Review of Nealyda Dietz (Lepidoptera: Gelechiidae: Apatetrinae) with description of a new species from the Florida Keys
Abstract
Hayden, Sidney V. Bennett James E. (2024): Review of Nealyda Dietz (Lepidoptera: Gelechiidae: Apatetrinae) with description of a new species from the Florida Keys. Insecta Mundi 2024 (86): 1-13, DOI: 10.5281/zenodo.14662477
Full text
Center for Systematic Entomology, Inc., Gainesville, FL Date of issue: November 29, 2024 1086 Review of Nealyda Dietz (Lepidoptera: Gelechiidae: Apatetrinae) with description of a new species from the Florida Keys Sidney V. Bennett Florida State Collection of Arthropods, Florida Department of Agriculture – Division of Plant Industry, 1911 SW 34th St., Gainesville, FL 32608 USA James E. Hayden Florida State Collection of Arthropods, Florida Department of Agriculture – Division of Plant Industry, 1911 SW 34th St., Gainesville, FL 32608 USA Insecta MundI A journal of world insect systematics Page Count: 13 Bennett and Hayden
Bennett SV, Hayden JE. 2024. Review of Nealyda Dietz (Lepidoptera: Gelechiidae: Apatetrinae) with description of a new species from the Florida Keys. Insecta Mundi 1086: 1–13. Published on November 29, 2024 by Center for Systematic Entomology, Inc. P.O. Box 141874 Gainesville, FL 32614-1874 USA http://centerforsystematicentomology.org/ Insecta Mundi is a journal primarily devoted to insect systematics, but articles can be published on any nonmarine arthropod. Topics considered for publication include systematics, taxonomy, nomenclature, checklists, faunal works, and natural history. Insecta Mundi will not consider works in the applied sciences (i.e. medical entomology, pest control research, etc.), and no longer publishes book reviews or editorials. Insecta Mundi publishes original research or discoveries in an inexpensive and timely manner, distributing them free via open access on the internet on the date of publication. Insecta Mundi is referenced or abstracted by several sources, including the Zoological Record and CAB Abstracts. Insecta Mundi is published irregularly throughout the year, with completed manuscripts assigned an individual number. Manuscripts must be peer reviewed prior to submission, after which they are reviewed by the editorial board to ensure quality. One author of each submitted manuscript must be a current member of the Center for Systematic Entomology. Guidelines and requirements for the preparation of manuscripts are available on the Insecta Mundi website at http://centerforsystematicentomology.org/insectamundi/ Chief Editor: David Plotkin, insectam[email protected]m Assistant Editor: Paul E. Skelley, insectam[email protected]m Layout Editor: Robert G. Forsyth Editorial Board: Davide Dal Pos, M. J. Paulsen, Felipe Soto-Adames Founding Editors: Ross H. Arnett, Jr., J. H. Frank, Virendra Gupta, John B. Heppner, Lionel A. Stange, Michael C. Thomas, Robert E. Woodruff Review Editors: Listed on the Insecta Mundi webpage Printed copies (ISSN 0749-6737) annually deposited in libraries Florida Department of Agriculture and Consumer Services, Gainesville, FL, USA The Natural History Museum, London, UK National Museum of Natural History, Smithsonian Institution, Washington, DC, USA Zoological Institute of Russian Academy of Sciences, Saint-Petersburg, Russia Electronic copies (online ISSN 1942-1354) in PDF format Archived digitally by Portico. Florida Virtual Campus: http://purl.fcla.edu/fcla/insectamundi University of Nebraska-Lincoln, Digital Commons: http://digitalcommons.unl.edu/insectamundi/ Goethe-Universität, Frankfurt am Main: http://nbn-resolving.de/urn/resolver.pl?urn:nbn:de:hebis:30:3-135240 This is an open access article distributed under the terms of the Creative Commons, Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. https://creativecommons.org/licenses/by-nc/3.0/
