scieee AI-readable full text Open interactive document viewer

Hybrid Hydroxyapatite–Metal Complex Materials Derived from Amino Acids and Nucleobases

Jiménez Pérez, Alondra; MARTÍNEZ ALONSO, MARTA; Garcia Tojal, Javier

Abstract

Alondra Jiménez-Pérez , Marta Martínez-Alonso and Javier García-Tojal Calcium phosphates (CaPs) and their substituted derivatives encompass a large number of compounds with a vast presence in nature that have aroused a great interest for decades. In particular, hydroxyapatite (HAp, Ca10(OH)2(PO4)6) is the most abundant CaP mineral and is significant in the biological world, at least in part due to being a major compound in bones and teeth. HAp exhibits excellent properties, such as safety, stability, hardness, biocompatibility, and osteoconductivity, among others. Even some of its drawbacks, such as its fragility, can be redirected thanks to another essential feature: its great versatility. This is based on the compound’s tendency to undergo substitutions of its constituent ions and to incorporate or anchor new molecules on its surface and pores. Thus, its affinity for biomolecules makes it an optimal compound for multiple applications, mainly, but not only, in biological and biomedical fields. The present review provides a chemical and structural context to explain the affinity of HAp for biomolecules such as proteins and nucleic acids to generate hybrid materials. A size-dependent criterium of increasing complexity is applied, ranging fromamino acids/nucleobases to the corresponding macromolecules. The incorporation of metal ions or metal complexes into these functionalized compounds is also discussed.

Full text

7.44.2 Hybrid Hydroxyapatite–Metal Complex Materials Derived from Amino Acids and Nucleobases Alondra Jiménez-Pérez, Marta Martínez-Alonso and Javier García-Tojal Special Issue Advances in Coordination Chemistry 2.0 Edited by Prof. Dr. Juan Niclós-Gutiérrez and Dr. Miquel Barceló-Oliver Review https://doi.org/10.3390/molecules29184479 Citation: Jiménez-Pérez, A.; Martínez-Alonso, M.; García-Tojal, J. Hybrid Hydroxyapatite–Metal Complex Materials Derived from Amino Acids and Nucleobases. Molecules 2024,29, 4479. https:// doi.org/10.3390/molecules29184479 Academic Editors: Juan Niclós-Gutiérrez and Miquel Barceló-Oliver Received: 30 July 2024 Revised: 12 September 2024 Accepted: 15 September 2024 Published: 20 September 2024 Copyright: © 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). molecules Review Hybrid Hydroxyapatite–Metal Complex Materials Derived from Amino Acids and Nucleobases Alondra Jiménez-Pérez , Marta Martínez-Alonso and Javier García-Tojal * Departamento de Química, Facultad de Ciencias, Universidad de Burgos, Plaza Misael Bañuelos s/n, 09001 Burgos, Spain; [email protected] (A.J.-P.); [email protected] (M.M.-A.) *Correspondence: [email protected] Abstract: Calcium phosphates (CaPs) and their substituted derivatives encompass a large number of compounds with a vast presence in nature that have aroused a great interest for decades. In particular, hydroxyapatite (HAp, Ca 10 (OH) 2 (PO 4 ) 6 ) is the most abundant CaP mineral and is significant in the biological world, at least in part due to being a major compound in bones and teeth. HAp exhibits excellent properties, such as safety, stability, hardness, biocompatibility, and osteoconductivity, among others. Even some of its drawbacks, such as its fragility, can be redirected thanks to another essential feature: its great versatility. This is based on the compound’s tendency to undergo substitutions of its constituent ions and to incorporate or anchor new molecules on its surface and pores. Thus, its affinity for biomolecules makes it an optimal compound for multiple applications, mainly, but not only, in biological and biomedical fields. The present review provides a chemical and structural context to explain the affinity of HAp for biomolecules such as proteins and nucleic acids to generate hybrid materials. A size-dependent criterium of increasing complexity is applied, ranging from amino acids/nucleobases to the corresponding macromolecules. The incorporation of metal ions or metal complexes into these functionalized compounds is also discussed. Keywords: amino acid; calcium phosphate; hybrid material; hydroxyapatite; nucleobase; nucleic acid; peptide; protein 1. Introduction The geological relevance of phosphates is considerable. They are found in several formations, such as fossils and about 200 groups of minerals present in igneous and sedimentary phosphate rocks (PRs) [ 1 – 4 ]. In particular, calcium phosphates (CaPs) have gained attention due to both their geological relevance as primary phosphorus ores and their biological roles. The abundance of apatite-type minerals (chloro-, fluor-, and hydroxy-apatite), with the formulae Ca 10 (Cl,F,OH) 2 (PO 4 ) 6 , make them stand out as ores from a mining point of view. Other prominent examples of CaP minerals are brushite CaHPO 4· 2H 2 O, dahlite 3Ca3(PO4)2·CaCO3, monetite CaHPO4, and whitlockite Ca9Mg(HPO4)(PO4)6. Nevertheless, many other CaPs, apart from the above-mentioned mineral phases, have been studied in depth [ 5 ]. Their formulae usually exhibit atomic Ca/P ratios between 0.5 and 2 (in general, the lower the Ca/P ratio, the more acidic and soluble the calcium phosphate phase). Table 1shows some of the CaPs we will discuss in this work due to their involvement in the processes described here [ 6 ]. Nonetheless, the most common members of this family, according to their solubility products [ 7 ], are hydroxyapatite and the polymorphic forms of tricalcium phosphate (TCP). From now on, it must be emphasized that the formulae given in the present review follow the International Union of Pure and Applied Chemistry (IUPAC) recommendations for chemical nomenclature, but we have retained the traditional names given in the literature for a better understanding and connection with the sources [8]. Molecules 2024,29, 4479. https://doi.org/10.3390/molecules29184479 https://www.mdpi.com/journal/molecules Molecules 2024,29, 4479 2 of 39 Table 1. Selected calcium phosphate phases and structural details. Name (Abbreviation) Formula Ca/P Ratio System (Space Group) Cell Parameters (Å, 0)Refs. Monocalcium phosphate anhydrous (MCPA) Ca(H2PO4)20.50 Triclinic (P1) a = 7.5577(5), b = 8.2531(6), c = 5.5504(3) α= 109.87(1), β= 93.68(1), γ= 109.15(1) [9] Monocalcium phosphate monohydrate (MCPM) Ca(H2PO4)2·H2O0.50 Triclinic (P1) a = 5.6261(5), b = 11.889(2), c = 6.4731(8) α= 98.633(6), β= 118.262(6), γ= 83.344(6) [10] Dicalcium phosphate anhydrous (DCPA, monetite) CaHPO41.00 Triclinic P1) a = 6.90(1), b = 6.65(1), c = 7.00(1) α= 96.35(2), β= 103.90(2), γ= 88.73(2) [11] Dicalcium phosphate dihydrate (DCPD, brushite) CaHPO4·2H2O1.00 Monoclinic (Ia) a = 5.812(2), b = 15.180(3), c = 6.239(2) β= 116.42(2) [12] Amorphous calcium phosphates (ACPs) 1 CaxHy(PO4)z·nH2O (n = 3.0–4.5) 21.20–2.20 3 Octacalcium phosphate (OCP) Ca8H2(PO4)6·5H2O1.33 Triclinic P1) a = 19.692(4), b = 9.523(2), c = 6.835(2) α= 90.15(2), β= 92.54(2), γ= 108.65(2) [13,14] α-tricalcium phosphate (α-TCP) α-Ca3(PO4)21.50 Monoclinic (P21/a) a = 12.887(2), b = 27.280(4), c = 15.219(2) β= 126.20(1) [15] β-tricalcium phosphate (β-TCP, synthetic whitlockite) β-Ca3(PO4)21.50 Rhombohedral (R3c) (hexagonal setting) a = b = 10.439(1), c = 37.375(6) [16] Hydroxyapatite (HAp) Ca10(OH)2(PO4)61.67 Hexagonal (P63/m) a = b = 9.424(4), c = 6.879(4) [17] Hydroxyapatite (HApM) M-Ca10(OH)2(PO4)61.67 Monoclinic (P21/b) a = 9.419(3), b = 18.848(6), c = 6.884(2) β= 119.98(2) [18] Oxyapatite (OAp, voelckerite) 4 Ca10O(PO4)61.67 Hexagonal P6) a = b = 9.432, c = 6.881 [19] Tetracalcium phosphate (TTCP, hilgenstockite) Ca4O(PO4)22.00 Monoclinic (P21) a = 7.023(1), b = 11.986(4), c = 9.473(2) β= 90.90(1) [20] Dicalcium diphosphate dihydrate (DCDD) Ca2(P2O7)·2H2O1.00 Triclinic P1) a = 7.365(4), b = 8.287(4), c = 6.691(4) α= 102.96(1), β= 72.73(1), γ= 95.01(1) [21] 1 ACPs are probably metastable amorphous states of different crystalline calcium phosphates. Roughly speaking, a dozen phosphate phases could exist in an amorphous state (e.g., amorphous HAp, amorphous TCP, etc.). An excellent review about them was published by Dorozhkin [ 22 ]. 2 The amount of water varies between 15 and 20%. 3 The range is wider, but the majority exhibit a Ca/P value close to 1.5. This would be consistent with the presence of Posner’s clusters, common units in ACPs, with formula Ca 9 (PO 4 ) 6 [ 23 ], which would evolve into different crystalline phases through distinct experimental conditions. 4 The nature and crystal structure of this compound remains controversial. The crystallographic information given in the table comes from the work by Henning et al. An interesting historical background about the different proposals published up to date is covered by Bulina et al. [24]. Regarding the CaP-containing apatite Ca 10 X 2 (PO 4 ) 6 family, different minerals with a Ca/P=1.67molarratiocanbefounddependingontheXanion,suchasfluorapatite(Ca 10 F 2 (PO 4 ) 6 ), carbonate–fluorapatite (Ca 10 F 2 (PO 4 ,CO 3 ) 6 ) and chlorapatite (Ca 10 Cl 2 (PO 4 ) 6 ) [ 25 ]. They exhibit varying levels of crystallinity and solubility [ 26 ]. Amongst them, hydroxyapatite (HAp, Ca 10 (OH) 2 (PO 4 ) 6 ) is the most significant compound in the context of both biology and geology. In the living world, HAp is involved in calcification, which is the biological Molecules 2024,29, 4479 3 of 39 process of the deposition of calcium in tissues and body structures. In terms of weight, HAp is the main component of bones and teeth in vertebrates. In this sense, about 60–70% of bone [ 27 , 28 ] and even 96% of tooth enamel [ 29 , 30 ] is HAp, with a slight amount of replacement of the PO 43− /OH − groups by anions, mainly CO 32− (2–8%, generating the so-called bioapatite [31,32]). HAp can typically be found in two crystallographic forms [ 33 , 34 ]: the hexagonal and monoclinic phases (see Table 1). Stoichiometric HAp gives rise to the thermodynamically more stable monoclinic polymorph [ 35 – 37 ]. However, factors such as the inclusion of ions and the formation of vacancies cause it to take the hexagonal form, the most common phase in the mineral and biological worlds. In hexagonal HAp, hydroxide OH − ions stack in channels along the [001] direction. The arrangement of tetrahedral phosphate ions distributes the calcium ions (Ca 2+ ) in two different crystallographic sites. Ca1 is parallel to the c-axis and links to nine oxygen atoms from six different phosphate tetrahedra: three phosphate oxyanions act as monodentate ligands through the O1 oxygen atoms, and the other three phosphates behave as bidentate through the O2 and O3 sets of atoms. The Ca2 atoms are placed on the hexagonal screw axes, in polyhedra with an irregular sevenfold coordination whose environment contains one O1, one O2, and four O3 phosphate atoms and a hydroxide ion [ 38 , 39 ]. Differences with the monoclinic structure are subtle and mainly involve the orientation of hydroxide anions. In the hexagonal cell, two adjacent hydroxides point in the opposite direction, but in the monoclinic structure, all the hydroxides in a given column point in the same direction, which is reversed in the next column [40] (Figure 1). ff ff − − − − ⁺ ff ff ff − −ff Figure 1. View of the hexagonal crystal structure of HAp (a). PO 43− tetrahedra are represented in purple, the positions of the OH − anions in red, and the two different sites for the Ca 2+ ions in blue. The metal ions are depicted as balls (Ca2) and blue polyhedra (Ca1), respectively. (b) Schematic drawings of the hydroxide arrangements of hexagonal (left) and monoclinic (right) structures along the z-axis. HAp is a highly versatile material and, therefore, the field of applicability of this ceramic covers several areas. It has found use in biomedical research (implants and bone regeneration; scaffolds for tissue engineering and drug delivery), water purification (adsorbent for sequestering contaminants like heavy metals, dyes, and organic and inorganic pollutants, such as hydrocarbons and phosphates, and for reducing water hardness), batteries (energy storage), catalysis (catalysts, such as photocatalysts, or as active phase support), nanocarrier of biocides or elicitors in agriculture, ion exchange (membranes and filters for the separation and purification of liquids), and sensors (gas, temperature, biomolecule, ion, and pH sensors) [41–45]. The versatility of HAp and its multiple applications can be tailored by a thorough control of certain design factors. These factors, which can be modified by different synthetic methods, are the reaction time, pressure, rate, nature and order of the precursor’s addition, Molecules 2024,29, 4479 4 of 39 concentration of the reactants, pH, and temperature [ 46 – 49 ]. The attained products show distinct composition (e.g., Ca/P ratio), particle size (powder, granular, macroor microporous), degree of crystallinity, and morphology. Numerous synthetic routes to obtain polycrystalline HAp powder have been developed over the last decades. Post-synthesis parameters, such as re-immersion in solutions of the isolated solids or further thermal treatments, have also been analyzed [ 50 ]. All these procedures can be summarized in four different groups of methods (Figure 2) [51–56]. ff ff tt ff tt ff− − − Figure 2. Summary of methods for the synthesis of HAp. The morphology and crystal size of HAp depend on the crystal formation rate. The latter, in turn, is influenced by supersaturation, which correlates with the initial concentrations of calcium (i[Ca]) and phosphate (i[PO 4 ]) ions, the so-called iCa/P ratio, and ipH of the solution [ 57 ]. In a study conducted by Szterner and Biernat [ 58 ], it was found that lower [Ca] levels (0.025 and 0.050 mol/dm 3 ) produced HAp whiskers, whereas higher concentrations (0.1 and 0.2 mol/dm 3 ) led to the formation of hexagonal rods. Furthermore, the crystallite size of HAp nanoparticles diminishes with decreasing [Ca]. These results suggest a significant influence of calcium ion concentration on the shape and size of HAp crystals during synthesis [59]. The relationship between the pH and shape of HAp crystals is crucial. The modification of the ipH value causes a change in the structure and morphology of the crystals, including spheres, rods, needles, wires, whiskers, spherulites, belts, etc. [ 60 – 