIL01-H07, genitalia on slide TL967♂; BOLD sample ID PYPHI378-23). PHILIPPINES: Mindoro: Occidental Mindoro, Mount Baco Pass, 1150 m, 14.01.1998 (W. Mey, V. Samarita). Deposited in MfN. Paratypes: 1 ♂ (specimen identifier coll.mfnberlin.de_u_29f992), 10 ♀ (specimen identifiers: MfN: coll.mfn-berlin.de_u_2899da, bb43cb, bef944, 7946ab, 426cd2, 495315, 99a7b7, c3967f, e754a7; PNM: id.bioseasia.org_u_023875) (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Eudonia homogenes (Meyrick, 1894). DIAGNOSIS Eudonia penicula sp. n. resembles Eudonia homogenes (Meyrick, 1894), from which it can be confidently separated by examination of the genitalia. In the Philippines, this species is separated from Eudonia barbipennis (Hampson, 1897) by the distinctive proximal discoidal and cubital dark brown streaks on the forewing. In male genitalia, the thick setae on the innerside of the valva as well as the thick bristles on the apex of the juxta unambiguously separates this species from E. homogenes. In female genitalia, the antrum is covered with tiny sclerotized spicules as in E. homogenes, but it forms a pouch well delimited from the colliculum in E. penicula sp. n. and is cone-shaped, gradually enlarging torward opening in E. homogenes. Furthermore, the colliculum forms a sclerotized ring about 4/5 of the length of tergite VIII, while it is three to four times the length of tergite VIII and is only weakly sclerotized in E. homogenes. HABITUS (FIG. 15) Forewing length 7.2-8.0 mm (n = 5), ground color grey. Basal area with marked dark brown dash. Antemedian line white, running from costal 1/4 to dorsal 1/3, arched outwards. Median area speckled with white scales; marked cubital, proximal discoidal, and distal discoidal thick dark brown ticks. Postmedian and subterminal lines thin, white, forming X-shaped pattern. Margin white. Fringe dirty white, medially with grey line. Hindwing grey. MALE GENITALIA (FIG. 72) Uncus 3/4 X tegumen arm length, quadriangular, about twice as long as wide, densely setose; apex broad, truncate. Gnathos projection about 0.5 X uncus length, tubular, Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 17
Figs 32-39. Wings of Gargela, Ancylolomia and Chilo species. Fig. 32. Gargela bidentella sp. n. , ♀, paratype, specimen coll.mfn-berlin.de_u_9859, right wing. Fig. 33. Ancylolomia orchidea Bleszynski, 1970, ♂, specimen coll.mfnberlin.de_u_6873a4, right half. Fig. 34. Ancylolomia westwoodi Zeller, 1863, specimen coll.mfn-berlin.de_u_8a1d13, ♂, right wing. Fig. 35. Chilo auricilius Dudgeon, 1905, specimen coll.mfn-berlin.de_u_5678ae, left wing (mirrored). Fig. 36. Chilo luteellus (Motschulsky, 1866), ♂, specimen coll.mfn-berlin.de_u_31e49, left side (mirrored). Fig. 37. Chilo infuscatellus Snellen, 1890, ♀, specimen coll.mfn-berlin.de_u_3ba9f3, left side (mirrored). Fig. 38. Chilo sacchariphagus (Bojer, 1856), ♂, specimen coll.mfn-berlin.de_u_9cde85, right half. Fig. 39. Chilo suppressalis (Walker, 1863), ♀, specimen coll.mfn-berlin.de_u_c58f13, left wing (mirrored). Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 18
Figs 40-47. Wings of Eschata, Calamotropha and Angustalius species. Fig. 40. Eschata cf. rififi Bleszynski, 1965, ♂, specimen coll.mfn-berlin.de_u_bf466f, right half. Fig. 41. Calamotropha obliterans (Walker, 1863), ♂, specimen coll.mfnberlin.de_u_7aa174, right wing. Fig. 42. Calamotropha philippinensis sp. n. , ♂, paratype, specimen coll.mfnberlin.de_u_f30a8c, right half. Fig. 43. Calamotropha anacantha sp. n. , ♂, holotype, specimen coll.mfnberlin.de_u_1609c7, right wing. Fig. 44. Calamotropha unicolorellus (Zeller, 1863), ♂, specimen coll.mfnberlin.de_u_294fbd, right wing. Fig. 45. Calamotropha sp. 1 cf. oculalis, ♂, specimen coll.mfn-berlin.de_u_1e3488, right wing. Fig. 46. Calamotropha sp. 2 cf. oculalis, ♂, specimen coll.mfn-berlin.de_u_a7f185, right wing. Fig. 47. Angustalius malacelloides (Bleszynski, 1955), specimen coll.mfn-berlin.de_u_e7300e, right half. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 19
Figs 48-55. Wings of Catoptria, Culladia, Metaeuchromius and Microchilo species. Fig. 48. Catoptria philippinensis sp. n. , ♂, paratype, specimen coll.mfn-berlin.de_u_78302c, right half. Fig. 49. Culladia hastiferalis (Walker, 1865), specimen coll.mfn-berlin.de_u_656531, right wing. Fig. 50. Culladia pseudoscoparia sp. n. , specimen coll.mfn-berlin.de_u_893233, right wing. Fig. 51. Metaeuchromius micralis comb. nov. , ♀, specimen coll.mfn-berlin.de_u_5b3516, right wing. Fig. 52. Metaeuchromius rizali sp. n. , specimen MTD11447, right wing. Fig. 53. Metaeuchromius makintabus sp. n. , specimen coll.mfn-berlin.de_u_868941, ♂, holotype, right wing. Fig. 54. Microchilo bundoki sp. n. , ♂, holotype, specimen coll.mfnberlin.de_u_b4f995, right wing. Fig. 55. Microchilo cebuano sp. n. , ♀, paratype, specimen coll.mfn-berlin.de_u_c18ec0, left wing (mirrored). Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 20
Figs 56-57. Forewings of Microchilo. Fig. 56. Microchilo spinosus sp. n. , ♀, paratype, specimen coll.mfn-berlin.de_u_58c789, left wing (mirrored). Fig. 57. Microchilo imminutela sp. n. , specimen coll.mfn-berlin.de_u_7fbefe, right wing Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 21
curved upwards, dorsal edge dentate, tip rounded. Valva dorsal margin slightly convex, protruding distally into a pointed apex; ventral margin almost straight, curved upwards on distal 1/4; hump bearing patch of thick setae pointed inwards at midlength of innerside of valva. Juxta with base rounded, narrowing from basal 1/4 to 3/4, apex lightly sclerotized, covered with thick bristles. Phallus sclerotized, basal end conspicuously curved, apex with rows of short teeth. FEMALE GENITALIA (FIG. 133) Antrum forming broad pouch densely covered with tiny sclerotized spicules, forming a U-shaped indentation in ventral view. Colliculum 4/5 X length of tergite VIII, forming sclerotized ring. Ductus bursae ca 4 X length of corpus bursae, straight, narrow. Corpus bursae globular, with large rounded sclerotized patch. DISTRIBUTION PHILIPPINES: Luzon (Benguet, Ifugao, Mountain Province), Mindoro (Oriental Mindoro). Collected at altitudes between 1150 and 2300 m. DNA BARCODING The species delimitation analysis recovered two MOTUs, one for specimens from Luzon and Mindoro and one single specimen from Mindanao. The maximum intraspecific pdistance of 2.9% is found between specimens MFNLEPPYRALPHIL01-D03 from Luzon Mountain and MFNLEPPYRALPHIL09-E01 from Mindanao. Unfortunately, the abdomen of the Mindanao specimen was lost during the DNA extraction. ETYMOLOGY From the Latin peniculus, i: brush, referring to the brushlike appendices in male genitalia. REMARKS Nuss (1998) reports Eudonia homogenes from the Philippines. He probably refers to this species, which is externally similar to E. homogenes. Eudonia barbipennis (Hampson, 1897) Scoparia barbipennis Hampson, 1897: 238. Type locality: Malaysia, Malay Peninsula, Gunong Ijau Dasyscopa barbipennis (Hampson, 1897): Nuss, 1998, p. 497 Eudonia barbipennis (Hampson, 1897): Léger et al., 2019, p. 769. Figs. 16, 73, 134. MATERIAL Lectotype: ♂ (specimen identifier NHMUK013696725, genitalia on slide PyralidaeNHMUK Slide N° 3617). “Gunung Ijau, Mal[aysia]. Pen[insula]” (NHMUK). Lectotype designated by M. Nuss. Other specimens examined: 5 ♂, 10 ♀ (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). DIAGNOSIS The dark brown ground color of the forewing (Fig. 16) with the distal discoidal white patches and the postmedian white X separate Eudonia barbipennis (Hampson, 1897) from other Eudonia species encountered in South-East Asia. In male genitalia (Fig. 73), the uncus apex is duck-beak-shaped, while it is bifid in E. barbipennis sp. n. , and the gnathos forms a projection about ¼ of uncus length, while the gnathos projection is reduced to a bump in E. barbipennis sp. n. In female genitalia, the lightly sclerotized anterior half of the ductus bursae as well as the pouch at corpus opening covered with sclerotized spinules separates this species from E. penicula sp. n. Female genitalia of E. barbipennis sp. n. were not investigated. REDESCRIPTION HABITUS (FIG. 16) Forewing length: 8.2-9.5 mm (n = 5); ground color dark brown, with snow white markings. Antemedian line wavy, white. Median area with two well marked distal discoidal rounded white patches. Postmedian line forming at costa and dorsum well-marked patches, forming with subterminal line a X shape. Subterminal line ill-defined, forming well-marked white spot between R5 and M1 and two smaller blotches between CuA1 and CuA2. Margin with white lunules. Fringe chequered dirty white and brown. Hindwing white; in males, presence of an androconial organ on the dorsum of the hindwing. MALE GENITALIA (FIG. 73) Uncus 4/5 X tegumen arm length, large, densely haired dorso-apically, apex duck-beak-shaped. Gnathos projection about ¼ of uncus length, slender, with apex rounded. Valva dorsal margin basally concave, medially conspicuously convex, apex pointed. Juxta broad, lanceolate, weakly sclerotized. Phallus slender, curvy, vesica without cornuti. FEMALE GENITALIA (FIG. 134) Antrum membranous, spinulose. Colliculum 6.8 X length of tergite VIII, narrow, lightly sclerotized. Ductus bursae 5.3 X length of tergite VIII, straight, narrow. Corpus bursae small, globular, membranous, with pouch-like projection at corpus opening bearing sclerotized spinules. One signum at corpus opening. DISTRIBUTION PHILIPPINES: Luzon (Benguet, Ifugao, Mountain Province). Collected at altitudes between 2000 and 2350 m. DNA BARCODING The species delimitation analysis recovered two MOTUs, one for the specimens from North Luzon and one for the specimens from Negros. A maximum intraspecific p-distance of 5.5% is found between specimens MFNLEPHalf of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 22
PYRALPHIL07-C06 from Luzon (Benguet) and MFNLEP1165 from Negros. Micraglossa Warren, 1891 Micraglossa Warren, 1891. Type species: Micraglossa scoparialis Warren, 1891. = Microglossa Hampson, 1907: 20 DIAGNOSIS Descriptions of Micraglossa are provided in Nuss (1999) and Li et al. (2010). Micraglossa exhibits a typical scopariine pattern with the X-shaped postmedian and subterminal lines but can be separated from other related genera by the shiny golden-colored forewing markings. The absence of appendix bursae in female genitalia separates it from Eudonia and Scoparia (Léger et al., 2019). Male genitalia exhibit the following characters: uncus elongate, relatively narrow; gnathos usually slightly longer than uncus, with small apical tooth pointing downwards; valva with spine projection on innerside in some species, distal half of valva usually bent upwards; vesica with or without cornuti. Female genitalia exhibit the following characters: posterior and anterior apophyses shorter than in Eudonia; colliculum long, tubular, lightly sclerotized; ductus bursae long, membranous, sometimes with loops; corpus bursae globular, membranous, without appendix bursae, with ovate or streak-like signum (W. Li et al., 2010). DISTRIBUTION Oriental and Australasian regions. The distribution stretches from temperate China and Japan southwards to Australia (Nuss et al., 2003–2023). Three species are found in the Philippines: Micraglossa tagalica Nuss, 1998, M. polisensis sp. n. , M. kianganensis sp. n. PHYLOGENETIC RELATIONSHIPS Micraglossa is sister to the clade formed by Eudonia and Scoparia (Léger et al., 2019). Micraglossa tagalica Nuss, 1998 Figs. 17, 74, 135. Micraglossa tagalica Nuss, 1998, pp. 512–515, figs. 8, 21–22, 28. Type locality : Philippines, Mindanao, Mt Agtuuganon, 1050 m MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_6df1a8). PHILIPPINES: Mindanao, Mt. Agtuuganon, 1050 m, 28. V.–7. Vi. 1996 (W. Mey). Deposited in MfN. Paratypes: 7 ♂ (specimen identifiers coll.mfnberlin.de_u_be7bfe, b628af, 4c9b77, 40a24b, 4a853e, 6df1a8, b79f72), 13 ♀ (specimen identifiers coll.mfnberlin.de_u_dd60b9, 2e4c39, 3e34c3, 5b97ef, 9fa4ce, a8ac63, bb595c, ca1c27, d47b3e, 28b40f, e52e8f, 39bccc, 7c77db), 5 specimens unsexed (specimen identifiers coll.mfn-berlin.de_u_c83896, 3e4e28, 90724b, b2c9f1, 999692) (detailed information in Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). Other material examined: 117 specimens (detailed information in Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh). DIAGNOSIS Micraglossa tagalica has a pale yellow forewing ground color with shiny gold iridescence, with dark brown markings. The prominence of the pale yellow ground color separates this species from other scopariine species in the Philippines. In male genitalia (Fig. 74), the vesica devoid of cornuti and the mesal part of the valva without a projection separate this species from other Micraglossa species from continental China (W. Li et al., 2010). From Micraglossa polisensis sp. n. and M. kianganensis sp. n. , Micraglossa tagalica can be separated by the combination of the following characters: the uncus has a narrow apex, the gnathos bears a marked subapical dorsal bump, the valva is distally enlarged, and the juxta apex is bifid. In female genitalia (Fig. 135), the two conspicuous loops of the ductus bursae and the elongate signum covered with small spines separate this species from other Micraglossa species (Nuss, 1998). Females of Micraglossa polisensis sp. n. and M. kianganensis sp. n. are unknown. DISTRIBUTION PHILIPPINES: Leyte, Luzon (Ifugao, Laguna, Mountain Province, Nueva Vizcaya), Mindanao (Davao Oriental), Mindoro (Oriental Mindoro), Negros. Collected at altitudes between 1050 and 2100 m. DNA BARCODING A p-distance of 1.1 to 2% is observed between the specimens from Luzon and Mindoro. A maximum intraspecific p-distance of 2.9% is found between specimens MFNLEPPYRALPHIL01-D11 from Leyte and MFNLEP-PYRALPHIL01-H02 from Luzon (Laguna). REMARKS Nine more paratypes (three males, one female, and five unsexed) were found that were not listed in the original publication but were labelled as such. Micraglossa polisensis Léger, sp. n. https://zoobank.org/8281886e-f21c-4a8dab50-4340f966399a Figs. 18, 75. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_c6cac, DNA voucher MFNLEP-PYRALPHIL01-D10, genitalia on slide TL985♂; BOLD sample ID PYPHI035-21, Genbank Accession Number PP196727). PHILIPPINES: Luzon, Mountain Province, Chatol, 2100 m, 16-18.11.1997 (K. Ebert, W. Mey, M. Nuss). Deposited in MfN. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 23
Paratypes: 2 ♂ (specimen identifiers coll.mfnberlin.de_u_e1338d, 9e6b86) (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). DIAGNOSIS In male genitalia (Fig. 75), the vesica devoid of cornuti and the mesal part of the valva without a projection separate this species from other Micraglossa species from continental China (W. Li et al., 2010). From other Philippines species, Micraglossa polisensis sp. n. can be recognized by the bulky uncus apex (in lateral view), the valva gently tapering towards apex, the semi-rounded apex of the valva, and the rounded juxta. Females are not known. HABITUS (FIG. 18) Forewing length 5.0-5.7 mm (n = 2); ground color cream and brown. Antemedian line white, wavy. Median area mixed with cream and brown scales; one distal discoidal thick brown patch. Postmedian line well marked, S-shaped, running straight down to discal cell, cream. Subterminal line cream, medially incurved inwards, nearly meeting postmedian line there. Fringe cream with black spots. Hindwing dirty white. MALE GENITALIA (FIG. 75) Uncus ca 9/10 X tegumen arm length, narrowed on distal half, laterally with scattered setae, apex spatulate in dorsal view. Gnathos projection about 9/10 X uncus length, with subapical dorsal tooth pointing upwards, small tip pointing downwards at apex. Valva tapering towards apex, dorsal margin sclerotized, slightly concave, apex semi-rounded. Juxta basally broadly rounded, distally membranous. Phallus straight, vesica without cornuti. FEMALE GENITALIA Not known. DISTRIBUTION PHILIPPINES: Luzon (Ifugao, Mountain Province). Collected at altitudes between 2000 and 2100 m. DNA BARCODING A maximum intraspecific p-distance of 0.2% is found between specimens MFNLEP-PYRALPHIL01-D10 from Mountain Province and MFNLEP-PYRALPHIL01-H01 from Ifugao on Luzon. ETYMOLOGY The name is derived from the type locality, Mount Polis, on Luzon island. Micraglossa kianganensis Léger, sp. n. https://zoobank.org/ FD0D400C-4645-4C66-996C-9A6747AD034F Figs. 19, 76. MATERIAL Holotype: ♂ (specimen identifier MTD11400, DNA barcode BC MTD 01473, genitalia on slide TL1296♂; BOLD sample ID PYRG626-11). PHILIPPINES: Luzon, Ifugao, Kiangan, 750 m, 10/11/1985 (J. Settele). Deposited in MTD. DIAGNOSIS In male genitalia (Fig. 76), the slender and wavy gnathos lacks the subapical dorsal conical projection observed on the other congeneric species from the Philippines. Females are not known. HABITUS Forewing length 4 mm, ground color cream and brown. Antemedian band wavy, edged with cream lines. Median area with a mix of cream and brown scales. Postmedian line well marked, S-shaped, running straight down to CuA1, meeting subterminal line at half length, then bent inwardly with 90° angle, running straight towards base, then bent downwards towards dorsum. Subterminal line fuzzy, cream, medially incurved inwards. Margin cream. Fringe cream with brown spots. Hindwing light copper-color. MALE GENITALIA Uncus about 1.4 X tegumen arm length, regularly bent downwards, slender, with scattered setae dorsally, apex ventrally with short tooth pointing downwards. Gnathos projection about 0.9 X uncus length, slender, evenly curved downwards, distal 1/4 straightened, tip pointed downwards. Valva dorsal margin sclerotized, strongly concave; ventral margin basally straight, conspicuously curved upwards on distal half; apex broadly rounded. Juxta tongue-shaped. Phallus straight, vesica without cornuti. FEMALE GENITALIA Not known. DISTRIBUTION PHILIPPINES: Luzon (Ifugao). Collected at an altitude of 750 m. ETYMOLOGY Name derived from Kiangan, the locality where the specimen was caught. CRAMBINAE Latreille, 1810 Type genus : Crambus Fabricius, 1798 = Crambina Zeller, 1847: 745 = Tetrachila Hübner, 1818: 23, 28, 30, [34] DIPTYCHOPHORINI Gaskin, 1972 Glaucocharis Meyrick, 1938 Glaucocharis Meyrick, 1938. Type species : Glaucocharis stella Meyrick, 1938 Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 24
