scieee AI-readable full text Open interactive document viewer

Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae (Dothideomycetes, Ascomycota): Two new species and three new host reports in the coastal region of Guangdong Province, China

de Silva, Nimali I.; Tennakoon, Danushka S.; Xie, Ning; Hongsanan, Sinang

Abstract

During a survey of microflora associated with dead plant substrates in coastal regions of Guangdong Province, China, we identified several interesting Dothideomycetes fungi and provided refined updated phylogenetic analyses for Dictyosporium and Melomastia species. Two novel species are introduced, Dictyosporium thecatum and Melomastia shenzhenensis, based on molecular and morphological evidence. New host records of M. beihaiensis, M. hydei and M. fusispora are also reported in this paper. Molecular phylogenetic studies of new isolates were based on concatenated (i) ITS, LSU, tef1-α and (ii) LSU, SSU, ITS, tef1-α gene regions for Dictyosporium and Melomastia, respectively. These taxonomic novelties were recognised by comparing morphological characteristics with closely-related taxa. Melomastia shenzhenensis closely clustered with M. oleae (CGMCC 3.20619 and UESTCC 21.0003) with high statistical support value (ML/BYPP = 100%/1.00). Morphologically, Melomastia shenzhenensis can be distinguished from M. oleae in having larger of ascomata, ostiolar canal and peridium and smaller asci and ascospores. Dictyosporium thecatum forms a distinct basal clade with D. sexualis (MFLUCC 10-0127). Dictyosporium thecatum is different from D. sexualis in having smaller ascomata, asci and ascospores and possesses a larger mucilaginous sheath surrounding ascospores than D. sexualis. Two pairwise identity analyses were conducted for Dictyosporium and Melomastia. The resulting sequence identity scores were saved as a matrix and visualised as plots with a colour key to indicate the correspondence between pairwise identities. This study offers new insights into saprobic Dothideomycetes colonising dead woody substrates in coastal habitats of Guangdong Province, China.

Full text

115 Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae (Dothideomycetes, Ascomycota): Two new species and three new host reports in the coastal region of Guangdong Province, China Nimali I. de Silva1, Danushka S. Tennakoon1, Ning Xie1, Sinang Hongsanan1,2 1 Shenzhen Key Laboratory of Microbial Genetic Engineering, College of Life Science and Oceanography, Shenzhen University, Shenzhen 518060, China 2 Guangdong Provincial Key Laboratory for Plant Epigenetics, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518060, China Corresponding author: Sinang Hongsanan ([email protected]) Copyright: © Nimali I. de Silva et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract During a survey of microflora associated with dead plant substrates in coastal regions of Guangdong Province, China, we identified several interesting Dothideomycetes fungi and provided refined updated phylogenetic analyses for Dictyosporium and Melomastia species. Two novel species are introduced, Dictyosporium thecatum and Melomastia shenzhenensis, based on molecular and morphological evidence. New host records of M. beihaiensis, M. hydei and M. fusispora are also reported in this paper. Molecular phylogenetic studies of new isolates were based on concatenated (i) ITS, LSU, tef1-α and (ii) LSU, SSU, ITS, tef1-α gene regions for Dictyosporium and Melomastia, respectively. These taxonomic novelties were recognised by comparing morphological characteristics with closely-related taxa. Melomastia shenzhenensis closely clustered with M. oleae (CGMCC 3.20619 and UESTCC 21.0003) with high statistical support value (ML/BYPP = 100%/1.00). Morphologically, Melomastia shenzhenensis can be distinguished from M. oleae in having larger of ascomata, ostiolar canal and peridium and smaller asci and ascospores. Dictyosporium thecatum forms a distinct basal clade with D. sexualis (MFLUCC 10-0127). Dictyosporium thecatum is different from D. sexualis in having smaller ascomata, asci and ascospores and possesses a larger mucilaginous sheath surrounding ascospores than D. sexualis. Two pairwise identity analyses were conducted for Dictyosporium and Melomastia. The resulting sequence identity scores were saved as a matrix and visualised as plots with a colour key to indicate the correspondence between pairwise identities. This study offers new insights into saprobic Dothideomycetes colonising dead woody substrates in coastal habitats of Guangdong Province, China. Key words: Dyfrolomycetales, multi-gene phylogeny, Pleosporales, saprobes, systematics, taxonomy Introduction Coastal regions encompass some of the most biodiverse and unique ecosystems on Earth. These maritime zones are home to the oceans’ bounty that encompass a broad range of habitat types, including coral reefs, kelp forests, seagrass, tidal flats, mangroves, estuaries, salt marshes, wetlands and coastal wooded habitat (Williams et al. 2022). China is one of the countries possessing Academic editor: Ning Jiang Received: 9 September 2025 Accepted: 20 October 2025 Published: 17 November 2025 Citation: de Silva NI, Tennakoon DS, Xie N, Hongsanan S (2025) Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae (Dothideomycetes, Ascomycota): Two new species and three new host reports in the coastal region of Guangdong Province, China. MycoKeys 125: 115–146. https://doi. org/10.3897/mycokeys.125.171612 MycoKeys 125: 115–146 (2025) DOI: 10.3897/mycokeys.125.171612 116 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae numerous sea resources with a vast maritime region (Ren et al. 2018). The persistence of many fungal species relies upon diverse macro and micro habitats in coastal regions. Despite the availability of abundant ecological niches, research on the fungi inhabiting coastal south China region remains limited. Consequently, exploration of fungi in poorly-understood geographical locations, such as maritime ecological regions of China, would probably contribute to reveal novel taxa and expand host and geographical association of known species. The South China Sea is the largest marginal sea in the western Pacific, covering ~ 3.5 million km2 along the continental margin of East Asia and averaging over 2,000 m in depth (Morton and Blackmore 2001; Yao and Wang 2021; Wang et al. 2022). Since it is a marginal sea, it is surrounded by extensive landmasses (Morton and Blackmore 2001). The South China Sea lies at the centre of the Indo-West Pacific biogeographic region harbouring the world’s most diverse shallow-water maritime ocean (Morton and Blackmore 2001). The south