66 ]. pH is a pivotal parameter to be considered for the solubility and dissolution of several ions in solution. Variations in this value generate different concentrations of OH − and H 3 O + ions, thereby inducing changes in Ca 2+ and PO 43− levels [ 67 , 68 ]. In the process of synthesizing HAp, incorporating a base like NH 4 OH leads to an elevated concentration of OH − ions, consequently boosting the reaction’s alkalinity. This occurrence arises from the release of additional hydroxide ions, which can facilitate precipitation during synthesis. HAp is preferentially formed under neutral or alkaline conditions. Acidic conditions give rise to the formation of different phases [ 69 , 70 ]. Depending on the pH value, various crystalline phases are obtained, primarily due to the prevalence of the phosphate anion. In fact, H 2 PO 4− ions remain stable at pH levels between 3 and 6. If the pH increases between 8 and 11, HPO 42− ions become predominant, but beyond pH 12, phosphate ions PO 43− prevail [ 71 ]. Thus, the interplay between temperature, pH, and the order of the addition of precursors yields CaP precipitates, usually as mixtures of the OCP, DCPA, and HAp phases, where HAp tends to be the most abundant phase at pH > 5.3, whereas the former prevails at pH < 3.8 [72,73]. Temperature and pressure during synthesis also have a significant impact on the crystal growth of HAp [ 74 ], i.e., crystal size and shape. An optimal method for achieving Molecules 2024,29, 4479 5 of 39 pure and uniform HAp involves using high temperatures and pressures, as lower values result in the formation of diverse crystalline phases [58,66]. The chemical composition and vacancies present in the HAp crystal structure allow for a wide variety of anionic substitutions (involving hydroxide or phosphate groups) or cationic substitutions (like mono-, di-, and trivalent metals). The replacements cause disturbances in the crystalline network, which decreases crystallinity and therefore increases its capacity for reabsorption in physiological media. Ionic substitution in this ceramic material has gained importance in recent years, as summarized in Figure 3, which shows some of the replacements carried out [75–84]. Figure 3. Alphabetically ordered ions in doped HAp, both cationic and anionic positions. The interaction of biologically active metal ion complexes with hard tissues, like bones or teeth, has propelled the study of the interplay between HAp and coordination compounds [ 85 , 86 ]. In some cases, an inhibition of HAp growth in the presence of a metal complex has been shown [ 87 ]. In addition, the search for HAp-containing multifunctional materials with new or improved properties has led to the fabrication of hybrid HAp–metal complexes as new steps in the process of achieving systems with increasing complexity. Thus, coordination compounds formed by transition metal ions linked to carboxylates, phosphonates, Schiff bases, or polypyridyl-type ligands, amongst others, have been incorporated into the inorganic HAp kernel [ 88 – 96 ]. A few years ago, Barbosa et al. wrote a very interesting review in this field [ 97 ]. Even though a deep bibliographic search on this matter falls outside the scope of the present review, the ligand behavior of most biomolecules is a nexus of these systems, including of the ternary HAp–biomolecule–metal systems that will be discussed later. This has prompted us to include the short insight given in this paragraph. Some HAp–biomolecule–metal compounds have been published recently. One of them incorporates glucose-6-phosphate and Cu(II)/Zn(II) ions into the HAp matrix, generating HAp-functionalized nanoparticles with good survivability and adhesion to osteoblast cells [ 98 ]. Another example links polydopamine to an alginate/Sr(II)/HAp composite, promoting osteogenic differentiation and vascularization [ 99 ]. In another case, β -cyclodextrin reacts with an inorganic zinc phosphate@HAp matrix, giving rise to a composite that serves as a nanocarrier for the antitumoral drug cisplatin [100]. Currently, various efforts are underway to achieve the synthesis of new materials from biomimetic and bio-inspired perspectives [ 30 , 101 , 102 ]. This search must take into account the features involved in the biomineralization processes, which are induced by physical and chemical factors, but also conditioned by the biological environment or presence of different living organisms [ 103 – 108 ]. In particular, research on innovative biomaterials aimed at bone tissue regeneration through the covalent functionalization of ceramic materials with biomolecules, or closely related models, has been fruitful [ 109 – 111 ]. Of course, CaPs are among the inorganic materials that are most likely to be used in bone healing [ 112 – 115 ]. But the relevance of these studies is also related to the dark side of the biomineralization process of HAp and other CaPs, which are involved in the formation of urinary stones and in vascular calcification, which can promote cardiovascular diseases [ 116 , 117 ]. The knowledge of the underlying mechanisms in both biologically essential and undesirable processes can be applied to different therapeutic strategies. In the case of bone [ 118 – 122 ], mineralization occurs on the bone surface, where cells called osteoblasts secrete matrix structural proteins (mainly collagen, but also glycoproteins Molecules 2024,29, 4479 6 of 39 and proteoglycans) and the peptide hormone osteocalcin. The layers formed by type I collagen, microfibrils containing triple-helix collagen, act as templates in a complex process that has not yet been fully clarified. After a possible transient formation of ACP particles, the process leads to the deposition of HAp nanocrystals with platelet shapes and their c-axis aligned with the collagen fibrils. Hence, the mineralized collagen fibers constitute the structural units of bones [ 123 , 124 ]. In particular, the behavior of the inorganic matrix was explored by a combined Raman/ 31 P-NMR study whose synthetic methodology provided a slow incorporation of base (NH 3 ) from pH 2 to pH 10 [ 125 ]. The study found that the concentration of the tested biological components (a synthetic polyaspartate mimicking non-collagenous proteins, citrate, and collagen) could control the usual sequence of solid precipitates, represented in Equation (1), to reach the final crystalline HAp. Thus, polyaspartate stabilized OCP and citrate inhibited its formation and precluded HAp precipitation, whereas the great influence of collagen in the structure of HAp showed no dependence on the concentration. Solution 0–96 min −−−−−→ ACP 96–480 min −−−−−−→ OCP 480 min–6days −−−−−−−−→ HAp (1) As a result, bone tissue is produced. By weight, its average composition is approximately 65% inorganic components, 25% organic components, and 10% water. The main inorganic component is calcium-deficient carbonate hydroxyapatite (90%). In the case of the organic fraction, it is largely type I collagen (around 90%), non-collagenous proteins (like osteocalcin, osteopontin, bone sialoprotein, osteonectin, and SPARC, among others, 2.50–3.75%), together with small amounts of citrate (1.5–2.0%) and lipids (1–10%) [ 126 – 129 ]. In the case of teeth, three hard structures can be distinguished: dentin, cement, and enamel. The amount of inorganic apatite matrix in dentin and cement is similar to that in bones, 70 and 65% in weight, respectively, and the percentages of organic and water content are 20 and 10% in both cases. Nonetheless, the HAp content reaches nearly 95–97% in enamel [ 130 – 132 ], where amelogenin is the most abundant protein in the organic matrix [133]. The way to tackle the incorporation of biomolecules in the HAp bone/teeth matrix involves ensuring the effective immobilization of biomolecules on the surface of HAp. Thus, it requires high affinity and specificity with the ceramic moiety, achieving a precise immobilization at the desired site and ensuring the maintenance of biological activity [ 134 ]. In research on the functionalization of HAp with biomolecules, various synthetic approaches have been described [ 135 ]. Given that we will focus our review on the anchorage of peptides and nucleic acid derivatives on HAp, we will provide, in the following paragraphs, a very brief survey on the functionalization of HAp with carbohydrates, lipids, and vitamins. - The biodecoration of HAp with carbohydrates has been achieved by directly and covalently bonding nanostructured apatite granules to various polysaccharides, like cellulose [ 136 , 137 ], chitosan [ 138 ], pectine [ 139 ], carrageenan [ 140 ], alginate [ 141 ], hyaluronic acid [ 142 , 143 ], and, very recently, acemannan mucopolysaccharide [ 144 ]. Additionally, monosaccharides such as D-glucose, D-galactose, and L-fructose are also utilized in this context [145,146]. - The interaction of HAp with different carboxylic acids has been extensively analyzed based on the affinity of Ca 2+ ions for carboxylate groups, such as those present in aliphatic (propionic, malonic, glutaric, adipic, maleic, fumaric . . . ), aromatic, polycarboxylic, and lactic/glycolic acid derivatives or even more complex carboxylate-containing organic compounds [ 147 – 151 ]. Studies have also included fatty acids and lipids, including stearic acid, ricinoleic acid, linoleic acid, and oleic acid, among others [ 152 – 155 ]. In fact, the presence of lipids promotes the precipitation of HAp [ 156 ], given, at least in part, that phospholipids trigger the in vivo transformation of OCP into HAp [ 157 ]. These phase transitions seem to be crucial in the early stages of bone biosynthesis, probably boosted by the formation of calcium–phospholipid complexes [158]. Molecules 2024,29, 4479 7 of 39 - The creation of hybrid materials of HAp matrices functionalized with vitamins, such as folic acid [159] and biotin [160], has been described in the literature. The aforementioned findings highlight the essential role that HAp plays in the construction of the hard tissues of vertebrates. Their organic components are mainly proteins. Because of this, the present review is focused on the study of synthetic HAp–biomolecule materials containing proteins, or their simplest constituents, such as amino acids and peptides. We have also included HAp–nucleic acid biomaterials and their nucleobase biological bricks, emphasizing the relevance of phosphate anions in many biological processes, including those involving energy or information transference. As far as we are aware, no neat reviews simultaneously covering both aspects—proteins and nucleic acids or their constituting bricks—have been published up to date. Notwithstanding this, perhaps the most interesting novelty of the present review are the sections dealing with the incorporation of metal complexes, which we have included at the end of each chapter. A bibliographic insight into the scientific literature on these systems gives an impression of the cumulative efforts dedicated to them for years. With this purpose, we carried out a search in the Web of Science database using “hydroxyapatite” AND “(amino acid OR peptide OR protein)” as key terms present in abstracts. The search yielded 23,958 results [ 161 ]; the oldest paper was the early Cartier publication from 1948 [ 162 ]. In the same way, 2554 results were obtained for “hydroxyapatite” AND “(nucleic acid OR nucleotide OR nucleobase)”. Figure 4depicts the results published from 1961 to 2023, showing a total of 23,569 and 2537 results for the peptide and nucleotide families, respectively. As can be seen, papers on HAp–protein related systems are much more numerous than those dealing with nucleic acid derivatives. Thus, this review is not an exhaustive description of the extensive bibliography about HAp–peptide–nucleotide systems but an essay aiming to introduce them. The perspective of this work is chemical, and it is mainly aimed at beginners or researchers who wish to have an initial and brief introduction to these hybrid systems. ≈ ffi Figure 4. Chronological evolution of the number of entries in the bibliographic search on HAp–(AA–peptide–protein) (in blue) and HAp–(nucleobase/nucleotide/nucleic acid) (in orange) systems. The range of years covered in the figure is from 1961 to 2023. Data were collected from Web of Science (see main text). 