= Pagmania Amsel, 1961: 332. Type species: Pagmania bilinealis Amsel, 1961. Błeszyński, 1965, p. 51 (syn.) = Pareromene Osthelder, 1941: 366. Type species: Pareromene rebeli Osthelder, 1941. Gaskin, 1985, p. 11 (syn.) = Ditomoptera Hampson, 1893: 52, 179. Type species: Ditomoptera minutalis Hampson, 1893. DIAGNOSIS Forewing with conspicuous antemedian and postmedian lines, apex usually with apical streak, termen protruding outwards at apex, below apex with an indentation reaching tip of M1, often with a secondary indentation at tip of M3 (W. Li & Li, 2012b). Male genitalia with the following characteristics: uncus and gnathos elongate, narrow, of various shapes; valva long and narrow, with narrow cucullus, costal process sclerotized, elongate, narrow, pointed outwards or upwards. Female genitalia with short papillae anales coalesced dorsally; posterior and anterior apophyses over twice the tergite length; antrum usually tubular or funnelshaped; ductus bursae long, narrow; corpus bursae rounded or ovate, signum present or absent (W. Li & Li, 2012b; pers. obs.). DISTRIBUTION Known from the Afrotropics, the Palearctic, Oriental, and Australasian regions. Nine species are reported here from the Philippines: Glaucocharis lathonia (Błeszyński, 1966), Glaucocharis clytia (Błeszyński, 1966), Glaucocharis negrosensis sp. n. , Glaucocharis hamulus sp. n. , Glaucocharis kayumanggi sp. n. , Glaucocharis kabundukanis sp. n. , Glaucocharis altissima sp. n. , Glaucocharis uncusellus sp. n. , Glaucocharis sungay sp. n. PHYLOGENETIC RELATIONSHIPS Glaucocharis belongs to the Diptychophorini, the mostbasal tribe of Crambinae (Léger et al., 2019). Glaucocharis clytia (Błeszyński, 1966) Figs. 20, 77, 136. Pareromene clytia Błeszyński, 1966: 459, fig. 20, pl. 40 fig. 3. Type locality: Indonesia, Sumatra, Fort de Kock. Glaucocharis clytia (Błeszyński, 1966): Gaskin 1974: 192-194, figs. 5, 22. MATERIAL Material examined: 7 ♂, 6 ♀ (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Glaucocharis hamulus sp. n. , Glaucocharis kabundukanis sp. n., and Glaucocharis species of the ajaxella group. DIAGNOSIS Glaucocharis clytia (Fig. 20) is very similar in the forewing pattern to G. kabundukanis sp. n. and G. hamulus sp. n. In male genitalia (Fig. 77), the bifid costal projection unambiguously separates this species from other Glaucocharis species from the Philippines. The female genitalia (Fig. 136) share the cruciform-shaped signum on corpus bursae with G. kabundukanis sp. n. and species from the ajaxella species group from Papua, but the two sharp prongs of the antrum posterior margin projected posterad separate this species from other Glaucocharis species. DESCRIPTION OF THE MALE GENITALIA (FIG. 77) Uncus ca 7/10 X tegumen length, slender, apex pointed, with ventral and dorsal patches of setae. Gnathos 9/10 X uncus length, slender, straight, with small apical tip pointing upwards. Tegumen arms narrow, with subtriangular bump on posterior margin. Costal process with ventral arm ca 1.5 X valva length, dorsal arm much shorter, S-shaped. Valva triangular, dorsal and ventral margins straight, with 3-4 sclerotized bristles at its base, valva apex pointed. Juxta elongate, with apex conspicuously notched. Phallus slender, straight. Vesica with one short cornutus. DISTRIBUTION INDONESIA: Sumatra. MALAYSIA: Borneo. PHILIPPINES: Mindanao, Mindoro, Negros. Collected at altitudes between 750 and 1300 m. DNA BARCODING The highest intraspecific divergence observed is of 4.3% between MFNLEP030 from Negros and MFNLEP031 from Mindoro. REMARKS This is the first description of the male genitalia. This species is recorded here for the first time from the Philippines. Glaucocharis lathonia (Błeszyński, 1966) Figs. 21, 78, 137. Pareromene lathonia Błeszyński, 1966: 459, figs. 12, 19, pl. 40 fig. 2. Type locality : Moluccas, W Obi, Obi Lake. Glaucocharis lathonia (Błeszyński, 1966): Gaskin, 1985, p. 21, figs. 23, 89, 94. MATERIAL Material examined: 2 ♂, 17 ♀ (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh) DIAGNOSIS In the forewing (Fig. 21), the zigzag antemedian line as well as the notch at dorsal 1/3 of the postmedian line separates this species from other Glaucocharis species found in the Philippines. In male genitalia (Fig. 78), the costal process projecting posterad into a long, narrow spine reaching beyond valval apex separates this species from other Glaucocharis species. In female genitalia (Fig. 137), the elongatetongue-shaped ventral sclerotization of the antrum and the rounded pouch at midlength of ductus bursae separates this species from other Glaucocharis species. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 25
into a tip, and the juxta apex is deeply notched. Females are unknown. HABITUS As in Glaucocharis kabundukanis sp. n. MALE GENITALIA (FIG. 81) Uncus as long as tegumen arm length, slender, regularly curved downwards, apex spatulate, slightly pointing downwards. Gnathos projection about 5/6 of uncus length, slender, narrowing towards apex, apex tip pointed upwards. Tegumen arms slightly angled at distal 1/3. Valva basally with three conspicuous, sclerotized bristles; dorsal and ventral margin straight, valva apex rounded; costal process forming narrow arm, distally projecting beyond valva, apex bent upwards, forming pointed tip. Juxta basally rounded, apically broadly notched. Vesica with row of ca 15 cornuti. FEMALE GENITALIA Unknown. DISTRIBUTION PHILIPPINES: Luzon (Benguet), Negros. Collected at altitudes between 750 and 1400 m. DNA BARCODING The highest intraspecific divergence observed is of 1.9% between samples MFNLEP-PYRALPHIL10-A11 and MFNLEPPYRALPHIL11-C03, both from Benguet (Luzon). ETYMOLOGY From the Latin hamulus, i, hook, refering to the hookshaped apex of the costal process in male genitalia. Glaucocharis uncusellus Léger, sp. n. https://zoobank.org/F1890790-8270-44CFB878-0A66E2F3920C Figs. 24, 82, 140. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_693863, DNA voucher MFNLEP999, genitalia on slide TL1310♂; BOLD sample ID PYPHI354-22, Genbank Accession Number PP197031). PHILIPPINES: Samar, Concord Cadacan, 150 m, 22-24.04.1997 (W. Mey, W. Speidel). Deposited in MfN Paratypes: 1 ♂ (specimen identifier coll.mfnberlin.de_u_5e4759), 1 ♀ (specimen identifier coll.mfnberlin.de_u_343871) (see detailed information on Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Glaucocharis melistoma (Meyrick, 1931); Glaucocharis furculella Wang & Sung, 1988; Glaucocharis reniella Wang & Sung, 1988; Glaucocharis tridentata Li & Li, 2012; Glaucocharis unipunctalis Sasaki, 2007. DIAGNOSIS The general dark brown pattern of the forewing (Fig. 24), the regularly arched antemedian line, and the b-shaped stigma separate this species from other Glaucocharis from the Philippines. With the above listed species, this species shares similar male genitalia (Fig. 82): The gnathos projection is spatulate, covered with a patch of hairs, the valva is distally narrowed, projecting upwards, and the costal process forms a thin basal arm projecting upwards. The short uncus and the S-shaped basal arm of the valva unambiguously separates this species from other Glaucocharis species. In female genitalia (Fig. 140), the membranous antrum, the tubular sclerotized colliculum, and the spherical corpus bursae with one single signum separates this species from other Glaucocharis species. HABITUS (FIG. 24) Forewing length 4 mm; ground color dark brown. Antemedian line evenly arched, cream. Broad ocher suffusion at costa in basal half, with a mix of cream and brown scales in distal half. Median area scattered with cream scales, cubital area with patch of ocher scales. Postmedian stigma forming b-shaped cream dash filled with ocher. Postmedian line barely marked at costa, zigzagging near margin on middle, then meeting dorsum at 4/5. Apical ocher blotch with cream streak. Margin ocher, interspersed with two dark brown spots. Hindwing dirty white. MALE GENITALIA (FIG. 82) Uncus ca half as long as tegumen arm, triangular, with apex rounded. Gnathos projection twice as long as uncus, slender, apex larger, spatula-shaped, with patch of sclerotized spines surrounded with hairs. Valva with costal arm projected upwards, bent at 2/5 outwards with 75° angle, then bent upwards at 4/5; valva subtriangular in basal 2/3, distal 1/3 projecting upwards into slender arm with rounded tip. Juxta basally rounded, distally forming two arms surrounding phallus. Phallus long, sclerotized, slender. FEMALE GENITALIA (FIG. 140) Papillae anales missing in the specimen investigated. Anterior apophyses ca 2.2 X length of tergite VIII. Antrum membranous. Colliculum ca half of ductus bursae length, tubular, lightly sclerotized. Ductus bursae long, narrowed medially, conspicuously enlarged on distal 1/4 at ductus seminalis connection. Corpus bursae globular, scobinate, with one rounded signum. DISTRIBUTION PHILIPPINES: Mindanao (Davao Oriental), Negros, Samar. Collected at altitudes between 150 and 1050 m. DNA BARCODING The two samples MFNLEP-PYRALPHIL07-C10 from Negros and MFNLEP999 from Samar shows identical DNA barcodes. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 32
ETYMOLOGY From “uncus” and the diminutive Latin suffix “–ellus”, referring to the short-sized uncus in male genitalia. Glaucocharis kayumanggi Léger, sp. n. https://zoobank.org/ E9FD5C3D-4BEB-4144-A5B3-D7A24900F20D Figs. 25, 26, 83, 141. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_bc1764, DNA voucher MFNLEP-PYRALPHIL10-D09, genitalia on slide TL1321♂; BOLD sample ID PYPHI422-23, Genbank Accession Number PP211078). PHILIPPINES: Luzon, Nueva Vizcaya, Bald Mountains, Santa Fe, 1150 m, 11-13.11.1997 (K. Ebert, W. Mey, M. Nuss). Deposited in MfN. Paratypes: 12 ♀ (specimen identifiers MfN: coll.mfnberlin.de_u_137c30, cc22c2, bd83a4, 7b7c16, 4c185f, 1453bc, 292a90, 89b6f7, 3f58c4; PNM: id.bioseasia.org_u_0235c0, 0235c2; NHMUK: NHMUK013706262), 1 ♂ (specimen identifier coll.mfn-berlin.de_u_7c8ebe) (see detailed information on Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh). SIMILAR SPECIES Glaucocharis sungay sp. n. , Glaucocharis negrosensis sp. n. DIAGNOSIS Among the Philippines Glaucocharis species, Glaucocharis kayumanggi sp. n. , G. sungay sp. n. , and G. negrosensis sp. n. are easily distinguished by the general brown color of the forewing in female specimens, while other species exhibit a mix of white, fulvous, and brown scales. Glaucocharis kayumanggi sp. n. can only be confidently separated from G. sungay sp. n. and G. negrosensis sp. n. by examination of genitalia. In male genitalia (Fig. 83), this species shares with G. sungay sp. n. and G. negrosensis sp. n. the club-shaped gnathos apex, the ventro-basal hookshaped process of the valva, and the long, narrow, sclerotized phallus. In G. kayumanggi sp. n. , the hook-like ventral process of the valva is thinner than in G. sungay sp. n. and longer than that of G. negrosensis sp. n. , almost reaching valval dorsal margin. The sacculus apex splits in two, with the dorsal arm extending beyond ventral process distally and ventrally forming a conspicuous lobe. In female genitalia (Fig. 141), the oblong corpus bursae with the starlike signum separates this species and G. sungay sp. n. from all Glaucocharis species (female of G. negrosensis sp. n. not known). The triangular indentation of the antrum ventral margin best separates this species from G. sungay sp. n. , where the antrum margin is evenly rounded. HABITUS (FIGS. 25, 26) Forewing length 5.4-6.4 mm (n = 6). Male forewing (Fig. 26) with pale yellow ground color, suffused with brown scales. Antemedian line originating at costal 1/3, arched outwardly, then bent inwards towards dorsum, meeting dorsum at right angles, cream. Distal discoidal stigma forming short transversal dark brown streak. Postmedian line originating at costal 3/4, broadly arched outwards, jagged at CuA2 vein, meeting dorsum with an angle of 80°, cream. Subapical V-shaped cream streak. Subterminal area speckled with dark brown. Margin with six black spots, the three near tornus more conspicuously marked. Fringes metallic brown. Hindwing white. Female forewing (Fig. 25) with metallic brown ground color. Antemedian line curved in costal half, then bent inwards towards dorsum, cream, distally edged with darker brown. Median area uniformly metallic brown, small fulvous blotch at costa. Distal discoidal stigma forming short transverse fulvous streak. Postmedian line conspicuously arched outwards towards margin, wavy, basally and distally edged with dark brown. Apex fuscous with thin metallic streak. Subterminal area brown to copper, with darker spots. Fringes metallic brown, white apically, cream at margin notch. Hindwing pale yellow, apex metallic brown. MALE GENITALIA (FIG. 83) Uncus about 4/5 of tegumen arm length, slender; lateral margin projecting downwards into a tooth at basal 1/4, uncus conspicuously narrowed at 3/4; apex duck-beak shaped. Gnathos arms joining at basal 1/4, gnathos projection as long as uncus, slender, apex club-shaped, covered with small teeth, densely haired. Valva with ventro-distal process hook-shaped, pointing upwards, strongly sclerotized; sacculus split in two: ventral arm slender with subtriangular apex; dorsal arm more strongly sclerotized, dorsal margin straight, ventral margin forming a conspicuous rounded bump, apex reaching beyond ventral hook-shaped projection, rounded, pointing downwards. Juxta with ventral keel-like projection at base; juxta plate enlarging in basal half, abruptly narrowed at midlength, distal projection narrow, apex tongue-shaped. Phallus long, thin, sclerotized, vesica devoid of cornuti. FEMALE GENITALIA (FIG. 141) Posterior apophyses ca 2.2 X length of tergite VIII. Intersegmental membrane VIII-IX ca 1.3 X length of tergite VIII. Anterior apophyses ca 2 X length of tergite VIII. Antrum funnel-shaped, ventral posterior margin V-shaped, strongly sclerotized. Antrum-colliculum junction marked, short, membranous. Colliculum narrow, ca 1/10 of ductus length, incurved, sclerotized. Ductus bursae long, roughly straight. Ductus seminalis branching at corpus opening. Corpus bursae oblong, roughly as long as ductus bursae, scobinate, with well-marked star-like signum near corpus opening. DISTRIBUTION PHILIPPINES: Luzon (Mountain Province, Nueva Vizcaya). Collected at altitudes between 1150 and 2100 m. DNA BARCODING The highest intraspecific divergence observed is 0.33% between MFNLEP-PYRALPHIL10-D09 (Luzon: Nueva VizHalf of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 33
