scieee AI-readable full text Open interactive document viewer

A new species of the genus Leptobrachella (Amphibia, Anura, Megophryidae) from the Darongshan Nature Reserve, Guangxi, China

Chen, Wei-Cai; Bei, Yong-Jian; Li, Peng

Abstract

A new species of the genus Leptobrachella, L. darongshanensis sp. nov., is described from the Darongshan Nature Reserve, Yulin City, Guangxi, China, integrating molecular, morphological, and bioacoustic evidence. The new species can be distinguished from its congeners by a combination of the following characters: (1) medium body size (SVL 24.9–27.7 mm in males; 32.0–35.4 mm in females); (2) dorsal skin rough with small, raised tubercles and ridges; (3) ventral surface creamy white with minute irregular textures and tiny pale brown spots laterally on the belly; (4) flanks bearing irregular black spots; (5) distinct black supratympanic line; (6) rudimentary toe webbing on toes I–IV and absence of lateral dermal fringes on toes; (7) distinct, continuous ventrolateral glandular line; (8) iris bicolored, upper half tangerine, lower half silver with black reticulations, pupil black with tangerine edges; (9) tibiotarsal articulation reaching the posterior margin of the eye when adpressed; (10) advertisement calls with dominant frequencies of 6.1–6.7 kHz at 20.0 °C. Phylogenetic analyses based on the mitochondrial 16S rRNA gene indicate that L. darongshanensis sp. nov. and L. shiwandashanensis are sister taxa. The new species is currently known only from montane evergreen forests at elevations between 800 and 1,200 m within the Darongshan Nature Reserve, where it is sympatric with L. yunkaiensis.

Full text

171 A new species of the genus Leptobrachella (Amphibia, Anura, Megophryidae) from the Darongshan Nature Reserve, Guangxi, China Wei-Cai Chen1,2 , Yong-Jian Bei3,4, Peng Li1 1 Key Laboratory of Environment Change and Resources Use in Beibu Gulf Ministry of Education, Nanning Normal University, Nanning 530001, China 2 Guangxi Key Laboratory of Earth Surface Processes and Intelligent Simulation, Nanning Normal University, Nanning 530001, China 3 College of Biology and Pharmacy, Yulin Normal University, Yulin 537000, China 4 Key Laboratory of Mountain Biodiversity Conservation, Education Department of Guangxi Zhuang Autonomous Region, Yulin Normal University, Yulin 537000, China Corresponding authors: Wei-Cai Chen ([email protected]); Yong-Jian Bei ([email protected]) Copyright: © Wei-Cai Chen et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract A new species of the genus Leptobrachella, L. darongshanensis sp. nov., is described from the Darongshan Nature Reserve, Yulin City, Guangxi, China, integrating molecular, morphological, and bioacoustic evidence. The new species can be distinguished from its congeners by a combination of the following characters: (1) medium body size (SVL 24.9–27.7 mm in males; 32.0–35.4 mm in females); (2) dorsal skin rough with small, raised tubercles and ridges; (3) ventral surface creamy white with minute irregular textures and tiny pale brown spots laterally on the belly; (4) flanks bearing irregular black spots; (5) distinct black supratympanic line; (6) rudimentary toe webbing on toes I–IV and absence of lateral dermal fringes on toes; (7) distinct, continuous ventrolateral glandular line; (8) iris bicolored, upper half tangerine, lower half silver with black reticulations, pupil black with tangerine edges; (9) tibiotarsal articulation reaching the posterior margin of the eye when adpressed; (10) advertisement calls with dominant frequencies of 6.1–6.7 kHz at 20.0 °C. Phylogenetic analyses based on the mitochondrial 16S rRNA gene indicate that L. darongshanensis sp. nov. and L. shiwandashanensis are sister taxa. The new species is currently known only from montane evergreen forests at elevations between 800 and 1,200 m within the Darongshan Nature Reserve, where it is sympatric with L. yunkaiensis. Key words: Bioacoustics, morphology, phylogeny, sympatric distribution, taxonomy Introduction The genus Leptobrachella Smith, 1925 is widely distributed across southern China, northeastern India, Myanmar, Thailand, Vietnam, Peninsular Malaysia, Borneo, and Natuna Island (Frost 2024). Currently comprising 110 species, 45 occur in China (AmphibiaChina 2025). Recent years have seen a surge in descriptions of new Leptobrachella species, indicating that the diversity of this genus remains underestimated. Most species occupy specialized microhabitats, such as headwater streams in montane forests. Their small body size and cryptic habits make them challenging to locate in the field. Academic editor: Anthony Herrel