2. Functionalization of HAp with Amino Acids, Peptides, Proteins, and Metal Complex Hybrids 2.1. HAp and Amino Acids Amino acids (AAs) have a wide range of biological functions. They are the building blocks of proteins and play essential roles in metabolism, enzymatic activity, cellular signaling, nitrogen balance, and detoxification [ 163 ]. The structural AAs inside proteins have a carboxyl (-COOH) fragment, an amino (-NH 2 ) moiety, and organic R-substituents Molecules 2024,29, 4479 8 of 39 covalently bonded to the same carbon atom (Figure 5). Amino acids are classified as acidic, basic, or neutral, depending on the nature of their side chains. Out of the 20 known AAs with which cells form proteins, 9 cannot be synthesized by mammals (i.e., they are dietary essential). ≈ ffi Figure 5. General structure of protein-forming AAs, with oneand three-character codes in parentheses. Prebiotically relevant AAs, such as histidine, cysteine and arginine, have been reported to enhance phosphate adsorption onto iron oxy(hydroxide) minerals by ≈ 30% [ 164 ]. In the context of the interplay between AAs and phosphate ions, it can be expected that the arrangement of phosphate and calcium ions in the crystal structure of HAp [ 165 ] could favor their binding to AAs. In fact, the affinity between HAp and AAs rests on the presence of both carboxyl and amino functional groups in AAs, as well as in the side chain substituents (R) such as the -COOH (e.g., aspartic acid (Asp), glutamic acid (Glu)), -NH 2 (e.g., lysine (Lys), arginine (Arg)), and -OH groups (e.g., serine (Ser), threonine (Thr)). These substituents are able to form covalent, ionic, and hydrogen bonds with the calcium and/or phosphate ions on the surface of HAp, affecting its structure and its physical, chemical, and biological properties. Several preparative methods have been applied to obtain HAp-AA hybrid materials. Some of them involve direct synthesis in water under controlled conditions using solutions of soluble calcium and phosphate salts, such as Ca(NO 3 ) 2· 4H 2 O and (NH 4 ) 2 HPO 4 . The desired amino acid is added to the phosphate solution before adjusting the pH above 9 with NH 4 OH. Reactions are often carried out in a nitrogen atmosphere to avoid carbonation processes in such a basic medium. Note that carbonate ions are incorporated into the HAp structure by partial replacement of the OH − (substitution in the A-sites) or PO 43− ions (substitution in the B-sites) [ 166 – 169 ]. Finally, the hybrids are obtained as solids and, sometimes, further treatments (like moderate heating or hydrothermal) are performed [ 170 ]. Notwithstanding this, many other methods such as ultrasonic and microwave irradiation have been applied [ 171 ]. But regardless of the kinds of methods used, the experimental results unveil the complexity of the HAp/AA interaction. Studies show that complexes formed between charged AAs and Ca 2+ and PO 43− ions are time-dependent and react differently following pathways that depend on their level of organization and structure. Consequently, the time between the preparation of the solution of the precursor and their mix should be taken into account as an important variable in any biomineralization experiment [172]. The surface of HAp is neutral or slightly negatively charged in aqueous suspensions at neutral pH values. In the case of a basic pH, amino acids exist in their carboxylate ion (-COO − ) form with a neutral amino group. Due to these negative charges, the electrostatic HAp-AA interaction could be considered weak because of the charge repulsion. Notwithstanding this, an investigation performed with the simplest AA (Gly) showed that the HAp–glycine (HAp-Gly) interaction modulated the morphology and size of the particles: the greater the amount of Gly, the smaller the size of the HAp-Gly crystals [ 173 ]. In other words, the crystallinity of HAp decreased with an increasing amount of Gly. And, more importantly, this result suggested that, for the interaction mechanism, the coordination of Molecules 2024,29, 4479 15 of 39 molecules and ions present on the HAp surface, forming the hydration and the non-apatite layers, respectively, affect the immobilization of proteins on the particle [232]. This review will cover non-collagenous proteins (NCPs) in a broad manner but will primarily focus on the role of Clg in their linkage to the inorganic CaP matrix, as collagen represents the most abundant protein in mammals, at around 20–30% of the protein weight [233]. As mentioned in the Introduction, bones are composed of 65–70% minerals and 30–35% organic molecules, predominantly type I collagen [ 234 ]. Type I collagen is characterized by its high content of proline, glycine, and hydroxyproline, which together represent over 50% of the amino acid composition, often arranged as Gly-X-Y repeats (where X and Y are Pro or Hyp). These amino acids assemble into Clg fibrils forming the fundamental triple-helix secondary structure. A representation of the primary structure of Clg is given in Figure 7. α α ffi γ ff α ff − tt ff Figure 7. Primary structure of collagen. The structural organization of this protein is relevant for the deposition of HAp within bone tissue. Type I collagen fibrils consist of tropocollagen as their basic unit, composed of three chains: two α -1 collagen chains (COL1A1) and one α -2 collagen chain (COL1A2) [ 235 ]. Tropocollagen has a diameter of 1.5 nm and a length of 300 nm. These tropocollagen units are aligned in an organized manner, and the regions between the fibrils, known as “hole zones”, are approximately 40 nm in length and 5 nm in width [ 236 ], exhibiting a high charge density, which is critical for mineral nucleation. These hole zones create favorable conditions for the accumulation of mineral ions, initiating the formation of incipient nuclei, which subsequently grow into larger, organized mineral structures. Furthermore, the size of these holes appears to limit inorganic growth. Bone sialoproteins, osteonectin, osteopontin, osteocalcin, and/or dentin matrix proteins—all NCPs—bind to tropocollagen and regulate the mineralization process of hydroxyapatite. These NCPs are rich in acidic amino acid residues or experience post-translational modifications that add acidic groups into their sequences, enhancing their affinity for Ca 2+ ions. Within bone proteins, osteocalcin stands out for having a distinct amino acid residue that binds to calcium, γ -carboxyglutamic acid (Gla), so osteocalcin is also called bone Gla protein (BGP) [237]. Approximately 28 types of collagens have been identified, each sharing a triple-helix (TH) structure while differing in the composition of their α chains, thereby contributing to their distinct functional properties. The five main types of collagens and their roles include the following [238–242]: - Type I forms 90% of organic bone mass and is a major protein constituent in various tissues, such as tendons, ligaments, the cornea, or the skin. - Type II is found in elastic cartilage, providing resilience and support to joints. - Type III is present in muscles, arteries, and organs, offering structural support and elasticity. - Type IV is located in skin layers, contributing to basement membranes and tissue organization. Molecules 2024,29, 4479 16 of 39 - Type V is found in the cornea of the eye, some skin layers, hair, and placental tissue, contributing towards tissue stability and function. Studies on the mineralization of apatite in the presence of protein suggest that collagen fibrils facilitate the formation of apatite from low [Ca 2+ ] and [PO 43− ] values [ 243 ]. Bradt et al. [ 244 ] described a wet method for the attainment of mineralized Clg gel by mixing an acid calcium-containing Clg solution with a buffered neutralized phosphate solution. This process allowed for the simultaneous assembly of collagen fibrils and precipitation of amorphous calcium phosphate (ACP), which subsequently transformed into crystalline HAp. The crystallization of HAp on the fibrils improved with the addition of polyaspartate, a synthetic polymer that mimics NCP function. Another approach studied by Qu et al. [ 245 ] employed type I collagen substrates immersed in a solution called simulated body fluid (SBF), which contained inorganic ions (from salts such as NaCl, NaHCO 3 , KH 2 PO 4 , MgCl 2 , and CaCl 2 ) in similar concentrations to those in human blood plasma. The preformed substrates acted as templates for HAp deposition, gels on which minerals could nucleate and grow, mimicking the natural mineralization process in biological tissues like bones and teeth. The binding of Ca 2+ to negatively charged carboxylate groups in collagen was found to be crucial in facilitating this nucleation [ 246 ]. Molecular dynamic simulations of the interaction mechanism of aspartic acid residues in collagen on the crystal HAp surface have revealed the impact of calcium vacancies on carboxylate adsorption and the stabilizing role of hydrogen phosphate in the process [ 247 ]. In addition, it has been proposed that HAp nucleation mainly occurs around charged amino acid residues in human type I collagen. In particular, arginine seems to play a pivotal role in the process. The thermodynamic barrier height for the formation of complexes with Glu and Asp with PO 43− is higher than those with Lys and Arg [ 248 ]. Moreover, the phosphorylation (incorporation of negatively charged phosphate groups) of Clg nanofibers promoted the deposition of HAp [249]. Mesoporous hydroxyapatite nanoparticles coated with collagen have been successfully synthesized for the selective delivery of drugs to cancer cells [ 250 ]. These NPs exhibited biocompatibility, nontoxicity, and anti-inflammatory properties, highlighting their potential for future biomedical applications. Regarding research on non-collagenous proteins, it has been demonstrated that certain highly acidic NCPs, characterized by multiple phosphorylation sites [ 219 ] or an integrin-binding RGD (Arg-Gly-Asp) domain, can bind HAp through their acidic protein regions [ 251 ] and directly influence controlled mineralization [ 252 ]. Some NCPs used as linker molecules to functionalize the surface of HAp include bovine serum albumin (BSA) and a small integrin-binding ligand, N-linked glycoprotein (SIBLING). Proteins from the SIBLING family located on human chromosome 4q21 include dentin matrix protein 1 (DMP1), dentin sialophosphoprotein (DSPP), matrix extracellular phosphoglycoprotein (MEPE), osteopontin (OPN), and bone sialoprotein (BSP). BSP and OPN are found in higher concentrations in bone tissues, whereas DMP1, DSP, and DPP are predominantly found in dentin. These proteins are characterized by domains that mediate cell adhesion and can functionalize mineralization by inhibiting calcification. Despite their strong affinity for HAp crystal surfaces, their structural flexibility enables other parts of the molecule to interact with other proteins or facilitate cell binding through the exposed RGD integrin-binding domains. SIBLING proteins are characterized by a high content of acidic amino acids such as Asp and Glu, but also contain basic residues like Arg and Lys. Upon ionization, these residues, along with Gln, Gly, Pro, and Ser, are known disruptors of the protein structure, which may influence the long-term ordering of their main conformational stability. Additionally, the SIBLING protein family has been observed to stably bind to Clg fibrils. The concentration of organic additives, like collagen, citrate, and a synthetic polyaspartate mimicking an NCP, influences HAp crystallization. This concentration was found to modify the sequence of HAp formation (usually, first ACP, afterwards OCP, and, finally, HAp) [ 253 ]. The most outstanding result in this work was that confinement thermodynamically drives HAp formation by slowing down the kinetics in the formation of CaP precursors. Molecules 2024,29, 4479 17 of 39 Apart from bones, HAp is also present in teeth. As previously mentioned, amelogenin is the most abundant protein in enamel (about 90% of the protein content). There, this hydrophobic peptide self-assembles to form an extracellular matrix which acts as a template for the continuously growing HAp crystals, presumably through nanosphere formation via oligomers [ 254 ]. Habelitz et al. revealed that the enamel protein amelogenin adopts ribbon-like supramolecular structures that template the growth of highly oriented HAp nanofibers. The mechanism is regulated by enzymatic processing and interaction with acidic nonamelogenin proteins [ 255 ]. It is remarkable that very small variations in the amino acid primary sequence can drastically influence the biomineralization of HAp. Thus, the change in one amino acid, proline to threonine, within the sequence in amelogenin, gives rise to defective enamel; this is present in a group of congenital disorders known as amelogenesis imperfecta [256]. Regarding other proteins, Kollath et al. [ 201 ] explored methods to improve the adsorption capacity of HAp powder for proteins such as BSA. Under neutral pH conditions in an aqueous solution, HAp has a neutral or slightly negative charge, while BSA is negatively charged. Specific linker molecules (L-Arg, L-Lys, and O-phospho-L-Ser) were used as functionalizing agents to modify the charge of BSA. Thus, the electrostatic interactions on the surface of the crystalline material were altered, improving the attraction between the powder and the protein. The carboxyl group of these linker molecules can interact with Ca 2+ ions present on the HAp surface through electrostatic reactions, leaving the amino group available to react with BSA. Additionally, the amino group can form a hydrogen bond with the HA surface via a water molecule, although this interaction is weaker. Lys and Arg increased protein adsorption, whereas phosphoserine reduced it. This increase seemed to be due to a change in the surface charge of apatite, making the positively charged residues more prominent after functionalization, thereby enhancing the adsorption of negatively charged BSA. A slight increase in the zeta potential also significantly boosted protein adsorption. The findings indicated that adsorption capacity can be controlled through different functionalization, depending on the specific protein–carrier pair under consideration. Medicinal research on biomaterials, which includes the search for nanocarriers to be used as drug delivery systems, has successfully found good candidates in hybrid compounds formed by HAp functionalized with proteins such as keratin [257], collagen [258], BSA [ 259 ], and buttermilk proteins [ 260 ], among others. However, not only HAp, but other CaPs, too, have been used as bioceramics derived from collagen scaffolds, including β –TCP or a silicon-based bioactive glass composed of 60% SiO 2 , 36% CaO, and 4% P 2 O 5 (mol%) to yield a SiO 2 –CaO–P 2 O 5 network [ 261 ]. The use of CaPs as inorganic matrices for bone morphogenetic proteins (BNPs) has also been investigated and recently reviewed [ 262 – 264 ], together with the field of protein-based active coatings in biomedical materials [ 265 ]. In fact, the creation of a synthetic bi-functional fusion protein has allowed for the targeting and monitoring of HAp biomineralization processes [266]. 