caya) and MFNLEP-PYRALPHIL08-C03 (Luzon: Mountain Province). ETYMOLOGY From the Tagalog kayumanggi, brown, refering to the brownish color of the forewings of the females. Glaucocharis sungay Léger, sp. n. https://zoobank.org/ D68F24B4-38FF-47B5-91B9-287740C7EE0C Figs. 84, 142. MATERIAL Material examined: Holotype: ♂ (specimen identifier coll.mfn-berlin.de_u_5bf419, DNA voucher MFNLEPPYRALPHIL08-F09, genitalia on slide TL1204♂; BOLD sample ID PYPHI218-22, Genbank Accession Number PP196898). PHILIPPINES: Luzon, Albay, Amater, Mount Malinao, submontane forest, 400 m, 25-26.03.2000 (K. Ebert, W. Mey). Deposited in MfN. Paratypes: 1 ♂ (specimen identifier coll.mfnberlin.de_u_ab87f5), 2 ♀ (specimen identifiers coll.mfnberlin.de_u_ae0f07, e19c94) (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Glaucocharis kayumanggi sp. n. , G. negrosensis sp. n. DIAGNOSIS This species is externally identical to Glaucocharis kayumanggi sp. n. (see Fig. 25, Fig. 26) and G. negrosensis sp. n. and can only be reliably identified by examination of genitalia. In male genitalia (Fig. 84), the gnathos is broader than in G. kayumanggi sp. n. and bears small teeth dorsally on apical 1/4, the stout ventral hook-like process of the valva is larger than that in G. kayumanggi sp. n. and G. negrosensis sp. n. , and the sacculus does not extend distally beyond the ventral process. In female genitalia (Fig. 142), the evenly incurved margin of the antrum ventral margin best separates this species from G. kayumanggi sp. n. , where the antrum margin is indented. HABITUS As in Glaucocharis kayumanggi sp. n. MALE GENITALIA (FIG. 84) Uncus ca 2/3 of tegumen arm length, dorsally glabrous, ventral margin undulate, apex pointed. Gnathos projection about 5/3 of uncus length, distal half slightly larger, tongue-shaped, dorsally covered with tiny teeth, apex densely haired. Valva with strongly sclerotized cucullus, projecting distally into a thickly sclerotized hook pointing upwards; sacculus dorsal margin straight, apex conspicuously indented, with dorsal lobe narrower, projecting beyond ventral lobe. Juxta base notched, medially conspicuously widened, apically projected into two thin arms with pointed tip. Phallus slender, curved, sclerotized; vesica without cornuti. FEMALE GENITALIA (FIG. 142) Posterior apophyses ca 2.5 X length of tergite VIII. Intersegmental membrane VIII-IX 1.5-2 X length of tergite VIII. Anterior apophyses ca 2.1 X length of tergite VIII. Antrum narrow, tubular, strongly sclerotized, ventral margin evenly incurved. Antrum-colliculum junction marked, narrow, membranous. Colliculum short, ca 1/7 of ductus length, tubular, sclerotized. Ductus bursae long, curved twice in basal half, roughly straight on distal half. Ductus seminalis branching at distal 1/3 of ductus bursae. Corpus bursae oblong, slightly longer than ductus bursae, scobinate, with well-marked star-like signum near corpus opening. DISTRIBUTION PHILIPPINES: Luzon (Quezon, Albay), Mindoro. Collected at altitudes between 400 and 1300 m. DNA BARCODING The highest intraspecific divergence observed is of 1.15% between MFNLEP-PYRALPHIL07-F10 (Luzon) and MFNLEP-PYRALPHIL07-G10 (Mindoro). ETYMOLOGY From the Tagalog sungay, horn, referring to the hookshaped projection in male genitalia. This name was proposed by Clister Pangantihon and Beatriz Christalle Seno. Glaucocharis negrosensis Léger, sp. n. https://zoobank.org/ 3325F05B-56BF-48E8-98C2-4526780D89BB Fig. 85 MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_c1f971, DNA voucher MFNLEP-PYRALPHIL08-G01, genitalia on slide TL1360♂; BOLD sample ID PYPHI221-22, Genbank Accession Number PP196901). PHILIPPINES: Negros, Negros Oriental, Patag, Lake Danao, 1400 m, 21.05.1996 ( W. Mey). Deposited in MfN. Paratype: 1 ♂ (specimen identifier coll.mfnberlin.de_u_5145c8) (detailed information on Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Glaucocharis kayumanggi sp. n. , Glaucocharis sungay sp. n. DIAGNOSIS The male of this species is externally identical to Glaucocharis kayumanggi sp. n. and Glaucocharis negrosensis sp. n. and can only be reliably identified by examination of genitalia. In male genitalia, Glaucocharis negrosensis sp. n. can be separated by the narrower, shorter ventro-basal process, the valval innermargin forming two conspicuous Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 34
lobes, the juxta basal arm projected ventrally, and the juxta plate evenly narrowing towards apex. HABITUS As in G. kayumanggi sp. n. MALE GENITALIA (FIG. 87) Uncus ca 4/5 of tegumen arm length, slender, bent downwards at basal 1/4, apex spatulate. Gnathos projection ca 1.1 X uncus length, slender, apex club-shaped, covered with small teeth, densely haired. Valva with cucullus process hook shaped, pointing upwards, strongly sclerotized; sacculus dorsal margin roughly straight, inner margin forming two conspicuous lobes, apex rounded. Juxta basally with stout arm projected ventro-anterad, curved downward; juxta plate basally rounded, narrowing towards apex; apex incurved. Phallus long, thin, sclerotized, vesica devoid of cornuti. FEMALE GENITALIA Not known. DISTRIBUTION PHILIPPINES: Negros. Collected at an altitude of 1400 m. DNA BARCODING The two specimens sequenced have identical DNA barcodes. ETYMOLOGY Derived from Negros island where the species is encountered. Glaucocharis spp. MATERIAL Glaucocharis ♀ sp. 1 (not illustrated): ♀ (specimen identifier coll.mfn-berlin.de_u_3a3401, DNA voucher MFNLEPPYRALPHIL07-E10, abdomen lost). PHILIPPINES: Luzon, Zambales Mountains, Coto, 110 m, 05-06.05.1999 (K. Ebert, W. Mey). Glaucocharis ♀ sp. 2 (Fig. 143): 1 ♀ (specimen identifier coll.mfn-berlin.de_u_b8b597, DNA voucher MFNLEPPYRALPHIL07-B11, genitalia on slide TL1079F). PHILIPPINES: Leyte, Lake Danao, 650 m, 14-17.04.1997 (W. Mey, W. Speidel). Glaucocharis ♀ sp. 3 (Fig. 144): 1 ♀ (specimen identifier coll.mfn-berlin.de_u_86abe6, DNA voucher MFNLEPPYRALPHIL07-F11, genitalia preparation TL1081F). PHILIPPINES: Mindoro, Occidental Mindoro, Mount Baco Pass, 1150 m, 14.01.1998 (W. Mey, V. Samarita). Glaucocharis ♀ sp. 4 (not illustrated): 1 ♀ (specimen identifier coll.mfn-berlin.de_u_613241, DNA voucher MFNLEP-PYRALPHIL07-H11, genitalia on slide TL1083F). PHILIPPINES: Mindanao, Davao oriental, Mount Agtuuganon, 1050 m, 28.05-07.06.1996 (W. Mey). Glaucocharis ♀ sp. 5 (not illustrated): 1 ♀ (specimen identifier coll.mfn-berlin.de_u_fcd9bf, DNA voucher MFNLEP-PYRALPHIL10-G10, genitalia on slide TL1331F). PHILIPPINES: Luzon, Laguna, Los Baños, Mount Makiling, 850 m, 16.03.2000 (K. Ebert, W. Mey). Glaucocharis ♀ sp. 6 (not illustrated): 1 ♀ (specimen identifier coll.mfn-berlin.de_u_590635, DNA voucher MFNLEP-PYRALPHIL10-H10, genitalia preparation TL1332F), 1 ♀ (coll.mfn-berlin.de_u_359dc3, DNA voucher MFNLEPPYRALPHIL08-A03, abdomen lost). PHILIPPINES: Luzon, Laguna, Los Baños, Mount Makiling, 850 m, 16.03.2000 (K. Ebert, W. Mey). REMARKS Six further species could be delimited using evidence from DNA barcoding, female genitalia, and habitus. However, I refrain from describing new species from unique female specimens here. Roxita sp. MATERIAL 1 ♂ (specimen identifier coll.mfn-berlin.de_u_a7fa3, DNA voucher MFNLEP-PYRALPHIL07-H07, genitalia on slide TL1057♂). PHILIPPINES: Leyte, Mount Balocaue, 719 m, 20-22.09.2011 (S. Naumann). REMARKS The unique male specimen of this species presumably belongs to a new species of Roxita. Unfortunately, much of the male genitalia was destroyed during the DNA extraction, so I decided not to formally describe this species but rather wait for additional material. Gargela Walker, 1864 Gargela* Walker, 1864: 815. Type species: Gargela subpurella Walker, 1864. = Mixophyla Meyrick, 1887: 269. Type species: Crambus ermineus Moore, 1886 = Angonia Snellen, 1893: 54–56. Type species: Angonia crambidalis Snellen, 1893. Hampson 1896: 190 (syn.) = Mixophila* Hampson, 1896: 190 DIAGNOSIS Forewing usually silvery white with curved median and postmedian lines (Song et al., 2009). In male genitalia, Gargela species show the following characters: uncus short, beak-shaped, with two characteristic ventral basal arms bearing a tuft of thick setae; gnathos short, beak-shaped; valva with costal arm narrow, sclerotized, elongate, with apex pointed upwards or posterad; and juxta distally with two lateral arms with scattered setae. In female genitalia, Gargela species show the following characters: papillae anales evenly rounded, posterior apophyses short, ductus bursae usually covered with spines in basal half, and corpus bursae with two signa. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 35
Figs 82-87. Male genitalia of Glaucocharis and Gargela species. Fig. 82. Glaucocharis uncusellus sp. n. , holotype, slide TL1310♂. Fig. 83. Glaucocharis kayumanggi sp. n. , holotype, slide TL1321♂. Fig. 84. Glaucocharis sungay sp. n. , holotype, slide TL1204♂. Fig. 85. Glaucocharis negrosensis sp. n. , holotype, slide TL1360♂. Fig. 86. Gargela minuta Song, Chen & Wu, 2009, TL1210M♂. Fig. 87. Gargela aculea sp. n. , holotype, slide TL1207♂. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 36
Figs 88-93. Male genitalia of Gargela and Ancylolomia species. Fig. 88. Gargela acutibrachium sp. n. , paratype, slide TL1205♂. Fig. 89. Gargela polyacantha Li, 2019, slide TL1206♂. Fig. 90. Gargela xanthocasis (Meyrick, 1897), slide TL1235♂. Fig. 91. Gargela bidentella sp. n. , holotype, slide TL1325♂. Fig. 92. Ancylolomia chrysographellus (Kollar & Redtenbacher, 1844), adapted from fig. 1, p. 29 of Bleszynski (1970b). Fig. 93. Ancylolomia orchidea Bleszynski, 1970, slide TL1221♂. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 37
Figs 94-99. Male genitalia of Ancylolomia and Chilo species. Fig. 94. Ancylolomia westwoodi Zeller, 1863, slide TL1062♂. Fig. 95. Chilo auricilius Dudgeon, 1905, adapted from fig. 38, p. 136 of Bleszynski (1970c). Fig. 96. Chilo infuscatellus Snellen, 1890, adapted from fig. 27, p. 127 of Bleszynski (1970c). Fig. 97. Chilo luteellus (Motschulsky, 1866), slide TL1319♂. Fig. 98. Chilo pulverata (Wileman & South, 1917), slide NHMUK n° 7637. Fig. 99. Chilo sacchariphagus (Bojer, 1856), slide TL1378♂. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 38
Figs. 100-105. Male genitalia of Chilo, Eschata and Calamotropha species. Fig. 100. Chilo suppressalis (Walker, 1863), adapted from fig. 120, p. 180 of Bleszynski (1970c). Fig. 101. Eschata cf. miranda Bleszynski, 1965, slide TL1215♂. Fig. 102. Calamotropha atkinsoni Zeller, 1863, adapted from fig. 129, plate LI of Bleszynski (1970b). Fig. 103. Calamotropha obliterans (Walker, 1863), slide TL1304♂. Fig. 104. Calamotropha unicolorellus (Zeller, 1863), slide TL1405♂. Fig. 105. Calamotropha philippinensis sp. n. , paratype, slide TL1211♂. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 39
DISTRIBUTION Known from the Oriental and Australasian (Papua) regions. Six species are reported from the Philippines: Gargela minuta Song et al., 2009, Gargela valvaspinae sp. n. , Gargela acutibrachium sp. n. , Gargela polyacantha Li, 2019, Gargela xanthocasis (Meyrick, 1897), Gargela negrosensis sp. n. PHYLOGENETIC RELATIONSHIPS Molecular phylogenies recovered Gargela as part of the Diptychophorini, sister to the three other Diptychophorini included in the study (Diptychophora Zeller, 1866, Glaucocharis Meyrick, 1938, Microcausta Hampson, 1895) (Léger et al., 2019). Gargela minuta Song et al. , 2009 Figs. 27, 86, 145. Gargela minuta Song et al., 2009, p. 55, figs. 12, 24. Type locality: Taiwan, Lanyu Island, 270 m. MATERIAL 7 ♂, 8 ♀, 2 unsexed (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Gargela distigma Song et al., 2009, Gargela polyacantha Li, 2019, Gargela bidentella sp. n. DIAGNOSIS Among Gargela species of the Philippines, Gargela minuta can be separated on the forewing by the dark brown spots and the ocher coloration of the fringes (Fig. 27). Gargela minuta shows a nearly identical forewing pattern to G. bidentella sp. n., but the fringe spots are more pronounced in G. minuta than G. bidentella sp. n. Both species are unambiguously separated by examination of male genitalia (Fig. 86); the bulky costal process with dorsal bump, the narrowed distal part of the valva, and the tiny cornuti of the vesica separates G. minuta from other Gargela species. This species has similar male genitalia as in G. distigma; however, in the latter species, the valva has a notched apex, and the vesica lacks the tiny cornuti. In female genitalia (Fig. 145), the following characters separate G. minuta from other Gargela species: the papillae anales are ventrally produced posterad, the posterior apophyses are bent upwards at basal 1/3, the basal half of ductus is covered with tiny spines, and the corpus bursae is pear-shaped with two thorn-shaped signa. DISTRIBUTION PHILIPPINES: Luzon (Nueva Vizcaya, Zambales, Laguna), Mindanao (Davao Oriental), Mindoro; Negros. TAIWAN. Collected at altitudes between 150 and 1150 m. DNA BARCODING The species delimitation analysis recovered two MOTUs, one for the specimens from Luzon (North Luzon, Zambales, Laguna) and Mindoro and one for the unique female specimen from Mindanao (Davao Oriental). The highest intraspecific divergence observed is of 3.97% between samples MFNLEP-PYRALPHIL07-A08 from Mindanao (Davao) and MFNLEP-PYRALPHIL09-F09 from Luzon (Laguna). Haplotype from the specimen from Taiwan (DNA voucher MFNLEP995) differs by 0.16% from the haplotype from Luzon and Mindoro (see Fig. 179h). REMARKS This is the first record of this species from the Philippines. Gargela aculea Léger, sp. n. https://zoobank.org/AC6452D7-B53A-4FBEB7C0-A0CD01B85E79 Figs. 28, 87, 146. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_d6f70c, DNA voucher MFNLEP-PYRALPHIL08-A06, genitalia on slide TL1207♂; BOLD sample ID PYPHI160-22, Genbank Accession Number PP196844). PHILIPPINES: Negros, Patag, 750 m, 20-25.05.1996 (W. Mey). Deposited in MfN. Paratypes: 5 ♀ (coll.mfn-berlin.de_u_613e87, 386de0, fcb937, 4e1641, a5452e) (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). Other specimen examined: 1 ♀ (detailed information in table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Gargela hastatela Song et al., 2009; G. hainana Song et al., 2009; G. renatusalis (Walker, 1859). DIAGNOSIS In the forewing, the well-marked and evenly curved black median and subterminal lines as well as the conspicuous blotch formed by the median line at dorsum (Fig. 28) are unique among Gargela species of the Philippines. These characters are found elsewhere in Gargela hastatela Song et al., 2009, G. hainana Song et al., 2009, and G. renatusalis (Walker, 1859), all occurring in China. In male genitalia (Fig. 87), the dorsal spine of the costal process, the ventrally indented valva, and the three very long cornuti followed by the group of roughly 70 cornuti will separate this species from its congeners. In female genitalia, the evenly rounded posterior margin of the papillae anales, the sclerotized and wrinkled basal part of ductus bursae, and the globular corpus bursae with two lanceolate signa separate Gargela aculea sp. n. from other Gargela species. HABITUS (FIG. 28) Forewing length 5.0-6.4 mm (n = 6); ground color snow white. Median line thin, dark brown, broadly incurved outwards, ending at large dark brown patch at dorsum. Postmedian line thin, brown, starting at 7/10 of costa, broadly incurved outwards, ending on dorsum near tornus. SubterHalf of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 40
minal area with three marked cream yellow dashes at R4, R5, and M1, fourth dash faintly marked at M2; yellowish patch between M3 and CuA2, marked with dark brown between CuA1 and CuA2. Margin thinly marked with black from apex down to M3, with dashes between R5 and M3. Fringe white, with black distal blotches at R5, M1, M2, CuA1, and CuA2. Hindwing white, tornus bearing tuft of thin brown iridescent scales in males. MALE GENITALIA (FIG. 87) Uncus ca half of tegumen arm length, beak-shaped, ventrally covered with thick setae, dorso-apically setose, apex pointing downwards. Gnathos projection short, curved downwards, thinly dentate, apex pointed. Valva with broad sacculus, abruptly narrowed at distal 1/4, apex pointed; costal process fused to valva, forming a dorsal tooth at midlength, posteriorly projecting beyond valva, apex curved upwards. Juxta base narrow; apex forming two arms about half as long as total length, dentate and setose on its innerside. Phallus straight, apex lightly sclerotized. Vesica covered with 60+ small cornuti, apically with three long and slender curved cornuti. FEMALE GENITALIA (FIG. 146) Papillae anales posterior margin regularly rounded. Posterior apophyses ca 2.7 X length of tergite VIII. Intersegmental membrane VIII-IX ca 1.4 X tergite length. Anterior apophyses ca 1.7 X tergite length. Antrum membranous, with ventral sclerotized tongue. Colliculum elongate, forming sclerotized circumvolutions. Ductus bursae curved in basal half, straight on distal half, enlarging towards corpus opening. Ductus seminalis branching at midlength of ductus bursae. Corpus bursae globular, reticulate, with two lanceolate signa, one at corpus opening, the other at middle of corpus. DISTRIBUTION PHILIPPINES: Leyte, Luzon (Quezon), Mindanao, Negros. Collected at altitudes between 650 and 2100 m. DNA BARCODING The species delimitation analysis revealed four different MOTUs for the populations of North Luzon (Mountain Province), Luzon (Quezon), Negros, and Mindanao + Leyte. Unfortunately, only the MOTU from Negros contained male specimens, precluding unambiguous assignment of these MOTUs to G. aculea sp. n. The highest intraspecific divergence observed is of 4.3% between samples MFNLEPPYRALPHIL07-C07 from Luzon (Quezon) and MFNLEPPYRALPHIL08-B06 from Leyte. ETYMOLOGY From the Latin aculeus, i, sting, refering to the small spine of the valva in male genitalia. REMARKS Specimen MFNLEP-PYRALPHIL08-C06 exhibits slight differences in female genitalia and could represent another closely related species. Future investigation of male specimens will clarify this case. Gargela acutibrachium Léger, sp. n. https://zoobank.org/ DC8217B7-9C33-4BA3-A934-4481FEC32A76 Figs. 29, 88. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_eca446, DNA voucher MFNLEP-PYRALPHIL09-G09, genitalia on slide TL1398♂; BOLD sample ID PYPHI301-22, Genbank Accession Number PP196980). PHILIPPINES: Luzon, Laguna, Mount Makiling, 850 m, 30-31.03.2000 (K. Ebert, W. Mey). Deposited in MfN. Paratypes: 5 ♂ (coll.mfn-berlin.de_u_72eab6, 33a322, 9c8b85, 189117, d44f2d) (detailed information in table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Gargela grandispinata Li, 2019. DIAGNOSIS From the other Gargela species in the Philippines, this species can be separated by the copper color of the fringes towards termen on the forewing (Fig. 29). In male genitalia (Fig. 88), the arm-like costal process at base of valva separates this species from its congeners. Females are not known. HABITUS (FIG. 29) Forewing length 5.0-5.5 mm (n = 4); ground color snow white. Median line broadly arched towards margin. Postmedian line originating at 3/4 of costa, curved towards margin, then inwardly around subterminal spot, running downwards to termen; costally dark brown, dorsally ocher. Subterminal area broadly filled with ocher; conspicuous dark brown blotch between M3 and CuA1. Margin indented at R5-M1; apically dark brown, elsewhere ocher. Fringe white in apical half, copper in dorsal half. Hindwing white, tornus bearing tuft of thin brown iridescent scales in males. MALE GENITALIA (FIG. 88) Uncus about 9/10 of tegumen arm length, with conspicuous ventral triangular lobe at base, dorsally with thin setae, ventrally covered with thick setae, slightly bent downwards on distal 1/4, apex pointed. Gnathos projection about 1/3 of uncus length, slender, directed posterad. Costal process projecting into an arm about 1/3 of valva length. Costal arm fused to valva, elongate, distally curved upwards into a tip. Valva narrowing on distal half, dorsal margin straight, valva apex rounded. Juxta elongate, narrow at base, enlarging on distal half; distal part forming two incurved arms about 1/4 X juxta length, with rounded setose apex. Phallus straight, narrowing towards apex, slightly sclerotized. Vesica with one large cornutus (length = 200 μm) and two rows of densely packed cornuti. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 41
