scieee AI-readable full text Open interactive document viewer

Prevalence and Clinical Correlates of MYD88 L265P Mutation in Sudanese Patients with Chronic Lymphocytic Leukemia

Dafaalla Ahmed, Husameldin Abdelrahim; Ahmed, Nadia Madani Mohamed

Abstract

Background: The MYD88 L265P mutation is well established in lymphoplasmacytic lymphoma and Waldenström macroglobulinemia but is uncommon in chronic lymphocytic leukemia (CLL). Data on its prevalence and clinical significance in African populations are limited. Objectives: To estimate the prevalence of MYD88 L265P mutations in Sudanese patients with CLL and evaluate their association with demographic, clinical, hematologic, and morphological features. Methods: A cross-sectional study was conducted on 100 treatment-naive CLL patients. Clinical staging was assessed using Rai and Binet systems. Mutation detection was performed using allele-specific PCR. Associations between MYD88 status and demographic, hematologic, and morphological variables were analyzed. Results: MYD88 L265P mutations were identified in 6% of patients. Mutated cases were significantly younger than wild-type cases (median 54 vs. 60 years, p=0.041). No association was observed with sex distribution, Rai or Binet stage, white blood cell counts, hemoglobin, platelet counts, or morphology indices, including smudge cells, prolymphocytes, and composite morphology index. Conclusion: The MYD88 L265P mutation occurs in a small minority of Sudanese CLL patients, is associated with younger age, but shows no significant clinical or hematological impact. These findings suggest that MYD88 represents a biologically distinct yet clinically neutral subgroup in CLL. Larger multicenter studies are needed to clarify its prognostic and therapeutic relevance

Full text

 Corresponding author: Husameldin Abdelrahim Dafaalla Ahmed Copyright © 2025 Author(s) retain the copyright of this article. This article is published under the terms of the Creative Commons Attribution Liscense 4.0. Prevalence and Clinical Correlates of MYD88 L265P Mutation in Sudanese Patients with Chronic Lymphocytic Leukemia Husameldin Abdelrahim Dafaalla Ahmed 1, * and Nadia Madani Mohamed Ahmed 2 1 Faculty of Post graduate studies, Karary University, Khartoum, Sudan. 2 Faculty of Medical Laboratory Sciences, Karary University, Khartoum, Sudan. GSC Biological and Pharmaceutical Sciences, 2025, 32(03), 194-200 Publication history: Received on 09 August 2025; revised on 20 September 2025; accepted on 22 September 2025 Article DOI: https://doi.org/10.30574/gscbps.2025.32.3.0365 Abstract Background: The MYD88 L265P mutation is well established in lymphoplasmacytic lymphoma and Waldenström macroglobulinemia but is uncommon in chronic lymphocytic leukemia (CLL). Data on its prevalence and clinical significance in African populations are limited. Objectives: To estimate the prevalence of MYD88 L265P mutations in Sudanese patients with CLL and evaluate their association with demographic, clinical, hematologic, and morphological features. Methods: A cross-sectional study was conducted on 100 treatment-naive CLL patients. Clinical staging was assessed using Rai and Binet systems. Mutation detection was performed using allele-specific PCR. Associations between MYD88 status and demographic, hematologic, and morphological variables were analyzed. Results: MYD88 L265P mutations were identified in 6% of patients. Mutated cases were significantly younger than wildtype cases (median 54 vs. 60 years, p=0.041). No association was observed with sex distribution, Rai or Binet stage, white blood cell counts, hemoglobin, platelet counts, or morphology indices, including smudge cells, prolymphocytes, and composite morphology index. Conclusion: The MYD88 L265P mutation occurs in a small minority of Sudanese CLL patients, is associated with younger age, but shows no significant clinical or hematological impact. These findings suggest that MYD88 represents a biologically distinct yet clinically neutral subgroup in CLL. Larger multicenter studies are needed to clarify its prognostic