2.4. HAp–Peptide–Metal Complex Hybrids The interaction of functionalized HAp–peptide hybrids with metal ions and coordination compounds has been explored. For instance, the use of HAp for removing Cu(II) ions in solution was investigated in the presence of Gly and ligands (ethylenediamine, en, and ethylenediamine tetraacetic acid, EDTA). The study ratified that the ligand sequestration effect minimizes the incorporation of transition metal ions into the HAp matrix [ 267 ]. But Cu(II) ions have also been included into calcium-deficient hydroxyapatite/multi-(amino acid) copolymers, showing good capacity for angiogenesis and osteogenesis [268]. The interaction of Zn-substituted OCP and the corresponding Ca-deficient Zn-HAp derivative with AAs (Asp, Cys, Glu, His, and Lys) was analyzed by Suzuki et al. [ 269 ], who reported that the release of Zn 2+ ions in the presence of AAs was larger in the case of Cys and His. Molecules 2024,29, 4479 18 of 39 Hybrid Sm-doped fluoroapatites (Sm-FAp) functionalized with Asp, Glu, Gly, and His were tested as catalysts in the synthesis of 1,2,4-triazole from 2-nitrobenzaldehyde and thiosemicarbazide, highlighting the excellent yield of the Gly hybrid [ 270 ]. Fe-derivatives in the same fluoroapatite–AA system showed good catalytic activity in the synthesis of thio-triazole compounds, in particular in the attainment of 1,2,4-triazolidine-3-thione products [ 271 ]. Fluorescence in Cd-FAp-Glu/His hybrids revealed that fluorescence intensity enhanced with the amount of AA adsorbed [272] In turn, Chrissantopoulos et al. [ 273 ] created a ternary organometallic–AA–HAp by reaction of titanocene with Gly/Ala and HAp, whose growth was found to be inhibited in the presence of the complex. Li et al. captured phosphorylated peptides by means of a hybrid compound formed by a magnetic Fe-containing metal–organic framework (Fe-MOF built with benzene-1,3,5tricarboxylic acid) and inorganic HAp nanowires [274]. In the case of proteins, the adsorption of myoglobin on the surface of HAp modified with Ni 2+ , Cu 2+ , and Zn 2+ has been analyzed [ 275 ]. For their part, Kalidas and Sumathi [ 276 ] have recently reported the preparation of a scaffold for bone tissue engineering based on a gelatin/polyvinyl alcohol/silk fiber reinforced with Cu-substituted HAp, which showed antimicrobial activity, biocompatibility, strong mechanical strength, and promising osteostimulation clues. On the contrary, the presence of Pb 2+ was found to inhibit the binding of osteocalcin to hydroxyapatite [277]. Not only complexes, but also metal nanoparticles have been linked to HAp-AA scaffolds, like the hydroxyapatite/gold nanoparticles/Arg nanocomposite designed by Vukomanovi´c et al. [ 278 ], or viceversa, as in the case of the construction of a silica/HAp/gold nanoparticle assembly to be used in phage display techniques [ 279 ]. The opposite strategy allowed for the construction of Asp-capped gold nanoparticles to induce HAp crystallization [ 280 ]. From the same perspective, PEGylated, peptide-coated superparamagnetic iron oxide nanoparticles (SPIONs) were investigated to bind the HAp present, in small amounts, in diseased cardiovascular tissues, in order to detect atherosclerosis or aortic stenosis [ 281 ]. Finally, the use of silver nanoparticles in dentistry, which involves interactions with CaP– protein composites, has recently been reviewed [282]. 3. Functionalization of HAp with Nucleobases, Nucleotides, Nucleic Acids, and Nucleic Acid–Metal Complex Hybrids 3.1. HAp and Nucleobases Nucleobases, or nitrogenous bases, are organic compounds that make up nucleotides, which are the essential building blocks of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). There are different nucleobases, but those likely found in DNA and RNA and thus involved in the genetic code are five: adenine (Ade, A), guanine (Gua, G), cytosine (Cyt, C), thymine (Thy, T), and uracil (Ura, U). Several tautomeric forms of them are possible. In the case of Ade, the three monocationic tautomers with the lowest energy are shown in Figure 8; one of them is protonated at N1 of the 9H tautomer of Ade, another at N3 of the 7H tautomer, and the last one at N3 of the 9H tautomer [ 283 ]. At physiological pH, approximately 7.4, the five main nucleobases exist almost completely in their keto and amino tautomeric forms. The corresponding pKavalues are shown in Table 4[284–287]. The lack of functional groups to establish strong enough linkages with HAp precludes the direct binding of nucleobases to CaPs, so no papers dealing with this item have been found. Therein, the information given here must be placed in the context of the whole section. Molecules 2024,29, 4479 19 of 39 ff ć ff Figure 8. Nucleobases in their unprotonated form and the three lowest-energy tautomers of protonated Ade. Table 4. pKavalues for nucleic acid nitrogenous bases. Nitrogen acidic atoms are indicated. Base Atom pKa Uracil N3 9.63 Thymine N3 10.30 Guanine N1 9.56 Guanine N7 3.11 Cytosine N3 4.60 Adenine N1 4.10 3.2. HAp and Nucleotides Nucleotides are essential organic compounds that, arranged in an anti conformation, act as the monomeric constituents of nucleic acids. Nucleotides have a wide range of functions, serving as the primary energy currency in cells, as coenzymes or cofactors in enzymatic reactions, as second messengers in signal transduction, and playing a crucial role in the metabolism of carbohydrates, lipids, and proteins, etc. Figure 9 represents the basic nucleotide structure and the atom numbering. As can be seen, a nucleotide comprises three fundamental components: a nitrogenous base, pentose sugar (a five-carbon monosaccharide), and from one to three phosphate groups. Nucleotides can adopt numerous conformations in solution, engaging in rapid dynamic equilibrium [ 288 ]. tt ′ ′ − − − ′ ff ′− − − ′ ′ − − − ′ − − − ′ ′ − Figure 9. Basic structure of nucleotides with their three essential components. The nitrogenous base can be either a purine or a pyrimidine; the pentose sugar is either ribose or deoxyribose, and the phosphate group is attached to the 5′carbon of the sugar. Molecules 2024,29, 4479 20 of 39 The protonation sites in 2 ′ - deoxynucleotides (dNXP n where N = purine or pyrimidine; X = M, D and T; n = − 2, − 3 and − 4, respectively) exhibit greater basicity compared to their ribose analogs (NXP n ). The pK a values of 2 ′ -deoxyribose are more basic than those of ribose nucleotides. Table 5shows the acid strengths for the different nucleotides: adenosine 5 ′ -mono-, di-, and triphosphate (AMP 2− , ADP 3− , ATP 4− ); 2 ′ -deoxyadenosine 5 ′ -mono-, di-, and triphosphate (dAMP 2− , dADP 3− , dATP 4− ); guanosine 5 ′ -mono-, di-, and triphosphate (GMP 2− , GDP 3− , GTP 4− ); 2 ′ -deoxyguanosine 5 ′ -mono-, di-, and triphosphate (dGMP 2− , dGDP 3− , dGTP 4− ); cytosine 5 ′ -mono-, di-, and triphosphate (CMP 2− , CDP 3− , CTP 4− ); 2 ′ -deoxycytosine 5 ′ - mono-, di-, and triphosphate (dCMP 2− , dCDP 3− , dCTP 4− ); uridine 5 ′ -mono-, di-, and triphosphate (UMP 2− , UDP 3− , UTP 4− ); and thymidine 5 ′ -mono-, di-, and triphosphate (dTMP2−, dTDP3−, dTTP4−). Table 5. Comparison of pK a values for several deoxyand ribonucleotides as determined by potentiometric pH titrations in water at 25 ◦ C and I = 0.1 M (NaNO 3 ). Adapted with permission from [ 289 ]. Copyright © 2008 WILEY VCH Verlag GmbH & Co. KGaA, Weinheim. Refs. Acid NXP/dNXP pKafor N1H+or N7H+ NXP/dNXP (4a) pKafor PO2(OH)− NXP/dNXP (5a) pKafor N1H or N3H NXP/dNXP (6a) [290,291] H2(GMP)±/H2(dGMP)±2.48 ±0.04/2.69 ±0.03 6.25 ±0.02/6.29 ±0.01 9.49 ±0.02/9.56 ±0.02 [289,290] H 2 (AMP) ± /H 2 (dAMP) ±3.84 ±0.02/3.97 ±0.02 6.21 ±0.01/6.27 ±0.04 [292,293] H2(CMP)±/H2(dCMP)±4.33 ±0.04/4.46 ±0.01 6.19 ±0.02/6.24 ±0.01 [293] H(UMP)−/H(dTMP) 6.15 ±0.01/6.36 ±0.01 9.45 ±0.02/9.90 ±0.03 [289,294] H2(GDP)−/H2(dGDP)−2.67 ±0.02/2.91 ±0.07 6.38 ±0.01/6.46 ±0.03 9.56 ±0.03/9.64 ±0.04 [289,295] H2(ADP)−/H2(dADP)−3.92 ±0.02/4.00 ±0.03 6.40 ±0.01/6.45 ±0.01 [296] H3(CDP)±6.39 ±0.02/ [296] H2(UDP)−/H2(dTDP) 6.38 ±0.02/6.44 ±0.01 9.47 ±0.02/9.93 ±0.02 [289,297] H 2 (GTP) 2− /H 2 (dGTP) 2−2.94 ±0.02/3.16 ±0.05 6.50 ±0.02/6.64 ±0.02 9.57 ±0.02/9.66 ±0.04 [289,297]H2(ATP)2−/H2(dATP)2−4.00 ±0.01/4.14 ±0.02 6.47 ±0.01/6.62 ±0.03 [297,298]H2(CTP)2−4.55 ±0.02 6.55 ±0.02 [297,298]H2(UTP)2−/H2(dTTP)2−6.45 ±0.01/6.52 ±0.02 9.57 ±0.02/10.08 ±0.05 Taking H 2 (GMP) as an example, three deprotonation reactions can occur: from (a) N7H + site; (b) PO 3 (OH) − group; and c) N1H unit. Thus, in a general formulation, the deprotonation reactions for nucleoside 5 ′ -mono-, di-, and triphosphates (NP 2− / 3− / 4− ) are described in Equations (4)–(6) [289], which yield the pKavalues given in Table 5. H2(NP)±/−/2−⇌H(NP)−/2−/3−+H+(4a) KH H2(NP)=[H(NP)−/2−/3−][H+ [H2(NP)±/−/2−](4b) H(NP)−/2−/3−⇌NP2−/3−/4−+H+(5a) KH H(NP)=[NP2−/3−/4−]H+ [HNP)−/2−/3−(5b) NP2−/3−/4−⇌(NP −H)3−/4−/5−+H+(6a) where NP minus H means a N1H site of a guanine residue or the N3H site of a uracil/thymine residue loses its H. KH NP =[(NP −H)3−/4−/5−][H+] [NP2−/3−/4−](6b) Depending on the specific nucleobase, only certain equilibria are applied. The nucleotides GXP and dGXP follow equilibria (4a), (5a), and (6a). For the nucleotides A/CXP and dA/CXP, only equilibria (4a) and (5a) are important, as they consider the deprotonation of the N1H + site (4b) and the monoprotonated phosphate group (5b). For the Molecules 2024,29, 4479 21 of 39 nucleotides U/TXP and dU/TXP, it is only necessary to consider equilibria (5a) and (6a), which quantify the release of the proton from the monoprotonated phosphate residue and the deprotonation of the N3H site (6b). An increase in basicity arises from the replacement of the 2 ′ OH group with a 2 ′ H atom, which diminishes the hydrophilicity of the nucleotide. As a result, the nucleotide solvation by water molecules is affected, leading to changes in its deprotonation behavior. Among all the nucleotides, the one with guanine is the most impacted, with the N7 site showing a notable increase in basicity, leading to a higher acidity constant. Consequently, the effect on the phosphate groups and N1H or N1H + is smaller, but still present. These effects become more pronounced again only when the phosphate chain is long enough to form a macrochelate with N7, as in the case of triphosphates. The bases of transphosphorylation, the exchange of phosphate groups, between nucleotides and HAp have been explored. In 1962, speculation began about the possibility of a structural relationship between nucleotides and the surface of apatite that could explain the accelerated transphosphorylation reaction found [ 299 ]. Several nucleosides diand triphosphate were tested, together with inorganic pyrophosphate, in their reaction with different phosphates, including substituted apatites with Sr or Pb. The binding of nucleotides to apatites was found to be more efficient than that to other phosphates. In addition, the production of inorganic pyrophosphate in the reaction with nucleotides was detected. The terminal PO 43− of the nucleotide was released to combine with a phosphate from the apatite crystal, forming P2O74−. Further studies evidenced the role of P2O74−as an inhibitor of the biomineralization of HAp [300,301]. More recent studies have demonstrated that adsorption on the HAp matrix is affected by the charge of the nucleotide [ 302 ]. The presence of a cationic or neutral charge in a nucleotide results in absent or significantly reduced adsorption. Conversely, a net negative charge promotes significant chemical adsorption, which can be neutralized by acidification. Additionally, at neutral pH, it is known that the mere presence of phosphates in the nucleotide does not ensure adsorption on HAp. The number of phosphates can only influence the adsorption efficiency of a molecule if it carries an overall negative charge. 3.3. HAp and Nucleic Acids Nucleic acids are essential biological macromolecules that store and transmit genetic information, play a crucial role in protein synthesis, and are also involved in regulating gene expression and activating specific genes. These functions are fundamental to the development, machinery, and reproduction of all living organisms. There are two main types of nucleic acids: RNA and DNA (Figure 10). In 1953, Watson and Crick (WC) [ 303 ] proposed the three-dimensional model of DNA structure, which consists of two strands of nucleotides that wind together to form a double helix, whereas RNA is single-stranded. The base pairing in DNA involves the nitrogenous base A always combined with T, and C with G. This specific pairing is governed by the formation of hydrogen bonds between complementary bases: A-T forms two hydrogen bonds and C-G forms three hydrogen bonds. These hydrogen bonds play a critical role in the stability and specificity of doublestranded DNA. DNA and RNA derivatives are known to be able to adsorb onto HAp [ 303 ]. In fact, like in the case of proteins, some of the earliest studies on the interaction between HAp and (poly)nucleotides arose from the utilization of inorganic matrices in chromatography [ 304 ]. Soon, the efficiency of HAp was discovered to be remarkable as a result of the high affinity for phosphate groups in the nucleotides [ 305 – 307 ], allowing even fine separations of doublestranded DNA, single-stranded DNA, and RNA [308]. Molecules 2024,29, 4479 22 of 39 (a) (b) ffi ffi ffi Figure 10. Structure of (a) double-helix DNA and (b) single-stranded RNA. One of the first applications of the nucleic acid condensation induced by CaP was its use by Graham and Van Der Eb for carrying and delivering adenovirus 5 DNA into KB cells [ 309 ]. Studies on HAp particles as vectors for DNA delivery in gene therapy have recently been reviewed by Zhu et al. [310]. Baglioni et al. [ 311 ] studied the interactions between DNA and CaPs in the search for composites to be used in nanomedicine. Inorganic carriers play a crucial role in enhancing cell adhesion and facilitating the entry of therapeutic materials into cells. In addition, and following the same idea, Drouet’s research group evaluated the adsorption of DNA on HAp, verifying the strong binding affinity between DNA and HAp. They also studied the desorption process triggered when there is an excess of phosphate ions in the medium by the competition of free phosphates with the DNA–phosphate backbone [312]. Yazaki et al. used lipids to provoke the precipitation of DNA onto the HAp surface [ 313 , 314 ], which has been demonstrated to enhance the gene expression of mesenchymal stem genes [ 315 ]. Furthermore, studies conducted by Gibbs et al. [ 316 ] supported a model of prebiotic polynucleotide synthesis in which a mineral, such as HAp, with anion exchange properties immobilizes high-molecular-weight products of a template-directed reaction. This avoids the spontaneous hydrolyzation processes that break the oligonucleotides in solution and are incompatible with the survival of long preformed oligomers. These authors observed that HAp adsorbs polyuridylic acid (poly(U)) from aqueous solution almost completely, without reducing its ability to function as a template for the synthesis of oligoadenylates. The adenine nitrogenous base (monomeric A) was found not to bind HAp directly; however, the functionalized HAp/poly(U) hybrid was found to incorporate 74% free adenine from the solution. The presence of HAp in the prebiotic environment could have led to the stabilization of nucleotides on its surface and made possible the further accretion of monomers to form polynucleotides. In this sense, it must be considered that two factors, an