of A. westwoodi found in the Philippines. Furthermore, the saccus anterior margin is conspicuously incurved, while it is straight or slightly rounded in A. westwoodi specimens from the Philippines. In female genitalia (Fig. 151), A. orchidea lacks the bag-shaped sclerites and the interspersed sclerotization on the antrum (Bleszynski, 1970b). DISTRIBUTION PHILIPPINES: Luzon (Cordillera central), Panay (Iloilo). Collected at altitudes between 400 and 2000 m. DNA BARCODING The species delimitation analysis recovered two MOTUs, one for the specimen from North Luzon and one for the specimen from Panay. A p-distance of 6.9% is observed between samples MFNLEP-PYRALPHIL07-F08 (Panay) and MFNLEP-PYRALPHIL08-D12 (Luzon, Ifugao). Ancylolomia westwoodi Zeller, 1863 Figs. 34, 94, 152. Ancylolomia westwoodi Zeller, 1863 b: 11. Type locality : Australia [Terra Vandiemenii] = Ancylolomia westwoodi bitubirosella Amsel, 1959 d: 11, text-fig. 2, pl. 1 fig. 1, pl. 3 fig. 4. Type locality: Iran, Balochistan, Iranshar, 800 m MATERIAL 2 ♂, 1 ♀ (detailed information in Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Ancylolomia orchidea Bleszynski, 1970. DIAGNOSIS Characters of the male genitalia (Fig. 94) and female genitalia (Fig. 152) separate this species from A. orchidea. See diagnosis of A. orchidea. DISTRIBUTION AFGHANISTAN; AUSTRALIA; INDIA; INDONESIA: Java, Sumatra; MALAYSIA; PAKISTAN; PHILIPPINES: Luzon; SRI LANKA (Bleszynski, 1970b). Collected at an altitude of 250 m on the Philippines. DNA BARCODING The two specimens with sample numbers MFNLEP-PYRALPHIL07-E08 and MFNLEP-PYRALPHIL08-C12, both from Luzon, Zambales, diverge by p-dist=1.1% from each other. These two specimens show a divergence 7-9% with specimens of A. westwoodi on BOLD collected in Australia (see Fig. S2a), which is the type locality of the species. REMARKS Ancylolomia westwoodi is widespread all over the Oriental and Australasian regions (Bleszynski, 1970b) and probably represent a species complex rather than one single homogeneous species, as attested by analyses of the COI barcodes. This is the first record for the Philippines. CHILOINI Heinemann, 1865 CHILO ZINCKEN, 1817 Chilo Zincken, 1817: 33. Type species: Tinea phragmitella Hübner, 1810 = Borer* Guenée, 1862: 68-70. Type species: Phalaena saccharalis Fabricius sensu Guenée, 1862. Tams 1942: 67 (syn.) = Chilona Sodoffsky, 1837: 94 = Chilotraea Kapur, 1950: 402, 403. Type species: Chilo infuscatellus Snellen, 1890. Błeszyński 1962 d: 1 (syn.) = Diphryx Grote, 1881 d: 273. Type species: Diphryx prolatella Grote, 1881. Hampson 1896: 954 (syn.) = Hypiesta Hampson, 1919 a: 538. Type species: Hypiesta argyrogramma Hampson, 1919. Błeszyński, 1965, p. 102 (syn.) = Nephalia Turner, 1911: 113. Type species: Nephalia crypsimetalla Turner, 1911. Błeszyński 1966: 478 (syn.) = Silveria Dyar, 1925: 10. Type species: Silveria hexhex Dyar, 1925. DIAGNOSIS Błeszyński provided a world revision for the genus (Bleszynski, 1970), and Landry provides a redescription of the genus (Landry, 1995). Species of Chilo have yellow to brown forewings with subterminal line, devoid of longitudinal lines, with many species having metallic scales, which are hypothesized as the apomorphy for the genus by Landry (Bleszynski, 1970c; Landry, 1995). Male genitalia have the following characters: uncus short and stout; gnathos as long as uncus; valva rather simple; vinculum conspicuously projected; pseudosaccus present; juxta usually with long arms, sometimes assymetrical (Bleszynski, 1970c). Female genitalia with papillae anales coalesced dorsally and ventrally; posterior apophyses roughly the length of tergite VIII; anterior apophyses 2-3 X tergite length; sterigma absent; antrum sclerotized; ductus bursae often with longitudinal sclerotized ridges; corpus bursae variable in shape, with or without cornuti. DISTRIBUTION Known from all continents except Antarctica (Bleszynski, 1970c; Nuss et al., 2003–2023). The genus shows its highest diversity in the Afrotropics (Bleszynski, 1970c). Some pest species show wide distributions. Seven species are reported from the Philippines: Chilo auricilius Dudgeon, 1905, Chilo infuscatellus Snellen, 1890, Chilo luteellus (Motschulsky, 1866), Chilo pulverata (Wileman & South, 1917), Chilo polychrysus (Meyrick, 1932), Chilo sacchariphagus (Bojer, 1856), and Chilo suppressalis (Walker, 1863). PHYLOGENETIC RELATIONSHIPS The genus Chilo is part of the Chiloini (Léger et al., 2019). Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 48
Chilo auricilius Dudgeon, 1905 Figs. 35, 95, 153. Chilo auricilia Dudgeon, 1905: 405. Type locality : India, Burogah, N. Bihar. = Diatraea auricilia (Dudgeon): Fletcher 1928: 58; Gupta 1940: 799. = Chilotraea auricilia (Dudgeon): Kapur 1950: 408. = Chilo popescugorji Błeszyński, 1963: 179, fig. 63, type locality: Taiwan, China; Bleszynski, 1970: 135 (syn.). MATERIAL 7 ♀ (detailed information on Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Chilo polychrysus (Meyrick, 1932). DIAGNOSIS Chilo auricilius, also known as the Gold-fringed Stemborer, is a widespread species in South-East Asia. It can be recognized by the silver suffusion as well as the thickly marked silver median line in males and females (Fig. 35). This species is highly similar to Chilo polychrysus in habitus, which led to erroneous reports from the Philippines (Barrion et al., 1990). Examination of male genitalia (Fig. 95) enables unambiguous identification of this species: pars basalis at base of valva absent (thorn-shaped pars basalis at base of valva in C. polychrysus); saccus narrow, conspicuously protruding anterad; juxta with two medium-length symmetrical arms not extending beyond basal-costal angle of valva, straight (two arms curved around the phallus in C. polychrysus); phallus with ventro-lateral arms roughly curved, reaching subapical part of phallus (strongly curved, reaching apex of phallus in C. polychrysus); phallus with subapical conical bump and small bulbose basal projection (both absent in C. polychrysus). In female genitalia (Fig. 153), the following characters distinguish this species from congeneric species: short ring-shaped sclerotized antrum; ductus bursae narrow, ca 1.5 X length of corpus bursae; corpus bursae progressively widening, pear-shaped, without signum. Chilo polychrysus exhibits a conspicuous C-shaped sclerotization at antrum, on each side of ductus opening, which enables unambiguous recognition of the species. DISTRIBUTION Most of South-East Asia (Sugar Research Australia). PHILIPPINES: Luzon (Batangas, Cagayan, Laguna, Quezon, Zambales), Panay (Iloilo), Mindanao (Davao Oriental, Misamis Oriental, Sirugao del Sur) (Litsinger et al., 2011). Collected at altitudes between 50 and 850 m on the Philippines. DNA BARCODING A maximum p-distance of 0.33% is observed between specimens MFNLEP-PYRALPHIL07-B08 from Mindanao (Surigao) and MFNLEP-PYRALPHIL07-H09 from Luzon (Quezon). Haplotype network reconstruction including all available BOLD sequences reveal that the Philippine haplotype is identical to a haplotype found elsewhere in Australia and India. REMARKS This Chilo species is a pest of sugarcane in South-East Asia. It also feeds on rice, maize, and sorghum (Bleszynski, 1970c; Litsinger et al., 2011; Maes, 2022). In a survey of Chilo species on rice in the Philippines, C. auricilius accounted for 73% of the total number of specimens collected, while C. polychrysus was not recorded (Barrion et al., 1990). Broad distribution of Chilo auricilius over the Philippines is the result of rice culture expansion over the archipelago. Chilo infuscatellus (Snellen, 1890) Figs. 37, 96, 154. Chilo infuscatellus Snellen 1890: 94. Type locality: Indonesia, Java = Argyria sticticraspis Hampson 1919: 449; Gupta 1940: 788; Isaac & Rao 1941: 799; Isaac & Venkatraman 1941: 806 [syn. Kapur 1950]. = Argyria coniorata Hampson 1919: 449. Fletcher 1928 (syn.). = Diatraea calamina Hampson 1919: 544; Kapur 1950 (syn.). = Diatraea auricilia (Dudgeon): Fletcher & Ghosh 1920: 387. = Diatraea shariinensis Eguchi 1933: 3; Kapur 1950 (syn.). = Chilo tadzhikiellus Gerasimov 1949: 704; Błeszyński 1962: 111 (syn.). MATERIAL 3 ♀ (detailed information on Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). DIAGNOSIS Chilo infuscatellus, also known as the Yellow Top Borer, have narrow brownish forewings medially speckled with dark brown and snow white hindwings. This species can be separated from other Chilo species by the presence of a conspicuous cornutus on the vesica of the male genitalia (Fig. 96). In female genitalia (Fig. 154), the following characters distinguish this species from congeneric species: ostial pouch distincly incised; ductus bursae devoid of swellings and sclerotized markings; corpus bursae with one signum (Anon, 2019; Bleszynski, 1970c). DISTRIBUTION AFGHANISTAN; INDIA; INDONESIA, MYANMAR; PHILIPPINES: Luzon (Benguet; Zambales); TAIWAN; TAJIKISTAN; TIMOR (Bleszynski, 1970c). Collected at altitudes between 150 and 500 m on the Philippines. DNA BARCODING A maximum intraspecific p-distance of 0.3% is observed between MFNLEP-PYRALPHIL11-B01, MFNLEP-PYRALHalf of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 49
PHIL11-A01, and MFNLEP-PYRALPHIL11-G01, all from Luzon (Zambales). The haplotypes of Luzon are most closely related to those found in Thailand (see Fig. S2e). A maximum intraspecific divergence of 7.1% is observed in specimen LSTEM114-18 from Java identified as Chilo infuscatellus. REMARKS Błeszyński (1970) investigated one female specimen from Klondyke on Luzon, Philippines. Chilo luteellus (Motschulsky, 1866) Figs. 36, 97, 155. Schoenobius luteellus Motschulsky, 1866: 199. Type lo - cality: Japan, Honshu, Kanagawa Pref., Kugenuma, Fujisawa = Chilo concolorellus Christoph, 1885, in Romanoff: 149, pl. 8 figs. 15a, b; type locality: Turkmenistan, Askhabad. = Chilo gensanellus Leech, 1889: 108, pl. 5 fig. 9; type locality: Korea, Gensan. = Chilo dubia Bethune-Baker, 1894: 48, pl. 1 figs. 18, 19; type locality: Egypt, Alexandria. = Chilo boxanus Hering, 1903: 111 ; type locality: China, Yangtse. = Chilo plumbosellus Chrétien, 1910: 366 ; type locality: Algeria, Biskra. = Chilo molydellus Zerny in Osthelder, 1935: 79 ; type locality: Syria, Amanus, Juksek Dagh. = Chilo pseudoplumbellus Caradja, 1932: 117; type locality: China, Tianjin. = Chilo luteellus (Motschulsky): Shibuya, 1928: 144. MATERIAL 1 ♂, 2 ♀ (detailed information on Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Chilo pulverosellus Ragonot, 1895. DIAGNOSIS Chilo luteellus (Fig. 36) is a rather large species (♂: 10 mm, ♀: 13-14 mm) and has somewhat broader forewings than other large Chilo species. Unambiguous identification succeeds by examination of the genitalia. In male genitalia (Fig. 97), the two elongate arms of the juxta and the absence of ventral arm on phallus separate this species and C. pulverosellus from other Chilo species. From C. pulverosellus, it is separated by the valva shape, which is more triangular than in C. pulverosellus, and the tips of the juxtal arms have a short tooth missing in C. pulverosellus (note that C. pulverosellus is not reported from the Philippines). In female genitalia (Fig. 155), the following characters distinguish this species from congeneric species: ductus bursae with basal half sclerotized, distally indented, abutted by two sclerotized lobes at ductus midlength; distinct swelling at midlength; ductus distal half wrinkled, with punctuate membrane; corpus bursae with light sclerotized ring at corpus opening; signum lacking (Anon 2019; Bleszynski, 1970c). DISTRIBUTION ALGERIA; CHINA; CROATIA; ISRAEL; ITALY; JAPAN; PHILIPPINES: Luzon (Laguna), Mindoro, Negros; ROMANIA; RUSSIA; SPAIN (Bleszynski, 1970c; Koren, 2021; Poltavsky & Artokhin, 2015). Collected at an altitude of 150 m on the Philippines. Bleszynski (1970c) reports the species from North Africa and Central Asia. He investigated one female specimen from the USNM collected on Mount Makiling (Laguna). DNA BARCODING A maximum intraspecific p-distance of 1.0 % is observed between specimens MFNLEP-PYRALPHIL07-C08 from Mindoro and MFNLEP-PYRALPHIL10-H09 from Negros. Three haplotypes were recovered in total from the Philippines. Of the three DNA barcodes available for this species, the haplotype from Shandong, China, is recovered as the closest neighbor, while the two other haplotype from Italy are more distantly related (Fig. S2f). Chilo pulverata (Wileman & South, 1917) Figs. 98, 156. Diatraea pulverata Wileman & South, 1917. Type local - ity: Taiwan [Formosa], Kanshirei, 1000 ft. = Chilo izuensis Okano, 1962a: 123, pl. 6, fig. 6; Bleszynski, 1970: 132 (syn.) = Chilo izouensis Błeszyński, 1965a: 115 MATERIAL No material was examined for this species. DIAGNOSIS This species can be separated from other Chilo species by examination of the male genitalia (Fig. 98): juxta symmetrical, with lateral arms arms not extending beyond basalcostal angle of valva; phallus with short ventral arm, subapical long patch of thorns and elongate patch of small cornuti. In female genitalia (Fig. 156), the two lamellate signa of the corpus bursae separate this species from other congeneric species of the Philippines (Anon, 2019; Bleszynski, 1970c). DISTRIBUTION CHINA; INDONESIA; JAPAN; PHILIPPINES: Luzon (Benguet); TAIWAN; TIMOR. REMARKS Błeszyński investigated two specimens (1 ♂, 1 ♀) of this species from Klondyke on Luzon, Philippines. Chilo sacchariphagus (Bojer, 1856) Figs. 38, 99, 157. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 50