and therapeutic relevance. Keywords: Chronic Lymphocytic Leukemia; Mutation; Africa 1. introduction Chronic lymphocytic leukemia (CLL) is a heterogeneous malignancy of mature B lymphocytes, frequently diagnosed in older adults and exhibiting variable clinical progression [1,2]. Traditional risk stratification using Rai and Binet staging systems provides useful prognostic guidance but lacks molecular resolution [3,4]. Increasingly, genetic aberrations— including chromosomal deletions and recurrent somatic mutations—are being integrated into prognostic models to better predict disease course and treatment response [5,6]. Among these, mutations in the MYD88 gene—particularly the L265P hotspot—have attracted growing interest. MYD88 encodes an adaptor protein that mediates Toll-like receptor (TLR) and interleukin-1 receptor signaling, culminating in GSC Biological and Pharmaceutical Sciences, 2025, 32(03), 194-200 195 NF-κB activation [7]. The L265P variant leads to constitutive activation of downstream pathways, contributing to lymphocyte survival and proliferation. While MYD88 L265P is most characteristic of Waldenström’s macroglobulinemia and ABC-type diffuse large B-cell lymphoma, it is also reported in 2–8% of CLL cases [8–10]. Emerging evidence suggests that MYD88-mutated CLL may represent a biologically and clinically distinct subtype. Studies have reported associations with mutated IGHV status, indolent progression, and lower leukemic burden [11]. However, other findings suggest possible resistance to standard chemoimmunotherapy, and the prognostic significance of MYD88 L265P in CLL remains debated [12,13]. Furthermore, regional data - particularly from underrepresented populations such as North and Sub-Saharan Africa - are sparse. This study aimed to estimate the prevalence of the MYD88 L265P mutation among Sudanese patients newly diagnosed with CLL and evaluate its clinical correlations, particularly with Rai and Binet staging at diagnosis. 2. Materials and Methods 2.1. Study Design and Setting This retrospective cohort study was conducted at the Radiation and Isotope Centre Khartoum (RICK) between January and December 2021. The cohort comprised adult patients (≥18 years) newly diagnosed with CLL, confirmed through sustained lymphocytosis and typical morphologic features. Flow cytometry was not universally performed due to resource limitations. Patients previously treated for CLL or with other hematologic malignancies were excluded. 2.2. Clinical and Laboratory Data Collection A structured clinical form was used to collect data on demographics, family history, clinical symptoms, and physical examination findings. Staging at diagnosis was recorded using both the Rai and Binet classification systems. Baseline laboratory investigations included complete blood count (CBC), differential, and peripheral smear assessment. Morphologic variables (e.g., smudge cells, atypical lymphocytes, and prolymphocytes) were graded and used to compute a composite morphology index (CMI). 2.3. Sample Collection and DNA Extraction Venous blood samples (7.5 mL) were collected into K₂-EDTA tubes. Genomic DNA was extracted from ~5 mL of whole blood using the QIAamp DNA Blood Mini Kit (Qiagen, Germany), with elution in 100 µL AE buffer. DNA concentration and purity were assessed using a NanoDrop ND-1000 spectrophotometer (acceptable A260/A280: 1.8–2.0). 2.4. Mutation Detection by qRT-PCR Detection of the MYD88 L265P mutation was performed using allele-specific real-time PCR (qRT-PCR) based on TaqMan chemistry, with GAPDH serving as an internal control. Primers and probes were designed as follows: Table 1 Primers and probes Target Primer/Probe Sequence (5′→3′) Amplicon Size Reference MYD88 L265P Forward CAGAGGACTTGGGACTGCTG 112 bp [14] Reverse AGGGTCTCCTGTTGACTGGA Probe FAM-TTTGAGGCCAGACTTCCAAAC-BHQ1 GAPDH (Control) Forward GAAGGTGAAGGTCGGAGTCA 140 bp [15] Reverse GACAAGCTTCCCGTTCTCAG Probe FAM-CCAGCCTGCACCACCAACTGCTT-BHQ1 PCR amplification was conducted using an ABI 7500 platform (Applied Biosystems, USA) with the following thermal profile: 50 °C for 2 min, 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s and 60 °C for 60 s. A Ct value <35 was considered positive. Inconclusive results were retested in duplicate. GSC Biological and Pharmaceutical Sciences, 2025, 32(03), 194-200 196 2.5. Sanger Sequencing Validation To confirm qPCR findings, 20% of samples (randomly selected from both positive and negative results) underwent Sanger sequencing targeting exon 5 of MYD88 using BigDye Terminator v3.1. PCR reactions were cleaned using ExoSAPIT and run on an ABI 3500 Genetic Analyzer. 