increase in the molecular weight and the secondary structure of the oligonucleotide, govern the HAp/polynucleotide binding. Regarding the secondary structure, it has been known for a long time that the linkage of double-stranded nucleotides and HAp is stronger than the one with single-stranded polynucleotides. Triple-stranded is even stronger than double-stranded, and quadruplexes even more so [ 317 , 318 ]. In the case of DNA, the negatively charged polyanion can be stabilized by positive charges, like Ca 2+ ions in HAp, suggesting that DNA sequences will have an affinity for the crystalline mineral. The adsorption affinity constant, K aff , may change as the secondary structure is modified by increasing ionic strength. It has been shown that aptamer sequences with G-quadruplex structures have a higher affinity for apatite, relative to other sequences, when higher ionic strength is used to stabilize the G-quadruplex [319]. Molecules 2024,29, 4479 23 of 39 The use of DNA aptamers obtained by the process known as SELEX (Systematic Evolution of Ligands by EXponential enrichment) bonded to calcium phosphate materials has recently been studied. Aptamers are single-stranded oligonucleotides, typically ranging from 15 to 100 nucleotides in length [ 320 ]. Experimental and computational studies have shown that DNA aptamers are involved in the mineralization process and act as crucial affinity reagents or markers, enabling the differentiation between amorphous and crystalline materials. Duffy et al. [ 321 ] selected three aptamers (with a higher percentage of G nucleotides) and checked their affinity for HAp, ACP, and β -TCP. Large and similar K aff values and binding at low aptamer concentrations (~50 nM) indicated the strong affinity of three aptamers for HAp (Table 6). The aptamers showed high selectivity for crystalline HAp over ACP and TCP. Kinetic analysis of the aptamers revealed a higher forward rate constant (kf) for aptamer 1, with the most compact G-quadruplex secondary structure. Table 6. Sequence, Gibbs free energy, affinity, and kinetics of aptamers for binding to HAp (*). Adapted with permission from [321]. Copyright © 2020 Elsevier B.V. Aptamer Sequence kf(min−1) Kaff (M−1)∆G (Kcal·mol−1) 1 CAGGGCGCTACGGTATGTGTTGGGTCTGGCG TAGGGCTGGC 12 ±2×1053±1×106−7.37 2 GAGCGCGCTACGGTATGTGTTGCGTGTGGCG TAGCGGTGCG 6±1×1057±4×106−8.54 3CAGCGCCCTACGCTATGTCTT GCGTCTCGCCTAGCGCTCGC 2±2×1057±4×106−7.99 * Kf: kinetic rate constant; Kaff: adsorption affinity constant; ∆G: Gibbs free energy of folding for aptamers. 3.4. HAp–Nucleic Acid–Metal Complex Hybrids Metal ions play various roles in nucleic acid chemistry [ 287 ] and can be categorized as follows: 1. Natural counterions: Common cellular ions like K + , Mg 2+ , and Na + act to neutralize the charges of polyanionic nucleic acids. 2. Folding and stabilization: These are essential for the proper folding of nucleic acids and for the stabilization of many RNA structures, as well as for the catalytic function of ribozymes, maintaining DNA structures such as Gua-quartets in telomeres and in Holliday junctions, and for the cross-shape structures formed during genetic recombination. 3. Exogenous ions and mimicry: Both physiological and non-physiological (exogenous) metal ions can mimic natural ions, affecting nucleic acid stability and charge neutralization and potentially causing DNA condensation or mutations. 4. Damage by Reactive Oxygen Species (ROS): Redox-active metal ions can cause damage to nucleic acids by breaking DNA strands. These ions can be essential (e.g., Cu + , Fe 2+ ), both in certain disease states and in therapeutic and DNA sequencing applications. 5. Phosphodiester reactions: Metal ions are involved in the formation and degradation of nucleic acid phosphodiester bonds. They can provide the OH − nucleophile, polarize P-O bonds, or stabilize transition states or leaving groups. Nucleobases in the structure of nucleic acids are typically uncharged within the physiological pH range (4 < pH < 9). Metal coordination, like other chemical modifications of nucleobases, alters their acid–base properties and causes changes in pK a values. The binding of metals to nucleic bases has been studied by several authors [ 322 – 326 ]. Studies by Sigel demonstrate that the protons of endocyclic NH groups become more acidic when a metal ion binds to an available nitrogen atom in the nucleobase ring. This phenomenon leads to changes in pK a values, which can shift in either direction as the metal ion displaces a proton from the nucleobase and relocates it within the heterocycle, thereby generating a metal-stabilized rare tautomer. Metal–nucleobase bond formation occurs through the Molecules 2024,29, 4479 24 of 39 following contributions: (a) electrostatic interaction: between a metal ion and the nucleobase dipole, dominant in the gas phase but influenced by solvent polarity in solution or solid states; (b) hydrogen bond formation: between a metal’s coligands and nucleobase, contributing to the stability of the complex; and (c) polarization and charge transfer effects: involving electron redistribution within the metal–nucleobase complex, less influenced by solvents and counterions. As expected, the substitution of nucleobase protons with metal ions increases this contribution compared to the binding of the metal to an available lone pair of a ring nitrogen atom or an exocyclic oxygen. The discussion will focus on guanine, which has a huge dipole moment and favorable orientation in the isolated base, resulting in high affinity of metal ions for the N7 position. In double-helical DNA, the affinity of metal ions for G-N7 is influenced by the nature of the base at the 5 ′ side, thus depending on the molecular electrostatic potential and N7 accessibility. Additionally, within nucleic acids, the affinity for metal ions is higher for DNA G-N7 than for RNA G-N7 [ 289 ]. Platinated DNA fragments confirm that guanine residues become more acidic after Pt coordination at N7 [ 327 – 329 ]. Conversely, the dipole moment and orientation of adenine make it less favorable for metal binding at N7, compounded by the steric hindrance of the exocyclic amino group. As has been indicated before, HAp has been extensively used in column chromatography, and the literature covers multiple examples of this technical approach. However, as far as we are aware, the way functionalized HAp–nucleic acid hybrids engage with metal ions and coordination compounds has been investigated little. In one of the few instances, Benedetti et al. [ 302 ] focused their study on the adsorption of platinated nucleotide analogs onto HAp. The adsorption of these nucleotide complexes occurs through electrostatic interactions between the negative phosphate groups and positive ions on the surface of hydroxyapatite crystals (Figure 11). But the mere presence of phosphates does not ensure the adsorption of the nucleotide to HAp. The adsorption efficiency of these nucleotide derivatives was found to be influenced by the overall electrical charge of the metal complex. Platinated compounds with a net negative charge exhibited significant chemical adsorption onto the HAp surface, which could be reversed by acidification. In contrast, complexes with cationic or neutral charges showed very low adsorptions. ffi ffi ′ ffi tt tt ffi Figure 11. Structure and interaction of the platinum complex with the apatite surface. On the other hand, guanosine 5 ′ -triphosphate (GTP) was anchored to the surface of Zn-substituted HAp nanoparticles, and its activity against osteosarcoma cells (Saos-2) was evaluated [ 330 ]. The functionalized nanoparticles induced differentiation into normal osteoblast cells in Saos-2 and provoked an enhancement of intracellular GTP content. In other work, luminescent HAp nanoparticles containing Eu 3+ ions were prepared by amidation of previously inserted AMP and final functionalization of the nanorods with poly(ethylene glycol) methacrylate (PEGMA) [331]. Molecules 2024,29, 4479 31 of 39 122. Paramasivan, M.; Sampath Kumar, T.S.; Kanniyappan, H.; Muthuvijayan, V.; Chandra, T.S. Microbial biomineralization of hydroxyapatite nanocrystals using Bacillus tequilensis. Ceram. Int. 2023,49, 5621–5629. [CrossRef] 123. Olszta, M.J.; Cheng, X.; Jee, S.S.; Kumar, R.; Kim, Y.Y.; Kaufman, M.J.; Douglas, E.P.; Gower, L.B. Bone structure and formation: A new perspective. Mater. Sci. Eng. R Rep. 2007,58, 77–116. [CrossRef] 124. Blair, H.C.; Larrouture, Q.C.; Tourkova, I.L.; Nelson, D.J.; Dobrowolski, S.F.; Schlesinger, P.H. Epithelial-like transport of mineral distinguishes bone formation from other connective tissues. J. Cell. Biochem. 2023,124, 1889–1899. [CrossRef] 125. Robin, M.; Von Euw, S.; Renaudin, G.; Gomes, S.; Krafft, J.M.; Nassif, N.; Azaïs, T.; Costentin, G. Insights into OCP identification and quantification in the context of apatite biomineralization. CrystEngComm 2020,22, 2728–2742. [CrossRef] 126. Feng, X. Chemical and biochemical basis of cell-bone matrix interaction in health and disease. Curr. Chem. Biol. 2009,3, 189–196. [PubMed] 127. Schwarcz, H.P. The ultrastructure of bone as revealed in electron microscopy of ion-milled sections. Semin. Cell Dev. Biol. 2015,46, 44–50. [CrossRef] 128. Pang, S.; Schwarcz, H.P.; Jasiuk, I. Interfacial bonding between mineral platelets in bone and its effect on mechanical properties of bone. J. Mech. Behav. Biomed. Mater. 2021,113, 104132. [CrossRef] 129. Hong, M.H.; Lee, J.H.; Jung, H.S.; Shin, H.; Shin, H. Biomineralization of bone tissue: Calcium phosphate-based inorganics in collagen fibrillar organic matrices. Biomater. Res. 2022,26, 42. [CrossRef] 130. Godberg, M.; Kulkarni, A.B.; Young, M.; Boskey, A. Dentin: Structure, composition and mineralization. Front. Biosci. 2011,3, 711. 131. Hu, D.; Ren, Q.; Li, Z.; Zhang, L. Chitosan-based biomimetically mineralized composite materials in human hard tissue repair. Molecules 2020,25, 4785. [CrossRef] [PubMed] 132. Du, M.; Chen, J.; Liu, K.; Xing, H.; Song, C. Recent advances in biomedical engineering of nano-hydroxyapatite including dentistry, cancer treatment and bone repair. Compos. Part B Eng. 2021,215, 108790. [CrossRef] 133. Jagadeeshanayaka, N.; Awasthi, S.; Jambagi, S.C.; Srivastava, C. Bioactive surface modifications through thermally sprayed hydroxyapatite composite coatings: A review of selective reinforcements. Biomater. Sci. 2022,10, 2484–2523. [CrossRef] 134. Fukumoto, S.; Nakamura, T.; Yamada, A.; Arakaki, M.; Saito, K.; Xu, J.; Fukumoto, E.; Yamada, Y. New insights into the functions of enamel matrices in calcified tissues. Jpn. Dent. Sci. Rev. 2014,50, 47–54. [CrossRef] 135. Lama-Odría, M.C.; Valle, L.J.; Puiggalí, J. Hydroxyapatite biobased materials for treatment and diagnosis of cancer. Int. J. Mol. Sci. 2022,23, 11352. [CrossRef] 136. Salama, A. Cellulose/calcium phosphate hybrids: New materials for biomedical and environmental applications. Int. J. Biol. Macromol. 2019,127, 606–617. [CrossRef] [PubMed] 137. Yamada, T.; Kitamura, T.; Morita, Y.; Mizuno, M.; Yubuta, K.; Teshima, K. Growth of dispersed hydroxyapatite crystals highly intertwined with TEMPO-oxidized cellulose nanofiber. CrystEngComm 2020,22, 4933–4941. [CrossRef] 138. Frohbergh, M.E.; Katsman, A.; Botta, G.P.; Lazarovici, P.; Schauer, C.L.; Wegst, U.G.K.; Lelkes, P.I. Electrospun hydroxyapatitecontaining chitosan nanofibers crosslinked with genipin for bone tissue engineering. Biomaterials 2012,33, 9167–9178. [CrossRef] [PubMed] 139. Ni, P.; Fox, J.T. Synthesis and appraisal of a hydroxyapatite/pectin hybrid material for zinc removal from water. RSC Adv. 2019,9, 21095–21105. [CrossRef] 140. Alinavaz, S.; Mahdavinia, G.R.; Jafari, H.; Hazrati, M.; Akbari, A. Hydroxyapatite (HA)-based hybrid bionanocomposite hydrogels: Ciprofloxacin delivery, release kinetics and antibacterial activity. J. Mol. Struct. 2021,1225, 129095. [CrossRef] 141. Szurkowska, K.; Zgadzaj, A.; Kuras, M.; Kolmas, J. Novel hybrid material based on Mg 2+ and SiO 44co-substituted nanohydroxyapatite, alginate and chondroitin sulphate for potential use in biomaterials engineering. Ceram. Int. 2018,44, 18551–18559. [CrossRef] 142. Xiong, H.; Du, S.; Ni, J.; Zhou, J.; Yao, J. Mitochondria and nuclei dual-targeted heterogeneous hydroxyapatite nanoparticles for enhancing therapeutic efficacy of doxorubicin. Biomaterials 2016,94, 70–83. [CrossRef] [PubMed] 143. Kong, L.; Mu, Z.; Yu, Y.; Zhang, L.; Hu, J. Polyethyleneimine-stabilized hydroxyapatite nanoparticles modified with hyaluronic acid for targeted drug delivery. RSC Adv. 2016,6, 101790–101799. [CrossRef] 144. Negi, D.; Bhavya, K.; Pal, D.; Singh, Y. Acemannan coated, cobalt-doped biphasic calcium phosphate nanoparticles for immunomodulation regulated bone regeneration. Biomater. Sci. 2024,12, 3672–3685. [CrossRef] 145. Russo, L.; Landi, E.; Tampieri, A.; Natalello, A.; Doglia, S.M.; Gabrielli, L.; Cipolla, L.; Nicotra, F. Sugar-decorated hydroxyapatite: An inorganic material bioactivated with carbohydrates. Carbohydr. Res. 2011,346, 1564–1568. [CrossRef] 146. Sandria, M.; Natalellob, A.; Binib, D.; Gabriellib, L.; Cipolla, L.; Nicotra, F. Sweet and salted: Sugars meet hydroxyapatite. Synlett 2011,13, 1845–1848. 147. Skinner, J.C.; Presser, H.J.; Scott, R.P.; Wilson, A.D. Adhesion of carboxylate cements to hydroxyapatite. I. The effect of the structure of aliphatic carboxylates on their uptake by hydroxyapatite. Biomaterials 1986,7, 438–440. [CrossRef] 148. Scott, R.P.; Jackson, A.M.; Wilson, A.D. Adhesion of carboxylate cements to hydroxyapatite. II. Adsorption of aromatic carboxylates. Biomaterials 1990,11, 341–344. [CrossRef] [PubMed] 149. Ellis, J.; Scott, R.P.; Jackson, A.M.; Wilson, A.D. Adhesion of carboxylate cements to hydroxyapatite. III. Adsorption of poly(alkenoic acids). Biomaterials 1990,11, 379–384. [CrossRef] 150. Tenhuisen, K.S.; Brown, P.W.; Reed, C.S.; Allcock, H.R. Low temperature synthesis of a self-assembling composite: Hydroxyapatitepoly[bis(sodium carboxylatophenoxy)phosphazene]. J. Mater. Sci. Mater. Med. 1996,7, 673–682. [CrossRef] Molecules 2024,29, 4479 32 of 39 151. Soheilmoghaddam, M.; Padmanabhan, H.; Cooper-White, J.J. Biomimetic cues from poly(lacticco -glycolic acid)/hydroxyapatite nano-fibrous scaffolds drive osteogenic commitment in human mesenchymal stem cells in the absence of osteogenic factor supplements. Biomater. Sci. 2020,8, 5677–5689. [CrossRef] 152. Placente, D.; Benedini, L.A.; Baldini, M.; Laiuppa, J.A.; Santillán, G.E.; Messina, P.V. Multi-drug delivery system based on lipid membrane mimetic coated nano-hydroxyapatite formulations. Int. J. Pharm. 