Proceras sacchariphagus Bojer, 1856; Błeszyński 1966: 477 (Chilo). Type locality: Mauritius = Argyria straminella Caradja, 1926 c: 168; type locality: China, Tsingtan = Borer saccharellus* Guenée, 1862: 70–71; type locality: Réunion; Tams 1942 (syn.) = Chilo mauriciellus Walker, 1863 b: 141–142; type locality: Mauritius = Chilo venosatus Walker, 1863 b: 144; type locality: Malaysia, Borneo, Sarawak; Bleszynski 1970: 183 (syn.) = venosatum* Hua, 2005: 50 = Diatraea striatalis Snellen, 1890: 98, pl. 2 figs. 1–4; Hampson 1896: 953 (syn.) = Chilo sacchariphagus indicus (Kapur, 1950: 414–415, pl. 6 figs. 3, 7, 13) (Proceras); type locality: India, Bihar, Pusa; Błeszyński 1966: 493 (Chilo) = Chilo sacchariphagus stramineella (Caradja, 1926: 168) (Argyria); type locality: China, Tsingtau MATERIAL 1 ♂, 2 ♀ (detailed information in Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). DIAGNOSIS Chilo sacchariphagus, also known as the Spotted Borer or the Striped Stem Borer, is recognized by the striped forewings with a tiny dark brown cell spot in males, while female specimens are similar to those of C. suppressalis. This species can, however, be separated from other Chilo species by examination of the genitalia. In male genitalia (Fig. 99), the following characters separate this species: juxta plate short, broad, deeply notched, two arm projections conspicuously shorter as in other Chilo species; phallus with a row of 15-30 slender cornuti. In female genitalia (Fig. 157), the following characters separate this species: the antrum is well-marked, sclerotized; the ductus bursae has longitudinal ribs; and the corpus bursae is large, with one scobinate half (Anon, 2019; Bleszynski, 1970c). Bleszynski (1970c) discussed the differences in genitalia between the population from mainland China and Taiwan and that of the Philippines and Indonesia. He states that the “phallus in the specimens from Indonesia and Philippines is thinner and lacks the apical scobinations; in the ♀ genitalia the ductus bursae lacks the sclerite, but shows distinct longitudinal ribbing absent in the specimens from China and Formosa” (Bleszynski, 1970c). DISTRIBUTION EAST AFRICA; BANGLADESH; BRUNEI; CAMBODIA; CHINA; INDIA; INDONESIA (Borneo, Java, Bali, Sumatra, Celebes); IRAN; JAPAN; LAOS; MALAYSIA; PAKISTAN; PHILIPPINES: Luzon (Albay, Zambales); SINGAPORE; SRI LANKA; TAIWAN; THAILAND; VIETNAM (CABI Compendium 2019). DNA BARCODING The three specimens from the Philippines sequenced show identical DNA barcodes. Haplotype network reconstruction reveals that the Philippine haplotype is not shared with any other haplotypes retrieved from BOLD and GenBank and shows a p-distance of 2.4% to the closest conspecific specimen AGIMP002-12 from India. The highest distance observed is of 6.1% with specimen LSTEM508-18 from Java, Indonesia. REMARKS This species shows an extensive variation in genitalia, suggesting that it might indeed represent a species complex (Bleszynski, 1970c). Błeszyński investigated six specimens of this species from Benguet and Passay Rizal and two male specimens from Los Banos on Luzon, Philippines. This species is a major pest of sugar-cane in South-East Asia (Bleszynski, 1970c). Chilo suppressalis (Walker, 1863) Figs. 39, 100, 158. Crambus suppressalis Walker, 1863. Type locality : [China, Kiangsu], Shanghai = Chilo oryzae Fletcher, 1928: 59, pls 3, 4; type locality: India. Pusa; Kawada 1930: 145 (syn.) = Jartheza simplex Butler, 1880: 690; type locality: Taiwan [Formosa]; Hampson, 1896: 957 (Chilo); Vinson, 1942: 40 (syn.) = suppresalis Hampson, 1896: 957 MATERIAL 6 ♀ (detailed information in Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). DIAGNOSIS Chilo suppressalis, also known as the Asiatic Rice Borer or Striped Rice Borer, is recognized by the cream/yellow forewing with a conspicuous black rounded discoidal spot in males, while females are similar to those of C. sacchariphagus. Chilo suppressalis can be separated from other Chilo species by the following characters of the male genitalia (Fig. 100): arms of juxta ca 2/3 of valva length, distincly swollen at midlength; phallus with characteristic long, thin ventral arm (Bleszynski, 1970c). In female genitalia (Fig. 158), the following characters separate this species: ostial pouch small, slightly demarcated from ductus bursae; ductus bursae basally forming a twist, with sclerotized band; corpus bursae with elongate signum (Bleszynski, 1970c). DISTRIBUTION EAST AND SOUTH AFRICA; BANGLADESH; BRUNEI; CAMDOBIA; CHINA; INDIA; INDONESIA; IRAN; JAPAN; LAOS; MALAYSIA; PAKISTAN; PHILIPPINES: Luzon (Bataan, Batangas, Cagayan, Ifugao, Laguna, Nueva Ecija, Pangasinan, Mountain Province), Marinduque, Mindanao (Misamis Oriental, South Cotabato); SRI LANKA; TAIWAN; THAILAND; VIETNAM. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 51
DNA BARCODING A maximum intraspecific p-distance of 0.3% is observed between MFNLEP-PYRALPHIL11-A02 from Luzon (Ifugao) and the other three specimens from Luzon and Marinduque. Haplotype network reconstruction reveals that the Philippine haplotype is shared with specimens from China, South Korea, and Iran. REMARKS Chilo suppressalis is one of the most severe rice pest species and is present in the whole Oriental region, reaching temperate China and Japan to the North. It has been introduced to Europe and Hawaii (Maes, 2022). Chilo suppressalis together with Scirpophaga incertulas (Walker, 1863) are the most widespread rice pest species in the Philippines (Calora & Reyes, 1972). The observed decline of Chilo suppressalis in the past decades could be due to the introduction of narrow-stemmed rice (Litsinger et al., 2011). Eschata Walker, 1856 Eschata Walker, 1856. Type species: Eschata gelida Walker, 1856 = Chaerecla Walker, 1865 b: 633. Type species: Chaerecla chrysargyria Walker, 1865. Hampson 1896: 961 (syn.) = Myeza Walker, 1863 b: 190. Type species: Myeza tonsalis Walker, 1863 DIAGNOSIS The Palaearctic fauna of Eschata was revised by Błeszyński (1965). Forewings are shiny snow white, generally with one postmedian and one subterminal line (pers. obs.). Male genitalia with the following characteristics: parrot-beak shaped uncus and beak-shaped gnathos; valva with costal arm; sacculus not marked; juxta notched or bifid as in other Chiloini (Léger et al., 2019; pers. obs.); vesica often with patch of short cornuti. Female genitalia are characterized as follows: papillae anales large, coalesced ventrally and dorsally; posterior apophyses roughly as long as length of tergite VIII; anterior apophyses roughly twice as long as length of tergite VIII; antrum membranous; posterior half of ductus sclerotized as in Chilo species; corpus bursae often with one signum. DISTRIBUTION Known from the Oriental region. One species, Eschata sp. cf. rififi Błeszyński, 1965, is reported here from the Philippines. PHYLOGENETIC RELATIONSHIPS Although the genus was not included in the molecular phylogeny of Léger et al. (2019), it can be confidently placed in the Chiloini based on the bifid juxta in male genitalia as well as the thick venulae secundae on the tympanal organs. Eschata cf. miranda Błeszyński, 1965 Figs. 40, 101, 159. Eschata miranda Błeszyński, 1965, in Amsel et al. (eds.): 99, pl. 40 fig. 501, 2, pl. 90 fig. 50. Type locality : Taiwan. MATERIAL 2 ♂, 6 ♀ (detailed information in Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). DIAGNOSIS Eschata sp. near miranda Błeszyński, 1965 shows similarities to E. miranda (type locality: India, Darjeeling) and E. rococo Błeszyński, 1970 (type locality: India, Khasis) in male genitalia (Fig. 101): uncus parrot-beak shaped, kinked downwards at half length; gnathos arm with posterior edge protruded upwards; valva slightly curved upwards, basally with narrow costal arm projecting postero-dorsally, juxta apex deeply notched; vesica with patch of short cornuti. However, the present species shows noticeable differences to E. miranda and R. rococo: The costal arm is dorsally concave (convex in the two other species), the juxta apical arms are narrower and slightly longer, and the vesica has a large, isolated cornutus not found in the two other species. The large, isolated cornutus of the vesica is also observed in E. miranda Błeszyński, 1965 (type locality: Taiwan); however, the short and bulky costal arm of the latter species separates it from the Philippine species. DISTRIBUTION PHILIPPINES: Luzon (Laguna, Zambales), Marinduque, Palawan. Collected at altitudes between 40 and 500 m. DNA BARCODING The highest intraspecific divergence observed is of 3.8% between specimens MFNLEP-PYRALPHIL08-D11 from Luzon (Zambales) and MFNLEP-PYRALPHIL08-G11 from Palawan. Both specimens from Palawan only yielded sequences for the COI1a fragment and were thus not included in the species delimitation analysis. REMARKS E. rococo is a possible synonym of E. rififi. Both species are only separated by minor details of the juxta in male genitalia. CALAMOTROPHINI Gaskin, 1988 Calamotropha Zeller, 1863 Calamotropha Zeller, 1863 b: 8, 9. Type species : Tinea paludella Hübner, [1824] 1796 = Aurelianus Błeszyński, 1962 d: 2. Type species: Chilo discellus Walker, 1863 = Myeza Walker, 1863 b: 190. Type species: Myeza tonsalis Walker, 1863 DIAGNOSIS Calamotropha was revised by Błeszyński (1961) and the genus was redescribed by Landry (1995). The combination of forewing Rs4 vein stalked with Rs2+Rs3 and the open Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 52
Figs 120-123. Female genitalia of Scoparia species. Fig. 120. Scoparia meyi Nuss, 1998, slide TL1042♀. Fig. 121. Scoparia monticola Nuss, 1998, slide TL955♀. Fig. 122. Scoparia philippinensis (Hampson, 1917), slide TL913♀. Fig. 123. Scoparia luzonensis sp. n. , paratype, slide TL938♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 53
Figs 124-127. Female genitalia of Scoparia species. Fig. 124. Scoparia masiita sp. n. , paratype, slide TL1010♀. Fig. 125. Scoparia noacki Nuss, 2002, paratype, slide GU Nuss 955♀. Fig. 126. Scoparia bicornuta sp. n. , paratype, slide TL959♀. Fig. 127. Scoparia ifugaoensis sp. n. , paratype, slide TL1021♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 54
Figs 128-131. Female genitalia of Scoparia species. Fig. 128. Scoparia negrosensis sp. n. , paratype, slide TL1482♀. Fig. 129. Scoparia aenea sp. n. , paratype, slide TL770♀. Fig. 130. Scoparia cf. spadix, slide TL961♀. Fig. 131. Scoparia cf. abo, slide TL901♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 55
Figs 132-135. Female genitalia of Scoparia, Eudonia and Micraglossa species. Fig. 132. Scoparia cf. tenuispina, slide TL952♀. Fig. 133. Eudonia penicula sp. n. , paratype, slide TL915♀. Fig. 134. Eudonia barbipennis (Hampson, 1897), TL911♀. Fig. 135. Micraglossa tagalica Nuss, 1998, paratype, slide GU Nuss 756♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 56
hindwing cell characterize the genus (Landry, 1995; Léger et al., 2019). Forewing white or brown, generally with a median and a subterminal fascia, margin with several small dots (W. Li & Li, 2012a; pers. obs.). Male genitalia with hairs at base of uncus; tegumen usually with short dorsal roof; valva relatively short; pseudosaccus present; vinculum subtriangular, conspicuously protruding anterad, saccus blunt (Landry, 1995; W. Li & Li, 2012a). Female genitalia with papillae anales coalesced dorsally and ventrally; posterior apophyses roughly as long as tergite VIII; anterior apophyses short or absent; antrum often sclerotized; ductus bursae usually slender; corpus bursae usually without signum. DISTRIBUTION Known from the Afrotropical, the Palearctic, Oriental, and Australasian regions (Błeszyński, 1961). Seven species are reported here from the Philippines, of which five can be confidently named: Calamotropha anacantha sp. n. , Calamotropha atkinsoni Zeller, 1863, Calamotropha obliterans (Walker, 1863), Calamotropha philippinensis sp. n. , Calamotropha unicolorellus (Zeller, 1863). PHYLOGENETIC RELATIONSHIPS Calamotropha is part of the Calamotrophini, also including Pseudocatharylla Błeszyński, 1961 and Vaxi Błeszyński, 1962 (Léger et al., 2019). Calamotropha atkinsoni Zeller, 1863 Figs. 102, 160. Calamotropha atkinsoni Zeller, 1863. Type locality : India, near Calcutta. = Calamotropha fuscicostella Snellen, 1880: 247. Type locality: Indonesia, Sulawesi [Celebes], Bonthain; Makassar; Maros. Błeszyński, 1961 e: 196 (syn.) = Crambus holodryas Meyrick, 1933: 444, 445. Type locality: [Thailand] Siam = Calamotropha atkinsoni malaica Błeszyński, 1961 e: 196, 197, pl. 32 50, pl. 63 fig. 189. Type locality: Singapore MATERIAL No material was investigated for this species. DIAGNOSIS In male genitalia (Fig. 102), the very short, rounded uncus and the two conspicuous spine-like cornuti on the vesica unambiguously separate this species from other Calamotropha species (Błeszyński, 1961). In female genitalia (Fig. 160), the conspicuous sterigma covered by minute hair forms a chamber surrounding the antrum. DISTRIBUTION Ranging from India to the Philippines (Błeszyński, 1961). REMARKS Błeszyński (1961) reports this species from the Philippines. Calamotropha obliterans (Walker, 1863) Figs. 41, 103, 161. Crambus obliterans Walker, 1863: 169, 170. Type local - ity: [Malaysia] Sarawak, Borneo. = Crambus candidifer Walker, 1863: 170, 171 = Crambus candifer Hampson, 1896c: 934 = Crambus condidifer Błeszyński & Colling, 1962: 223 = obliteranus (Hua, 2005: 52) (Crambus) Calamotropha obliterans Błeszyński, 1961, pp. 168, 169; pl. 24, fig. 20; pl. 47, fig. 111; pl. 66, fig. 204 MATERIAL 4 ♂, 1 unsexed (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). SIMILAR SPECIES Calamotropha formosella Błeszyński, 1961, C. okanoi Błeszyński, 1961. DIAGNOSIS Calamotropha obliterans can be separated from other Calamotropha species by the following characters of the forewing: ground color cream, costa dark brown, median line on costal half evenly arched outwardly, forming a dot at midlength, then fading towards dorsum; median discoidal marked spot; subterminal line arched outwards near costa, cream, basally thinly edged with dark brown. Błeszyński (1961) states that the habitus of C. obliterans resembles that of C. formosella and C. okanoi. The genitalia enable unambiguous separation from these two species. In the male (Fig. 103), the valva apex is broadly notched ventrally (notch smaller in C. okanoi), the valva apex is pointed (rounded in C. formosella), and the vesica bears one medium and small cornuti (no cornuti in C. formosella, one single cornutus in C. okanoi). In female genitalia, the ventral, evenly curved plate of the antrum separates this species from other Calamotropha species. REDESCRIPTION OF FEMALE GENITALIA (FIG. 161) Posterior apophyses ca 5/4 of length of tergite VIII length, medially larger. Anterior apophyses ca 1.5 X tergite VIII length, narrowed on distal half. Antrum forming ventral evenly curved plate. Ductus bursae ca 1/4 of corpus length, straight. Corpus bursae not well demarcated from ductus bursae, elongate, membranous, devoid of signum. DISTRIBUTION MALAYSIA: Sabah, Sarawak; PHILIPPINES: Leyte, Luzon, Palawan, Samar. Collected at altitudes between 50 and 500 m. DNA BARCODING The species delimitation analysis recovered four different MOTUs within C. obliterans for the specimens from Leyte, Luzon (Zambales), Palawan, and Samar (one MOTU each). A maximum intraspecific p-distance of 6.7% is found between samples MFNLEP-PYRALPHIL09-C08 from Luzon Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 57
Figs 144-147. Female genitalia of Glaucocharis and Gargela species. Fig. 144. Glaucocharis sp., slide TL1081♀. Fig. 145. Gargela minuta Song, Chen & Wu, 2009, TL1058♀. Fig. 146. Gargela aculea sp. n. , paratype, slide TL1049♀. Fig. 147. Gargela polyacantha Li, 2019, slide TL1371♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 64
Figs 148-151. Female genitalia of Gargela and Ancylolomia species. Fig. 148. Gargela xanthocasis (Meyrick, 1897), slide TL1236♀. Fig. 149. Gargela bidentella sp. n. , paratype, slide TL1327♀. Fig. 150. Ancylolomia chrysographellus (Kollar & Redtenbacher, 1844), adapted from fig. 5, p. 31 of Bleszynski (1970b). Fig. 151. Ancylolomia orchidea Bleszynski, 1970, adapted from fig. 15, p. 34 of Bleszynski (1970b). Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 65
MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_b2c391, DNA voucher MFNLEP-PYRALPHIL07-A09, genitalia on slide TL1066♂; BOLD sample ID PYPHI074-21, Genbank Accession Number PP196760). PHILIPPINES: Luzon, Mt Banahaw, Kinabuhayan, 17-19.03.2000, leg. Mey & V. Richter. Paratypes: 9 ♂ (specimen identifiers coll.mfnberlin.de_u_b95e98, e491f8, 2050dc, 1b2cf2, 78302c, c83b5d, 3b633b, 841b24, 4cf534), 1 ♀ (specimen identifier coll.mfn-berlin.de_u_d8bd7e) (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). DIAGNOSIS The arched, white antemedian line, the conspicuously arched postmedian line with indentation at dorsal 1/3, and the two conspicuous black marginal dots separate this species from other Catoptria species. In male genitalia, the costa is sclerotized, albeit without projection, and the sacculus forms a hook-shaped projection directed upwards. In female genitalia (Fig. 166), the papillae anales are not coalesced; the ostium is conspicuously sclerotized, with a Ushaped aperture; the ductus bursae is slender and membranous; and the corpus bursae is membranous, without signum. HABITUS (FIG. 48) Forewing length 7.5-9.5 mm (n = 5); ground color tawny to brown. Antemedian line white, starting at 1/5 of dorsum, forming a wide arch, meeting costa at basal 1/3. Median area suffused with dark brown. Marked white stripes along discoidal veins and 1A + 2A. Postmedian line originating at costal 2/3, conspicuously arched outwards, indented outwards at CuA2, then meeting dorsum at 3/5. Subterminal area with five white spots, interspersed with two black dots at CuA1 and CuA2. Apex with one large, marked blotch, white. Fringes dirty white to copper. Hindwings cream colored. MALE GENITALIA (FIG. 110) Uncus elongate, slender; apex pointing downwards. Gnathos projection slender, apex rounded, pointing upwards. Sacculus forming one quadrangular sclerite in basal half; second sclerite at valva midlength subtriangular, dorsally projected upwards into a slender curved sclerotized arm about 2/5 of valva length, extending beyond cucullus, with apex pointed. Costal sclerite up to valva midlength, devoid of dorsal projection, distally projected ventrally into subtriangular tip reaching sacculus. Valva curved upwards in distal half, apex broadly rounded. Juxta evenly rounded, with sclerotized edges. Saccus forming acute triangle, with anterior tip pointing upwards. Phallus slender, slightly curved, apex covered with tiny teeth. FEMALE GENITALIA (FIG. 166) Posterior apophysis about 5/3 of length of tergite VIII, enlarged at 1/6. Anterior apophysis reduced to bump. Ostial