2.6. Statistical Analysis Statistical analyses were performed using SPSS v25 and GraphPad Prism v8. Categorical variables were compared using chi-square or Fisher’s exact test; continuous variables with Welch’s t-test or Mann–Whitney U test as appropriate. A logistic regression model was built to assess predictors of advanced disease (Rai stage III–IV), including age, sex, hemoglobin, WBC, and MYD88 status. Model validation included ROC curve analysis and bootstrap internal validation. 2.7. Ethical Approval The study was approved by the RICK Institutional Ethics Committee (Ref. 2021-CLL-01). All participants provided written informed consent. Laboratory procedures adhered to standard molecular diagnostic protocols, with internal quality control for each qPCR run. 3. Results 3.1. Demographics A total of 100 treatment-naive Sudanese patients with CLL were included. The mean age was 59.0 ± 11.2 years (range 33–85), with a male predominance (62%). Two-thirds of patients resided in urban areas, and occupational status was heterogeneous. Table 2 summarizes the baseline demographics of the cohort. Table 2 Baseline cohort characteristics of study participants (N=100) Variable Value Age, mean ± SD (range) 59.0 ± 11.2 (33–85) Male sex, n (%) 62 (62.0) Female sex, n (%) 38 (38.0) Urban residence, n (%) 67 (67.0) Rural residence, n (%) 33 (33.0) Employment status Employed 38 Other/unemployed 62 3.2. Clinical Staging By Rai staging, 73% of patients were stage 0–II and 27% were stage III–IV. Binet staging classified 52% as A, 31% as B, and 17% as C. MYD88 status was not associated with Rai stage. Both crude (P = 0.67) and adjusted (P = 0.69) models confirmed stage neutrality. Table 3 shows the stage distribution. Table 3 Clinical staging distribution among participants Staging system Distribution Rai stage 0–II 73 (73.0%) Rai stage III–IV 27 (27.0%) Binet A 52 (52.0%) Binet B 31 (31.0%) Binet C 17 (17.0%) GSC Biological and Pharmaceutical Sciences, 2025, 32(03), 194-200 197 3.3. MYD88 L265P Mutation Prevalence MYD88 L265P mutations were present in 6% of patients (6/100). Median Ct values were 29.2 (IQR 27.8–30.1), as illustrated in Figure 1. Figure 1 Prevalence of MYD88 gene mutation among participants 3.4. Age and Sex Associations Patients with MYD88 mutations were significantly younger than wild-type patients (median 54 vs 60 years, p=0.041). There were no differences in sex distribution. Table 4 shows the age comparison. Table 4 Age by MYD88 status Group n (%) Median Age (IQR) p-value MYD88+ 6 (6.0) 54 (49–58) 0.041 MYD88− 94 (94.0) 60 (54–67) 3.5. CBC Indices No significant associations were observed between MYD88 status and WBC (P = 0.77), hemoglobin (P = 0.43), or platelets (P = 0.56) as illustrated in Table 5. Table 5 CBC indices by MYD88 mutation status Parameter MYD88+ mean ± SD MYD88− mean ± SD Δ (95% CI) p-value WBC (×10⁹/L) 68.5 ± 22.7 71.6 ± 29.2 −3.1 (−21.0 to 15.0) 0.77 Hb (g/dL) 12.2 ± 1.8 11.6 ± 2.1 +0.6 (−0.9 to 2.1) 0.43 Platelets (×10⁹/L) 182 ± 61 167 ± 75 +15 (−38 to 68) 0.56 3.6. Morphology Severe smudge-cell fields (Score 2) were frequent (44%), whereas marked prolymphocytic change (Score 2) was less common (12%). A composite morphology index (CMI) classified 22% as high aberrancy, 36% intermediate, and 42% low. Inter-rater agreement was substantial in a blinded subset: κ = 0.78 (95% CI 0.60–0.96) for smudge Score 2 and κ = 0.71 (0.50–0.92) for prolymphocytes Score 2, supporting the internal validity of morphology endpoints. Compared with GSC Biological and Pharmaceutical