2018,548, 559–570. [CrossRef] [PubMed] 153. Lett, J.A.; Sundareswari, M.; Ravichandran, K.; Latha, M.B.; Sagadevan, S.; Bin Johan, M.R. Tailoring the morphological features of sol-gel synthesized mesoporous hydroxyapatite using fatty acids as an organic modifier. RSC Adv. 2019,9, 6228–6240. [CrossRef] [PubMed] 154. Qi, M.; Yao, S.; Wang, W.; Qi, L.; Wang, Y.; Zhang, H. Hydroxyapatite nanomaterials with tailored length regulated by different fatty acids. Micro Nano Lett. 2021,16, 649–655. [CrossRef] 155. Wang, Y.C.; Wang, J.N.; Xiao, G.Y.; Huang, S.Y.; Xu, W.L.; Yan, W.X.; Lu, Y.P. Investigation of various fatty acid surfactants on the microstructure of flexible hydroxyapatite nanofibers. CrystEngComm 2021,23, 7049–7055. [CrossRef] 156. Odutuga, A.A.; Prout, R.E.S.; Hoare, R.J. Hydroxyapatite precipitation in vitro by lipids extracted from mammalian hard and soft tissues. Arch. Oral Biol. 1975,20, 311–316. [CrossRef] 157. Wuthier, R.E.; Eanes, E.D. Effect of phospholipids on the transformation of amorphous calcium phosphate to hydroxyapatite in vitro. Calcif. Tissue Res. 1975,19, 197–210. [CrossRef] 158. Boskey, A.L.; Posner, A.S. The role of synthetic and bone extracted Ca-phospholipid-PO 4 complexes in hydroxyapatite formation. Calcif. Tissue Res. 1977,23, 251–258. [CrossRef] 159. Verma, G.; Shetake, N.G.; Pandrekar, S.; Pandey, B.; Hassan, P.; Priyadarsini, K. Development of surface functionalized hydroxyapatite nanoparticles for enhanced specificity towards tumor cells. Eur. J. Pharm. Sci. 2020,144, 105206. [CrossRef] 160. Baeza, A.; Izquierdo-Barba, I.; Vallet-Regí, M. Biotinylation of silicon-doped hydroxyapatite: A new approach to protein fixation for bone tissue regeneration. Acta Biomater. 2010,6, 743–749. [CrossRef] [PubMed] 161. Web of Science. Available online: https://www.webofscience.com/wos/ (accessed on 11 July 2024). 162. Cartier, P. Les constituants mineraux des tissus calcifies. 1.La structure minerale de los, de la dentine et du cement. Bull. Soc. Chim. Biol. 1948,30, 65–73. 163. Uneyama, H.; Kobayashi, H.; Tonouchi, N. New Functions and potential applications of amino acids. In Amino Acid Fermentation; Yokota, A., Ikeda, M., Eds.; Advances in Biochemical Engineering/Biotechnology; Springer: Tokyo, Japan, 2016; Volume 159. 164. Flores, E.; Martinez, E.; Rodriguez, L.E.; Weber, J.M.; Khodayari, A.; Vandervelde, D.G.; Barge, L.M. Effects of amino acids on phosphate adsorption onto iron (oxy)hydroxide minerals under early earth conditions. ACS Earth Space Chem. 2021,5, 1048–1057. [CrossRef] 165. Kay, M.I.; Young, R.A.; Posner, A.S. Crystal structure of hydroxyapatite. Nature 1964,204, 1050. [CrossRef] [PubMed] 166. Fleet, M.E. Infrared spectra of carbonate apatites: ν2-region bands. Biomaterials 2009,30, 1473–1481. [CrossRef] 167. Pham Minh, D.; Tran, N.D.; Nzihou, A.; Sharrock, P. Carbonate-containing apatite (CAP) synthesis under moderate conditions starting from calcium carbonate and orthophosphoric acid. Mater. Sci. Eng. C 2013,33, 2971–2980. [CrossRef] 168. Grunenwald, A.; Keyser, C.; Sautereau, A.M.; Crubézy, E.; Ludes, B.; Drouet, C. Revisiting carbonate quantification in apatite (bio)minerals: A validated FTIR methodology. J. Archaeol. Sci. 2014,49, 134–141. [CrossRef] 169. Hayashi, K.; Kishida, R.; Tsuchiya, A.; Ishikawa, K. Transformable carbonate apatite chains as a novel type of bone graft. Adv. Healthc. Mater. 2024,13, e2303245. [CrossRef] 170. Boanini, E.; Torricelli, P.; Gazzano, M.; Giardino, R.; Bigi, A. Nanocomposites of hydroxyapatite with aspartic acid and glutamic acid and their interaction with osteoblast-like cells. Biomaterials 2006,27, 4428–4433. [CrossRef] 171. Indira, J.; Malathi, K.S. Comparison of template mediated ultrasonic and microwave irradiation method on the synthesis of hydroxyapatite nanoparticles for biomedical applications. Mater. Today Proc. 2021,51, 1765–1769. [CrossRef] 172. Jahromi, M.T.; Cerruti, M. Amino acid/ion aggregate formation and their role in hydroxyapatite precipitation. Cryst. Growth Des. 2015,15, 1096–1104. [CrossRef] 173. Moussa, S.B.; Bachouâ, H.; Gruselle, M.; Beaunier, P.; Flambard, A.; Badraoui, B. Hybrid organic-inorganic materials based on hydroxyapatite structure. J. Solid State Chem. 2017,248, 171–177. [CrossRef] 174. Krukowski, S.; Lysenko, N.; Kolodziejski, W. Synthesis and characterization of nanocrystalline composites containing calcium hydroxyapatite and glycine. J. Solid State Chem. 2018,264, 59–67. [CrossRef] 175. Chen, Z.; Fu, Y.; Cai, Y.; Yao, J. Effect of amino acids on the crystal growth of hydroxyapatite. Mater. Lett. 2012,68, 361–363. [CrossRef] 176. Bigi, E.A.; Boanini, M.; Gazzano, M.A.; Kordecki, K. Rubini. Microstructural investigation of hydroxyapatite-polyelectrolyte composites. J. Mater. Chem. 2004,14, 274–279. [CrossRef] 177. Jack, K.S.; Vizcarra, T.G.; Trau, M. Characterization and surface properties of amino acid-modified, carbonate-containing hydroxyapatite particles. Langmuir 2007,23, 12233–12242. [CrossRef] [PubMed] 178. Gonzalez-McQuire, R.; Chane-Ching, J.Y.; Vignaud, E.; Lebuglec, A.; Manna, S. Synthesis and characterization of amino acid-functionalized hydroxyapatite nanorods. J. Mater. Chem. 2004,14, 2277–2281. [CrossRef] 179. Koutsopoulos, S.; Dalas, E. The effect of acidic amino acids on hydroxyapatite crystallization. J. Cryst. Growth 2000,217, 410–415. [CrossRef] Molecules 2024,29, 4479 33 of 39 180. Koutsopoulos, S.; Dalas, E. Hydroxyapatite crystallization in the presence of serine, tyrosine and hydroxyproline amino acids with polar side groups. J. Cryst. Growth 2000,216, 443–449. [CrossRef] 181. Koutsopoulos, S.; Dalas, E. The crystallization of hydroxyapatite in the presence of lysine. J. Colloid Int. Sci. 2000,231, 207–212. [CrossRef] 182. Koutsopoulos, S.; Dalas, E. Inhibition of hydroxyapatite formation in aqueous solutions by amino acids with hydrophobic side groups. Langmuir 2000,16, 6739–6744. [CrossRef] 183. Koutsopoulos, S.; Dalas, E. Hydroxyapatite crystallization in the presence of amino acids with uncharged polar side groups: glycine, cysteine, cystine, and glutamine. Langmuir 2001,17, 1074–1079. [CrossRef] 184. Spanos, N.; Klepetsanis, P.G.; Koutsoukos, P.G. Model studies on the interaction of amino acids with biominerals: The effect of L-serine at the hydroxyapatite-water interface. J. Colloid Interface Sci. 2001,236, 260–265. [CrossRef] 185. Dalas, E.; Malkaj, P.; Vasileiou, Z.; Kanellopoulou, D.G. The effect of Leucine on the crystal growth of calcium phosphate. J. Mater. Sci. Mater. Med. 2008,19, 277–282. [CrossRef] [PubMed] 186. Tavafoghi, M.; Cerruti, M. The role of amino acids in hydroxyapatite mineralization. J. R. Soc. Interface 2016,13, 20160462. [CrossRef] 187. Hoff, S.E.; Liu, J.; Heinz, H. Binding mechanism and binding free energy of amino acids and citrate to hydroxyapatite surfaces as a function of crystallographic facet, pH, and electrolytes. J. Colloid Interface Sci. 2022,605, 685–700. [CrossRef] 188. Kresak, M.; Moreno, E.C.; Zahradnik, R.T.; Hay, D.I. Adsorption of amino acids onto hydroxyapatite. J. Colloid Interface Sci. 1977, 59, 283–292. [CrossRef] 189. Sharma, R.; Pandey, R.R.; Gupta, A.A.; Kar, S.; Dhayal, M. In situ amino acid functionalization and microstructure formation of hydroxyapatite nanoparticles synthesized at different pH by precipitation route. Mater. Chem. Phys. 2012,133, 718–725. [CrossRef] 190. Ratnatilaka Na Bhuket, P.; Li, Y.; Yu, S.M. From collagen mimetics to collagen hybridization and back. Acc. Chem. Res. 2024,57, 1649–1657. [CrossRef] 191. Saurav, S.; Sharma, P.; Kumar, A.; Tabassum, Z.; Girdhar, M.; Mamidi, N.; Mohan, A. Harnessing natural polymers for nanoscaffolds in bone tissue engineering: A comprehensive overview of bone disease treatment. Curr. Issues Mol. Biol. 2024,46, 585–611. [CrossRef] 192. Kawasaki, A.; Kawano, K.; Terada, Y.; Hirayasu, R. Interaction of hydroxyapatite with amino acids. J. Jpn. Prostodonthic Soc. 1989, 33, 522–527. [CrossRef] [PubMed] 193. El Shafei, G.M.S.; Moussa, N.A. Adsorption of some essential amino acids on hydroxyapatite. J. Colloid Interface Sci. 2001,238, 160–166. [CrossRef] 194. Chauhan, N.; Singh, Y. L-histidine controls the hydroxyapatite mineralization with plate-like morphology: Effect of concentration and media. Mater. Sci. Eng. C 2021,120, 111669. [CrossRef] [PubMed] 195. Gorbunoff, M.J.; Timasheff, S.N. The interaction of proteins with hydroxyapatite. III. Mechanism. Anal. Biochem. 1984,136, 440–445. [CrossRef] 196. El Rhilassi, A.; Mourabet, M.; Bennani-Ziatni, M.; El Hamri, R.; Taitai, A. Interaction of some essential amino acids with synthesized poorly crystalline hydroxyapatite. J. Saudi Chem. Soc. 2016,20, S632–S640. [CrossRef] 197. El Rhilassi, A.; Oukkass, O.; Bennani-Ziatni, M. Isotherms, kinetics, and thermodynamics of methionine adsorption onto poorly crystalline hydroxyapatite with different Ca/P ratios. Curr. Chem. Lett. 2023,12, 781–798. [CrossRef] 198. Gorbunoff, M.J. The interaction of proteins with hydroxyapatite. I. Role of protein charge and structure. Anal. Biochem. 1984,136, 425–432. [CrossRef] 199. Wassell, D.T.H.; Hall, R.C.; Embery, G. Adsorption of bovine serum albumin onto hydroxyapatite. Biomaterials 1995,16, 697–702. [CrossRef] 200. Gorbunoff, M.J. The interaction of proteins with hydroxyapatite. II. Role of acidic and basic groups. Anal. Biochem. 1984,136, 433–439. [CrossRef] 201. Kollath, V.O.; den Broeck, F.V.; Fehér, K.; Martins, J.C.; Luyten, J.; Traina, K.; Mullens, S.; Cloots, R. A modular approach to study protein adsorption on surface modified hydroxyapatite. Chem. Eur. J. 2015,21, 10497–10505. [CrossRef] 202. Victor, S.P.; Sharma, C.P. Tryptophan complexed hydroxyapatite nanoparticles for immunoglobulin adsorption. J. Mater. Sci. Mater. Med. 2011,22, 2219–2229. [CrossRef] [PubMed] 203. Uddin, M.H.; Matsumoto, T.; Ishihara, S.; Nakahira, A.; Okazaki, M.; Sohmura, T. Apatite containing aspartic acid for selective protein loading. J. Dent. Res. 2010,89, 488–492. [CrossRef] [PubMed] 204. Holden, D.T.; Morato, N.M.; Cooks, R.G. Aqueous microdroplets enable abiotic synthesis and chain extension of unique peptide isomers from free amino acids. Proc. Natl. Acad. Sci. USA 2022,119, e2212642119. [CrossRef] 205. Pountos, I.; Panteli, M.; Lampropoulos, A.; Jones, E.; Calori, G.M.; Giannoudis, P.V. The role of peptides in bone healing and regeneration: A systematic review. BMC Med. 2016,14, 103. [CrossRef] 206. Hernández-Ledesma, B.; Hsieh, C.C. Chemopreventive role of food-derived proteins and peptides: A review. Crit. Rev. Food Sci. Nutr. 2017,57, 2358–2376. [CrossRef] [PubMed] 207. Cicero, A.F.G.; Fogacci, F.; Colletti, A. Potential role of bioactive peptides in prevention and treatment of chronic diseases: A narrative review. Br. J. Pharmacol. 2017,174, 1378–1394. [CrossRef] 208. Owji, H.; Nezafat, N.; Negahdaripour, M.; Hajiebrahimi, A.; Ghasemi, Y. A comprehensive review of signal peptides: Structure, roles, and applications. Eur. J. Cell Biol. 2018,97, 422–441. [CrossRef] Molecules 2024,29, 4479 34 of 39 209. Wang, X.; Xu, J.; Kang, Q. Neuromodulation of bone: Role of different peptides and their interactions (review). Mol. Med. Rep. 2021,23, 320. [CrossRef] 210. Pérez, J.J. Exploiting knowledge on structure-activity relationships for designing peptidomimetics of endogenous peptides. Biomedicines 2021,9, 651–669. [CrossRef] 211. Kastin, A.J. (Ed.) Handbook of Biological Active Peptides; Elsevier: Amsterdam, The Netherlands, 2006. 212. Zhao, N.; Yan, L.; Zhao, X.; Chen, X.; Li, A.; Zheng, D.; Zhou, X.; Dai, X.; Xu, F.J. Versatile types of organic/inorganic nanohybrids: From strategic design to biomedical applications. Chem. Rev. 2019,119, 1666–1762. [CrossRef] 213. Li, Q.; Wang, Y.; Zhang, G.; Su, R.; Qi, W. Biomimetic mineralization based on self-assembling peptides. Chem. Soc. Rev. 2023,52, 1549–1590. [CrossRef] [PubMed] 214. Drouet, C.; Al-Kattan, A.; Choimet, M.; Tourrette, A.; Santran, V.; Dexpert-Ghys, J.; Pipy, B.; Brouillet, F.; Tourbin, M. Biomimetic apatite-based functional nanoparticles as promising newcomers in nanomedicine: Overview of 10 years of initiatory research. J. Gen. Pract. Med. Diagn. 2015,1, 1–9. [CrossRef] [PubMed] 215. Miragoli, M.; Ceriotti, P.; Iafisco, M.; Vacchiano, M.; Salvarani, N.; Alogna, A.; Carullo, P.; Ramirez-Rodríguez, G.B.; Patrício, T.; Esposti, L.D.; et al. Inhalation of peptide-loaded nanoparticles improves heart failure. Sci. Transl. Med. 2018,10, eaan6205. [CrossRef] [PubMed] 216. Iafisco, M.; Carella, F.; Degli Esposti, L.; Adamiano, A.; Catalucci, D.; Modica, J.; Bragonzi, A.; Vitali, A.; Torelli, R.; Sanguinetti, M.; et al. Biocompatible antimicrobial colistin loaded calcium phosphate nanoparticles for the counteraction of biofilm formation in cystic fibrosis related infections. J. Inorg. Biochem. 2022,230, 111751. [CrossRef] [PubMed] 217. Capriotti, L.A.; Beebe, T.P.; Schneider, J.P. Hydroxyapatite surface-induced peptide folding. J. Am. Chem. Soc. 2007,129, 5281–5287. [CrossRef] 218. Fujisawa, R.; Mizuno, M.; Nodasaka, Y.; Kuboki, Y. Attachment of osteoblastic cells to hydroxyapatite crystals by a synthetic peptide (Glu 7 -Pro-Arg-Gly-Asp-Thr) containing two functional sequences of bone sialoprotein. Matrix Biol. 1997,16, 21–28. [CrossRef] 219. Ling, C.; Zhao, W.; Wang, Z.; Chen, J.; Ustriyana, P.; Gao, M.; Sahai, N. Structure-activity relationships of hydroxyapatite-binding peptides. Langmuir 2020,36, 2493–2742. [CrossRef] 220. Smith, G.P. Filamentous fusion phage-novel expression vectors that display cloned antigens on the virion surface. Science 1985, 228, 1315–1317. [CrossRef] [PubMed] 221. Burton, D.R. Phage display. Immunotechnology 1995,1, 87–94. [CrossRef] 222. Smith, G.P.; Petrenko, V.A. Phage display. Chem. Rev. 1997,97, 391–410. [CrossRef] 223. Addison, W.N.; Miller, S.J.; Ramaswamy, J.; Mansouri, A.; Kohn, D.H.; McKee, M.D. Phosphorylation-dependent mineral-type specificity for apatite-binding peptide sequences. Biomaterials 2010,31, 9422–9430. [CrossRef] [PubMed] 224. Zhao, W.; Xu, Z.; Cui, Q.; Sahai, N. Predicting the structure-activity relationship of hydroxyapatite-binding peptides by enhancedsampling molecular simulation. Langmuir 2016,32, 7009–7022. [CrossRef] 225. Do Nascimento, M.; Almeida, A.R.S.; Hirata, M.C.; Elzubair, A.; da Rocha, D.N.; da Silva, M.H.P. Biomineralization of calcium phosphates functionalized with hydroxyapatite-binding peptide. J. Mech. Behav. Biomed. Mater. 