Received: 8 June 2025 Accepted: 28 October 2025 Published: 19 November 2025 ZooBank: https://zoobank. org/0F8F8B32-7095-45BC-806B71854F223827 Citation: Chen W-C, Bei Y-J, Li P (2025) A new species of the genus Leptobrachella (Amphibia, Anura, Megophryidae) from the Darongshan Nature Reserve, Guangxi, China. ZooKeys 1260: 171–194. https://doi. org/10.3897/zookeys.1260.161514 ZooKeys 1260: 171–194 (2025) DOI: 10.3897/zookeys.1260.161514 172 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi The Darongshan Nature Reserve is located in Yulin City, Guangxi, China. It encompasses the Darongshan mountain range, with Lotus Peak reaching the highest elevation of 1,275.6 m. Situated on the southern edge of the South Subtropical Monsoon Climate Zone, the reserve is predominantly covered by monsoon evergreen broad-leaved forests. The annual average temperature ranges from 16.8 °C to 19.6 °C (July average: 26.1 °C). Annual precipitation is 1,800–2,200 mm, primarily between June and September, with an average annual relative humidity of 82.8% (Zheng and Qin 2022). During amphibian surveys conducted from 2023 to 2025 within the Darongshan Nature Reserve, two morphotypes of Leptobrachella were encountered. No species of Leptobrachella had been previously reported from this reserve. Phylogenetic analysis using the mitochondrial 16S rRNA gene revealed that one morphotype (hereafter referred to as the putative new species) formed a sister clade to L. shiwandashanensis Chen, Peng, Pan, Liao, Liu & Huang, 2021, while the other morphotype clustered closely with L. yunkaiensis Wang, Li, Lyu & Wang, 2018. Morphological characterization and bioacoustic analyses demonstrated significant differences between the putative new species and L. shiwandashanensis, supporting its recognition as a distinct species. The second morphotype showed only minor morphological divergence from L. yunkaiensis, but due to the lack of vocal comparisons with topotypic L. yunkaiensis, we conservatively identify it as L. cf. yunkaiensis. Material and methods Sampling Twenty-three adult specimens were collected within the Darongshan Nature Reserve, Yulin City, Guangxi, China (Fig. 1). Specimens were euthanized using isoflurane, fixed in 10% formalin, and subsequently stored in 75% ethanol as vouchers deposited at Nanning Normal University (NNU). Muscle tissue samples were preserved in 100% ethanol for molecular analysis. Figure 1. Localities of the new species, L. shiwandashanensis, and L. yunkaiensis. China Vietnam Guangxi Guangdong L. darongshanensis sp. nov. L. shiwandashanensis L. yunkaiensis N Darongshan Reserve Dawuling, Guangdong (Type locality) Ehuangzhang reserve, Guangdong Lidong, Guangxi Darongshan reserve, Guangxi 173 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Morphological comparisons Comparative morphological data were obtained from the literature (Suppl. material 2: table S1) and museum specimens (Suppl. material 2: table S2). Fourteen morphological characters were measured using digital calipers to the nearest 0.1 mm, following Rowley et al. (2016): snout-vent length (SVL), head length (HL, from tip of snout to posterior margin of jaw articulation), head width (HW, maximum width between left and right jaw articulations), snout length (SNT, from tip of snout to anterior corner of eye), eye diameter (ED, horizontal diameter of exposed eyeball), interorbital distance (IOD, shortest distance between anterior corners of orbits), horizontal tympanum diameter (TD), internarial distance (IN, minimum distance between inner margins of external nares), tibia length (TIB, from knee to tarsus), forelimb length (FLL, from elbow to tip of third finger), length of foot and tarsus (TFL, from tibiotarsal articulation to tip of toe IV), manus length (ML, from tip of third digit to proximal edge of inner palmar tubercle), hindlimb length (HLL, from tip of fourth toe to vent), and distance from proximal edge of femoral gland to knee (FG-knee). Sex was determined based on direct observation of calling behavior in the field or the presence of internal vocal sac openings. Molecular analyses Genomic DNA was extracted from tissue samples using commercial kits (Tiangen Biotech Co. Ltd., Beijing, China). A fragment of the mitochondrial 16S rRNA gene was amplified and sequenced following Palumbi et al. (1991) using primers 16Sar_L (5’–CGCCTGTTTACCAAAAACAT–3’) and 16Sbr_H (5’–CCGGTCTGAACTCAG ATCACGT–3’). Polymerase chain reaction (PCR) conditions were: initial denaturation at 94 °C for 5 min; 35 cycles of denaturation at 94 °C for 35 s, annealing at 58 °C for 40 s, extension at 72 °C for 40 s; final extension at 72 °C