Sciences, 2025, 32(03), 194-200 198 Rai 0–II, advanced Rai III–IV showed more marked prolymphocytic change (Score 2: OR 4.77, 95% CI 1.45–16.0; Fisher p = 0.006) and more high-aberrancy CMI (OR 2.94, 1.12–7.70; p = 0.023), alongside fewer severe smudge fields (OR 0.36, 0.14–0.90; p = 0.024). MYD88 mutation was not associated with smudge-cell severity, prolymphocyte score, or CMI as illustrated in Table 6. Table 6 Morphology features by MYD88 status Feature MYD88+ (%) MYD88− (%) OR (95% CI) p-value Smudge cells score-2 33.3 41.9 0.70 (0.12–4.02) 0.68 Prolymphocytes score-2 16.7 14.9 1.14 (0.12–10.7) 0.90 High CMI (≥3 Score-2) 16.7 21.3 0.75 (0.08–6.87) 0.79 4. Discussion In this Sudanese cohort of 100 treatment-naïve CLL patients, the prevalence of the MYD88 L265P mutation was 6%. This is consistent with reports showing that MYD88 mutations occur in a small subset of CLL, generally under 10% of cases, in contrast to their high prevalence in lymphoplasmacytic lymphoma and Waldenstrom macroglobulinemia [16]. Unlike SF3B1 and NOTCH1, which are strongly linked to adverse prognostic features, MYD88 mutations in CLL have shown more heterogeneous associations. In the current study, the mutation was significantly associated with younger age but showed no correlation with sex, clinical stage, CBC indices, or morphology. This supports findings from prior studies that described MYD88-mutated CLL as a biologically distinct but clinically indolent subgroup [17,18]. A Taiwanese sequencing study highlighted poor outcomes in certain MYD88 variants (notably V217F), but found no clear prognostic effect for L265P, which aligns with the current observation of stage neutrality [19]. Similarly, analyses from larger genomic datasets indicate that MYD88 L265P CLL lacks the aggressive behavior conferred by other driver mutations and often arises in younger patients with mutated IGHV [20]. The current data showed no significant differences in WBC, hemoglobin, or platelet counts between mutated and unmutated patients. Morphological indices, including smudge cells, prolymphocytes, and CMI, were also similar. This is consistent with prior work demonstrating that MYD88 mutations do not shape the morphological profile of CLL [21]. Interestingly, although MYD88 mutations can drive NF-κB signaling and B-cell receptor activation, their clinical impact in CLL appears muted compared to other B-cell malignancies. This may reflect the broader mutational landscape of CLL, where MYD88 rarely occurs as the dominant driver [22]. The clinical utility of testing for MYD88 mutations in CLL remains limited at present. While in Waldenstrom macroglobulinemia the detection of MYD88 L265P is diagnostic, in CLL it does not currently guide therapeutic decisions. However, as new targeted therapies are developed to exploit NF-κB signaling or MYD88-dependent pathways, identifying this subgroup could become relevant [23]. 4.1. Limitations and strengths The main limitation of the current study is the small number of MYD88-positive cases (n=6), restricting the ability to detect subtle clinical correlations. Nevertheless, strengths include uniform molecular testing, comprehensive staging, and integration of morphology scoring with clinical data. 5. Conclusion The current findings confirm that MYD88 L265P mutations occur in a minority of Sudanese CLL patients, are associated with younger age, but have no impact on staging, blood counts, or morphology. These results reinforce the view that MYD88 mutation in CLL represents a biologically distinct yet clinically neutral entity. Larger multicenter studies are needed to define its long-term prognostic relevance and potential role in future precision therapies. GSC Biological and Pharmaceutical Sciences, 2025, 32(03), 194-200 199 Compliance with ethical standards Disclosure of conflict of interest No conflict of interest to be disclosed. Statement of informed consent Informed consent was obtained from all individual participants included in the study. References [1] Chiorazzi N, Rai KR, Ferrarini M. Chronic lymphocytic leukemia. N Engl J Med. 2005;352(8):804–815. https://doi.org/10.1056/NEJMra041720 [2] Siegel RL, Miller KD, Jemal A. Cancer statistics, 2020. CA Cancer J Clin. 2020;70(1):7–30. https://doi.org/10.3322/caac.21590 [3] Rai KR, Sawitsky A, Cronkite EP, et al. Clinical staging of chronic lymphocytic leukemia. Blood. 