lobe forming broad spatulate plate and two tubular chambers; posterior margin broadly U-shaped. Antrum forming membranous pouch surrounding ostial lobe. Ductus bursae narrow, of medium length, membranous. Corpus bursae membranous, half as long as ductus bursae, corpus width ca 5/3 X length of corpus bursae, ovoid, devoid of signum. DISTRIBUTION Philippines: Luzon (Laguna, Mountain Province, Quezon), Mindoro. Collected at altitudes between 1150 and 1650 m. DNA BARCODING Two MOTUs were recovered in the species delimitation analysis, one from the unique specimen sampled from Luzon and another one from the two specimens from Mindoro. A maximum p-distance of 5.4% is observed between these two clusters. REMARKS This species is provisionally placed here in Catoptria. In female genitalia, some characters are not consistent with such placement: The ductus bursae is not sclerotized (anterior half sclerotized in most Catoptria species), and the corpus bursae lacks a signum (one signum is present in most Catoptria species). According to Błeszyński (1965), the southernmost occuring Catoptria species was C. pandora Błeszyński, 1965, known from Yunnan province in China. This species extends the known distribution of the genus well into the Oriental region. Culladia Moore, 1886 Culladia Moore, 1886: 382. Type species: Araxes admigratella Walker, 1863 = Araxes* Walker, 1863 b: 192. Type species: Araxes admigratella Walker, 1863 = Crambidion Mabille, 1900: 748. Type species: Crambidion achroellum Mabille, 1900. Viette 1990: 85 (syn.) = Nirmaladia Rose, 1983: 172, 175, figs. 1–7. Type species: Culladia dentilinaelis Hampson, 1919. M. Shaffer, Nielsen & Horak 1996: 183 (syn.) DIAGNOSIS The genus Culladia was revised by Bleszynski (1970a). Species of Culladia exhibit small, greyish wings. Vein R5 is very short or missing as observed in a few small Crambini genera (Bleszynski, 1970a; Léger et al., 2019). In male genitalia, the bifid sclerotized apex of the phallus is a potential apomorphy for the genus. Male genitalia exhibit the following characters: uncus and gnathos slender, with apex pointing downwards; valva slender, with costal arm at base, ventral process absent; pseudosaccus present; juxta short, with deep notch; vesica with one or more cornuti, with characteristic bifid sclerotized apex (Bleszynski, 1970a; pers. obs.). Female genitalia exhibit the following characters: papillae anales not coalesced dorsally and ventrally; posterior apophyses 1-2 X length of tergite VIII; anterior apophyses very short; antrum often with pair of sclerites; membranous pouch branching near antrum found in several Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 66
species; corpus bursae usually with long, scobinate signum (Bleszynski, 1970a; pers. obs.) DISTRIBUTION Occuring in the Afrotropical, Oriental, and Australasian regions. Five species are reported from the Philippines: Culladia evae Bleszynski, 1970, C. hastiferalis (Walker, 1865), C. pseudoscoparia sp. n. , C. suffusella Bleszynski, C. tonkinella Bleszynski, 1970. PHYLOGENETIC RELATIONSHIPS Culladia is sister to the Holarctic genus Pediasia Hübner, 1825 (Bleszynski, 1970a; Léger et al., 2019). Culladia hastiferalis (Walker, 1865) Figs. 49, 111, 167. Scopula hastiferalis Walker, 1965: 1473. Type locality : Borneo, Sarawak. Culladia admigratella Swinhoe (not Walker), 1900: 416. Culladia hastiferalis (Walker): Bleszynski, 1970: 52, figs. 9, 15. MATERIAL 8 ♂, 9 ♀, 43 unsexed specimens (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). DIAGNOSIS Identification of this species requires examination of genitalic characters. In male genitalia (Fig. 111), the hooklike basal process, the bifid apex of the juxta, and the two oblong cornuti on the vesica separate Culladia hastiferalis from other Culladia species. In female genitalia (Fig. 167), the atrium bursae with two rounded, minutely spined swellings; the lengthy subostial projection; and the crest of sclerotized spines in corpus bursae separates this species from other Culladia species. DISTRIBUTION INDONESIA: Sumatra, Java, Moluccas, Papua; MALAYSIA: Sabah; PHILIPPINES: Leyte, Luzon (Antique, Bataan, Batangas, Benguet, Camarines Sur, Quezon), Mindanao (Davao Oriental), Mindoro, Palawan, Panay, Negros; TAIWAN (Bleszynski, 1970a). This species is recorded on all examined islands in the Philippines and is recorded from 120 m to 1050 m in the Philippines and up to 1570 m on Borneo (see Table S1). DNA BARCODING The maximum intraspecific p-distance of 0.7% is found between samples MFNLEP-PYRALPHIL07-D09 from Mindanao (Davao) and MFNLEP-PYRALPHIL08-H12 from Negros. A p-distance of 3.1-4.3% is observed between specimens from Luzon and those from Australia retrieved from BOLD. Culladia evae Bleszynski, 1970 Fig. 168. Culladia evae Bleszynski, 1970: 55, fig. 20. Type locality : Luzon, Manil[l]a. MATERIAL No material of this species was examined. DIAGNOSIS This species is similar in habitus to other Culladia species but can be differentiated by the antrum pouch; the broad, medium-sized, wrinkled ductus bursae; and the corpus bursae devoid of signum in the female genitalia (Fig. 168). DISTRIBUTION CHINA: Hainan; INDONESIA: Java, Papua; PALAU; PHILIPPINES: Luzon (Laguna, Rizal). REMARKS This species is described from female specimens only. Błeszyński examined specimens from Rizal, Montalban (1 ♀), Mount Makiling (1 ♀), and Los Banos (3 ♀). Culladia suffusella Hampson, 1896 Figs. 113, 169. Culladia suffusella Hampson, 1896, Proc. zool. Soc. Lond. 1895 (4): 925. Type locality : India, Nilgiris. Culladia suffusella Bleszynski, 1970: 55, 56, fig. 21, 25. MATERIAL No material of this species was examined. DIAGNOSIS This species is similar in habitus to other Culladia species. In male genitalia (Fig. 113), the bifid basal process of the valva, the two apical horns of the vesica, and the small single cornutus separate this species from other Culladia species. In female genitalia (Fig. 169), the small sclerotization on antrum, the short subostial projection, and the corpus bursae barely delimited from the ductus separate this species from other Culladia species. DISTRIBUTION INDIA; PHILIPPINES: Luzon (Benguet). REMARKS Błeszyński examined 20 male and female specimens from Benguet, Luzon, and stored in the NHMUK. Culladia tonkinella Bleszynski, 1970 Figs. 112, 170. Culladia tonkinella Bleszynski, 1970: 53, 54, figs. 17, 19. Type locality : Hoa Binh [Vietnam]. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 67
MATERIAL 2 ♂ (detailed information in Table S1; https://doi.org/ 10.5061/dryad.b8gtht7mh). DIAGNOSIS This species is best separated by examination of genitalia. In male genitalia, the slender valva with the short, fingershaped basal process and the two patches of 4-5 cornuti on the vesica unambiguously separates this species from its congeners. In female genitalia, the pouch-like projection is devoid of sclerotization, and the corpus bursae bears a longitudinal signum. DISTRIBUTION INDONESIA: Java, Sumatra; PHILIPPINES: Mindoro, Panay; VIETNAM. Collected at altitudes between 150 and 400 m on the Philippines. REMARKS This is the first record of this species from the Philippines. Culladia pseudoscoparia Léger, sp. n. https://zoobank.org/ 1AA6EF61-001C-4424-95D6-242F26B7F834 Figs. 50, 114, 171. MATERIAL Holotype: ♂ (specimen identifier coll.mfnberlin.de_u_810de4, DNA voucher MFNLEP-PYRALPHIL01-E03, genitalia on slide TL916♂; BOLD sample ID PYPHI038-21, Genbank Accession Number PP196730). PHILIPPINES: Luzon, Zambales, Zambales Mountains, Pili, 150 m, 05-07.11.1998 (W. Mey, W. Speidel). Deposited in MfN. Paratype: 3 ♂ (specimen identifiers coll.mfnberlin.de_u_2c5838, ace978, 8e5a61), 2 ♀ (specimen identifiers coll.mfn-berlin.de_u_d9a2c0, 62cddb) (detailed information in Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh). Other specimens: 32 unsexed (detailed information in Table S1; https://doi.org/10.5061/dryad.b8gtht7mh). DIAGNOSIS This peculiar looking Culladia species is unambiguously separated from other Culladia species by the larger and broader forewing mixed with brown and white scales and the brown marginal lunules, while the zigzag postmedian brown line found in other species is absent. In male genitalia (Fig. 114), the large tegumen arms, the setose costal projection of the valva, as well as the long cornutus on vesica unambiguously separate this species from other Culladia species. In female genitalia (Fig. 171), the non-coalesced papillae anales, the very long ductus bursae, as well as the presence of an appendix bursae on the corpus bursae unambiguously separate this species from other Crambinae species. HABITUS Forewing length 8 mm (n = 1); greyish brown, scattered with cream scales. Antemedian line cream, forming a jag pointing outwards in cell. Median area lighter, with one costal, one cubital, and one dorsal dark brown patch. Postmedian line broken, cream, starting at 4/5 of costa, well marked near costa, broadly arched outwards down to CuA1, then slightly arched outwards in dorsal area, meeting the dorsum near tornus. Subterminal area broadly marked with white suffusion, more pronounced towards margin. Margin with seven dark quadriangular spots. Fringe basally cream, distally bronze. MALE GENITALIA (FIG. 114) Uncus elongate, slender, densely setose; apex with small tooth pointing downwards. Gnathos projection about as long as uncus, apex with small tooth pointing downwards. Tegumen arm large, covered with minute points, tegumen roof ca 4/5 of tegumen arm length. Valva elongate, slender, slightly curved upwards on distal 1/4, apex rounded. Costal process slightly S-shaped, covered with setae, tip pointing upwards. Juxta short, rounded, deeply indented. Phallus stout, apically narrowed, apex forming two narrow, spatulate, weakly sclerotized projections. One straight, large, elongate cornutus of 660 μm. FEMALE GENITALIA (FIG. 171) Papillae anales not connected dorsally and ventrally, slightly concave. Antrum membranous. Ductus bursae covered with minute spicules, straight, narrow in basal half, broadly incurved on distal half, slightly broader, conspicuously bent before corpus opening. Corpus bursae membranous, globular, with a small globular appendix bursae. Signum absent. DISTRIBUTION PHILIPPINES: Luzon (Mountain Province, Ifugao, Zambales). Collected at altitudes between 150 and 2100 m. DNA BARCODING An intraspecific divergence of 2.9 % is observed between specimens MFNLEP-PYRALPHIL01-F03, MFNLEP-PYRALPHIL01-C06, and MFNLEP-PYRALPHIL01-B10 all from Zambales, Luzon. ETYMOLOGY From the Greek pseudes, false, and the genus Scoparia Haworth, referring to the resemblance in habitus and female genitalia with specimens of Scoparia. REMARKS This species is tentatively placed in Culladia here. According to Graziano Bassi (pers. comm.), the “male genitalia [is] similar to Pediasia, but the bilobed apex of phallus and ductus ejaculatorius branching off close to antrum bursae are diagnostic. It is somewhat similar to C. dentilinealis Hmps and somewhat “heretical” with respect to typical Culladia Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 68
in female genitalia, but surely close to it, as male genitalia show”. Culladia sp. Fig. 172. MATERIAL 1 ♀ (specimen voucher coll.mfn-berlin.de_u_6acee3, DNA voucher MFNLEP-PYRALPHIL10-A12, genitalia on slide TL1320F). PHILIPPINES: Luzon, Zambales, Zambales Mountains, Coto, 250 m, 06-07.05.1999 (K. Ebert, W. Mey). REMARKS This species of Culladia could not be assigned to any of the known species. Its female genitalia (Fig. 172) are different from all Culladia species (Bleszynski, 1970a). No tribal assignment Metaeuchromius Błeszyński, 1960 Metaeuchromius Błeszyński, 1960 d: 217. Type species: Eromene yuennanensis Caradja, 1884 = Pseudeuchromius BłeszyńskiBłeszyński, 1965: 90. Type species: Eromene lata Staudinger, 1870 DIAGNOSIS A redescription of the genus is provided by Schouten (1997). Forewing ground color white to cream, speckled with brown; antemedian area white to amber yellow, median straight or oblique ochreous band; subterminal line present; termen with characteristic row of terminal dots (W. C. Li et al., 2009; pers.obs.). Several species have abdominal scent organs on male sternite III (Schouten, 1997). Male genitalia with the following characteristics: uncus with pointed tip; gnathos projection usually short, hookshaped, in some species with small dorsal teeth; valva narrow, with pointed apex, costal process usually developed into a spine, sacculus without process; saccus conspicuously protruding anterad; vesica with or without cornuti (W. C. Li et al., 2009; Schouten, 1997; pers. obs.). Female genitalia with the following characteristics: papillae anales coalesced or free dorsally and ventrally; anterior and posterior apophyses 1-2 X length of tergite VIII; antrum membranous or sclerotized, without projections; ductus bursae of variable length, with or without sclerotization, in some species with pouch-shaped enlargement; corpus bursae globular or pear-shaped, with or without signum (W. C. Li et al., 2009; Schouten, 1997; pers. obs.). DISTRIBUTION Known so far from the Palearctic (from Turkey to China), extending its distribution into the Oriental region in India (Metaeuchromius euzonella from Assam, India). Two species are newly described from the Philippines, and one is moved to the genus Metaeuchromius: Metaeuchromius micralis (Hampson, 1919), Metaeuchromius rizali sp. n., and Metaeuchromius makintabus sp. n. Further presumably undescribed species are known from Java. PHYLOGENETIC RELATIONSHIPS Phylogenetic placement of Metaeuchromius is currently unclear. This genus was not included in the molecular phylogeny of the Crambinae (Léger et al., 2019). The closed hindwing cell suggests that the genus is not part of the open-cell clade comprising the Argyriini, the Haimbachiini, the Calamotrophini, the Euchromiusini, and the Crambini and is possibly closely related to the genus Miyakea Marumo, 1933 as suggested by Schouten (Landry et al., 2020; Léger et al., 2019; Schouten, 1997). Metaeuchromius micralis (Hampson, 1919) comb nov. Figs. 51, 115, 173. Ommatopteryx micralis Hampson, 1919 a: 535. Type lo - cality: Philippines, Luzon, Benguet Prov., Irizan = Euchromius brunnealis syn. nov (Hampson, 1919). Type locality: Philippines, Negros island MATERIAL Material examined: 33 ♂, 27 ♀, 7 unsexed (detailed information in Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh). SIMILAR SPECIES Metaeuchromius fulvusalis Song & Chen, 2002, M. rizali sp. n., M. makintabus sp. n. DIAGNOSIS This species (Fig. 51) is very similar to Metaeuchromius fulvusalis from mainland China. In male genitalia (Fig. 115), the valva spine is less prominent than in M. fulvusalis, and the narrow colliculum of the female genitalia (Fig. 173) is absent in M. fulvusalis. In the Philippines, this species can be separated from M. rizali sp. n. and M. makintabus sp. n. by the subapical zigzag silver line on the forewing. In male genitalia, the short costal process of the valva as well as the vesical devoid of cornuti unambiguously separate this species from other Metaeuchromius species. In female genitalia, the narrow sclerotized colliculum, the short ductus bursae, and the presence of one rounded signum on corpus bursae best separate this species from M. makintabus sp. n. (female of M. rizali sp. n. is not known). DNA barcodes suggest that this species might indeed represent a complex of cryptic species. REDESCRIPTION HABITUS (FIG. 51) Forewing length 4.5-6.5 mm (n = 16); ground color cream suffused with tawny scales. Basal area amber yellow, with one slender shiny silver streak along costal cell vein; three white streaks following lower cell vein and anal veins. Medial line oblique, running inwardly from costa to dorsum, white, shiny silver near costa, marked basally and distally Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 69