Insecta MundI 1086: 1–13 2024 Review of Nealyda Dietz (Lepidoptera: Gelechiidae: Apatetrinae) with description of a new species from the Florida Keys Sidney V. Bennett Florida State Collection of Arthropods, Florida Department of Agriculture – Division of Plant Industry, 1911 SW 34th St., Gainesville, FL 32608 USA sidney.b[email protected]ov James E. Hayden Florida State Collection of Arthropods, Florida Department of Agriculture – Division of Plant Industry, 1911 SW 34th St., Gainesville, FL 32608 USA james.ha[email protected]ov Abstract. Nealyda grandipinella Bennett and Hayden, new species, is described from Big Pine Key, Florida, USA. Photographs of the adult and of male and female genitalia are provided for N. grandipinella and its congeners within the state of Florida. Nealyda Dietz (Lepidoptera: Gelechiidae) is provisionally transferred from Anomologinae to Apatetrinae based on characters of the genitalia. The homology and terminology of the processes arising from the vinculum of gelechiid genitalia are explored. The potential host plant of the new species is discussed, along with other undescribed species of Nealyda. Key words. Caribbean Region, Caryophyllales, sacculus, vinculum. ZooBank registration. urn:lsid:zoobank.org:pub:3A1AD0AF-0026-470A-8D9B-1C70B9CF3B37 Introduction Nealyda Dietz was proposed in Elachistidae with the type species N. bifidella Dietz, 1900. Later in the same year, Busck (1900) moved the genus to Gelechiidae and described two new species, N. kinzelella Busck and N. pisoniae Busck. The genus has been previously placed in Anomologinae based on its reduced uncus and gnathos (Bidzilya and Karsholt 2008; Lee and Landry 2023). We provisionally place Nealyda in Apatetrinae based on the similarity of the genitalia to those of Chrysoesthia Hübner (Karsholt and Moreno 2014) and particularly Metanarsia Staudinger (Bidzilya 2005, 2008; Karsholt et al. 2013). Currently, nine species of Nealyda are described worldwide (Hobern et al. 2024). The genus is restricted to the New World. Nealyda bifidella is the only species described from the Western Nearctic, but several potential undescribed species have been noted from California (Gates et al. 2002), Texas (Eiseman 2021) and Mexico (Powell and Opler 2009). Three species of Nealyda are recorded from Florida: Nealyda kinzelella, N. pisoniae, and N. phytolaccae Clarke (Heppner 2007). No new species have been described since the mid-20th Century (Hering 1955). The Asian species Apatetris panchromatica (Meyrick), which Clarke (1969) had transferred from Aristotelia Hübner to Nealyda, was transferred to Apatetris Staudinger by Sakamaki (2000), although the author had reservations because of severe damage to the type specimen. The presence of iridescent scales on the forewing, which Western species lack, and the similarity of A. panchromatica to A. elaeagnella Sakamaki lead us to agree with the placement of A. panchromatica in Apatetris. Nealyda species are oligophagous leaf-miners on Caryophyllales. Other Gelechiidae that share that habit are Chrysoesthia and several genera of more distantly related Gnorimoschemini and other Gelechiinae (Eiseman 2021; Bidzilya pers. comm. 2024). Nealyda larvae feed on Nyctaginaceae or Phytolaccaceae (Busck 1903; Clarke 1946; Eiseman 2021). In the Florida Keys, Nealyda specimens have been recorded from Pisonia L. and Guapira Aubl. (Nyctaginaceae) (Busck 1900; Clarke 1946; GBIF Secretariat 2023).