for 10 min. PCR products were sequenced directly on an ABI Prism 3730 automated DNA sequencer (Applied Biosystems, USA). New sequences were deposited in GenBank (Accession nos. PX480157–PX480169, PX480170–PX480176). Phylogenetic analyses employed Maximum Likelihood (ML) and Bayesian Inference (BI). The best-fit nucleotide substitution model (GTR+F+I) was selected using ModelFinder 2.2.0 (Kalyaanamoorthy et al. 2017) implemented in PhyloSuite v. 1.2.3 (Zhang et al. 2020), based on the Bayesian Information Criterion (BIC). ML analysis was performed in IQ-tree 2.2.2 (Nguyen et al. 2015) with 2000 ultrafast bootstrap replicates. BI was conducted using MrBayes v. 3.2 (Ronquist et al. 2012), running two independent analyses with four Markov chains each for 30 million generations, sampling every 1000 generations. The first 25% of sampled trees were discarded as burn-in. Uncorrected pairwise (p) distances were calculated in MEGA v. 11 (Tamura et al. 2021) using default settings. Bioacoustics analyses Advertisement calls were recorded using a SONY PCM-A10 recorder. Ambient air temperature during recordings was 20.0 °C, measured with a Deli LE505 hand-held weather meter. Calls were analyzed and visualized using Raven Pro 174 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi v. 1.6.1 (Cornell Laboratory of Ornithology, Ithaca, NY, USA). Spectrograms were generated using a Fast Fourier Transform (FFT) size of 512 points, 50% overlap, grid spacing of 172 Hz, and Hanning windows (Köhler et al. 2017). Results Molecular analyses The final alignment consisted of 126 sequences of the 16S rRNA fragment (Table 1). Both ML and BI analyses yielded similar tree topologies (Fig. 2). Specimens collected from Darongshan formed two distinct monophyletic lineages. One lineage, L. darongshanensis sp. nov., was strongly supported (BPP = 1.00, UFB = 100) as the sister taxon to L. shiwandashanensis. The second lineage clustered within specimens identified as L. yunkaiensis from its type locality. Uncorrected p-distances between L. darongshanensis sp. nov. and L. shiwandashanensis ranged from 2.6% to 3.0%. Distances between the Darongshan L. cf. yunkaiensis specimens and topotypic L. yunkaiensis ranged from 1.4% to 2.7% (Suppl. material 2: table S3). Bioacoustics Advertisement calls of three individuals of L. darongshanensis sp. nov. and three individuals of L. cf. yunkaiensis were recorded at approximately 20.0 °C. The calls of L. darongshanensis sp. nov. differed significantly from those of the sympatric L. cf. yunkaiensis in call duration (59.1–109.2 ms, mean ± SD: 77.9 ± 14.5 ms, n = 75 calls vs 25.8–46.6 ms, 35.6 ± 6.2 ms, n = 23), call interval (334.8–763.7 ms, 521.2 ± 106.7 ms, n = 74 intervals vs 150.1–559.5 ms, 309.5 ± 132.5 ms, n = 23), and dominant frequency (6.1–6.7 kHz vs 4.9–5.3 kHz). The calls of L. darongshanensis sp. nov. also differed markedly from its sister species, L. shiwandashanensis, in call duration (59.1–109.2 ms, 77.9 ± 14.5 ms, n = 75 vs 194.0–277.0 ms, 226.6 ± 16.4 ms, n = 80), call interval (334.8–763.7 ms, 521.2 ± 106.7 ms, n = 74 vs 134.0–186 ms, mean: 153.1 ms, n = 23), and dominant frequency (6.1–6.7 kHz vs 5.3–5.7 kHz) (Table 2, Fig. 3). Table 1. DNA sequences used in this study. ‘*’ represents type locality. ID Species Locality Voucher no. 16S rRNA Reference 1L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001152 PX480157 This study 2L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001153 PX480158 This study 3L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001157 PX480159 This study 4L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001158 PX480160 This study 5L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001159 PX480161 This study 6L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001160 PX480162 This study 7L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001161 PX480163 This study 8L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001390 PX480164 This study 9L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001391 PX480165 This study 10 L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001392 PX480166 This study 11 L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001393 PX480167 This study 12 L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001394 PX480168 This study 13 L. darongshanensis sp. nov. Darongshan Nature Reserve, Guangxi, China* NNU001395 PX480169 This study 175 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi ID Species Locality Voucher no. 16S rRNA Reference 14 L. shiwanshanensis Mt. Shiwandashan, Guangxi, China* NNU202103213 MZ326692 Chen et al. 2021a 15 L. shiwanshanensis