with amber to tawny yellow. Subapical line starting at costal 3/4, zizagging outwardly to vein M1, shiny silver. Apex with subapical white lunule. Termen with five black points surrounded by white. Fringe amber yellow to copper. Hindwing dirty white, with faint patch of marginal brown scales at CuA2. Fringe dirty white, apically copper. MALE GENITALIA (FIG. 115) Uncus ca half of tegumen arm length, slightly bent downwards, apical 1/3 with few setae, apex thorn-shaped. Gnathos projection about 1/5 of uncus length, dorsally covered with tiny teeth, tip pointed. Valva elongate, setose; costal arm projected into a tip pointed upwards inwardly; ventral margin straight, apically curved upwards; apex pointed, with patch of 3-5 long, thick bristles. Juxta elliptical. Saccus rounded. Vesica covered with minute spines. FEMALE GENITALIA (FIG. 173) Papillae anales not coalesced dorsally and ventrally. Posterior apophyses about 7/4 of length of tergite VIII. Anterior apophyses about 9/5 of tergite length. Antrum membranous. Colliculum narrow, tubular, sclerotized. Ductus bursae about as long as corpus bursae, basal half narrow, enlarging towards corpus bursae on distal half. Corpus bursae with opening barely marked; ovoid, with one conspicuous signum. DNA BARCODING An unsuspected high divergence is observed among specimens of Metaeuchromius micralis. The species delimitation analysis recovered five different island-specific clusters for Luzon, Mindanao, Mindoro, Leyte + Samar, and Negros (Fig. 179c). The highest intraspecific p-distance of 7.3% is observed between samples MFNLEP-PYRALPHIL07-D11 from Leyte and MFNLEP-PYRALPHIL10-E11 from Negros. DISTRIBUTION PHILIPPINES: Leyte, Luzon, Mindanao, Mindoro, Negros. Collected at altitudes between 150 and 2300 m. REMARKS The type of “Euchromius” brunnealis (Hampson, 1919) could not be located at the NHMUK (D. Lees, personal communication). According to the original description, it matches the characters observed here in Metaeuchromius micralis: The forewing is “red-brown with a cupreous gloss and mixed with some whitish especially before and beyond the inwardly oblique rather ill-defined narrow red-brown medial band” and bears at the apex “an oblique ill-defined whitish band” similar to that of Metaeuchromius micralis, while the band is silver colored, straight in M. makintabus sp. n. or regularly arched in M. rizali sp. n. This species shows a strong divergence in DNA barcodes among island populations. No striking differences were found in male genitalia; however, forewing pattern and size show some island-specific variation. This species might represent a species complex whose investigation requires additional evidence such as nuclear markers and morphometric analyses. Metaeuchromius rizali Léger, sp. n. https://zoobank.org/ F4F5BDD9-BCFD-45A4-B381-334DB4DCA854 Figs. 52, 116. MATERIAL Holotype: ♂ (specimen identifier MTD11449, DNA voucher MFNLEP-PYRALPHIL09-E07, TL1229♂; BOLD sample ID PYPHI282-22, Genbank Accession Number PP196961). PHILIPPINES: Luzon, Quezon, Lucena, Quezon National Park, 175 m, 20.03.2000 (M. Nuss). Deposited in MTD. Paratypes: 3 unsexed (specimen identifiers coll.mfnberlin.de_u_bc7445, MTD11448, MTD11447) (detailed information in Table S1; https://doi.org/10.5061/ dryad.b8gtht7mh). SIMILAR SPECIES Metaeuchromius makintabus sp. n., Peniculimius fructus Schouten, 1994. DIAGNOSIS From Metaeuchromius micralis, Metaeuchromius rizali sp. n. and M. makintabus sp. n. are separated by the thicker, conspicuously silver, and rather straight antemedian and subapical bands (Fig. 52). The termen black dots are not as well delimited as in M. micralis, and the fringes are copper. Metaeuchromius rizali sp. n. is very similar to M. makintabus sp. n. in the forewing pattern, but the following characters help to separate them: The antemedian and subapical amber yellow area are not connected at costa (meeting at costa in M. makintabus sp. n. ), the subapical silver band is slightly curved (straight in M. makintabus sp. n. ), and the subtermen line runs straight (zigzagging in M. makintabus sp. n. ). It is separated from Peniculimius fructus Schouten, 1994 by the amber color of the basal area (mix of grey and white scales in P. fructus) and the broader, silver color of the antemedian and subapical bands (narrow and whitish in P. fructus). In male genitalia (Fig. 116), the conspicuous costal process of the valva as well as the presence of a cornutus on the vesica separate this species from its congeners. Female specimens are not known. HABITUS (FIG. 52) Forewing length 4.8 mm (n = 1), ground color cream suffused with amber yellow scales, markings amber yellow. Antemedian area amber yellow. Antemedian band slightly bent inwards on costal half, then running straight to dorsum, shiny silver, edged distally with broad amber yellow band. Subapical band starting at costal 3/4, running towards M1 vein on margin, slightly arched, shiny silver. Apical area amber yellow. Termen with patch of dark brown and amber yellow scales. Fringes dirty white, shiny silver at termen. Hindwing dirty white, with faint patch of marginal brown scales at CuA2. Fringe dirty white, copper at termen. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 70
Figs 152-155. Female genitalia of Ancylolomia and Chilo species. Fig. 152. Ancylolomia westwoodi Zeller, 1863, slide TL1220♀. Fig. 153. Chilo auricilius Dudgeon, 1905, slide TL1059♀. Fig. 154. Chilo infuscatellus Snellen, 1890, slide TL1372♀. Fig. 155. Chilo luteellus (Motschulsky, 1866), slide TL1060♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 71
Figs 156-159. Female genitalia of Chilo and Eschata species. Fig. 156. Chilo pulverata (Wileman & South, 1917), adapted from fig. 34, p. 133 of Bleszynski (1970c). Fig. 157. Chilo sacchariphagus (Bojer, 1856), slide TL1373♀. Fig. 158. Chilo suppressalis (Walker, 1863), slide TL1380♀. Fig. 159. Eschata cf. miranda, slide TL1115♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 72
Figs 160-163. Female genitalia of Calamotropha species. Fig. 160. Calamotropha atkinsoni Zeller, 1863, adapted from fig. 189, plate LXIII of Bleszynski (1970b). Fig. 161. Calamotropha obliterans (Walker, 1863), slide TL1383♀. Fig. 162. Calamotropha unicolorellus (Zeller, 1863), slide TL1381♀. Fig. 163. Calamotropha philippinensis sp. n. , paratype, slide TL1225♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 73
Figs 172-175. Female genitalia of Culladia, Metaeuchromius and Microchilo species. Fig. 172. Culladia sp., slide TL1320♀. Fig. 173. Metaeuchromius micralis (Hampson, 1919) comb. nov. , slide TL997♀. Fig. 174. Metaeuchromius makintabus sp. n. , paratype, slide TL1056♀. Fig. 175. Microchilo bundoki sp. n. , paratype, slide TL944♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 80
Figs 176-178. Female genitalia of Microchilo species. Fig. 176. Microchilo cebuano sp. n. , holotype, slide TL918♀. Fig. 177. Microchilo spinosus sp. n. , paratype, slide TL1208♀. Fig. 178. Microchilo imminutela sp. n. , paratype, slide TL1209♀. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 81
spines, medially with one transverse row of thick sclerotized spines. DISTRIBUTION PHILIPPINES: Luzon (Zambales). Collected at an altitude of 150 m. DNA BARCODING The highest intraspecific p-distance observed is of 1 % between sample MFNLEP-PYRALPHIL01-D02 from Panay and the samples from Luzon (Zambales). ETYMOLOGY From the Latin minutalis, e: small, undersized. The name was appended to a series of specimens in the NHMUK. Checklist of the Philippines Scopariinae & Crambinae CRAMBINAE Ancylolomia orchidea Bleszynski, 1970 Ancylolomia westwoodi Zeller, 1863 Angustalius malacelloides (Błeszyński, 1955) Calamotropha anacantha sp. n. Calamotropha obliterans (Walker, 1863) Calamotropha philippinensis sp. n. Calamotropha unicolorellus (Zeller, 1863) Catoptria philippinensis sp. n. Chilo auricilius Dudgeon, 1905 Chilo infuscatellus Snellen, 1890 Chilo luteellus (Motschulsky, 1866) Chilo pulverata (Wileman & South, 1917) Chilo sacchariphagus (Bojer, 1856) Chilo suppressalis (Walker, 1863) Culladia evae Bleszynski, 1970 Culladia hastiferalis (Walker, 1865) Culladia pseudoscoparia sp. n. Culladia suffusella (Hampson, 1896) Culladia tonkinella (Walker, 1865) Gargela aculea sp. n. Gargela acutibrachium sp. n. Gargela minuta Song et al., 2009 Gargela negrosensis sp. n. Gargela polyacantha Li, 2019 Gargela xanthocasis (Meyrick, 1897) Glaucocharis altissima sp. n. Glaucocharis clytia (Błeszyński, 1966) Glaucocharis hamulus sp. n. Glaucocharis kabundukanis sp. n. Glaucocharis kayumanggi sp. n. Glaucocharis lathonia (Błeszyński, 1966) Glaucocharis negrosensis sp. n. Glaucocharis sungay sp. n. Glaucocharis uncusellus sp. n. Metaeuchromius makintabus sp. n. Metaeuchromius micralis (Hampson, 1919) Metaeuchromius rizali sp. n. Microchilo bundoki sp. n. Microchilo cebuano sp. n. Microchilo imminutela sp. n. Microchilo spinosus sp. n. SCOPARIINAE Eudonia penicula sp. n. Eudonia barbipennis Hampson, 1897 Micraglossa kianganensis sp. n. Micraglossa polisensis sp. n. Micraglossa tagalica Nuss, 1998 Scoparia abo sp. n. Scoparia aenea sp. n. Scoparia bicornuta sp. n. Scoparia fulvida sp. n. Scoparia ifugaoensis sp. n. Scoparia luzonensis sp. n. Scoparia masiita sp. n. Scoparia meyi Nuss, 1998 Scoparia monticola Nuss, 1998 Scoparia negrosensis sp. n. Scoparia noacki Nuss, 2002 Scoparia philippinensis (Hampson, 1917) Scoparia spadix Nuss, 1998 Scoparia tenuispina sp. n. Species incertae cedis Calamotropha sp. 1 cf. oculalis Calamotropha sp. 2 cf. oculalis Eschata cf. miranda Błeszyński, 1965 Roxita sp. Discussion Incongruence between morphology and DNA barcodes The low match ratio of 0.47 between morphospecies and molecular-delimited species can be linked to different factors. Species pairs or triplets could not be efficiently separated by the ASAP delimitation method and were merged into one MOTU in three cases. These low divergence cases might reflect a recent speciation event or might be caused by other factors inherent to mitochondrial DNA such as incomplete lineage sorting or introgression as reported in butterflies (Cong et al., 2017). Other cases of DNA barcode sharing between two closely related yet morphologically distinct species is known in the species pair Scoparia ambigualis/Scoparia basistrigalis (Barcoding Of Life Database; Matthias Nuss, pers. comm.), suggesting that introgression occurs in Scoparia. This underlines the need for caution when interpreting the delimited MOTUs, as different species can be lumped under a same MOTU. Twenty-two of the morphospecies investigated (30%) were split into two or more MOTUs. In all cases, the MOTUs represented different geographical populations from different mountain ranges or islands (e.g., Scoparia philipinnensis in Fig 179c and Metaeuchromius micralis in Fig 179d), suggesting partial or complete isolation between these popuHalf of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 82
lations due to geographical barriers. These values are similar to those found in Lepidoptera from Papua New Guinea (Craft et al., 2010) and in butterflies of the Samoan islands (Bruschini et al., 2023). The results of the ASAP analysis here can thus be explained by the inherent geography of the region favoring isolation and divergence of local demes, resulting in an overlap between intraand interspecific variation that is detrimental to the performance of distancebased methods such as ASAP (Ahrens et al., 2016). In some cases, the geographical gaps in the sampling might influence negatively the performance of ASAP as it underestimates the intraspecific variation in these cases (Lohse et al., 2009; Phillips et al., 2019). Endemism An apparent rate of Philippine endemism of 95% is observed in mountain dwelling Scopariinae. Only Scoparia monticola has been reported so far outside of the Philippines, extending its distribution to China (W. Li & Liu, 2013) and Sumatra (Nuss, 1998). Notably, the Bornean fauna has been only superficially investigated so far for Scopariinae, without revealing similar morphotypes. The Crambinae show a lower endemism rate of roughly 50%, presumably due to the occurrence of many lowland species. These endemism rates are higher than that of the endemism rate in butterflies (40.7%; Treadaway & Schröder, 2012) and closer to that observed in low-dispersal groups such as mammals (64%) or amphibians (77%) (Ong et al., 2002). This is presumably due to the large number of midor high-elevation species that are less likely to disperse to distant areas. The Scopariinae show a strong geographical structure and represent the majority of endemic species for the Philippines. In the Crambinae, the Diptychophorini account for a substantial part of the species diversity on the archipelago; Glaucocharis and Gargela form the two most species-rich genera and represent together nearly 40% of the total Crambinae diversity on the archipelago. Scopariinae and Glaucocharis share the same ecology; both groups feed on mosses (Beever & Dugdale, 1994; Glime, 2017; Nuss, 1999). Distribution patterns & drivers of diversification Star-shaped haplotype networks in Angustalius malacelloides, Culladia hastiferalis, and Microchilo bundoki sp. n. reveal rapid demographic expansion across the archipelago there (see Fig. 179a and 179b). Similarly, the widespread crop pest species Chilo auricilius, Chilo infuscatellus, and Chilo suppressalis all share their haplotype with specimens from continental Asia, suggesting recent, human-aided dispersal to the Philippine archipelago facilitated the expansion of crop cultures (see haplotype networks d, e, g, h on Fig. S2d). Microchilo bundoki sp. n. , whose host plant is currently unknown, is also likely to feed on grasses. Other cases reveal high local mitochondrial haplotype diversity, suggesting large population sizes as observed in Glaucocharis altissima sp. n. and G. clytia (Fig. 179e, f). Within Luzon, four centers of endemism can be highlighted: the Cordillera Central, the Southern Sierra Madre, the Bicol Peninsula, and the Zambales mountains. These mountain ranges have been highlighted as sub-centers of endemism in mammals (Heaney et al., 2016). Investigating MOTU endemism reveals here an endemism rate for these mountain ranges (33-52%) similar to those observed for medium-sized islands such as Negros (46%) and Mindoro (48%), suggesting that the Luzon mountain range acts as “sky islands” for dispersal and speciation. Interestingly, Mindoro does not have any endemic species, and haplotypes identical to those found on Luzon in Eudonia penicula sp. n. and Gargela minuta suggest that some exchange occurred between the two islands. A putative explanation here is a frequent colonization and extinction from either Luzon or Palawan, with limited in-situ diversification (MacArthur & Wilson, 1967). The islands of Leyte, Mindanao, and Samar form together the Mindanao Pleistocene aggregate island complex that was shown to host a similar fauna in several groups (R. M. Brown et al., 2013; de Jong & Treadaway, 1993). The DNA barcode haplotype network reveals this pattern at the intraspecific level in Gargela aculea sp. n. and Gargela acutibrachium sp. n. where specimens group in the same MOTU or in sister-group MOTUs with respect to the specimens from Luzon and Negros. DNA barcodes further reveal several cases of deep splits between the lineages from Samar and Leyte and that of Mindanao in the Scoparia spadix species group, Scoparia cf. tenuispina sp. n. , Calamotropha obliterans, Gargela acutibrachium sp. n. , Metaeuchromius micralis, Metaeuchromius makintabus sp. n., with two MOTUs found in Leyte in the latter species. This implies that these populations remained isolated despite the existence of land bridge connections between Mindanao, Samar, and Leyte during the Pleistocene ice ages (R. M. Brown et al., 2013). The island of Negros shows, on the other hand, no unequivocal faunal connection to either Luzon + Mindanao nor to the Mindanao Pleistocene Aggregate Island complex. Its fauna includes two presumably endemic species (Glaucocharis negrosensis sp. n. and Gargela bidentella sp. n. ) and have species distributed over the Northern part of the archipelago including Mindoro and Luzon (e.g., Glaucocharis agnathosellus, E. penicula sp. n. ), while, in other cases, it shares species with the Southern part of the archipelago including Leyte/Samar and Mindanao (e.g., Glaucocharis uncusellus sp. n. , Calamotropha philippinensis sp. n. , Gargela acutibrachium sp. n. ). The haplotype structure reveals similar ambivalent patterns, with closer affinity to those of Luzon or Mindoro in Gargela aculea sp. n. , Scoparia meyi, while in Glaucocharis lathonia a unique haplotype is shared among specimens from Leyte, Mindanao, and Negros, differing from that found on Luzon. The present pattern is similar to that observed in the Hesperiidae, where the fauna of Negros has been shown to be equally populated by species from a Northern origin (Luzon) and from a Southern origin (Mindanao), presumably resulting from either changing colonization opportunities from the two major islands (de Jong & Treadaway, 1993). Finally, the available Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 83
Fig. 179. Haplotype network reconstruction using the Median-joining network method for the species Angustalius malacelloides (a), Culladia hastiferalis (b), Metaeuchromius micralis (c), Scoparia philippinensis (d), Glaucocharis altissima sp. n. (e), Glaucocharis clytia (f), Glaucocharis lathonia (g), Gargela minuta (h). Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 84
Fig. 180. Collecting localities as well as density mapping of the collecting effort on the Philippines generated with Rpackages ggmap. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 85