China coastline harbours different ecosystem types, i.e. coral reefs, seagrasses, mangroves, wetlands, bays and coastal vegetation (Morton and Blackmore 2001; Zhang et al. 2025). The largest mainland coastline in the South China Sea can be seen in Guangdong Province which spans along 14 coastal cities (Zhang et al. 2025). The Shenzhen Bay Estuary is located on the east coast of the Pearl River Estuary in South China, in Guangdong Province (Xu et al. 2022). Eight rivers, including the Fengtang River, flow into Shenzhen Bay (Xu et al. 2022) indicating an ecologically valuable habitat for fungal identification. The natural vegetation in Shenzhen Bay consisting of mangroves, semi-mangroves, wetland plants and terrestrial plants, was restored from the bund to the inner bank of the Fengtang River (Xu et al. 2022). These unique geographical locations provide a suitable growth environment for abundant fungal resources. In addition, Guangdong Province has a rich diversity of plants, ranking it sixth in China (Zhuqiu et al. 2023). The vegetation comprises a variety of plants, including native wild higher plants, bryophytes, lycopods and pteridophytes, gymnosperms and angiosperms (Zhuqiu et al. 2023). The most common and widely distributed angiosperms are Poaceae, Fabaceae, Orchidaceae, Cyperaceae, Rubiaceae, Lamiaceae, Asteraceae, Rosaceae, Lauraceae and Gesneriaceae (Zhuqiu et al. 2023). Apart from that, the southern China coastal region is considered as one of the major mangrove regions in the world (Luo et al. 2022). Further, the fungal resources in this region have been exploited and utilised to research secondary metabolites, such as anti-tumour drugs to treat cancer (Luo et al. 2022). Dothideomycetes represent a major taxonomic group of Ascomycota, encompassing more than 25 orders, 110 families and over 19,000 species (Wijayawardene et al. 2022). The species of this group are characterised by bitunicate asci, typically with fissitunicate dehiscence and many species have been collected from freshwater habitats (Dong et al. 2020; Pem et al. 2021; Wang et al. 2025). They show cosmopolitan distribution and occur in a wide variety of environments including terrestrial, marine, freshwater and extreme environments (Suetrong et al. 2009; Dayarathne et al. 2020; Dong et al. 2020; Pem et al. 2021). Terrestrial fungi occur in a variety of substrata, soil, rocks and in plants and exhibit different life-styles as saprobes, plant pathogens, endophytes, epiphytes, ectomycorrhizal, lichens, lichenicolous, nematode-trapping and rock-inhabiting members (Taylor and Sinsabaugh 2015; Hongsanan et al. 2020; Pem et al. 2021; Wanasinghe et al. 2022). In terms of marine mycota, fungi associated 117 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae with plants in coastal region receive little attention compared to mangrove ecosystems. Therefore, our aim is to investigate and identify some of the saprobic Dothideomycetes fungi in Shenzhen Bay region in Guandong Province, China. In this study, we mainly focus on Dictyosporium species (Dictyosporiaceae, Pleosporales) and Melomastia species (Pleurotremataceae, Dyfrolomycetales, Dothideomycetes orders incertae sedis). The overall intention of this study has been to present two novel fungal species, Dictyosporium thecatum and Melomastia shenzhenensis and three new records of Melomastia species. All the taxonomic novelties were confirmed through molecular phylogenetic analyses and morphological evidence. Materials and methods Sample collection, examination and isolation of fungi A fungal collection from dead plant materials were conducted from different sampling sites in Shenzhen Bay, Guangdong Province, China during January to June 2025. Dead twigs, branches were collected and those samples were taken into the laboratory in polythene bags and paper envelopes for examination. Micro-morphological characteristics including structure and size of ascomata, conidiomata, asci, ascospores and conidia were observed using an OLYMPUS SZ61 compound microscope. Images of these fungal micro-structures were acquired with a Canon EOS 600D digital camera equipped with a Nikon ECLIPSE 80i compound microscope. All the measurements were taken using NIS-Elements version 5.10 imaging software when capturing photographs. Photographs were processed and photographic plates were assembled using Adobe Photoshop 2021 (Adobe Systems, San Jose, CA). Pure fungal cultures were obtained through single spore isolation following Senanayake et al. (2020). Single germinating spores were transferred on to fresh PDA (Potato Dextrose Agar) plates and incubated in the dark at 25 °C. Herbarium specimens were deposited in the Herbarium of Shenzhen University (SZU), China. The living cultures were deposited in the Microbial Culture Collection at Shenzhen University (MBSZU), China. Facesoffungi numbers are provided as explained in Jayasiri et al. (2015) and Index Fungorum identifiers were obtained by registering with Index Fungorum (2025). DNA extraction, PCR amplification and sequencing Initially, pure fungal cultures were grown in PDA and kept the dark at temperatures ranging from 25 to 27 °C. Fresh fungal mycelia were scraped from these fungal cultures under axenic conditions. Subsequently, fungal genomic DNA was extracted from mycelia using Biospin fungus genomic DNA kit (BioFlux, P.R. China) according to the manufacturer’s instructions. DNA was kept at 4 °C for the DNA amplification of genes and maintained at –20 °C for long-term storage. DNA amplification was performed by polymerase chain reaction (PCR). Both forward and reverse primers of four loci that used for the PCR amplification, namely, internal transcribed spacers (ITS), large subunit rDNA (LSU), small subunit rDNA (SSU) and translation elongation factor 1-α (tef1-α) regions were listed in Table 1. The PCR thermal cycle programmes for LSU, SSU, ITS and tef1 118 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae amplification were followed as in Wu et al. (2024). The final reaction volume of the PCR mixture was 25 µl containing 1 µl of DNA template, 1 µl each of the forward and reverse primer, 9.5 µl of double-distilled water (ddH2O) and 12.5 µl of 2× taq PCR Master Mix (mixture of DNA Polymerase, dNTPs, Mg2+ and optimised buffer; CoWin Biosciences, Jiangsu, China). The PCR product quality was tested on 1% agarose electrophoresis gels stained with ethidium bromide. PCR purification and sequencing of amplified PCR products were carried out at Beijing Liuhe BGI Genomics Co., Ltd., China. Phylogenetic analyses Initially, resulted DNA sequence data was matched with available sequence data in the GenBank, based on