Mt. Shiwandashan, Guangxi, China* NNU202103214 MZ326693 Chen et al. 2021a 16 L. shiwanshanensis Mt. Shiwandashan, Guangxi, China* NNU202103215 MZ326694 Chen et al. 2021a 17 L. shiwanshanensis Mt. Shiwandashan, Guangxi, China* NNU202103146 MZ326691 Chen et al. 2021a 18 L. shiwanshanensis Mt. Shiwandashan, Guangxi, China* NNU202103261 MZ326695 Chen et al. 2021a 19 L. cf. yunkaiensis Darongshan Nature Reserve, Guangxi, China NNU001147 PX480170 This study 20 L. cf. yunkaiensis Darongshan Nature Reserve, Guangxi, China NNU001148 PX480171 This study 21 L. cf. yunkaiensis Darongshan Nature Reserve, Guangxi, China NNU001149 PX480172 This study 22 L. cf. yunkaiensis Darongshan Nature Reserve, Guangxi, China NNU001150 PX480173 This study 23 L. cf. yunkaiensis Darongshan Nature Reserve, Guangxi, China NNU001151 PX480174 This study 24 L. cf. yunkaiensis Darongshan Nature Reserve, Guangxi, China NNU001155 PX480175 This study 25 L. cf. yunkaiensis Darongshan Nature Reserve, Guangxi, China NNU001156 PX480176 This study 26 L. yunkaiensis Dawuling, Guangdong, China* SYS a004666 MH055933 Chen et al. 2018 27 L. yunkaiensis Lidong, Guangxi, China KIZ018211 MH055931 Chen et al. 2018 28 L. yunkaiensis Ehuangzhang Nature Reserve, Guangdong, China KIZ047782 MH055932 Chen et al. 2018 29 L. yunkaiensis Dawuling, Guangdong, China* SYS a004663 MH605584 Wang et al. 2018 30 L. yunkaiensis Dawuling, Guangdong, China* SYS a004664 MH605585 Wang et al. 2018 31 L. yunkaiensis Dawuling, Guangdong, China* SYS a004665 MH605586 Wang et al. 2018 32 L. yunkaiensis Dawuling, Guangdong, China* SYS a004666 MH605587 Wang et al. 2018 33 L. yunkaiensis Dawuling, Guangdong, China* SYS a004667 MH605588 Wang et al. 2018 34 L. yunkaiensis Dawuling, Guangdong, China* SYS a004668 MH605589 Wang et al. 2018 35 L. yunkaiensis Dawuling, Guangdong, China* SYS a004669 MH605590 Wang et al. 2018 36 L. yunkaiensis Dawuling, Guangdong, China* SYS a004690 MH605591 Wang et al. 2018 37 L. aerea Quang Binh, Vietnam ZFMK 86362 JN848409 Ohler et al. 2011 38 L. alpina Caiyanghe, Yunnan, China KIZ049024 MH055867 Chen et al. 2018 39 L. applebyi Phong Dien Nature Reserve, Thua Thien-Hue, Vietnam KIZ010701 MH055947 Chen et al. 2018 40 L. arayai Borneo, Malaysia* AE100/S9 DQ642119 Veith et al. 2006 41 L. ardens Kon Ka Kinh National Park, Gia Lai, Vietnam* ZMMU-NAP-06099 MH055949 Chen et al. 2018 42 L. aspera Huanglianshan Nature Reserve, Lyuchun, Yunnan, China* SYS a007743 MW046199 Wang et al. 2020 43 L. baluensis Sabah, Borneo, Malaysia* SP 21604 LC056792 Eto et al. 2015 44 L. bashaensis Basha Nature Reserve, Guizhou, China* GIB196404 MW136295 Lyu et al. 2020 45 L. bidoupensis Bidoup-Nui Ba National Park, Lam Dong, Vietnam* ZMMU-A-4797-01454 MH055945 Chen et al. 2018 46 L. bijie Bijie City, Guizhou, China* SYS a007313 MK414532 Wang et al. 2020 47 L. botsfordi Lao Cai, Vietnam* AMS R 176540 MH055952 Chen et al. 2018 48 L. bourreti Mao’er Shan, Guangxi, China KIZ019389 MH055869 Chen et al. 2018 49 L. brevicrus Sarawak, Borneo, Malaysia* ZMH A09365 KJ831302 Oberhummer et al. 2014 50 L. chishuiensis Guizhou, China* CIBCS20190518047 MT117053 Li et al. 2020 51 L. crocea Thua Thien-Hue, Vietnam ZMMU-NAP-02274 MH055955 Chen et al. 2018 52 L. damingshanensis Wuming County, Guangxi, China* NNU202103281 MZ145229 Chen et al. 2021b 53 L. dayaoshanensis Dayaoshan, Jinxiu County, Guangxi, China* NNU202103018 PQ476281 Yu et al. 2024 54 L. dong Tongdao County, Hunan, China* CIB SSC1757 OP764530 Liu et al. 2023 55 L. dorsospina Yushe Forest Park, Shuicheng, Guizhou, China* SYS a004961 MW046194 Wang et al. 2020 56 L. dringi Borneo, Malaysia* KUHE:55610 AB847553 Matsui et al. 2014a 57 L. eos Phongsaly, Laos* MNHN 2004.0274 JN848452 Ohler et al. 2011 58 L. feii Yunnan, China* KIZ048894 MT302634 Chen et al. 2020 59 L. firthi Kon Tum, Vietnam* AMS: R 176524 JQ739206 Rowley et al. 2012 60 L. flaviglandulosa Xiaoqiaogou Nature Reserve, Yunnan, China* KIZ016072 MH055934 Chen et al. 2018 61 L. fritinniens Danum Valley Field Center, Sabah, Malaysia FMNH 244800 MH055971 Chen et al. 2018 62 L. fuliginosa Phetchaburi, Thailand KUHE:20197 LC201988 Matsui et al. 2017 63 L. gracilis Bukit Kana, Sarawak, Malaysia FMNH 273682 MH055972 Chen et al. 2018 64 L. guinanensis Shangsi County, Guangxi, China* NNU00557 OP548561 Chen et al. 2024 65 L. hamidi Borneo, Malaysia* KUHE 17545 AB969286 Matsui et al. 2014b 176 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi ID Species Locality Voucher no. 16S rRNA Reference 66 L. heteropus Peninsular, Malaysia KUHE 15487 AB530453 Matsui et al. 2010 67 L. isos Gia Lai, Vietnam* AMS R 176480 KT824769 Rowley et al. 2015a 68 L. itiokai Gunung Mulu