material from Palawan was insufficient to discuss its faunal affinities here, but a strong similarity with the Sundaland fauna can be expected, as observed elsewhere in the Hesperiidae (de Jong & Treadaway, 1993). Homogeneous morphology in some groups suggests small in situ species radiations in the Philippines. This is, for example, the case in the group formed by S. spadix, S. noacki, S. bicornuta sp. n. , and S. aenea sp. n. These species share the short triangular uncus, the long and slender gnathos projection, and nearly identical female genitalia. Different elevational distribution has been proposed to promote speciation in some groups of vertebrates (R. M. Brown et al., 2013) as well as in Trichoptera (Mey, 2003). Nonor partly overlapping elevational distributions in genera such as Gargela, Glaucocharis, and Microchilo suggest that adaptation to an elevational ecozone might also play a role in diversification. Specialization on different host plants is another possible driver of diversity in sympatric lineages and has been reported on tropical moth communities (Craft et al., 2010). Colonization routes Four routes have been proposed to colonize the Philippine archipelago by Dickerson (1928): from Taiwan via the Batanes and Babuyan island chain; from Borneo via Palawan; from Borneo via the Sulu archipelago; and from Sulawesi. A fifth route from Papua over the Sangihe–Talaud–Sarangani island chain has been later emphasized by other authors (Diamond & Gilpin, 1983; Dickinson et al., 1991; Inger, 1954). While our knowledge from the fauna of the neighboring regions is scarce, some biogeographical affinities can be inferred from the morphology, DNA barcodes, or both. Several species are found to be shared with Borneo, i. e., Calamotropha obliterans, Glaucocharis lathonia, Microchilo spinosus sp. n. , or have a sister-species from Sumatra (Eudonia penicula sp. n. ) or Java (Calamotropha cf. oculalis, Scoparia meyi, and S. spadix; unpublished data). In the case of Calamotropha obliterans, haplotype network reconstruction reveals that a specimen from Palawan (DNA voucher MFNLEP-PYRALPHIL09-A08) shares its haplotype with another specimen (DNA voucher MFNLEP1161) from Tawau Hills, Borneo (see Fig. S2b), suggesting a recent crossing of the Balabac Strait between Borneo and Palawan. For Glaucocharis lathonia, the haplotype network reconstruction suggests a colonization of the Philippines from Borneo (or vice-versa) via the Palawan route, while an identical haplotype found on Leyte, Mindanao, and Negros suggest a recent spreading over these islands (see Fig. 179g). Furthermore, striking similarities between female genitalia of Glaucocharis clytia, G. kabundukanis sp. n. , and G. altissima sp. n. with those of the ajaxella species group from Papua suggests a likely colonization of the Philippines from Papua New Guinea. Finally, colonization of the distant island of Taiwan is evidenced in Gargela minuta, with haplotypes from Taiwan and the Philippines differing by only two base pairs (see Fig. 179h). Revisional studies of the Crambinae and Scopariinae fauna of the surrounding regions such as Sundaland, Continental Asia, Wallacea, and Papua are strongly needed in order to have a good estimate of the influence of each region on the current diversity observed in the Philippines. Cryptic diversity The high diversity in DNA barcodes between island-specific MOTUs in several species are signs of a marked lineage differentiation and raises the question as to whether these MOTUs represent cryptic species or not. Similar high genetic differentiation between island populations in the Philippines has been debated in birds (Hosner et al., 2018; Lohman et al., 2010). In insects, cases of deep genetic differentiation have been reported in the montane genus Hoploscopa Meyrick, 1886 (Lepidoptera) (Léger et al., 2020) as well as other insect orders such as Coleoptera (Komarek & Freitag, 2020) and Ephemeroptera (Kaltenbach et al., 2020). These mitochondrial lineages could represent different real geographical species where morphological differentiation is moderate because of low selective pressure acting on these characters, or they may result from mechanisms affecting mitochondrial DNA such as introgression, incomplete lineage sorting, or symbiont-driven genetic flow (Hurst & Jiggins, 2005). Cases of discrepancy between mitochondrial genetic diversity and nuclear genomic diversity have been reported elsewhere in Lepidoptera (Cong et al., 2017; Doorenweerd et al., 2022; Hinojosa et al., 2019; Lopez-Vaamonde et al., 2021), prompting caution when interpreting results relying on mitochondrial markers alone. This underlines the need to include additional nuclear markers in further studies in order to test whether or not these mitochondrial lineages represent real cryptic species. Geographical sampling The collecting density (Fig. 180) reveals that, although collecting localities are widely spread, the material available was predominantly collected on Luzon and that some geospatial gaps remain in our sampling in the Philippines. High elevation sampling has mainly been performed on Luzon, where altitudes over 2000 m can be reached by motorized transport. Palawan, Mindanao, Negros, and Panay have high mountain ranges (>2000 m above sea level), and collecting at higher elevations there should be undertaken in future expeditions. Furthermore, Palawan geological history is completely different than that of the other islands (Hall, 1998), and it shows the least faunal similarities with other Philippines islands in vertebrates (Heaney, 1986). Hence, future surveys on the island hold the promise of new species discoveries in both groups. Mindanao and its multiple mountain ranges are expected to host a large unexplored diversity as the unique sampled locality (Mount Agtuuganon) has the highest MOTU endemicity (79%). Mindanao is, with 79,000 km2, the second largest island after Luzon and has been shown to be in the stage of intra-island allopatric diversification in birds (Hosner et al., 2013), which suggests that a similar pattern could be observed in moths. Undersampling of Mindanao has been reported in DNA barcodes and species occurrence data and can be explained by the risk of terrorism that kept foreign researchers away (Berba & Matias, 2022). Finally, future samHalf of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 86
pling should be extended to yet unexplored islands such as Camiguin, Sibuyan, or other mountain ranges from Palawan, Panay, or Eastern Luzon. Conclusion and outcomes The present revision of the Crambinae and Scopariinae of the Philippines has uncovered thirty-two new species, showing that slightly over half of the diversity in these two groups was undescribed until now. Furthermore, six species were reported for the first time from the Philippines. At least another seven further species (five Glaucocharis species, one Calamotropha near oculalis, one Culladia sp.) represented exclusively by female specimens or by males that could not be matched to the type specimen were recognized as new but are not formally described here. The high discrepancy between the number of lineages inferred from the morphology and from the species delimitation analysis of the DNA barcoding dataset suggests several cases of cryptic geographical species that will require further investigations. Three cases of MOTU sharing suggest the occurrence of evolutionarily young lineages. The present status of the diversity of Crambinae and Scopariinae suggests an endemism rate of 50% for the Crambinae and 95% for the mountain dwelling Scopariinae. Further expeditions to undersampled islands and mountains such as Mindanao and Palawan will surely reveal additional species. Acknowledgments I thank Isabelle Waurick, Robert Schreiber, and Anne Müller for performing parts of the laboratory work. For operating the sequencing via the Oxford Nanopore Minion pipeline, I am thankful to Mary-Ann Davenport, Shauna Kekoe, Amrita Srivathsan, and Julien Graf. I am grateful to Volker Bormann, Oskar Werb, Eran Wolff, Lucie Rentsch, and Marlene Düsterhoff for the photographs and image post-processing of the specimens. Matthias Nuss (MTD) enabled the digitization of the microslides at the MTD and facilitated the loan for the specimens of the MTD. David Lees kindly provided images of the habitus and genitalia slides of several type specimens of the National History Museum in London. I am thankful to Weichun Li and Graziano Bassi for their comments on generic placement and identification. Wolfram Mey provided additional information on the localities where he and his colleagues collected. I thank Christalle Beatriz Seno and Clister Pangantihon for suggesting Tagalog or Visayan names for some species. A special thanks goes to Stella Beavan, Bob Heckford, and David Agassiz for proofreading the English of the manuscript, as well as David Lees and Weichun Li for reviewing the manuscript. Finally, I thank Bernard Landry for helping to improve some parts of the manuscript. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 87
References Ahrens, D., Fujisawa, T., Krammer, H. J., Eberle, J., Fabrizi, S., & Vogler, A. P. (2016). Rarity and incomplete sampling in DNA-based species delimitation. Syst Biol, 65(3), 478–494. https://doi.org/10.1093/sysbio/syw002 Anon. (2019). Dossiers on CHILO species as pests of sugarcane. Sugar Research Australia Limited. Bandelt, H. J., Forster, P., & Röhl, A. (1999). Medianjoining networks for inferring intraspecific phylogenies. Mol Biol Evol, 16(1), 37–48. https://doi.org/10.1093/ oxfordjournals.molbev.a026036 Barrion, A. T., Catindig, J. L. A., & Litsinger, J. A. (1990). Chilo auricilius Dudgeon (Lepidoptera: Pyralidae), the correct name for the dark-headed stem borer (SB) found in the Philippines. International Rice Research Newsletter, 15(4), 29. Bassi, G. (2013). Revisione delle specie afrotropicali del genere Ancylolomia Hübner,[1825]. I: i gruppi indica e chrysargyria (Lepidoptera: Pyralidae, Crambinae). Shilap-rev Lepidopt, 41(164), 517–529. Beever, J. E., & Dugdale, J. S. (1994). Bryological Notes: Bryophagy of Dawsonia superba Grev. by larvae of the crambid moth Glaucocharis epiphaea (Meyrick) in New Zealand. J Bryol, 18(2), 365–366. https://doi.org/10.1179/jbr.1994.18.2.365 Berba, C. M. P., & Matias, A. M. A. (2022). State of biodiversity documentation in the Philippines: Metadata gaps, taxonomic biases, and spatial biases in the DNA barcode data of animal and plant taxa in the context of species occurrence data. PeerJ, 10, e13146. https://doi.org/10.7717/peerj.13146/supp-1 Błeszyński, S. (1961). Revision of the World species of the Family Crambidae (Lepidoptera). Part I. Genus Calamotropha Zell. Acta Zool Cracov, 6(7), 137–272. Błeszyński, S. (1965). Crambinae. In H. G. Amsel, F. Gregor, & H. Reisser (Eds.), Microlepidoptera Palaearctica (Vol. 1). Bleszynski, S. (1966). Further taxonomic notes on some tropical species. Acta Zool Cracov, 11(15), 451–497. Bleszynski, S. (1970a). A revision of the genus Culladia Moore (Studies on the Crambinae, Lepidoptera, Pyralidae, Part 50). Tijdschr Entomol, 113, 44–59. Bleszynski, S. (1970b). A revision of the Oriental species of the genus Ancylolomia Hübner (Studies on the Crambinae, Lepidoptera, Pyralidae, Part 49). Tijdschr Entomol, 113, 27–43. Bleszynski, S. (1970c). A revision of the world species of Chilo Zincken (Lepidoptera: Pyralidae). Bull Br Mus, 25(4), 101–195. https://doi.org/10.5962/ bhl.part.19677 Brown, R. M., Siler, C. D., Oliveros, C. H., Esselstyn, J. A., Diesmos, A. C., Hosner, P. A., Linkem, C. W., Barley, A. J., Oaks, J. R., & Sanguila, M. B. (2013). Evolutionary processes of diversification in a model island archipelago. Annu Rev Ecol Evol Syst, 44, 411–435. https://doi.org/10.1146/annurevecolsys-110411-160323 Brown, S. D., Collins, R. A., Boyer, S., Lefort, M. C., Malumbres-Olarte, J., Vink, C. J., & Cruickshank, R. H. (2012). Spider: An R package for the analysis of species identity and evolution, with particular reference to DNA barcoding. Mol Ecol Resour, 12(3), 562–565. https://doi.org/10.1111/ j.1755-0998.2011.03108.x Bruschini, C., Edwards, E. D., Talavera, G., Vaurasi, V. D., Latu, G. F., & Dapporto, L. (2023). A complete COI library of Samoan butterflies reveals layers of endemic diversity on oceanic islands. Zool Scr, 52, 315–330. https://doi.org/10.1111/zsc.12588 Calora, F. B., & Reyes, S. C. (1972). The ecology of rice stem borers in the Philippines. Japan Pesticide Information, 10, 111–112. Cong, Q., Shen, J., Borek, D., Robbins, R. K., Opler, P. A., Otwinowski, Z., & Grishin, N. V. (2017). When COI barcodes deceive: Complete genomes reveal introgression in hairstreaks. Proc R Soc B, 284(1848), 20161735. https://doi.org/10.1098/rspb.2016.1735 Craft, K. J., Pauls, S. U., Darrow, K., Miller, S. E., Hebert, P. D., Helgen, L. E., Novotny, V., & Weiblen, G. D. (2010). Population genetics of ecological communities with DNA barcodes: An example from New Guinea Lepidoptera. PNAS, 107(11), 5041–5046. https://doi.org/10.1073/pnas.0913084107 de Jong, R., & Treadaway, C. G. (1993). The Hesperiidae (Lepidoptera) of the Philippines (Vol. 288). Nationaal Natuurhistorisch Museum. Diakonoff, A. N. (1968). Microlepidoptera of the Philippine Islands. Bull US Nat Mus, 257, 1–458. https://doi.org/10.5479/si.03629236.257.1 Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 88
Diamond, J. M., & Gilpin, M. E. (1983). Biogeographic umbilici and the origin of the Philippine avifauna. Oikos, 41, 307–321. https://doi.org/10.2307/3544090 Dickerson, R. E. (1928). Distribution of life in the Philippines. Philippine Bureau of Science. Dickinson, E. C., Kennedy, R. S., & Parkes, K. C. (1991). The birds of the Philippines: An annotated check-list (Issue 12). British Ornithologists’ Union. Doorenweerd, C., Lee, K. M., van Nieukerken, E. J., & Mutanen, M. (2022). Phylogenomic inference of two widespread European leaf miner species complexes suggests mechanisms for sympatric speciation (Lepidoptera: Nepticulidae: Ectoedemia). Syst Ent, 48(2), 341–353. https://doi.org/10.1111/syen.12579 Gaskin, D. E. (1971). Revision of New Zealand Diptychophorini (Lepidoptera: Pyralidae: Crambinae). NZ Jl Sci, 14(4), 759–809. Gaskin, D. E. (1985). Morphology and Reclassification of the Australasian, Melanesian and Polynesian Glaucocharis Meyrick (Lepidoptera: Crambinae: Diptychophorini). Aust J Zool Suppl Ser, 33(115), 1–75. https://doi.org/10.1071/AJZS115 Geller, J., Meyer, C., Parker, M., & Hawk, H. (2013). Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. Mol Ecol Resour, 13(5), 851–861. https://doi.org/10.1111/1755-0998.12138 Glime, J. (2017). Terrestrial Insects: Holometabola – Lepidoptera: Tortricoidea – Papilionoidea. In J. Glime (Ed.), Bryophyte Ecology (Vol. 2, pp. 12–14). Hall, R. (1998). The plate tectonics of Cenozoic SE Asia and the distribution of land and sea. In Biogeography and Geological Evolution of SE Asia (pp. 99–131). Heaney, L. R. (1986). Biogeography of mammals in SE Asia: Estimates of rates of colonization, extinction and speciation. Biol J Linn Soc, 28(1–2), 127–165. https://doi.org/10.1111/j.1095-8312.1986.tb01752.x Heaney, L. R., Balete, D. S., Duya, M. R. M., Duya, M. V., Jansa, S. A., Steppan, S. J., & Rickart, E. A. (2016). Doubling diversity: A cautionary tale of previously unsuspected mammalian diversity on a tropical oceanic island. Front Biogeogr, 8(2). https://doi.org/ 10.21425/F5FBG29667 Hinojosa, J. C., Koubínová, D., Szenteczki, M. A., Pitteloud, C., Dincă, V., Alvarez, N., & Vila, R. (2019). A mirage of cryptic species: Genomics uncover striking mitonuclear discordance in the butterfly Thymelicus sylvestris. Mol Ecol, 28(17), 3857–3868. https://doi.org/10.1111/mec.15153 Hosner, P. A., Campillo, L. C., Andersen, M. J., Sánchez-González, L. A., Oliveros, C. H., Urriza, R. C., & Moyle, R. G. (2018). An integrative species delimitation approach reveals fine-scale endemism and substantial unrecognized avian diversity in the Philippine Archipelago. Conserv Genet, 19, 1153–1168. https://doi.org/10.1007/ s10592-018-1085-4 Hosner, P. A., Nyári, Á. S., & Moyle, R. G. (2013). Water barriers and intra-island isolation contribute to diversification in the insular Aethopyga sunbirds (Aves: Nectariniidae). J Biogeogr, 40(6), 1094–1106. https://doi.org/10.1111/jbi.12074 Hurst, G. D., & Jiggins, F. M. (2005). Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: The effects of inherited symbionts. Proc R Soc B, 272(1572), 1525–1534. https://doi.org/10.1098/ rspb.2005.3056 Inger, R. F. (1954). Systematics and zoogeography of Philippine Amphibia. https://doi.org/10.5962/ bhl.title.5571 Kahle, D. J., & Wickham, H. (2013). ggmap: Spatial visualization with ggplot2. R J., 5(1), 144. https://doi.org/10.32614/RJ-2013-014 Kaltenbach, T., Garces, J. M., & Gattolliat, J. L. (2020). The success story of Labiobaetis Novikova & Kluge in the Philippines (Ephemeroptera, Baetidae), with description of 18 new species. ZooKeys, 1002, 1–114. https://doi.org/10.3897/zookeys.1002.58017 Khan, Z. R., Litsinger, J. A., Barrion, A. T., Villanueva, F. F. D., Fernandez, N. J., & Taylo, L. D. (1991). World Bibliography of Rice Stem Borers: 1794-1990. IRRI. Kim, Y., Qi, M., Wang, S., & Li, H. (2023). Taxonomy of the genus Calamotropha Zeller (Lepidoptera: Crambidae: Crambinae) from mainland China. Zootaxa, 5297(4), 451–482. https://doi.org/10.11646/ zootaxa.5297.4.1 Komarek, A., & Freitag, H. (2020). Taxonomic revision of Agraphydrus Régimbart, 1903 V. Philippine species and their first DNA barcodes. Koleopterol Rundsch, 90, 201–242. Half of the Diversity Undescribed: Integrative Taxonomy Reveals 32 New Species and a High Cryptic Divers… Bulletin of the Society of Systematic Biologists 89