the BLAST (http://www.ncbi.nlm.nih.gov/) search tool. Representative fungal taxa that are closely related to our new strains were retrieved from GenBank and recent publications (Li et al. 2022; Kularathnage et al. 2023; Tennakoon et al. 2023; Shu et al. 2024; Hongsanan et al. 2025; Wang et al. 2025). Individual gene sequence data were aligned with MAFFT v. 7 (Katoh et al. 2019) and manually improved where necessary using BioEdit v. 7.0.5.2 (Hall 1999). Newly-generated sequence data were deposited in GenBank. The accession numbers used in the phylogenetic analyses were mentioned in Tables 2, 3. Evolutionary models for phylogenetic analyses were selected for each locus using MrModelTest v. 3.7 (Posada and Crandall 1998) under the Akaike Information Criterion (AIC). Maximum-Likelihood (ML) analysis was carried out in online portal CIPRES Science Gateway v.3.3 (http://www.phylo.org/portal2/; Miller et al. (2010)) using RAxML-HPC2 on XSEDE (8.2.12) tool (Stamatakis 2014). The default settings were adapted, except for the selection of GAMMA nucleotide substitution model and 1,000 rapid bootstrap replicates. Bayesian analysis was conducted with MrBayes v. 3.1.2 (Huelsenbeck and Ronqvist 2001). Parameters for Bayesian Inference: Markov chains were set to run 1,000,000 generations and resulting trees were sampled every 100th generation (printfreq = 100) and 10,000 trees were obtained. Initial trees were discarded (20% burn-in value) and the remaining trees were used to evaluate posterior probabilities (PP) in the majority rule consensus tree. Phylograms were visualised in FigTree v.1.4.0 (http://tree.bio.ed.ac.uk/software/figtree/; Rambaut (2014)) and the tree was edited using Microsoft PowerPoint (2010). In addition, pairwise similarity identity values were calculated for Dictyosporium and Melomastia genera. Sequence Demarcation Tool version 1.2 (SDT Table 1. Forward and reverse primers information of ITS, LSU, SSU and tef1-α regions. Locus Primers Reference ITS Forward: ITS5 TCCTCCGCTTATTGATATGC White et al. (1990) Reverse: ITS4 GGAAGTAAAAGTCGTAACAAGG LSU Forward: LR0R GTACCCGCTGAACTTAAGC Vilgalys and Hester (1990) Reverse: LR5 ATCCTGAGGGAAACTTC SSU Forward: NS1 GTAGTCATATGCTTGTCTC White et al. (1990) Reverse: NS4 CTTCCGTCAATTCCTTTAAG tef1-α Forward: EF1-983F GCYCCYGGHCAYCGTGAYTTYAT Rehner and Buckley (2005) Reverse: EF1-2218R ATGACACCRACRGCRACRGTYTG 119 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Table 2. Taxa names, strain numbers and corresponding GenBank accession numbers of the taxa included in the phylogenetic analysis of Melomastia. Taxa name Culture accession number GenBank accession numbers LSU SSU ITS tef1-α Acrospermum adeanum M 133 EU940104 EU940031 EU940180 – Acrospermum compressum M 151 EU940084 EU940012 EU940161 – Acrospermum graminum M 152 EU940085 EU940013 EU940162 – Anisomeridium phaeospermum MPN539 JN887394 JN887374 –JN887418 Anisomeridium ubianum MPN94 – JN887379 –JN887421 Dyfrolomyces chromolaenae MFLUCC 17-1434T–MT214413 –MT235800 Dyfrolomyces tiomanensis MFLUCC 13-0440 T KC692156 KC692155 –KC692157 Melomastia aquilariaeZHKUCC 23-0073 T OR807856 OR807854 –OR832867 Melomastia beihaiensis KUMCC 21-0084 T MZ726990 MZ727002 MZ726997 OK043822 Melomastia beihaiensis MBSZU 25-048 PX271110 PX271105 PX308635 PX273902 Melomastia clematidis MFLUCC 17-2092 T MT214607 MT226718 MT310651 MT394663 Melomastia diqingensis KUMCC 21-0536 OQ170873 OQ168224 OQ158951 OR613413 Melomastia distoseptata NFCCI 4377 MH971236 –MK024391 – Melomastia fulvicomae MFLUCC 17-2083 T MT214608 MT226719 MT310652 – Melomastia fusispora CGMCC 3.20618 T OK623464 OK623494 OK623480 OL335189 Melomastia fusispora UESTCC 21.0001 T OK623465 OK623495 OK623481 OL335190 Melomastia fusispora MBSZU 25-050 PX271112 PX271106 PX289102 PX273903 Melomastia guangdongensis GMBCC1046 T PQ530970 PQ530975 –PQ559185 Melomastia hydei MBSZU 25-003 T PQ844642 PQ844644 PQ849544 PQ868900 Melomastia hydei MBSZU 25-004 PQ844643 PQ844645 PQ849545 PQ868901 Melomastia hydei MBSZU 25-049 PX271111 –PX289101 – Melomastia italica MFLUCC 15-0160 T MG029458 MG029459 – – Melomastia loropetalicola ZHKUCC 22-0174 T OQ379412 OQ379411 – – Melomastia maolanensis GZCC 16-0102 T KY111905 KY111906 –KY814762 Melomastia maomingensis ZHKUCC 23-0038 T PP809724 PP809704 OR825372 PP812255 Melomastia maomingensis ZHKUCC 23-0055 PP809725 PP809705 PP812256 Melomastia neothailandica MFLU 17-2589 T NG068294 – – – Melomastia oleae CGMCC 3.20619 T OK623466 OK623496 OK623482 OL335191 Melomastia oleae UESTCC 21.0003 OK623467 OK623497 –OL335192 Melomastia phetchaburiensis MFLUCC 15-0951 T MF615402 MF615403 – – Melomastia puerensis ZHKUCC 23-0803 OR922310 OR922341 OR941078 OR966285 Melomastia puerensis ZHKUCC 23-0802 T OR922309 OR922340 OR941077 OR966284 Melomastia pyriformis ZHKUCC 22-0175 T OP791870 OP739334 –OQ718392 Melomastia rhizophorae JK 5439 A GU479799 GU479766 –GU479860 Melomastia septata MFLUCC 22-0112 T OP749870 – – OP760198 Melomastia shenzhenensis MBSZU 25-051TPX271109 PX271104 PX308634 PX273901 Melomastia sichuanensis CGMCC 3.20620TOK623469 OK623500 –OL335195 Melomastia sinensis MFLUCC 17-1344 T MG836699 MG836700 – – Melomastia thailandica MFLUCC 15-0945 T KX611366 KX611367 – – Melomastia thamplaensis MFLUCC 15-0635 T KX925435 KX925436 –KY814763 Melomastia winteri CGMCC 3.20621 OK623471 OK623502 OK623485 OL335197 Melomastia yunnanensis GMBCC1009T PQ530973 PQ530978 –PQ559188 Muyocopron castanopsis MFLUCC 14-1108 KU726965 KU726968 –MT136753 Muyocopron dipterocarpi MFLU 17-2608 KU726966 KU726969 NR_168252 MT136754 Muyocopron heveae MFLUCC 17-0066 T MH986832 MH986828 MH986836 – Muyocopron lithocarpi MFLUCC 14-1106 T KU726967 KU726970 NR_168253 MT136755 Palawania thailandensis MFLICC 14-1121 T KY086493 KY086495 MT137787 – 120 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Taxa name Culture accession number GenBank accession numbers LSU SSU ITS tef1-α Palawania thailandensis MFLU 16-1873 KY086494 –MT137788 – Stigmatodiscus enigmaticus CBS 132036 T KU234108 KU234130 KU234108 MH756078 Stigmatodiscus labiatus CBS 144700/AP 6516 T MH756065 MH756065 MH756065 MH756083 Stigmatodiscus oculatus CBS 144701 MH756069 –MH756069 MH756086 Stigmatodiscus pruni CBS 142598 T KX611110 KX611110 KX611110 KX611111 Remarks: The newly-generated sequences are indicated in red bold, ex-types indicated in superscript T and “-” indicated unavailable data. Table 3. Taxa names, strain numbers and corresponding GenBank accession numbers of the taxa included in the phylogenetic analysis of Dictyosporium. Taxa name Culture accession number GenBank accession numbers ITS LSU tef1-α Dictyosporium alatum ATCC 34953 TNR_077171 DQ018101 – Dictyosporium aquaticum