National Park, Sarawak, Malaysia* KUHE:55897 LC137805 Eto et al. 2016 69 L. jinshaensis Lengshuihe Nature Reserve, Jinsha County, Guizhou, China* CIBJS20200516001 MT814014 Cheng et al. 2021 70 L. jinyunensis Mt. Jinyun, Beibei District, Chongqing, China* CIB 119039 OQ024778 Shi et al. 2023 71 L. juliandringi Sarawak, Borneo, Malaysia* KUHE 17557 LC056784 Eto et al. 2015 72 L. kajangensis Tioman, Malaysia* LSUHC:4439 LC202002 Matsui et al. 2017 73 L. kalonensis Binh Thuan, Vietnam* IEBR A.2014.15 KR018114 Rowley et al. 2015b 74 L. kecil Cameron, Malaysia * KUHE:52439 LC202003 Matsui et al. 2017 75 L. khasiorum Meghalaya, India* SDBDU 2009.329 KY022303 Mahony et al. 2017 76 L. korifi Doi Inthanon, Thailand* KUHE 19134 LC741033 Matsui et al. 2023 77 L. laui Wutongshan, Shenzhen city, China* SYS a001507 KM014544 Sung et al. 2014 78 L. liui Wuyishan, Fujian, China * ZYCA907 MH055908 Chen et al. 2018 79 L. macrops Dak Lak, Vietnam* AMS R177663 KR018118 Rowley et al. 2015b 80 L. maculosa Ninh Thuan, Vietnam* AMS: R 177660 KR018119 Rowley et al. 2015b 81 L. mangshanensis Mangshan, Hunan, China* MSZTC201701 MG132196 Hou et al. 2018 82 L. maoershanensis Mao’er Shan, Guangxi, China KIZ07614 MH055927 Chen et al. 2018 83 L. marmorata Borneo, Malaysia* KUHE 53227 AB969289 Matsui et al. 2014b 84 L. maura Borneo, Malaysia SP 21450 AB847559 Matsui et al. 2014a 85 L. melanoleuca Kapoe, Ranong, Thailand KIZ018031 MH055967 Chen et al. 2018 86 L. melica Ratanakiri, Cambodia* MVZ 258198 HM133600 Rowley et al. 2010a 87 L. minima Doi Phu Fa, Nan, Thailand KIZ024317 MH055852 Chen et al. 2018 88 L. mjobergi Sarawak, Borneo, Malaysia* KUHE 47872 LC056787 Eto et al. 2015 89 L. nahangensis Tuyen Quang, Vietnam* ROM 7035 MH055853 Chen et al. 2018 90 L. namdongensis Thanh Hoa, Vietnam* VNUF A.2017.95 MK965390 Hoang Chen et al. 2019 91 L. neangi Veal Veng District, Pursat, Cambodia* CBC 1609 MT644612 Stuart and Rowley 2020 92 L. niveimontis Yongde County, Yunnan, China * KIZ028276 MT302620 Chen et al. 2020 93 L. oshanensis Emei Shan, Sichuan, China* Tissue ID: YPX37492 MH055896 Chen et al. 2018 94 L. pallida Lam Dong, Vietnam* UNS00510 KR018112 Rowley et al. 2015b 95 L. parva Mulu National Park, Sarawak, Malaysia* KUHE:55308 LC056791 Eto et al. 2015 96 L. pelodytoides NA TZ819 AF285192 Ziegler 2000 97 L. petrops Ba Vi National Park, Ha Tay, Vietnam ROM 13483 MH055901 Chen et al. 2018 98 L. phiadenensis Phia Oac-Phia Den NP, Cao Bang Prov., Vietnam* IEBR A.5205 OR405872 Luong et al. 2023 99 L. phiaoacensis Phia Oac-Phia Den NP, Cao Bang Prov., Vietnam* IEBR A. 5195 OR405871 Luong et al. 2023 100 L. picta Borneo, Malaysia UNIMAS 8705 KJ831295 Oberhummer et al. 2014 101 L. pluvialis Lao Cai, Vietnam* MNHN:1999.5675 JN848391 Ohler et al. 2011 102 L. puhoatensis Nghe An, Vietnam* VNMN 2016 A.22 KY849586 Rowley et al. 2017a 103 L. purpurus Yunnan, China * SYSa006530 MG520354 Yang et al. 2018 104 L. purpuraventra Guizhou, China * SYSa007281 MK414517 Wang et al. 2019 105 L. pyrrhops Loc Bac, Lam Dong, Vietnam* ZMMU-A-4873-00158 MH055950 Chen et al. 2018 106 L. rowleyae Da Nang City, Vietnam* ITBCZ2783 MG682552 Nguyen et al. 2018 107 L. sabahmontanus Borneo, Malaysia* BORNEENSIS 12632 AB847551 Matsui et al. 2014a 108 L. shangsiensis Shangsi County, China* NHMG1401032 MK095460 Chen et al. 2019 109 L. shimentaina Shimentai Nature Reserve, Guangdong, China* SYS a004712 MH055926 Chen et al. 2018 110 L. sinorensis Mae Hong Son, Thailand* KUHE 19816 LC741036 Matsui et al. 2023 111 L. sola Gunung Stong, Kelantan, Malaysia KU RMB20973 MH055973 Chen et al. 2018 112 L. suiyangensis Guizhou, China * GZNU20180606005 MK829649 Luo et al. 2020 113 L. sungi Vinh Phuc, Vietnam * ROM 20236 MH055858 Chen et al. 2018 114 L. tadungensis Dak Nong, Vietnam* UNS00515 KR018121 Rowley et al. 2015b 115 L. tengchongensis Yunnan, China * SYSa004598 KU589209 Yang et al. 2016 116 L. tuberosa Kon Ka Kinh National Park, Gia Lai, Vietnam* ZMMU-NAP-02275 MH055959 Chen et al. 2018 117 L. ventripunctata Zhushihe, Yunnan, China * SYSa004536 MH055831 Chen et al. 2018 177 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi ID Species Locality Voucher no. 16S rRNA Reference 118 L. verrucosa Lianshan Bijiashan Nature Reserve, Guangdong, China GEP a059 OP279589 Lin et al. 2022 119 L. wuhuangmontis Pubei County, Guangxi, China * SYS a003486 MH605578 Wang et al. 2018 120 L. wulingensis Hunan, China * CSUFT194 MT530316 Qian et al. 2020 121 L. yeae Mount Emei, Sichuan, China * CIBEMS20190422HLJ1-6 MT957019 Shi et al. 2021 122 L. yingjiangensis Yunnan, China * SYSa006532 MG520351 Yang et al. 2018 123 L. yunyangensis Yunyang County, Chongqing, China * GZNU20210622001 OL800364 Luo et al. 2022 124 L. zhangyapingi Chiang Mai, Thailand * KIZ07258 MH055864 Chen et al. 2018 125 Xenophrys major Kon Tum Province, Vietnam AMS R173870 KY476333 Rowley et al. 2017b 126 Leptobrachium chapaense Lao Cai Province, Vietnam AMS R 171623 KR018126 Rowley et al. 2015b Morphology Phylogenetic results indicated L. darongshanensis sp. nov. is closely related to L. shiwandashanensis. However, it differs from L. shiwandashanensis in several morphological characters, including iris coloration, relative eye diameter, supratympanic line color, toe webbing development, and ventrolateral glandular line continuity (see Comparisons below). Specimens of the second lineage (L. cf. yunkaiensis) were morphologically highly similar to topotypic L. yunkaiensis (see Taxonomic account for L. yunkaiensis). Based on the congruent results from molecular phylogenetics, bioacoustics, and morphology, we describe the first lineage as a new species, L. darongshanensis sp. nov. The second lineage is identified as L. cf. yunkaiensis, representing a new population record. Taxonomic account Leptobrachella darongshanensis sp. nov. https://zoobank.org/9F3C1115-FFF1-4D04-A88C-5939173E1F40 Fig. 4A–F Type material. Holotype • NNU 001390, adult male, collected at Darongshan Nature Reserve, Yulin City, Guangxi, China (22.868°N, 110.202°E; elevation 1048 m) by Wei-Cai Chen on 19 March 2025. Paratypes • NNU 001152–001153 (two adult males), NNU 001157–001161 (four adult females), collected at the same locality as the holotype on 17 May 2023 by Wei-Cai Chen and Yong-Jian Bei. • NNU 001391–001393 (three adult males), NNU 001394–001397 (four adult females), collected at the same locality as the holotype on 19 March 2025 by Wei-Cai Chen. Diagnosis. Leptobrachella darongshanensis sp. nov. is assigned to the genus Leptobrachella based on molecular phylogenetic results and the following generic morphological characters: small size, presence of an inner metacarpal tubercle, absence of vomerine teeth, distinct tympanum, and the presence Table 2. Comparisons of characters of advertisement calls of the new species, L. shiwandashanensis, and L. cf. yunkaiensis. Species Dominant frequency (kHz) Call duration (ms) Call interval (ms) Temperature (°C) References L. darongshanensis sp. nov. 6.1–6.7 77.9 (59.1–109.2) 521.2 (334.8–763.7) 20.0 This study L. shiwandashanensis 5.3–5.7 226.6 (194.0–277.0) 153.1 (134.0–186.0) 23.0 Chen et al. 2021a L. cf. yunkaiensis 4.9–5.3 35.6 (25.8–46.6) 309.5 (150.1–559.5) 20.0 This study 178 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Figure 2. BI trees based on 16S rRNA fragments with Bayesian posterior probabilities/bootstrap supports on branches. Sold black means Bayesian posterior probabilities greater than 0.95 (upper half) and ultrafast bootstrap supports greater than 90 (lower half). 0.1 L. yunkaiensis MH605584 L. yunkaiensis MH605586 L. yunkaiensis MH605589 L. yunkaiensis MH055933 L. yunkaiensis MH605587 L. yunkaiensis MH605588 L. yunkaiensis MH605591 L. yunkaiensis MH605590 L. yunkaiensis MH605585 NNU001147 NNU001149 NNU001148 NNU001155 NNU001150 NNU001151 NNU001156 L. yunkaiensis MH055931 L. yunkaiensis MH055932 L. dayaoshanensisPQ476281 L. verrucosaOP279589 L. liuiMH055908 L. mangshanensisMG132196 L. shimentainaMH055926 L. bashaensisMW136295 L. maoershanensisMH055927 L. lauiKM014544 L. flaviglandulosaMH055934 L. phiaoacensisOR405871 L. bijieMK414532 L. jinyunensisOQ024778 L. chishuiensisMT117053 L. suiyangensisMK829649 L. jinshaensisMT814014 L. purpuraventraMK414517 L.bourretiMH055869 L. dongOP764530 L. niveimontisMT302620 L. yunyangensisOL800364 L. yeaeMT957019 L. alpinaMH055867 L. purpurusMG520354 L. dorsospinaMW046194 L. wulingensisMT530316 L. eosJN848452L. korifiLC741033 L. sinorensisLC741036 L. oshanensisMH055896 L. tengchongensisKU589209 L. khasiorumKY022303 L. yingjiangensisMG520351 L. namdongensisMK965390 L. puhoatensisKY849586 L. petropsMH055901 L. sungiMH055858 L. zhangyapingiMH055864 L. firthiJQ739206 L. isosKT824769 NNU001157 NNU001392 NNU001158 NNU001160 NNU001159 NNU001390 NNU001393 NNU001394 NNU001153 NNU001161 NNU001152 NNU001391 NNU001395 L. shiwandashanensisMZ326691 L. shiwandashanensisMZ326693 L. shiwandashanensisMZ326694 L. shiwandashanensisMZ326692 L. shiwandashanensisMZ326695 L. wuhuangmontisMH605578 L. aereusJN848409 L. pelodytoidesAF285192 L. minimaMH055852 L. guinanensisOP548561 L. ventripunctataMH055831 L. asperaMW046199 L. feiiMT302634 L. phiadenensisOR405872 L. shangsiensisMK095460 L. pluvialisJN848391 L. nahangensisMH055853 L. damingshanensisMZ145229 L. bidoupensisMH055945 L. kalonensisKR018114 L. pallidaKR018112 