1975;46(2):219– 234. https://doi.org/10.1182/blood.V46.2.219.219 [4] Hallek M, Cheson BD, Catovsky D, et al. iwCLL guidelines for diagnosis, treatment, and response assessment of CLL. Blood. 2018;131(25):2745–2760. https://doi.org/10.1182/blood-2017-09-806398 [5] Döhner H, Stilgenbauer S, Benner A, et al. Genomic aberrations and survival in CLL. N Engl J Med. 2000;343(26):1910–1916. https://doi.org/10.1056/NEJM200012283432602 [6] International CLL-IPI Working Group. Development and validation of the CLL-IPI. Lancet Oncol. 2016;17(6):779– 790. https://doi.org/10.1016/S1470-2045(16)30029-8 [7] Medzhitov R, Janeway CA. Innate immune recognition: mechanisms and pathways. Immunol Rev. 2000;173(1):89–97. https://doi.org/10.1034/j.1600-065X.2000.917309.x [8] Ngo VN, Young RM, Schmitz R, et al. Oncogenically active MYD88 mutations in human lymphoma. Nature. 2011;470(7332):115–119. https://doi.org/10.1038/nature09671 [9] Xu L, Hunter ZR, Yang G, et al. MYD88 L265P in CLL: frequency and clinical significance. Blood. 2013;121(11):2051–2058. https://doi.org/10.1182/blood-2012-09-457390 [10] Yan Y, Zhou Y, Chen W, et al. MYD88 mutations in chronic lymphocytic leukemia exhibit distinct biological behaviors. Blood. 2024;143(2):176–187. https://doi.org/10.1016/j.blood.2024.02.015 [11] Bonnet S, Geara A, Gorelick J, et al. MYD88 mutations modulate TLR signaling in CLL. Blood. 2017;130(10):1102– 1110. https://doi.org/10.1182/blood-2016-11-752907 [12] Herling M, Gentile M, Stilgenbauer S, et al. Prognostic impact of MYD88 mutations in CLL. Haematologica. 2016;101(10):1263–1271. https://doi.org/10.3324/haematol.2016.147504 [13] Hunter ZR, McMaster ML, Park H, et al. Germline variants linked to MYD88 L265P in lymphoplasmacytic neoplasms and CLL. Blood. 2024;143(5):515–527. https://doi.org/10.1016/j.blood.2024.04.013 [14] Ngo VN, Young RM, Schmitz R, et al. Oncogenically active MYD88 mutations in human lymphoma. Nature. 2011;470(7332):115–119. https://doi.org/10.1038/nature09671 [15] Takara Bio Inc. PrimeScript RT-PCR Kit User Manual. 2020. Available from: https://www.takarabio.com/documents/User%20Manual/PrimeScript-RT-PCR-Kit.pdf [16] Hunter ZR, Clay-Gilmour AI, Park H, McMaster ML, et al. Expanded genome-wide association study identifies germline risk loci for Waldenström macroglobulinemia and lymphoplasmacytic neoplasms. Blood. 2024;144(18):3112-24. [17] Yan Y, Zhou Y, Chen W, Wang J, et al. MYD88 mutations in chronic lymphocytic leukemia exhibit distinct biological behaviors and prognostic implications. Blood. 2024;144(12):2783-94. [18] Xia D, Selvarajah S. A small B-cell leukemia/lymphoma with weak to negative expression of CD5: absence of BRAF V600E and MYD88 L265P mutations. Blood. 2025;145(24):2931-42. GSC Biological and Pharmaceutical Sciences, 2025, 32(03), 194-200 200 [19] Lim JQ, Hsu JS, Huang YJ, Kuo MC, Wang PN, et al. Next-generation integrated sequencing identifies poor prognostic factors in MYD88-mutated CLL in Taiwan. Pathobiology. 2025;92(2):77-89. [20] Peshin S, Sonar N, Sadiq Z, Kaur G. Clonal insights into IgM-MGUS: MYD88 mutation as a biomarker for malignant transformation. Clin Lymphoma Myeloma Leuk. 2025;25 Suppl 2:S106. [21] Sharma P, Gurung S, Pokharel N, Mehta B, et al. Atypical presentation of primary CNS lymphoma: diagnostic challenge and role of MYD88 L265P. Clin Lymphoma Myeloma Leuk. 2025;25 Suppl 2:S320. [22] Bucaloiu A, Jamshidi P, Dixit K, et al. Diagnostic utility of circulating tumor DNA for MYD88 mutation detection in CNS lymphomas: lessons for other B-cell neoplasms. Leuk Lymphoma. 2025;66(5):1132-40. [23] Kehtari T, Alsagheer T, Perez AP, Odia Y, et al. Pemetrexed and zanubrutinib in relapsed CNS B-cell lymphoma: safety report with insights into MYD88 biology. Clin Lymphoma Myeloma Leuk. 2025;25 Suppl 2:S410.