CBS 21460 T KM610236 – – Dictyosporium bulbosum yone 221 T LC014544 AB807511 AB808487 Dictyosporium digitatum KUMCC 17-0269 TMH388344 MH376716 MH388378 Dictyosporium duliujiangense GZCC 19-0426 T OQ842725 MW133815 OQ850746 Dictyosporium elegans NBRC 32502 T DQ018087 DQ018100 – Dictyosporium guangdongense ZHKUCC 24-0002 T PP326190 PP326213 – Dictyosporium guttulatum MFLUCC 16-0258 T MH388345 MH376717 MH388379 Dictyosporium hongkongensis KUMCC 17-0268 T MH388346 MH376718 MH388380 Dictyosporium hughesii KT 1847 T LC014548 AB807517 AB808493 Dictyosporium karsti MFLU 18-2282 OR225025 OP099521 OR140390 Dictyosporium krabiense MFLU 16-1890T – MH376719 MH388381 Dictyosporium meiosporum MFLUCC 10-0131 TKP710944 KP710945 – Dictyosporium muriformis GZCC 20-0006 T MT002304 MN897834 MT023011 Dictyosporium nigroapice BCC 3555 DQ018085 – – Dictyosporium olivaceosporum KH 375 TLC014542 AB807514 AB808490 Dictyosporium palmae CBS-H 22129 – KX555648 – Dictyosporium pandanicola MFLU 16-1886 T MH388347 MH376720 MH388382 Dictyosporium sp. MFLUCC 15-0629 MH381766 MH381775 MH388819 Dictyosporium sexualis MFLUCC 10-0127 TKU179105 KU179106 – Dictyosporium stellatum CCFC 241241 TNR_154608 JF951177 – Dictyosporium strelitziae CBS 123359 TNR_156216 FJ839653 – Dictyosporium tetrasporum KT 2865 LC014551 AB807519 AB808495 Dictyosporium thailandicum MFLUCC 13-0773 TKP716706 KP716707 – Dictyosporium thecatum MBSZU 25-047 TPX289103 PX271113 PX273904 Dictyosporium tratense MFLUCC 17-2052 TMH381767 MH381776 MH388820 Dictyosporium tubulatum MFLUCC 15-0631 TMH381769 MH381778 MH388822 Dictyosporium variabilisporum ZHKUCC 24-0003 PP326192 PP326215 PP333112 Dictyosporium wuyiense CGMCC 3.18703 TKY072977 – – Dictyosporium zhejiangense MW-2009a TFJ456893 – – Immotthia bambusae KUN-HKAS 112012AI TMW489455 MW489450 MW504646 Immotthia bambusae KUN-HKAS 112012AII MW489456 MW489451 MW504647 Pseudodictyosporium elegans CBS 688.93 TDQ018099 DQ018106 – Pseudodictyosporium thailandica MFLUCC 16-0029 TKX259520 KX259522 KX259526 Pseudodictyosporium wauense NBRC 30078 TDQ018098 DQ018105 – Pseudodictyosporium wauense DLUCC 0801 MF948622 MF948630 MF953165 Remarks: The newly-generated sequences are indicated in red bold, ex-types indicated in superscript T and “-” indicated unavailable data. 121 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae v.1.2) (Muhire et al. 2014) was used to generate pairwise nucleotide sequence identity matrix. Parameters of Pairwise identity calculation were set as ‘ClustalW’ for alignment programmes without specifying ‘cluster sequences using a neighbour-joining tree’ option. Sequence identity scores were saved as a matrix and delimited characters, such as commas or tabs, separated in each field. Finally, we visualised the pairwise similarity identity matrix as plots (Figs 2a, b, 4a, b) and included a colour key representing the correspondence between pairwise identity values and the colours displayed in the matrix. Results Phylogenetic analyses 1. Phylogenetic analyses: Dictyosporium Phylogenetic relationships of a new strain were assessed, based on concatenated ITS, LSU and tef1-α gene regions of 36 strains in Dictyosporiaceae. The final alignment consisted of combined ITS (1–610 bp), LSU (611–1895 bp), and tef1-α (1896–2820 bp) sequence data, including gaps. Two strains of Immotthia bambusae (HKAS 112012A and HKAS 112012B) served as outgroup taxa. The best scoring RAxML tree is shown in Fig. 1. The RAxML analysis of the combined dataset yielded a best-scoring tree (Fig. 1). The final ML optimisation likelihood value was -10451.848250. There were 32.80% undetermined characters or gaps and 729 distinct alignment patterns. The estimated base frequencies were A = 0.238697, C = 0.250582, G = 0.269387 and T = 0.241335; the substitution rates were AC = 1.242166, AG = 3.644387, AT = 2.048736, CG = 1.165862, CT = 9.067381 and GT = 1.000; the proportion of invariable sites I = 0.526947; and the gamma distribution shape parameter was a = 0.675504. The Bayesian analysis resulted in 10,000 trees after 1,000,000 generations. Maximum Likelihood and Bayesian analyses generated similar tree topology and concurred with previous studies (Tennakoon et al. 2023; Shu et al. 2024; Wang et al. 2025). Thirty strains of Dictyosporium species formed a monophyletic clade and nested within Dictyosporiaceae. In the current phylogram, a new strain, MBSZU 25-047, clusters within Dictyosporium species. Further, MBSZU 25-047 separates from other Dictyosporium species and forms a distinct basal clade with D. sexualis (MFLUCC 10-0127) with 77% ML and 0.75 BYPP statistical support (Fig. 1). The pairwise similarity values were calculated, based on concatenated ITS, LSU and tef1-α gene regions of 30 strains of Dictyosporium and two strains of Pseudodictyosporium species. According to the pairwise similarity plot, all taxa except for D. sexualis (MFLUCC 10-0127) and D. krabiense (MFLU 16-1890) show less than 95% pairwise identity with the new strain (MBSZU 25-047), which is represented by a pink-to-green gradient in the colour-coded matrix (Fig. 2a, b). 2. Phylogenetic analyses: Melomastia Phylogenetic relationships of four new strains were assessed, based on concatenated LSU, SSU, ITS and tef1-α gene regions of 51 strains in Pleurotremataceae, Acrospermaceae and Muyocopronaceae. The analysed alignment consisted of combined LSU (1–990 bp), SSU (991–2805 bp), ITS (2806–3740 bp) and tef1-α (3741–4995 bp) sequence data, including gaps. 122 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Figure 1. The phylogram, generated from Maximum Likelihood analysis, is based on combined ITS, LSU and tef1-α sequence data. The tree is rooted with Immotthia bambusae (HKAS 112012A and HKAS 112012B). The new strains are indicated in red and ex-type strains are in bold. Bootstrap support values ≥ 75% from the Maximum Likelihood (ML) and Bayesian Posterior Probabilities (BYPP) values ≥ 0.95 are given above the nodes, respectively. Anisomeridium phaeospermum (MPN539) and A. ubianum (MPN94) served as outgroup taxa. The best scoring RAxML tree is shown in Fig. 3. The RAxML analysis of the combined dataset yielded a best-scoring tree (Fig. 3). The final ML optimisation likelihood value was -27277.751366. There were 48% undetermined characters or gaps and 2089 distinct alignment patterns. The estimated base 123 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Figure 2. a. Colour-coded pairwise identity matrix, based on combined ITS, LSU, and tef1-α from 30 strains of Dictyosporium and two strains of Pseudodictyosporium species. Each coloured cell represents a percentage identity score between two sequences (one indicated