2023,146, 106082. [CrossRef] 226. Guérin, M.; Lebrun, A.; Kuhn, L.; Azaïs, T.; Laurent, G.; Marsan, O.; Drouet, C.; Subra, G. One-pot synthesis of bioinspired peptide-decorated apatite nanoparticles for nanomedicine. Small 2024,20, e2306358. [CrossRef] 227. Carpino, L.A.; Han, G.Y. 9-Fluorenylmethoxycarbonyl function, a new base-sensitive amino-protecting group. J. Am. Chem. Soc. 1970,92, 5748–5749. [CrossRef] 228. DeGrado, W.F.; Lear, J.D. Induction of peptide conformation at apolar water interfaces. 1. A study with model peptides of defined hydrophobic periodicity. J. Am. Chem. Soc. 1985,107, 7684–7689. 229. Xia, J.; Wang, W.; Jin, X.; Zhao, J.; Chen, J.; Li, N.; Xiao, S.; Lin, D.; Song, Z. Effects of chain lengths and backbone chirality on the bone-targeting ability of poly(glutamic acid)s. Biomater. Sci. 2024,12, 3896–3904. [CrossRef] 230. Bernardi, G.; Cook, W.H. Separation and characterization of the two high density lipoproteins of egg yolk, α - and β -lipovitellin. BBA Biochim. Biophys. Acta 1960,44, 96–105. [CrossRef] 231. Bernardi, G.; Kawasaki, T. Chromatography of polypeptides and proteins on hydroxyapatite columns. BBA Protein Struct. 1968, 160, 301–310. [CrossRef] 232. Kimura, R.; Noda, D.; Liu, Z.; Shi, W.; Akutsu, R.; Tagaya, M. Biological surface layer formation on bioceramic particles for protein adsorption. Biomimetics 2024,9, 347. [CrossRef] 233. Ricard-Blum, S. The collagen family. Cold Spring Harb. Perspect. Biol. 2011,3, a004978. [CrossRef] [PubMed] 234. Palmer, L.C.; Newcomb, C.J.; Kaltz, S.R.; Spoerke, E.D.; Stupp, S.I. Biomimetic systems for hydroxyapatite mineralization inspired by bone and enamel. Chem. Rev. 2008,108, 4754–4783. [CrossRef] [PubMed] 235. Iijima, K.; Hashizume, M. Utilization of proteins and peptides to create organic-hydroxyapatite hybrids. Protein Pept. Lett. 2018, 25, 25–33. [CrossRef] [PubMed] 236. De Yoreo, J.J.; Vekilov, P.G. Principles of crystal nucleation and growth. Rev. Mineral. Geochem. 2003,54, 57–93. [CrossRef] 237. Nishimoto, S.K.; Araki, N.; Robinson, F.D.; Waite, J.H. Discovery of bone gamma-carboxyglutamic acid protein in mineralized scales. The abundance and structure of Lepomis macrochirus bone gamma-carboxyglutamic acid protein. J. Biol. Chem. 1992,267, 11600–11605. [CrossRef] Molecules 2024,29, 4479 35 of 39 238. Rico-Llanos, G.A.; Borrego-González, S.; Moncayo-Donoso, M.; Becerra, J.; Visser, R. Collagen type I biomaterials as scaffolds for bone tissue engineering. Polymers 2021,13, 599. [CrossRef] 239. Cui, P.; Shao, T.; Liu, W.; Li, M.; Yu, M.; Zhao, W.; Song, Y.; Ding, Y.; Liu, J. Advanced review on type II collagen and peptide: Preparation, functional activities and food industry application. Crit. Rev. Food Sci. Nutr. 2023,2023., 1–18. [CrossRef] 240. McCormick, R.J. The flexibility of the collagen compartment of muscle. Meat Sci. 1994,36, 79–91. [CrossRef] 241. Abreu-Velez, A.M.; Howard, M.S. Collagen IV in normal skin and in pathological processes. N. Am. J. Med. Sci. 2012,4, 1–8. [CrossRef] 242. Massoudi, D.; Malecaze, F.; Galiacy, S.D. Collagens and proteoglycans of the cornea: Importance in transparency and visual disorders. Cell Tissue Res. 2016,363, 337–349. [CrossRef] 243. Boskey, A.L. Hydroxyapatite formation in a dynamic collagen gel system: Effects of type I collagen, lipids, and proteoglycans. J. Phys. Chem. 1989,93, 1628–1633. [CrossRef] 244. Bradt, J.H.; Mertig, M.; Teresiak, A.; Pompe, W. Biomimetic mineralization of collagen by combined fibril assembly and calcium phosphate formation. Chem. Mater. 1999,11, 2694–2701. [CrossRef] 245. Qu, H.; Xia, Z.; Knecht, D.A.; Wei, M. Synthesis of dense collagen/apatite composites using a biomimetic method. J. Am. Ceram. Soc. 2008,91, 3211–3215. [CrossRef] 246. Rhee, S.H.; Lee, J.D.; Tanaka, J. Nucleation of hydroxyapatite crystal through chemical interaction with collagen. J. Am. Ceram. Soc. 2000,83, 2890–2892. [CrossRef] 247. Sun, Y.; Wang, Y.; Ji, C.; Ma, J.; He, B. The impact of hydroxyapatite crystal structures and protein interactions on bone’s mechanical properties. Sci. Rep. 2024,14, 9786. [CrossRef] 248. Tan, X.; Xue, Z.; Zhu, H.; Wang, X.; Xu, D. How charged amino acids regulate nucleation of biomimetic hydroxyapatite nanoparticles on the surface of collagen mimetic peptides: Molecular dynamics and free energy investigations. Cryst. Growth Des. 2020,20, 4561–4572. [CrossRef] 249. Li, X.; Chang, J. Preparation of bone-like apatite-collagen nanocomposites by a biomimetic process with phosphorylated collagen. J. Biomed. Mater. Res. Part A 2008,85, 293–300. [CrossRef] 250. Li, D.; He, J.; Cheng, W.; Wu, Y.; Hu, Z.; Tian, H.; Huang, Y. Redox-responsive nanoreservoirs based on collagen end-capped mesoporous hydroxyapatite nanoparticles for targeted drug delivery. J. Mater. Chem. B 2014,2, 6089–6096. [CrossRef] 251. Bolander, M.E.; Young, M.F.; Fisher, L.W.; Yamada, Y.; Termine, J.D. Osteonectin cDNA sequence reveals potential binding regions for calcium and hydroxyapatite and shows homologies with both a basement membrane protein (SPARC) and a serine proteinase inhibitor (ovomucoid). Proc. Natl. Acad. Sci. USA 1988,85, 2919–2923. [CrossRef] 252. George, A.; Veis, A. Phosphorylated proteins and control over apatite nucleation, crystal growth, and inhibition. Chem. Rev. 2008, 108, 4670–4693. [CrossRef] 253. Robin, M.; Tovani, C.B.; Krafft, J.-M.; Costentin, G.; Azaïs, T.; Nassif, N. The concentration of bone-related organic additives drives the pathway of apatite formation. Cryst. Growth Des. 2021,21, 3994–4004. [CrossRef] 254. Bromley, K.M.; Kiss, A.S.; Lokappa, S.B.; Lakshminarayanan, R.; Fan, D.; Ndao, M.; Evans, J.S.; Moradian-Oldak, J. Dissecting amelogenin protein nanospheres: Characterization of metastable oligomers. J. Biol. Chem. 2011,286, 34643–34653. [CrossRef] 255. Bai, Y.; Yu, Z.; Ackerman, L.; Zhang, Y.; Bonde, J.; Li, W.; Cheng, Y.; Habelitz, S. Protein nanoribbons template enamel mineralization. Proc. Natl. Acad. Sci. USA 2020,117, 19201–19208. [CrossRef] 256. Tao, J.; Shin, Y.; Jayasinha, R.; Buchko, G.W.; Burton, S.D.; Dohnalkova, A.C.; Wang, Z.; Shaw, W.J.; Tarasevich, B.J. The energetic basis for hydroxyapatite mineralization by amelogenin variants provides insights into the origin of amelogenesis imperfecta. Proc. Natl. Acad. Sci. USA 2019,116, 13867–13872. [CrossRef] [PubMed] 257. Belcarz, A.; Ginalska, G.; Zalewska, J.; Rzeski, W.; ´ Slósarczyk, A.; Kowalczuk, D.; Godlewski, P.; Nied´zwiadek, J. Covalent coating of hydroxyapatite by keratin stabilizes gentamicin release. J. Biomed. Mater. Res. Part B Appl. Biomater. 2009,89B, 102–113. [CrossRef] 258. Matsumoto, R.; Yoshii, T.; Egawa, S.; Hashimoto, M.; Hirai, T.; Inose, H.; Oh, Y.; Fujita, K.; Okawa, A.; Sotome, S. Local suppression effect of paclitaxel-impregnated hydroxyapatite/collagen on breast cancer bone metastasis in a rat model. Spine Surg. Relat. Res. 2022,6, 294–302. [CrossRef] 259. Li, G.; Tang, D.; Wang, D.; Xu, C.; Liu, D. Effective chemotherapy of lung cancer using bovine serum albumin-coated hydroxyapatite nanoparticles. Med. Sci. Monit. 2020,26, e919716. [CrossRef] [PubMed] 260. Iung, J.; Doyen, A.; Remondetto, G.; Pouliot, Y.; Brisson, G. The affinity of milk fat globule membrane fragments and buttermilk proteins to hydroxyapatite. J. Dairy Sci. 2024,107, 4235–4247. 261. Qin, D.; Wang, N.; You, X.G.; Zhang, A.D.; Chen, X.G.; Liu, Y. Collagen-based biocomposites inspired by bone hierarchical structures for advanced bone regeneration: Ongoing research and perspectives. Biomater. Sci. 2022,10, 318–353. [CrossRef] 262. Schickle, K.; Zurlinden, K.; Bergmann, C.; Lindner, M.; Kirsten, A.; Laub, M.; Telle, R.; Jennissen, H.; Fischer, H. Synthesis of novel tricalcium phosphate-bioactive glass composite and functionalization with rhBMP-2. J. Mater. Sci.: Mater. Med. 2011,22, 763–771. [CrossRef] 263. Cuylear, D.L.; Elghazali, N.A.; Kapila, S.D.; Desai, T.A. Calcium phosphate delivery systems for regeneration and biomineralization of mineralized tissues of the craniofacial complex. Mol. Pharm. 2023,20, 810–828. [CrossRef] [PubMed] 264. Ripamonti, U.; Duarte, R. Mechanistic insights into the spontaneous induction of bone formation. Biomater. Adv. 2024,158, 213795. [CrossRef] [PubMed] Molecules 2024,29, 4479 36 of 39 265. Fu, C.; Wang, Z.; Zhou, X.; Hu, B.; Li, C.; Yang, P. Protein-based bioactive coatings: From nanoarchitectonics to applications. Chem. Soc. Rev. 2024,53, 1514–1551. [CrossRef] [PubMed] 266. Yuca, E.; Karatas, A.Y.; Seker, U.O.S.; Gungormus, M.; Dinler-Doganay, G.; Sarikaya, M.; Tamerler, C. In vitro labeling of hydroxyapatite minerals by an engineered protein. Biotechnol. Bioeng. 2011,108, 1021–1030. [CrossRef] 267. Fernane, F.; Mecherri, M.O.; Sharrock, P.; Fiallo, M.; Sipos, R. Hydroxyapatite interactions with copper complexes. Mater. Sci. Eng. C2010,30, 1060–1064. [CrossRef] 268. Mou, P.; Peng, H.; Zhou, L.; Li, L.; Li, H.; Huang, Q. A novel composite scaffold of Cu-doped nano calcium-deficient hydroxyapatite/multi-(amino acid) copolymer for bone tissue regeneration. Int. J. Nanomed. 2019,14, 3331–3343. [CrossRef] 269. Honda, Y.; Anada, T.; Morimoto, S.; Suzuki, O. Labile Zn ions on octacalcium phosphate-derived Zn-containing hydroxyapatite surfaces. Appl. Surf. Sci. 2013,273, 343–348. [CrossRef] 270. Gangu, K.K.; Maddila, S.; Maddila, S.N.; Jonnalagadda, S.B. Nanostructured samarium doped fluorapatites and their catalytic activity towards synthesis of 1,2,4-triazoles. Molecules 2016,21, 1281. [CrossRef] 271. Gangu, K.K.; Maddila, S.; Maddila, S.N.; Jonnalagadda, S.B. Efficient synthetic route for thio-triazole derivatives catalyzed by iron doped fluorapatite. Res. Chem. Intermed. 2017,43, 1793–1811. [CrossRef] 272. Gangu, K.K.; Maddila, S.N.; Maddila, S.; Jonnalagadda, S.B. A study on behavioral influence of glutamic acid and histidine on morphology and fluorescence activity of cadmium-doped fluorapatite. J. Alloys Compd. 2017,690, 817–824. [CrossRef] 273. Chrissanthopoulos, A.; Klouras, N.; Ntala, C.; Sevastos, D.; Dalas, E. Inhibition of hydroxyapatite formation in the presence of titanocene–aminoacid complexes: An experimental and computational study. J. Mater. Sci. Mater. Med. 2015,26, 15. [CrossRef] [PubMed] 274. Huan, W.; Xing, M.; Cheng, C.; Li, J. Facile fabrication of magnetic metal-organic framework nanofibers for specific capture of phosphorylated peptides. ACS Sustain. Chem. Eng. 2019,7, 2245–2254. [CrossRef] 275. Farinas, C.S.; Reis, P.C.; Ferraz, H.C.; Salim, V.M.M.; Alves, T.L.M. Adsorption of myoglobin onto hydroxyapatite modified with metal ions. Adsorpt. Sci. Technol. 2007,25, 717–727. [CrossRef] 276. Kalidas, S.; Sumathi, S. Copper substituted hydroxyapatite reinforced gelatin/polyvinyl alcohol/silk fibre-based scaffold for bone tissue engineering application. Mater. Chem. Phys. 2024,320, 129410. [CrossRef] 277. Dowd, T.L.; Rosen, J.F.; Gundberg, C.M.; Gupta, R.K. The displacement of calcium from osteocalcin at submicromolar concentrations of free lead. BBA Mol. Basis Dis. 1994,1226, 131–137. [CrossRef] [PubMed] 278. Vukomanovi´c, M.; Logar, M.; Škapin, S.D.; Suvorov, D. Hydroxyapatite/gold/arginine: Designing the structure to create antibacterial activity. J. Mater. Chem. B 2014,2, 1557–1564. [CrossRef] 279. Cao, B.; Yang, M.; Mao, C. Phage as a genetically modifiable supramacromolecule in chemistry, materials and medicine. Acc. Chem. Res. 2016,49, 1111–1120. [CrossRef] 280. Rautaray, D.; Mandal, S.; Sastry, M. Synthesis of hydroxyapatite crystals using amino acid-capped gold nanoparticles as a scaffold. Langmuir 2005,21, 5185–5191. [CrossRef] 281. Meisel, C.L.; Bainbridge, P.; Mitsouras, D.; Wong, J.Y. Targeted nanoparticle binding to hydroxyapatite in a high serum environment for early detection of heart disease. ACS Appl. Nano Mater. 2018,1, 4927–4939. [CrossRef] 282. Zhang, O.L.; Niu, J.Y.; Yin, I.X.; Yu, O.Y.; Mei, M.L.; Chu, C.H. Bioactive materials for caries management: A literature review. Dent. J. 2023,11, 59. [CrossRef] 283. Pedersen, S.Ø.; Støchkel, K.; Byskov, C.S.; Baggesen, L.M.; Nielsen, S.B. Gas-phase spectroscopy of protonated adenine, adenosine 5´-monophosphate and monohydrated ions. Phys. Chem. Chem. Phys. 2013,15, 19748–19752. [CrossRef] [PubMed] 284. Levene, P.A.; Bass, L.W.; Simms, H.S. The ionization of pyrimidines in relation to the structure of pyrimidine nucleosides. J. Biol. Chem. 1926,70, 229–241. [CrossRef] 285. Wierzchowski, K.L.; Litonska, E.; Shugar, D. Infrared and ultraviolet studies on the tautomeric equilibria in aqueous medium between monoanionic species of uracil, thymine, 5-fluorouracil, and other 2,4-diketopyrimidines. J. Am. Chem. Soc. 1965,87, 4621–4629. [CrossRef] 286. Sigel, H. Acid-base properties of purine residues and the effect of metal ions: Quantification of rare nucleobase tautomers. Pure Appl. Chem. 2004,76, 1869–1886. [CrossRef] 287. Lippert, B. Alterations of nucleobase pK a values upon metal coordination: Origins and consequences. In Progress in Inorganic Chemistry; Karlin, K.D., Ed.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2005; Volume 54, pp. 385–447. 