2 · November 29, 2024 Bennett and Hayden Materials and Methods The first specimens were collected with an ultraviolet light trap in an agricultural pest survey on Big Pine Key by the Cooperative Agricultural Pest Survey (CAPS), a division of the Florida Department of Agriculture and Consumer Services (FDACS). A subsequent Malaise trap in 2019 provided more specimens. The type specimens are deposited in the Florida State Collection of Arthropods (FSCA) and housed in the McGuire Center for Lepidoptera and Biodiversity (Gainesville, Florida). Specimens of related species in the FSCA were examined, including N. bifidella Dietz, N. pisoniae Busck, N. kinzelella Busck, and N. phytolaccae Clarke, as well as specimens of undescribed species of Nealyda (see additional material examined). In addition to the figures below, cataloged specimens and genitalia images are available through the Lepidoptera Specify database of the Florida Museum of Natural History (Florida Museum 2024). The FLMNH-MGCL specimen numbers stated below are the “Alt Cat Number” = “MGCL nnnnnn,” or else they can be found under Genus = Nealyda. The genitalia were dissected by maceration in 10% aqueous KOH, stained with Chlorazol black in 50% ethanol, Eosin Y, or Orange G (Robinson 1976), and slide-mounted in Euparal. Morphological terms follow Huemer and Karsholt (2010). The authors use both “vincular processes” and “lateromedial projections” to refer to the paired lobes between the valvae. The term vincular processes is used here because they are attached to the vinculum. Photographs of habitus were taken using a JVC digital camera and Leica Z16APO lens with Auto-montage Pro 5.01 (Synoptics Ltd.). High-resolution photographs of genitalia were taken with a Leica DM6 compound microscope with a Leica DMC6200 camera, and slices were stacked with Zerene Stacker Version 1.04. The stacked images were postprocessed with Adobe Photoshop 23.5.1. Habitus illustrations were edited with Adobe Photoshop 11 (Adobe Systems 2012) and stacked with Helicon Focus 8.2.2 if necessary (Kozub et al. 2000). Figures were assembled with GIMP 2.10.36 (GNU Image Manipulation Program 2023) and Artweaver Free 7 (Boris Eyrich Software 2023). The map was created using SimpleMappr (Shorthouse 2010) using data from the FSCA. Erroneous localities, such as coordinates that corresponded to a body of water, were excluded from the map. DNA was sequenced by the FDACS-DPI Molecular Diagnostics Laboratory. Dry legs were removed from a paratype, and the standard mtDNA “barcode” region was sequenced by standard methods (Hebert et al. 2004). COI sequences of congeners were downloaded from the Barcode of Life Data System (Ratnasingham and Hebert 2007). The Process ID numbers are: LNAUX180-18, MNAB1535-18, MNAB1536-18, BBLOB1332-11, MNAB1531-18, MNAB1526-18, MNAB1527-18, MNAB1525-18, MNAB1528-18, LNAUX002-18, GONA17610, LNAUX182-18, LNAUX183-18, SCBMF029-19, LNAUX001-18. The sequences were aligned with Muscle (Madeira et al. 2024). Extensive missing data in the other sequences precluded meaningful calculation of percentage differences by distance methods. Diagnostic sites were pinpointed by analysis with implied-weights parsimony with TNT 1.5 (Goloboff and Catalano 2016) with the commands: hold 1000; piwe=10; mu=hold 10 repl 10; best; apo [-.;. Abbreviations of institutions. FSCA Florida State Collection of Arthropods, Gainesville, FL MEM Mississippi Entomological Museum, Mississippi State, MS MGCL McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL NMNH US National Museum of Natural History, Washington D.C. Results Nealyda Dietz, 1900 (Fig. 1–5) Nealyda Dietz, 1900. Type species: Nealyda bifidella Dietz, 1900, by monotypy. Diagnosis. The maculation of Nealyda species (Fig. 1) is yellowish tan, brown, gray, and/or black. The labial palps (Fig. 2) are slightly rounded and stout with banding. The forewings typically have a single medial fascia darker than surrounding scales, but Caribbean species have two fasciae (N. neopisoniae Clarke) or none (N. bicolor
New species of Gelechiidae from the Florida Keys Insecta Mundi 1086 · 3 Walsingham). The apex of the wing is darkly irrorated. The hindwings have a medial cleft, whereby the tornus is extended similarly to the apex. The metathoracic legs have a medial inner tibial spur greater than two times the length of the outer spur. In the male genitalia (Fig. 3), the valvae have sparse microtrichia apically. The saccular processes (or sacculi) are large, often strongly sclerotized, and mesally connected to each other. The vincular processes of the phytolaccae group are large lobed structures, while in the pisoniae group, they are weakly sclerotized bumps with microtrichia. The uncus is globular to conical. The gnathos is strongly reduced to a ring around the base of the uncus. The tegumen is trapezoidal with sparse microtrichia. The phallus is ankylosed to the vinculum. In the female genitalia (Fig. 4), the papillae anales are large, heavily sclerotized, and extremely setose. The ductus bursae and corpus bursae are unsclerotized. The signum is a small hook, spine, or granular patch. The larvae feed in leaf mines in Caryophyllales. Nealyda grandipinella Bennett and Hayden, new species (Fig. 1A, 2A, 3A, 4A, 5) Diagnosis. Nealyda grandipinella differs from its congeners by the presence of silvery-gray scales throughout the forewing and a lack of brown pigmentation. The habitus is nearly indistinguishable from N. pisoniae specimens collected in the Bahamas, but it lacks the thick, dark gray band on the outer side of the first labial