horizontally to the left and the other vertically at the bottom). A coloured key indicates the correspondence between pairwise identities and the colours displayed in the matrix; b. Pairwise identity score distribution plot, based on combined ITS, LSU, and tef1-a from 30 strains of Dictyosporium and two strains of Pseudodictyosporium species. a b 130 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Pleurotremataceae, i.e. Dyfrolomyces, Melomastia and Pleurotrema (Hongsanan et al. 2020; Wijayawardene et al. 2022). The sexual morph is characterised by immersed ascomata, with a clypeus on the substrate, cylindrical asci and multi-septate ascospores with or without a sheath (Watson 1929; Barr 1994). Melomastia Nitschke & Sacc. Melomastia was introduced by Saccardo (1875) to accommodate M. mastoidea (= Melomastia friesii). Species Fungorum lists 66 epithets for Melomastia (accessed on 1 August 2025), yet most remain without molecular data. The sexual morph is characterised by semi-immersed, globose to subglobose, black, ostiolate ascomata with erumpent apex, cylindrical asci and hyaline, ovoid or cylindrical, 1–10-septate, ascospores with or without a gelatinous sheath (Kang et al. 1999; Hongsanan et al. 2020; de Silva et al. 2022; Li et al. 2022; Kularathnage et al. 2023; Hongsanan et al. 2025). Since the high degree of morphological overlap of ascospore characters between Melomastia and Dyfrolomyces, delimitation of two genera became challenging. Thus, based on the morphology and multigene phylogeny, 11 Dyfrolomyces species transferred to Melomastia (Li et al. 2022). However, M. tiomanensis and M. chromolaenae transferred to Dyfrolomyces, based on the most recent phylogenetic evidence by Kularathnage et al. (2023) as they form a well-supported basal clade separated from the remainder of Melomastia species. Further, this was supported by the presence of spindle-shaped ascospores with 6–11-septa and acute, tapering ends, that has not been observed in other Melomastia species (Kularathnage et al. 2023). The current phylogenetic analyses represented a topology consistent with recent studies (Kularathnage et al. 2023; Senanayake et al. 2023; Du et al. 2024; Hongsanan et al. 2025) confirming that Dyfrolomyces and Melomastia are distinct genera. Melomastia beihaiensis T.Y. Du, K.D. Hyde & Tibpromma, Fungal Diversity 122: 167 (2023) Facesoffungi Number: FoF10262 Index Fungorum: IF558764 Fig. 7 Description. Saprobic on dead branch of Volkameria inermis L. Sexual morph: Ascomata (including neck) 300–450 μm high × 250–400 µm diam. (x – = 360 × 370 μm, n = 10), visible on the host surface as raised spots, dark brown to black, semi-immersed to immersed, solitary or aggregated, globose to subglobose, ostiolate, carbonaceous. Ostiolar canal 200–250 high μm × 100–150 µm diam. (x – = 220 × 120 μm, n = 10), cylindrical, straight, dark brown to black, periphyses absent. Peridium 45–60 µm diam. (x – = 52 μm, n = 15), comprising 3–5 inner layers of light brown cells of textura prismatica, several outer layers of dense, dark brown cells of textura angularis fused with host tissues. Hamathecium 2–3 µm wide, comprising hyaline, filiform, unbranched, aseptate pseudoparaphyses, longer than asci, attached at the base, embedded in a gelatinous matrix. Asci 140–200 × 6–8 µm (x – = 160 × 7 μm, n = 20), 8-spored, bitunicate, cylindrical, elongate, minute pedicellate, rounded at the apex. As- 131 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Figure 7. Melomastia beihaiensis (SZU 25-036, new host record). a. The plant substrate; b, c. Appearance of ascomata on substrate; d, e. Vertical sections through ascomata; f. Peridium; g. Pseudoparaphyses with asci; h–j. Asci; k–n. Ascospores. Scale bars: 50 μm (d, e); 20 μm (f–j); 10 μm (k–n). cospores 18–32 × 6–8 µm (x – = 26 × 7 μm, n = 30), hyaline, overlapping, uni-seriate, fusiform to broadly fusiform, conical at upper part and the lower end is truncate, distinct 3-septate at maturity, one large guttule in each cell, thin walled. Asexual morph: Undetermined. Culture characteristics. Colonies on PDA reaching 35 mm diameter after 1 week at 25 °C, colonies from above: circular, margin undulate, dense, flat, olive 132 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae green at the margin, white in the centre; reverse: dark olive green at the margin, grey in the centre. Material examined. China • Guangdong Province, Shenzhen, on dead branch of Volkameria inermis L. (Lamiaceae), 11 June 2025, N. I de Silva NSZU6 (SZU 25-036), living culture, MBSZU 25-048. Notes. Melomastia beihaiensis was identified from dead stems of Chromolaena odorata (Asteraceae) in Beihai, Guangxi Province, China (Senanayake et al. 2023). The morphological characteristics of our collection (SZU 25-036) resembles M. beihaiensis (HKAS 121125) in having semi-immersed to immersed, globose to subglobose, ostiolate, carbonaceous ascomata, cylindrical, elongate, asci with minute pedicel and hyaline, fusiform to broadly fusiform, 3-septate, guttulate ascospores (Senanayake et al. 2023). We noted overlapping size ranges for asci and ascospores between the new strain (SZU 25-036) and the holotype of M. beihaiensis (HKAS 121125). The holotype possesses (125–)135–190 × 5–7 µm asci and 16–28 × 5–7 µm ascospores (Senanayake et al. 2023), whereas the new collection (SZU25-036) exhibits 140–200 × 6–8 µm asci and 18–32 × 6–8 µm ascospores. Multi-gene phylogeny also indicates that our collection (SZU25-036) nested with M. beihaiensis (KUMCC 21-0084) with 83% ML, 0.95 BYPP support (Fig. 4). Melomastia beihaiensis (MBSZU 25048), displays a red colour in the pairwise identity matrix, indicating 97–98% identity with the ex-type strain of M. beihaiensis (KUMCC 21-0084) (Fig. 4a, b). Therefore, based on morphological and phylogenetic evidence, we report our collection as the first host record of M. beihaiensis on a dead branch of Volkameria inermis (Lamiaceae). Melomastia hydei Hongsanan, Khuna & Xie N., Mycosphere 16(2): 48 (2025) Index Fungorum: IF903733 Facesoffungi Number: FoF17754 Fig. 8 Description. Saprobic on dead branch of Acanthus ilicifolius L. Sexual morph: Ascomata (including neck) 450–655 μm high × 400–560 µm diam. (x – = 550 × 490 μm, n = 10), black, visible as cone-shaped structures on host surface, solitary, scattered to gregarious, immersed to semi-immersed, globose to subglobose, coriaceous to carbonaceous, ostiolate. Ostiolar canal 170–210 μm high × 130–150 µm diam. (x – = 190 × 145 μm, n = 10), central, dark brown to black, ostiolar canal internally covered by filiform periphyses. Peridium 45–60 µm diam. (x – = 52 μm, n = 15), thick-walled, comprising 5–7 inner layers of light brown cells of textura angularis, several outer layers of dense, dark brown cells of textura angularis fused with host tissues. Hamathecium 1–2 μm wide, comprising hyaline, filiform, aseptate, unbranched pseudoparaphyses, longer than asci, embedded in a gelatinous matrix. Asci 135–160 × 5–7 µm (x – = 154 × 6 μm, n = 20), 8-spored, bitunicate, cylindrical, straight or slightly curved, rounded apex, with short pedicel. Ascospores 19– 22 × 5–7 µm (x – = 20 × 6 μm, n = 30), hyaline, overlapping, uni-seriate, fusiform, straight or slightly curved, tapering towards both ends, smooth-walled, 3-septate, guttules in each cell, without a sheath or appendages. Asexual morph: Undetermined. 