L. tadungensisKR018121 L. macropsKR018118 L. maculosaKR018119 L. pyrrhopsMH055950 L. applebyiMH055947 L. melicusHM133600 L. rowleyaeMG682552 L. ardensMH055949 L. tuberosaMH055959 L. croceaMH055955 L. botsfordiMH055952 L. fuliginosusLC201988 L. melanoleucusMH055967 L. neangiMT644612 L. brevicrusKJ831302 L. itiokaiLC137805 L. parvaLC056791 L. baluensisLC056792 L. mjobergiLC056787 L. juliandringiLC056784 L. dringiAB847553 L. sabahmontanus AB847551 L. pictusKJ831295 L. fritinniensMH055971 L. gracilisMH055972 L. arayaiDQ642119 L. hamidiAB969286 L. marmoratusAB969289 L. maurusAB847559 L. heteropus AB530453 L. solusMH055973 L. kecilLC202003 L. kajangensisLC202002 Leptobrachium chapaense KR018126 Xenophrys major KY476333 L. cf. yunkaiensis from Darongshan Reserve L. darongshanensis sp. nov. L. yunkaiensis from type locality 179 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi of macro-glands (pectoral and femoral glands, often including supra-axillary and ventrolateral glands). Leptobrachella darongshanensis sp. nov. can be distinguished from its congeners by the following combination of characters: (1) medium body size (SVL 24.9–27.7 mm in males; 32.0–35.4 mm in females); (2) dorsal skin rough with small, raised tubercles and ridges; (3) ventral surface creamy white with minute irregular textures and tiny pale brown spots laterally on the belly; (4) flanks bearing irregular black spots; (5) distinct black supratympanic line extending from posterior corner of eye to supra-axillary gland; (6) rudimentary toe webbing present between toes I–IV, lateral dermal fringes absent on toes; (7) ventrolateral glandular line distinct and continuous; (8) iris bicolored, upper half tangerine, lower half silver with black reticulations; pupil black with tangerine edges; (9) tibiotarsal articulation reaching the posterior margin of the eye when hindlimb is adpressed along body; (10) advertisement call dominant frequency 6.1–6.7 kHz at 20.0 °C. Figure 3. Advertisement call spectrograms of L. darongshanensis sp. nov. and L. cf. yunkaiensis. Leptobrachella darongshanensis sp. nov. A BLeptobrachella cf. yunkaiensis 186 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Table 4. Measurements of L. cf. yunkaiensis from the Darongshan Nature Reserve, Yulin City, Guangxi, China. Males Female Ranges (mm) (n = 7) Mean ± SD (mm) n = 1 SVL 24.6–27.2 25.8 ± 0.9 30.1 HL 9.3–10.5 9.9 ± 0.4 11.3 HW 9.4–10.5 9.8 ± 0.4 10.7 SNT 3.4–4.2 3.9 ± 0.3 4.0 ED 3.5–4.2 3.8 ± 0.2 4.2 IOD 2.7–3.2 2.8 ± 0.2 3.3 TD 1.7–2.1 1.9 ± 0.2 2.1 IN 2.5–3.1 2.8 ± 0.2 3.2 TIB 12.3–13.8 13.0 ± 0.6 13.7 FLL 11.9–13.7 12.8 ± 0.6 13.8 TFL 16.8–19.0 18.2 ± 0.8 19.2 ML 6.6–7.4 7.0 ± 0.3 6.8 HLL 36.3–40.7 38.9 ± 1.7 40.2 FG-knee 3.9–5.3 4.6 ± 0.4 5.1 Figure 6. Morphological characters of L. cf. yunkaiensis from Guangxi (adult male, voucher no. NNU 001147). A. Dorsal view; B. Dorsolateral view; C. Ventral view; D. Ventral view of hand; E. Ventral view of foot. 187 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi replaced by indistinct dermal ridges; inner metatarsal tubercle elongated; outer metatarsal tubercle absent; tibiotarsal articulation reaching mid-eye level when leg adpressed; heels meeting when thighs held at right angles to body. Dorsal skin rough with small tubercles; ventral skin smooth; pectoral glands rounded, creamy white, ~1.3 mm diameter; femoral glands oval, ~1.6 mm diameter, closer to knee than vent; supra-axillary glands small, round, ~0.5 mm diameter; ventrolateral glandular line distinct and continuous; limbs with sparse tubercles. Dorsum brown with sparse pale yellow markings; dark brown interorbital triangle; tympanum brown; brown supratympanic line; dark brown spots on upper lip; flanks with irregular black spots and creamy yellow tubercles; dorsal thigh with 3–5 distinct transverse dark brown bars; dorsal forearms with three distinct transverse dark brown bars; elbows and upper arms tangerine; ventral surface pink or creamy white with minute irregular creamy textures; ventral limbs with tiny irregular creamy yellow spots; pectoral, femoral, supra-axillary glands creamy yellow; pupil black; iris bicolored, upper half tangerine, lower half silver (Fig. 6, Suppl. material 1). Distribution. The type locality of L. yunkaiensis is Dawuling Forest Station, Maoming City, Guangdong, China (Wang et al. 2018). Previous records include Ehuangzhang Nature Reserve, Guangdong and Lidong, Bobai City, Guangxi, China (Chen et al. 2018; Yu et al. 2024). The Darongshan Nature Reserve, Yulin City, Guangxi, reported herein, represents the fourth known locality for this species (Fig. 1). Discussion The conserved external