palpomere that is present in N. pisoniae. In the male genitalia, the most obvious difference is the arrangement of setae on the sacculus: they are thick and parallel in a comb-like row, twelve to fourteen in number, whereas the most similar species have a few thin setae (N. kinzelella, N. pisoniae) or numerous rough, irregularly disposed setae (N. bifidella). Nealyda grandipinella also differs by the conical shape of the uncus that terminates in circular scales, a straight, broad phallus with four terminal teeth, and valvae that are medially constricted, with the distal half broad, laterally curved, and lemon shaped. In related species, the uncus is truncate, the phallus is narrow and curved without teeth, and the terminal expansion of the valva is narrower and not distinctly bent laterad. In the female genitalia, the ductus bursae is 33% longer than the corpus bursae, and the signum is curved, hook-shaped, and 1/5 as long as the corpus bursae. Congeners have the ductus bursae and corpus bursae subequal in length. In most other species, the central spine of the signum is 1/7 or less the length of the corpus bursae. Nealyda bifidella has a spine 1/3 the length of the corpus bursae and distinct lateral granular arms of the signum, but the ductus bursae has a distinct membranous swelling halfway along its length. Figure 1. Habitus of Nealyda species present in Florida, USA and the Bahamas. A) N. grandipinella, holotype. B) N. kinzelella. C) N. pisoniae (Florida). D) N. phytolaccae. Scale bars = 1 mm.
4 · November 29, 2024 Bennett and Hayden Description, Adult. Head (Fig. 2A). Labial palps slightly rounded and stout. Outer side light gray, with dark gray banding at apex, base of third segment, and distal end of second segment. Inner side with suffusion of white scales proximal to the frons and dark gray scales on opposite side. Vertex with broad, rounded scales that widen towards apex, smaller and more linear anteriad; scales dark gray subapically, only reaching the margin in more linear scales, pale gray on margin. Antennal scape light gray with black band at apex. Basal third of antenna with alternating gray and dark gray flagellomeres, becoming completely gray in distal two-thirds. Eyes light gray. Variation in intensity of irroration, nearly absent in some specimens. Silver or whitish ocelli. Thorax. Dorsal surface of thorax with broad light gray scales with thin white band at apex. Wings (Fig. 1A). Basal half of forewing with gray scales with rounded white apex. Antemedial fascia wide, black, followed by thin white fascia. Medial area with gray and white scales similar to those of basal half of wing. Postmedial fascia diffuse black, with lateral pointed projection of black scales near costa. Elongate, lateral patch of black scales near inner margin. White irroration near apex, diffusing into linear, dark gray scales with white apex. Terminal fringe dark gray. Hindwings with medial cleft extended less than a third of the wing’s length. Light gray, infuscated at apex. Pregenital abdomen. Scales similar to those on thorax. Tuft of yellow-white setae extending beyond final tergite to cover genital opening and valvae. Legs. Coxa and femur of prothoracic legs with scales light gray with dark gray suffusion on anterior surface. Scales on posterior side yellow white. Tibia light gray with three dark-gray bands on distal side; epiphysis present. First tarsomere long, light gray with two black bands on distal side. Other tarsomeres dark gray at base and Figure 2. Heads of Nealyda species. A) N. grandipinella. B) N. kinzelella. C) N. pisoniae. D) N. phytolaccae.
New species of Gelechiidae from the Florida Keys Insecta Mundi 1086 · 5 becoming light gray at apex. Mesothoracic legs with coxa cream colored, pattern otherwise similar to front legs except banding indistinct. Two lateral spurs arising one slightly above the other near distal end of tibia. Metathoracic legs with coxa and femur yellow grayish white with large, diffuse, light-gray spots. Tibia light gray near base, distally dark gray with four lateral spurs. Medial pair with inner spur more than 2 times the length of outer spur, extended to distal end of tibia in both sexes, becoming slightly broader at apex. Second pair of spurs subequal in length, slightly shorter than shorter medial spur, at distal end of tibia. First tarsomere dark gray with two yellowwhite bands, one at base and one at apex; other tarsomeres dark gray. Male genitalia (Fig. 3A). Valvae slightly bulbous at base, with many microtrichia, becoming constricted medially and expanding to lemon shape with slight upturned point at corona. Cucullus with microtrichia, most dense at corona. Sacculus bluntly rounded, about half the length of valvae, with strongly sclerotized apex and small blunted projection. Apex of sacculus with thick, comb-like setae. Vinculum band shaped, terminating shortly before tegumen. Uncus broadly conical, with many long microtrichia. Four large, circular scales at apex about 0.25x size of uncus, extending to about the same length as the valvae. Tegumen trapezoidal with few microtrichia, extending slightly longer than length of uncus. Gnathos thin, semicircular. Phallus ~0.25 mm, ankylosed, spinose. Figure 3. Male genitalia of Nealyda species present in Florida. A) N. grandipinella, MGCL slide 4702. 1) Saccular processes, 2) Vincular processes. B) N. kinzelella, MGCL slide 4703. C) N. pisoniae, MGCL slide 4113. D) N. phytolaccae, MGCL slide 4551. 3) Saccular processes, 4) Vincular processes. Terms from Huemer and Karsholt 2010. Scale bars = 0.1 mm.