133 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Figure 8. Melomastia hydei (SZU 25-037, new host record). a. The plant substrate; b, c. Appearance of ascomata on substrate; d, e. Vertical sections through ascomata; f. Peridium; g. Pseudoparaphyses with asci; h–j. Asci; k–n. Ascospores. Scale bars: 100 μm (d, e); 20 μm (f–j); 10 μm (k–n). Culture characteristics. Colonies on PDA reaching 32 mm diameter after 1 week at 25 °C, colonies from above: circular, margin entire, dense, flat, white at the margin, pale brown in the centre; reverse: white at the margin, pale brown in the centre. Material examined. China • Guangdong Province, Shenzhen, on dead branches of Acanthus ilicifolius L. (Acanthaceae), 11 June 2025, N. I de Silva NSZU13 (SZU 25-037), living culture, MBSZU 25-049. Notes. Our collection (SZU 25-037) morphologically fits well with the holotype of Melomastia hydei (SZU 25–003) indicating similar characteristics 134 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae including globose to subglobose, ostiolate ascomata, 8-spored, bitunicate, cylindrical asci and hyaline, fusiform to broadly fusiform, 3-septate, guttulate ascospores (Hongsanan et al. 2025). The phylogenetic analysis revealed that the new strain (MBSZU 25-049) clustered with the ex-type of M. hydei (MBSZU 25–003) with 77% ML and 1.00 BYPP) (Fig. 4). The new strain, M. hydei (MBSZU 25-049), denoted ‘red’ in the colour-coded matrix with M. hydei strains (MBSZU 25-003, MBSZU 25-004), indicating the highest identity scores (96–97%) and confirming their close relatedness (Fig. 4a, b). The type of M. hydei was found on decaying twigs of Beach Naupaka (Scaevola taccada, Goodeniaceae) in Guangdong Province, China (Hongsanan et al. 2025). We herein provide a new host record for this species, based on the collection from dead branches of Acanthus ilicifolius (Acanthaceae) in Guangdong Province, China. Melomastia fusispora W.L. Li, Maharachch. & Jian K. Liu, J. Fungi 8 (1, no. 76): 7 (2022) Index Fungorum: IF841499 Facesoffungi Number: FoF10533 Fig. 9 Description. Saprobic on dead twigs of Ficus species. Sexual morph: Ascomata (including neck) 620–700 μm high × 610–650 µm diam. (x – = 670 × 640 μm, n = 10), black, solitary, gregarious, visible as cone-shaped structures on the host surface, immersed to semi-immersed, erumpent through host tissue, globose to subglobose, coriaceous to carbonaceous, ostiolate. Ostiolar canal 240–280 μm high × 170–240 µm diam. (x – = 260 × 210 μm, n = 10), central, dark brown to black, carbonaceous, ostiolar canal internally covered by filiform periphyses. Peridium 60–75 µm diam. (x – = 68 μm, n = 15), two-layered, comprising 4–6 inner layers of light brown cells of textura angularis, several outer layers of dense, dark brown cells of textura angularis fused with host tissues. Hamathecium 1–2 μm wide, comprising dense, hyaline, filiform, aseptate, unbranched pseudoparaphyses. Asci 150–210 × 6–8 µm (x – = 178 × 7 μm, n = 20), 8-spored, bitunicate, cylindrical, elongate, slightly flexuous, apically round with ocular chamber, short pedicel. Ascospores 18–30 × 6–7.5 µm (x – = 26 × 7.1 μm, n = 30), hyaline, overlapping, uni-seriate, fusiform, with rounded to acute ends, narrow towards apex, 3-septate, constricted at the central septum, with guttules in each cell. Asexual morph: Undetermined. Culture characteristics. Colonies on PDA reaching 35 mm diameter after 1 week at 25 °C, colonies from above: circular, margin entire, dense, flat, cream at the margin, pale brown in the centre with white mycelia; reverse: white at the margin, brown in the centre. Material examined. China • Guangdong Province, Shenzhen, on dead twigs of Ficus sp. (Moraceae), 11 June 2025, N. I de Silva SZ15 (SZU 25-038), living culture, MBSZU 25-050. Notes. Melomastia fusispora was first reported from a dead branch of Olea europaea (Oleaceae) in Sichuan Province, China (Li et al. 2022). We recovered this species from dead twigs of Ficus sp. (Moraceae), in Guangdong Province, China. Our collection (SZU 25-038) morphologically fits well with M. fusispora (HKAS 121316) and the dimensions of asci (150–210 × 6–8 μm vs. 200–231 135 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Figure 9. Melomastia fusispora (SZU 25-038, new host record). a. The plant substrate; b, c. Appearance of ascomata on substrate; d, e. Vertical sections through ascomata; f. Peridium; g. Pseudoparaphyses with asci; h–j. Asci; k–n. Ascospores. Scale bars: 100 μm (d, e); 20 μm (f); 30 μm (g–j); 10 μm (k–n). × 7.6–9.2 μm) and ascosproes (18–30 × 6–7.5 μm vs. 27.5–32 × 6.5–7.5 μm) are also comparable with the holotype (Li et al. 2022). The new isolate MBSZU 25-050 clustered with ex-type M. fusispora (CGMCC3.20618) in multi-gene phylogeny (LSU, SSU, ITS and tef1-a). The comparison of nucleotide substitutions between our strain (MBSZU 25-050) and the ex-type strain of M. fusispora (CGMCC3.20618) showed 0.78% (5/640) and 1.02% (8/779) differences (without 136 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae gaps) in the ITS and tef1-α genes, respectively. Pairwise identity scores of 98% were calculated for the new strain M. fusispora (MBSZU 25-050) in comparisons with M. fusispora (CGMCC 3.20618, UESTCC 21.0001) (Fig. 4b). Therefore, based on morphology and phylogeny, a new host record for M. fusispora is provided. Melomastia shenzhenensis N.I. de Silva, Tennakoon, S. Hongsanan, sp. nov. Index Fungorum: IF904327 Facesoffungi Number: FoF18099 Fig. 10 Etymology. The epithet “shenzhenensis” refers to the habitat ‘Shenzhen’, where the holotype was collected. Holotype. SZU25-039. Description. Saprobic on dead twigs of Ficus species. Sexual morph: Ascomata (including neck) 650–780 μm high × 560–670 µm diam. (x – = 720 × 590 μm, n = 10), dark brown, black, solitary or gregarious, erumpent to superficial when mature, globose to subglobose, coriaceous, papillate, ostiolate. Ostiolar canal 270–320 μm high × 190–260 µm diam. (x – = 310 × 230 μm, n = 10), central, dark brown to black, conical, carbonaceous, internally covered by filiform periphyses. Peridium 70–85 µm diam. (x – = 78 μm, n = 15), two-layered, comprising 5–6 inner layers of light brown cells of textura angularis, several outer layers of thick, dark brown cells of textura angularis fused with host tissues. Hamathecium 1–2 μm wide, comprising dense, hyaline, filiform, aseptate, unbranched pseudoparaphyses. Asci 145–180 × 6–8 µm (x – = 168 × 7 μm, n = 20), 8-spored, bitunicate, fissitunicate, cylindrical, straight or slightly curved, apically round, with ocular chamber, short pedicellate. Ascospores 19–23 × 4–5.8 µm (x – = 21 × 5.3 μm, n = 30), hyaline, overlapping, uni-seriate, fusiform with acute ends, 3-septate, not constricted at the septa, smooth-walled, guttules in each cell. Asexual morph: Undetermined. Culture characteristics. Colonies on PDA reaching 28 mm diameter after 1 week at 25 °C, colonies from above: circular, margin entire, dense, flat, cream at the margin, pale olive-green in the centre; reverse: white at the margin, olive-green in the centre. Material examined. China • Guangdong Province, Shenzhen, on dead branches of Ficus sp. (Moraceae), 11 June 2025, N. I de Silva NSZU3 (SZU 25-039, holotype), ex-type living culture, MBSZU 25-051. Notes. A new strain (MBSZU 25-051) isolated from dead branches of Ficus sp. (Moraceae), shows high statistical support value (ML/BYPP = 100%/1.00) and closely clustered with Melomastia oleae (CGMCC 3.20619 and UESTCC 21.0003). The new strain (MBSZU 25-051) indicates the highest pairwise identity value (94.3%, represented by pink) with two strains of M. oleae strains i.e. CGMCC 3.20619 (ex-type) and UESTCC 21.0003 (Fig. 4a, b). Aside from the two M. oleae strains, the remaining taxa display 78–94% pairwise identity scores with M. shenzhenensis (MBSZU 25-051), corresponding to the green to olive-green colour range in the matrix. Morphologically, the new collection (SZU 25-039) differs from its closest M. oleae by larger ascomata (650–780 μm high × 560–670 µm diam. vs. 410–440 μm × 493–520 µm) and ostiolar canal (270– 320 μm high × 190–260 µm diam. vs. 20.5–50 × 60–83 µm) (Li et al. 2022). The 137 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Figure 10. Melomastia shenzhenensis (SZU 25-039, holotype). a. The plant substrate; b, c. Appearance of ascomata on substrate; d, e. Vertical sections through ascomata; f. Peridium; g. Pseudoparaphyses with asci; h–j. Asci; k–n. Ascospores. Scale bars: 200 μm (d, e); 20 μm (f); 30 μm (g–j); 10μm (k–n). peridium of the new collection (SZU25-039) (70–85 µm) is larger than M. oleae (54–65 µm) (Li et al. 2022). Further, the new collection (SZU25-039) was also distinguished from M. oleae in having smaller asci (145–180 × 6–8 µm 138 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae vs. 209–237 × 7.5–9 µm) and ascospores (19–23 × 4–5.8 µm vs. 28–34 × 6–7 μm) (Li et al. 2022). Thus, we introduce M. shenzhenensis here as a new species in genus Melomastia. Discussion In this study, we introduce a new species, Dictyosporium thecatum on a dead branch of Volkameria inermis L. (Lamiaceae) in the coastal region of China. Most accepted Dictyosporium species are represented by asexual morphs (Yang et al. 2018; Hyde et al. 2020; Liu et al. 2023; Tennakoon et al. 2023; Shu et al. 2024; Wang et al. 2025), except for D. sexualis (Boonmee et al. 2016), D. meiosporum (Liu et al. 2015) from Thailand, D. karsti (Zhang et al. 2023) and D. thecatum described in the present study from China. Phylogenetically, D. thecatum is sister to D. sexualis. Furthermore, Dictyosporium karsti forms a separate sub-clade with D. olivaceosporum (KH 375) that is closely related to the group consisting D. thecatum and D. sexualis. However, D. meiosporum (MFLUCC 10-0131) is distantly related to D. thecatum and clustered with D. tetrasporum (KT 265) (Fig. 1). Amongst the three sexual morph taxa considered (D. karsti, D. meiosporum and D. sexualis), the new species D. thecatum (MBSZU 25-047) is most closely related to D. sexualis (MFLUCC 10-0127), with which it shares the highest pairwise identity (95%). It shows lower identity values (92–93%) with D. karsti and D. meiosporum (Fig. 2b). These four sexual morph taxa share similar morphology in having black, superficial, solitary or scattered, globose to sub-globose, ostiolate ascomata, brown to black peridium composed of cells of textura angularis, 8-spored, bitunicate, fissitunicate, clavate to cylindrical asci, hyaline, elongated-ellipsoid, clavate, 1-septate, ascospores surrounded by a mucilaginous sheath (Liu et al. 2015; Boonmee et al. 2016; Zhang et al. 2023). Dictyosporium thecatum is distinguished from D. karsti, D. meiosporum and D. sexualis by its smaller asci and ascospores. Larger asci and ascospore sizes are reported for three species: in D. sexualis (100–145 × 10–14 μm/36–48 × 6–8 μm (asci/ascospores); Boonmee et al. (2016)), D. karsti (97 × 13.8 μm/30.8 × 5 μm; Zhang et al. (2023)) and D. meiosporum (83–135.5 × 13–17 μm/31–39 × 6–8.5 μm; Liu et al. (2015)). Furthermore, Dictyosporium thecatum is differentiated from D. karsti, D. meiosporum and D. sexualis by a distinct, 5–7 μm thick mucilaginous sheath surrounding its ascospores (Liu et al. 2015; Boonmee et al. 2016; Zhang et al. 2023). In this study, we observed brown to black, compact, sporodochia (asexual morph) of Dictyosporium thecatum in the culture (PDA media). Similarly, D. meiosporum produced conidia in the culture (Liu et al. 2015). In contrast, the asexual morph was not reported from D. karsti and D. sexualis (Boonmee et al. 2016; Zhang et al. 2023). The morphological variations possessed by the new species, Dictyosporium thecatum, may enhance its survival in coastal environments. Therefore, future investigations in different habitats should reveal novel species with unique adaptive morphologies. The current study introduced a novel Melomastia species, M. shenzhenensis and identified three new host associations of M. fusispora, M. hydei and M. beihaiensis. Melomastia species show a cosmopolitan distribution in both temperate and tropical countries, i.e. Africa (Central African Republic, Ivory Coast, South Africa), Asia (Brunei, China, India: Andaman and Nicobar Islands, Iran, Japan, Kazakhstan, Kirgizstan, Malaysia, Philippines, Thailand, Turkmenistan), 139 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Australia, Europe (Czechia, France, Germany, Italy) and South America (Argentina, Brazil, Chile) (Li et al. 2022; Kularathnage et al. 2023; Farr and Rossman 2025). Amongst these countries, several Melomastia species have recently been reported from China. Melomastia