288. Roy, B.; Depaix, A.; Perigaud, C.; Peyrottes, S. Recent trends in nucleotide synthesis. Chem. Rev. 2016,116, 7854–7897. [CrossRef] 289. Mucha, A.; Knobloch, B.; Je˙ zowska-Bojczuk, M.; Kozłowski, H.; Sigel, R.K.O. Comparison of the acid–base properties of ribose and 2′-deoxyribose nucleotides. Chem. Eur. J. 2008,14, 6663–6671. [CrossRef] 290. Sigel, H.; Massoud, S.S.; Nicolas, A.C. Comparison of the extent of macrochelate formation in complexes of divalent metal ions with guanosine (GMP 2- ), inosine (IMP 2- ), and adenosine 5 ′ -monophosphate (AMP 2- ). The crucial role of N-7 basicity in metal ion-nucleic base recognition. J. Am. Chem. Soc. 1994,116, 2958–2971. [CrossRef] 291. Sigel, H.; Lippert, B. The effects of N7-coordinated cis-diammine-platinum(II) on the acid-base properties of guanine derivatives. Pure Appl. Chem. 1998,70, 845–854. [CrossRef] Molecules 2024,29, 4479 37 of 39 292. Song, B.; Feldmann, G.; Bastian, M.; Lippert, B.; Sigel, H. Acid-base and metal ion-binding properties of 2 ′ -deoxycytidine 5 ′ - monophosphate (dCMP 2- ) alone and coordinated cis-diammine-platinum(II). Formation of mixed metal ion nucleotide complexes. Inorg. Chim. Acta 1995,235, 99–109. [CrossRef] 293. Massoud, S.S.; Sigel, H. Metal ion coordinating properties of pyrimidine-nucleoside 5 ′ -monophosphates (CMP, UMP, TMP) and of simple phosphate monoesters, including D-ribose 5-monophosphate. Establishment of relations between complex stability and phosphate basicity. Inorg. Chem. 1988,27, 1447–1453. [CrossRef] 294. Bianchi, E.M.; Griesser, R.; Sigel, H. Influence of decreasing solvent polarity (1,4-dioxane/water mixtures) on the acid-base and copper(II)-binding properties of guanosine 5′-diphosphate. Helv. Chim. Acta 2005,88, 406–425. [CrossRef] 295. Bianchi, E.M.; Sajadi, S.A.A.; Song, B.; Sigel, H. Stabilities and isomeric equilibria in aqueous solution of monomeric metal ion complexes of adenosine 5 ′ -diphosphate (ADP 3- ) in comparison with those of adenosine 5 ′ -monophosphate (AMP 2- ). Chem. Eur. J. 2003,9, 881–892. [CrossRef] 296. Sajadi, S.A.A.; Song, B.; Gregáˇn, F.; Sigel, H. Acid-base and metal ion-coordinating properties of pyrimidine-nucleoside 5 ′ - diphosphates (CDP, UDP, dTDP) and of several simple diphosphate monoesters. Establishment of relations between complex stability and diphosphate basicity. Inorg. Chem. 1999,38, 439–448. [CrossRef] 297. Sigel, H.; Bianchi, E.M.; Corfû, N.A.; Kinjo, Y.; Tribolet, R.; Martin, R.B. Acid–base properties of the 5 ′ -triphosphates of guanosine and inosine (GTP 4and ITP 4- ) and of several related nucleobase derivatives. J. Chem. Soc. Perkin Trans. 2 2001,4, 507–511. [CrossRef] 298. Sigel, H.; Tribolet, R.; Malini-Balakrishnan, R.; Martin, R.B. Comparison of the stabilities of monomeric metal ion complexes formed with adenosine 5 ′ -triphosphate (ATP) and pyrimidine-nucleoside 5 ′ -triphosphates (CTP, UTP, TTP) and evaluation of the isomeric equilibria in the complexes of ATP and CTP. Inorg. Chem. 1987,26, 2149. [CrossRef] 299. Krane, S.M.; Glimcher, M.J. Transphosphorylation from nucleoside diand triphosphates by apatite crystals. J. Biol. Chem. 1962,9, 2991–2998. [CrossRef] 300. Taves, D.R.; Reedy, R.C. A structural basis for transphosphorylation of nucleotides with hydroxyapatite. Calc. Tiss. Res. 1969,3, 284–292. [CrossRef] 301. Orriss, I.R.; Arnett, T.R.; Russell, G.G. Pyrophosphate: A key inhibitor of mineralization. Curr. Opin. Biotechnol. 2016,28, 57–68. 302. Benedetti, M.; Antonucci, D.; De Castro, F.; Girelli, C.R.; Lelli, M.; Roveri, N.; Fanizzi, F.P. Metalated nucleotide chemisorption on hydroxyapatite. J. Inorg. Biochem. 2015,153, 279–283. [CrossRef] 303. Watson, J.D.; Crick, F.H.C. Molecular structure of nucleic acids: A structure for deoxyribose nucleic acid. Nature 1953,171, 737–738. [CrossRef] 304. Bernardi, G. Chromatography of nucleic acids on hydroxyapatite. Nature 1965,206, 779–783. [CrossRef] [PubMed] 305. Bernardi, G. Chromatography of nucleic acids on hydroxyapatite. III. Chromatography of RNA and polyribonucleotides. Biochim. Biophys. Acta 1969,174, 449–457. [CrossRef] 306. Bastia, D.; Chiang, K.S.; Swift, H.; Siersma, P. Heterogeneity, complexity, and repetition of the chloroplast DNA of Chlamydomonas reinhardtii. Proc. Natl. Acad. Sci. USA 1971,68, 1157–1161. [CrossRef] [PubMed] 307. Wittelsberger, S.C.; Hansen, J.N. Hydroxyapatite chromatography of short single-stranded DNA. BBA Sect. Nucleic Acids Protein Synth. 1979,565, 125–130. [CrossRef] 308. Andrews-Pfannkoch, C.; Fadrosh, D.W.; Thorpe, J.; Williamson, S.J. Hydroxyapatite-mediated separation of double-stranded DNA, single-stranded DNA, and RNA genomes from natural viral assemblages. Appl. Environ. Microbiol. 2010,76, 5039–5045. [CrossRef] [PubMed] 309. Graham, F.L.; van der Eb, A.J. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 1973,52, 456–467. [CrossRef] 310. Xing, Z.; Chen, S.; Liu, Z.; Yang, X.; Zhu, X.; Zhang, X. Harnessing the power of hydroxyapatite nanoparticles for gene therapy. Appl. Mater. Today 2024,39, 102317. [CrossRef] 311. Ridi, F.; Meazzini, I.; Castroflorio, B.; Bonini, M.; Berti, D.; Baglioni, P. Functional calcium phosphate composites in nanomedicine. Adv. Colloid Interface Sci. 2017,244, 281–295. [CrossRef] [PubMed] 312. Grunenwald, A.; Keyser, C.; Sautereau, A.M.; Crubézy, E.; Ludes, B.; Drouet, C. Adsorption of DNA on biomimetic apatites: Toward the understanding of the role of bone and tooth mineral on the preservation of ancient DNA. Appl. Surf. Sci. 2014,292, 867–875. [CrossRef] 313. Oyane, A.; Yazaki, Y.; Araki, H.; Sogo, Y.; Ito, A.; Yamazaki, A.; Tsurushima, H. Fabrication of a DNA-lipid-apatite composite layer for efficient and area-specific gene transfer. J. Mater. Sci. Mater. Med. 2012,23, 1011–1019. [CrossRef] 314. Yazaki, Y.; Oyane, A.; Tsurushima, H.; Araki, H.; Sogo, Y.; Ito, A.; Yamazaki, A. Coprecipitation of DNA-lipid complexes with apatite and comparison with superficial adsorption for gene transfer applications. J. Biomater. Appl. 2014,28, 937–945. [CrossRef] [PubMed] 315. Wang, X.; Ito, A.; Li, X.; Sogo, Y.; Hirose, M.; Oyane, A.; Tsurushima, H. DNA-lipid-apatite composite layers enhance gene expression of mesenchymal stem cells. Mater. Sci. Eng. C 2013,33, 512–518. [CrossRef] 316. Gibbs, D.; Lohrmann, R.; Orgel, L.E. Template-directed synthesis and selective adsorption of oligoadenylates on hydroxyapatite. J. Mol. Evol. 1980,15, 347–354. [CrossRef] 317. Martinson, H.G. The basis of fractionation of single-stranded nucleic acids on hydroxylapatite. Biochemistry 1973,12, 2731–2736. [CrossRef] [PubMed] Molecules 2024,29, 4479 38 of 39 318. Fadrosh, D.W.; Andrews-Pfannkoch, C.; Williamson, S.J. Separation of single-stranded DNA, double-stranded DNA and RNA from an environmental viral community using hydroxyapatite chromatography. J. Vis. Exp. 2011,55, e3146. [CrossRef] 319. Shlaferman, J.; Paige, A.; Meserve, K.; Miech, J.A.; Gerdon, A.E. Selected DNA aptamers influence kinetics and morphology in calcium phosphate mineralization. ACS Biomater. Sci. Eng. 2019,5, 3228–3236. [CrossRef] 320. Wu, Y.X.; Kwon, Y.J. Aptamers: The “evolution” of SELEX. Methods 2016,106, 21–28. [CrossRef] [PubMed] 321. Duffy, E.; Florek, J.; Colon, S.; Gerdon, A.E. Selected DNA aptamers as hydroxyapatite affinity reagents. Anal. Chim. Acta 2020, 1110, 115–121. [CrossRef] 322. Clarke, M.J.; Taube, H. Pentaammineruthenium-guanine complexes. J. Am. Chem. Soc. 1974,96, 5413–5419. [CrossRef] 323. Chu, G.Y.H.; Mansy, S.; Duncan, R.E.; Tobias, R.S. Heavy metal nucleotide interactions. 11. Stereochemical and electronic effects in the electrophilic attack of cisand trans-diammineplatinum(II) on 5 ′ -guanosine monophosphate and polyguanylate in aqueous solution. J. Am. Chem. Soc. 1978,100, 593. [CrossRef] 324. Sigel, H. Komplexbildung von nucleinbasen mit Cu2+.Eur. J. Biochem. 1968,3, 530–537. [CrossRef] [PubMed] 325. Sigel, H. Zur katalatischen und peroxidatischen aktivität von Cu2+-komplexen. Angew. Chem. 1969,81, 161–171. [CrossRef] 326. Sigel, H. Nucleic base-metal ion interactions. Acidity of the N(1) or N(3) proton in binary and ternary complexes of Mn 2+ , Ni 2+ , and Zn 2+ with the 5 ′ -triphosphates of inosine, guanosine, uridine, and thymidine. J. Am. Chem. Soc. 1975,97, 3209–3214. [CrossRef] 327. Caradonna, J.P.; Lippard, S.J. Synthesis and characterization of [d(ApGpGpCpCpT)] 2 and its adduct with the anticancer drug cis-diamminedichloroplatinum(II). Inorg. Chem. 1988,27, 1454–1466. [CrossRef] 328. Garderen, C.J.; Altona, C.; Reedijk, J. Conformational changes in a singleand double-stranded nonanucleotide upon complexation of a monofunctional platinum compound as studied by proton NMR, phosphorus-31 NMR and CD methods. Inorg. Chem. 1990, 29, 1481–1487. [CrossRef] 329. Liu, Y.; Pacifico, C.; Natile, G.; Sletten, E. Antitumor trans platinum complexes can form cross-links with adjacent purine groups. Angew. Chem. Int. Ed. 2001,40, 1226–1228. [CrossRef] 330. Meshkini, A.; Sistanipour, E.; Oveisi, H.; Asoodeh, A. Induction of osteogenesis in bone tumour cells by purine-conjugated zinc-hydroxyapatite. Bioinspired Biomim. Nanobiomater. 2021,10, 16–27. [CrossRef] 331. Zeng, G.; Liu, M.; Heng, C.; Huang, Q.; Mao, L.; Huang, H.; Hui, J.; Deng, F.; Zhang, X.; Wei, Y. Surface polyPEGylation of Eu 3+ doped luminescent hydroxyapatite nanorods through the combination of ligand exchange and metal free surface initiated atom transfer radical polymerization. Appl. Surf. Sci. 2017,399, 499–505. [CrossRef] 332. Uskokovi´c, V. When 1 + 1 > 2: Nanostructured composites for hard tissue engineering applications. Mater. Sci. Eng. C 2015,57, 434–451. [CrossRef] 333. Chang, Q.; Li, K.K.; Hu, S.L.; Dong, Y.G.; Yang, J.L. Hydroxyapatite supported N-doped carbon quantum dots for visible-light photocatalysis. Mater. Lett. 2016,175, 44–47. [CrossRef] 334. Piccirillo, C.; Castro, P.M.L. Calcium hydroxyapatite-based photocatalysts for environment remediation: Characteristics, performances and future perspectives. J. Environ. Manag. 2017,193, 79–91. [CrossRef] [PubMed] 335. Calabrese, G.; Petralia, S.; Franco, D.; Nocito, G.; Fabbi, C.; Forte, L.; Guglielmino, S.; Squarzoni, S.; Traina, F.; Conoci, S. A new Ag-nanostructured hydroxyapatite porous scaffold: Antibacterial effect and cytotoxicity study. Mater. Sci. Eng. C 2021,118, 111394. [CrossRef] [PubMed] 336. Monte, J.P.; Fontes, A.; Santos, B.S.; Pereira, G.A.L.; Pereira, G. Recent advances in hydroxyapatite/polymer/silver nanoparticles scaffolds with antimicrobial activity for bone regeneration. Mater. Lett. 2023,338, 134027. [CrossRef] 337. Inam, H.; Sprio, S.; Tavoni, M.; Abbas, Z.; Pupilli, F.; Tampieri, A. Magnetic hydroxyapatite nanoparticles in regenerative medicine and nanomedicine. Int. J. Mol. Sci. 2024,25, 2809. [CrossRef] [PubMed] 338. Farazin, A.; Mahjoubi, S. Dual-functional hydroxyapatite scaffolds for bone regeneration and precision drug delivery. J. Mech. Behav. Biomed. Mater. 2024,157, 106661. [CrossRef] 339. Gong, Y.; Gan, Y.; Wang, P.; Gong, C.; Han, B.; Li, P.; Liu, E.; Yu, Z.; Sheng, L.; Wang, X. Injectable foam-like scaffolds release glucose oxidase-integrated metal–organic framework hybrids for diabetic bone defects. Appl. Mater. Today 2024,38, 102190. [CrossRef] 340. Mushtaq, A.; Zhang, H.; Cui, M.; Lin, X.; Huang, S.; Tang, Z.; Hou, Y.; Iqbal, M.Z.; Kong, X. ROS-responsive chlorin e6 and silk fibroin loaded ultrathin magnetic hydroxyapatite nanorods for T1-magnetic resonance imaging guided photodynamic therapy in vitro. Colloids Surfaces A Physicochem. Eng. Asp. 2023,656, 130513. [CrossRef] 341. Li, X.; Zou, Q.; Chen, L.; Li, W. A ternary doped single matrix material with dual functions of bone repair and multimodal tracking for applications in orthopedics and dentistry. J. Mater. Chem. B 2018,6, 6047–6056. [CrossRef] 342. Meyers, M.A.; Chen, P.Y.; Lin, A.Y.M.; Seki, Y. Biological materials: Structure and mechanical properties. Prog. Mater. Sci. 2008,53, 1–206. [CrossRef] 343. He, B.; Zhao, J.; Ou, Y.; Jiang, D. Biofunctionalized peptide nanofiber-based composite scaffolds for bone regeneration. Mater. Sci. Eng. C 2018,90, 728–738. [CrossRef] 344. Bai, X.; Gao, M.; Syed, S.; Zhuang, J.; Xu, X.; Zhang, X.Q. Bioactive hydrogels for bone regeneration. Bioact. Mater. 2018,3, 401–417. [CrossRef] [PubMed] 345. Ozimek, J.; Łukaszewska, I.; Pielichowski, K. POSS and SSQ materials in dental applications: Recent advances and future outlooks. Int. J. Mol. Sci. 2023,24, 4493. [CrossRef] [PubMed] Molecules 2024,29, 4479 39 of 39 346. Bauer, I.W.; Li, S.P.; Han, Y.C.; Yuan, L.; Yin, M.Z. Internalization of hydroxyapatite nanoparticles in liver cancer cells. J. Mater. Sci. Mater. Med. 2008,19, 1091–1095. [CrossRef] 347. Xu, D.; Wan, Y.; Li, Z.; Wang, C.; Zou, Q.; Du, C.; Wang, Y. Tailorable hierarchical structures of biomimetic hydroxyapatite micro/nano particles promoting endocytosis and osteogenic differentiation of stem cells. Biomater. Sci. 2020,8, 3286–3300. [CrossRef] 348. Zhu, C.; Zhou, X.; Liu, Z.; Chen, H.; Wu, H.; Yang, X.; Zhu, X.; Ma, J.; Dong, H. The morphology of hydroxyapatite nanoparticles regulates cargo recognition in clathrin-mediated endocytosis. Front. Mol. Biosci. 2021,8, 627015. [CrossRef] [PubMed] 349. Iriarte, E.; García-Tojal, J.; Santana, J.; Jorge-Villar, S.E.; Teira, L.; Muñiz, J.; Ibañez, J.J. Geochemical and spectroscopic approach to the characterization of earliest cremated human bones from the Levant (PPNB of Kharaysin, Jordan). J. Archaeol. Sci. Rep. 2020, 30, 102211. [CrossRef] 350. Gilbert, W. The RNA world. Nature 1986,319, 618. [CrossRef] 351. Ruiz-Mirazo, K.; Briones, C.; De La Escosura, A. Prebiotic systems chemistry: New perspectives for the origins of life. Chem. Rev. 2014,114, 285–366. [CrossRef] 352. Drouet, C.; Aufray, M.; Rollin-Martinet, S.; Vandecandelaère, N.; Grossin, D.; Rossignol, F.; Champion, E.; Navrotsky, A.; Rey, C. Nanocrystalline apatites: The fundamental role of water. Am. Mineral. 2018,103, 550–564. [CrossRef] 353. Carter, O.W.L.; Xu, Y.; Sadler, P.J. Minerals in biology and medicine. RSC Adv. 2021,11, 1939–1951. [CrossRef] 354. Luo, Y.; Liu, H.; Zhang, Y.; Liu, Y.; Liu, S.; Liu, X.; Luo, E. Metal ions: The unfading stars of bone regeneration-from bone metabolism regulation to biomaterial applications. Biomater. Sci. 2023,11, 7268–7295. [CrossRef] [PubMed] 355. Lin, K.; Wu, C.; Chang, J. Advances in synthesis of calcium phosphate crystals with controlled size and shape. Acta Biomater. 2014, 10, 4071–4102. [CrossRef] [PubMed] 356. Ellingham, S.T.D.; Thompson, T.J.U.; Islam, M.; Taylor, G. Estimating temperature exposure of burnt bone—A methodological review. Sci. Justice 2015,55, 181–188. [CrossRef] [PubMed] 357. Haider, A.; Haider, S.; Han, S.S.; Kang, I.K. Recent advances in the synthesis, functionalization and biomedical applications of hydroxyapatite: A review. RSC Adv. 2017,7, 7442–7458. [CrossRef] 358. Maia, M.T.; Luz, É.P.C.G.; Andrade, F.K.; Rosa, M.d.F.; Borges, M.d.F.; Arcanjo, M.R.A.; Vieira, R.S. Advances in Bacterial cellulose/strontium apatite composites for bone applications. Polym. Rev. 2021,61, 736–764. [CrossRef] 359. Munir, M.U.; Salman, S.; Ihsan, A.; Elsaman, T. Synthesis, characterization, functionalization and bio-applications of hydroxyapatite nanomaterials: An overview. Int. J. Nanomed. 2022,17, 1903–1925. [CrossRef] 360. Deng, Z.; Jia, Z.; Li, L. Biomineralized materials as model systems for structural composites: Intracrystalline structural features and their strengthening and toughening mechanisms. Adv. Sci. 2022,9, 2103524. [CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.