6 · November 29, 2024 Bennett and Hayden Figure 4. Female genitalia of Nealyda species present in Florida. A) N. grandipinella, MGCL slide 5021. B) N. kinzelella, MGCL slide 4984. C) N. pisoniae, MGCL slide 5058. D) N. phytolaccae, MGCL slide 4985. Scale bars = 1 mm.
New species of Gelechiidae from the Florida Keys Insecta Mundi 1086 · 7 Female genitalia (Fig. 4A). Corpus bursae broadly ovular. Signum a slightly curved hook, about 0.25x length of corpus bursae. Ductus bursae relatively narrow and straight, ~1 mm, lacking any sclerotization. Ductus seminalis arising from posterior portion of ductus bursae. Ostium bursae funnel shaped. Papillae anales large, elliptical, heavily sclerotized, ~0.33 mm, with many long microtrichia, some extending the length of papillae anales. Immature stages. Unknown. DNA barcode. The DNA COI barcode sequence is as follows (diagnostic sites in bold italics): CTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTTGGAACTTCTCTAAGCTTATTAATTCGAGCTGAATTAGGAACTCCTGGTTCTTTAAT TGGAGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGA AATTGATTAGTACCTTTAATATTGGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCTTCTTTAACTT TACTAATTTCTAGAAGTATCGTAGAAAATGGAGCAGGTACAGGATGAACAGTTTACCCCCCTCTTTCTTCTAATATTGCTCATGGAGGTACTTC AGTTGATTTAGCAATTTTCTCTCTTCATTTAGCAGGTATTTCATCAATTTTAGGAGCTATCAATTTTATTACAACTATTATTAATATAAAAATT AATGGCCTATCTTTTGATCAAATACCACTTTTTGTTTGAGCAGTAGGTATCACAGCTTTACTTCTTCTTTTATCTTTACCTGTATTAGCAGGAGC AATTACAATACTTTTAACAGATCGTAATTTAAATACATCATTTTTTGA The most closely related available COI sequence is GONA176-10, sample ID SL0379, an undetermined Nealyda specimen collected in Puerto Rico, deposited in the MEM. Host. Unknown. Predicted to be Guapira or Pisonia (Nyctaginaceae). Distribution (Fig. 5). Big Pine Key, Monroe County, Florida, USA. Type specimens. Holotype: 1 ♂♂ “USA, FL, Mon. Co. Big Pine Key, Key Deer Blvd. Trailhead. 24.7096, -81.3826, UVL [trap], 12-13-IV-2018, P. Corogin, B. Danner, J. Farnum, J. Hayden, J. Stanley, E, Talamas, L. Whilby. E181830; J.E. Hayden photo index 424, FLMNH-MGCL Slide 07061; FLMNH-MGCL Specimen 164645”. Deposited in the FSCA. Paratypes (9): USA, Florida: 4 ♂ “USA, FL, Mon. Co. Big Pine Key, Key Deer Blvd. Trailhead. 24.7096, -81.3826, UVL [trap], 12-13-IV-2018, P. Corogin, B. Danner, J. Farnum, J. Hayden, J. Stanley, E. Talamas, L. Whilby. E18-1830”; one “FLMNH-MGCL Slide 04702 | FLMNH-MGCL Specimen 164644”; one “DNA JEH-2019-0122B Figure 5. Map of Nealyda specimens from South Florida in the FSCA.