maolanensis was identified from dead plant substrates in Guizhou Province (initially described as ‘Dyfrolomyces maolanensis’) (Norphanphoun et al. 2017; Zhang et al. 2017). Subsequently, 16 novel Melomastia species and several new host/geographical records have been identified in China at an accelerated rate over the past three years (since 2022), reported from Guangxi, Guizhou, Guangdong, Sichuan and Yunnan Provinces on various host plants. Four species, namely, M. fusispora, M. oleae, M. sichuanensis and M. winteri were introduced by Li et al. (2022) from the dead branches of Olea europaea (Oleaceae) in Sichuan Province in China. In addition, several novel taxa have been established: in Guangxi Province, M. beihaiensis on dead stems of Chromolaena odorata (Senanayake et al. 2023); in Guizhou Province, M. chinensis on dead wood (Habib et al. 2025); and in Yunnan Province, M. diqingensis on dead twigs of Rhododendron rubiginosum (Ren et al. 2024) and M. puerensis on dead branches of Hevea brasiliensis (Xu et al. 2024). Another research team investigated saprobic fungi associated with Aquilaria spp., an important agarwood resin-producing tree. Their work discovered four novel species, M. aquilariae, M. guangdongensis, M. maomingensis and M. yunnanensis and also reported a new host and geographical record for M. sinensis in Guangdong and Yunnan Provinces, China (Du et al. 2024; Manawasinghe et al. 2024). Moreover, three species have been isolated in Guangdong Province, China: M. hydei on decaying twigs of Scaevola taccada (Hongsanan et al. 2025), M. loropetalicola on dead stems of Loropetalum chinense (Dong et al. 2023) and M. pyriformis on decaying wood (Kularathnage et al. 2023). In this study, we add one new species, M. shenzhenensis and report three new host associations for M. fusispora, M. hydei and M. beihaiensis in the same province. The Sequence Demarcation Tool version 1.2 (SDT v.1.2), a free user-friendly computer programme provides a robust and highly reproducible means of pairwise genetic identity calculations to classify any set of nucleotide or amino acid sequences (Muhire et al. 2014). This computational tool aligns every possible pair of sequences using one of three optional alignment algorithms, namely, MUSCLE, ClustalW2 or MAFFT and, subsequently, calculates a Needleman-Wunsch (NW) pairwise alignment-based genetic identity score for each pair (Muhire et al. 2014). The resulting score can be retrieved as a numerical matrix. In addition, it depicts colour-coded pairwise-identity matrix with according pairwise identity values. To cluster pairwise identities in an evolutionarily meaningful way, the sequences are ordered along the matrix axes according to their placement in the Maximum Likelihood (ML) phylogram. Thus, it allows us to detect newly-obtained sequences and their phylogenetically closely-related taxa easily and corresponding pairwise identity scores according to the colours of the cells in the matrix. The colour-coded pairwise identity matrix and its corresponding numerical data matrix further validate the phylogenetic analyses and species delimitation. The colour-coded plot facilitates the easy identification of taxa with high similarity values and distinguishes those with lower similarity to the strains of interest. Therefore, pairwise identity calculations generated using the SDT application offer additional evidence for species identification. 146 MycoKeys 125: 115–146 (2025), DOI: 10.3897/mycokeys.125.171612 Nimali I. de Silva et al.: Taxonomic novelties in Dictyosporiaceae and Pleurotremataceae Kukwa M, Kumla J, Leontyev DV, Lumbsch HT, Maharachchikumbura SSN, Marguno F, Martínez-Rodríguez P, Mešić A, Monteiro JS, Oehl F, Pawłowska J, Pem D, Pfiegler WP, Phillips AJL, Pošta A, He MQ, Li JX, Raza M, Sruthi OP, Suetrong S, Suwannarach N, Tedersoo L, Thiyagaraja V, Tibpromma S, Tkalčec Z, Tokarev YS, Wanasinghe DN, Wijesundara DSA, Wimalaseana SDMK, Madrid H, Zhang GQ, Gao Y, Sánchez-Castro I, Tang LZ, Stadler M, Yurkov A, Thines M (2022) Outline of Fungi and fungus-like taxa–2021. Mycosphere: Journal of Fungal Biology 13(1): 53–453. https://doi. org/10.5943/mycosphere/13/1/2 Williams BA, Watson JE, Beyer HL, Klein CJ, Montgomery J, Runting RK, Roberson LA, Halpern BS, Grantham HS, Kuempel CD, Frazier M (2022) Global rarity of intact coastal regions. Conservation Biology: The Journal of the Society for Conservation Biology 36(4): e13874. https://doi.org/10.1111/cobi.13874 Wu J, de Silva NI, Tennakoon DS, Kumla J, Suwannarach N, Xie N, Hongsanan S, Lumyong S (2024) Morphology and phylogeny reveal the asexual morph of Muriformispora (Neohendersoniaceae), M. thailandica sp. nov., and a new host and geographical record for M. magnoliae. Phytotaxa 678(2): 135–145. https://doi.org/10.11646/ phytotaxa.678.2.4 Xu H, Liu K, Ning T, Huang G, Zhang Q, Li Y, Wang M, Fan Y, Weili AN, Ji L, Guo Q (2022) Environmental remediation promotes the restoration of biodiversity in the Shenzhen Bay Estuary, South China. Ecosystem Health and Sustainability 8(1): e2026250. https://doi.org/10.1080/20964129.2022.2026250 Xu RF, Karunarathna SC, Phukhamsakda C, Dai DQ, Elgorban AM, Suwannarach N, Kumla J, Wang XY, Tibpromma S (2024) Four new species of Dothideomycetes (Ascomycota) from Pará Rubber (Hevea brasiliensis) in Yunnan Province, China. MycoKeys 103: 71–95. https://doi.org/10.3897/mycokeys.103.117580 Yang J, Liu JK, Hyde KD, Jones EG, Liu ZY (2018) New species in Dictyosporium, new combinations in Dictyocheirospora and an updated backbone tree for Dictyosporiaceae. MycoKeys 36: 83–105. https://doi.org/10.3897/mycokeys.36.27051 Yao Y, Wang C (2021) Variations in summer marine heatwaves in the South China Sea. Journal of Geophysical Research: Oceans 126(10): e2021JC017792. https://doi. org/10.1029/2021JC017792 Zhang JF, Liu JK, Hyde KD, Chen YY, Liu YX, Liu ZY (2017) Two new species of Dyfrolomyces (Dyfrolomycetaceae, Dothideomycetes) from karst landforms. Phytotaxa 313(3): 267–277. https://doi.org/10.11646/phytotaxa.313.3.4 Zhang JF, Liu JK, Hyde KD, Chen YY, Ran HY, Liu ZY (2023) Ascomycetes from karst landscapes of Guizhou Province, China. Fungal Diversity 122: 1–160. https://doi. org/10.1007/s13225-023-00524-5 Zhang X, Huang H, Lin J, Xie S (2025) Study on coastline protection strategies in Guangdong Province, China. Water 17(5): e727. https://doi.org/10.3390/w17050727 Zhuqiu S, Wen Y, Shiyong D, Zichao J, Xingjie Z, Zhen W, Buyun Z, Yechun X, Wenli C, Shijin L, Gang Y (2023) A dataset on inventory and geographical distributions of higher plants in Guangdong, China. Shengwu Duoyangxing 31(9): e23177. https://doi. org/10.17520/biods.2023177