morphology of Leptobrachella species makes identification challenging, contributing to the prevalence of cryptic diversity. Integrating molecular phylogenetics and bioacoustic analyses has significantly advanced the taxonomy of this genus (Chen et al. 2024; Yu et al. 2024). Advertisement calls, exhibiting species-specific differences, are a particularly valuable character for delineating Leptobrachella species (Köhler et al. 2017; Yu et al. 2024). In this study, the syntopic L. darongshanensis sp. nov. and L. yunkaiensis possess entirely distinct vocalizations, differing in dominant frequency, call duration, and call interval. Phylogenetic analysis identified L. darongshanensis sp. nov. as sister to L. shiwandashanensis. However, the profound acoustic divergence—evident in dominant frequency, call duration, and call interval—between L. darongshanensis sp. nov. and L. shiwandashanensis, coupled with morphological distinctions, provides robust support for recognizing the Darongshan lineage as a distinct new species. Geographically, the Darongshan Nature Reserve and the type locality of L. yunkaiensis (Dawuling Forest Station) both lie within the Yunkai mountain range, separated by a straight-line distance of ca. 120 km. Phylogenetic analysis confirms that the L. cf. yunkaiensis population from Darongshan is closely related to topotypic L. yunkaiensis. However, we note that two specimens previously identified as L. yunkaiensis—KIZ018211 (from Lidong, Guangxi; GenBank MH055931) and KIZ047782 (from Ehuangzhang Nature Reserve, Guangdong; GenBank MH055932)—exhibit relatively high genetic divergence (3.3–3.9%) from topotypic L. yunkaiensis (Suppl. material 2: table S3). This divergence exceeds the typical intraspecific threshold suggested for amphibians (Vences et al. 2005). These specimens were initially identified as Leptobrachella liui (Chen et al. 2018) and later assigned to L. yunkaiensis based solely on phylogeny without comprehensive morphological re-evaluation (Yu et al. 2024). Therefore, the taxonomic 188 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi status of specimens KIZ018211 and KIZ047782 requires further investigation incorporating morphological and bioacoustic data to confirm their identity. The discovery of L. darongshanensis sp. nov., currently known only from a small area within the Darongshan Nature Reserve, highlights the ongoing potential for uncovering new amphibian diversity in southern China’s montane regions. Its specialized habitat near headwater streams and limited known distribution warrant attention for conservation assessment. Acknowledgements We thank the staff of the Darongshan Nature Reserve for their support during fieldwork. Additional information Conflict of interest The authors have declared that no competing interests exist. Ethical statement No ethical statement was reported. Use of AI No use of AI was reported. Funding This work was supported by the National Natural Science Foundation of China (grant numbers 32360128 and 32060116) and Guangxi Natural Science Foundation, China (2020GXNSFDA238022). Author contributions CWC conceived and designed the study and prepared the manuscript. CWC and LP performed the molecular experiments and analyzed the data. CWC and BYJ conducted field surveys. All authors read and approved the final version of the manuscript Author ORCIDs Wei-Cai Chen https://orcid.org/0000-0002-2398-4079 Peng Li https://orcid.org/0000-0001-8311-0544 Data availability All of the data that support the findings of this study are available in the main text or Supplementary Information. References AmphibiaChina (2025) The database of Chinese amphibians. Kunming Institute of Zoology (CAS), Yunnan, China. http://www.amphibiachina.org/ [accessed 3 June 2025] Boulenger GA (1893) Concluding report on the reptiles and batrachians obtained in Burma by Signor L. Fea dealing with the collection made in Pegu and the Karin Hills in 1887–1888. Annali del Museo Civico di Storia Naturale di Genova 13: 304–347. 189 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Boulenger GA (1900) Descriptions of new batrachians and reptiles from the Larut Hills, Perak. Annals & Magazine of Natural History 6(32): 186–193. https://doi. org/10.1080/00222930008678356 Chen JM, Poyarkov Jr NJ, Suwannapoom C, Lathrop A, Wu YH, Zhou WW, Yuan ZY, Jin JQ, Chen HM, Liu HQ, Nguyen TQ, Nguyen SN, Duong TV, Eto K, Nishikawa K, Matsui M, Orlov NL, Stuart BL, Brown RM, Rowley JJL, Murphy RW, Wang YY, Che J (2018) Large-scale phylogenetic analyses provide insights into unrecognized diversity and historical biogeography of Asian leaf-litter frogs, genus Leptolalax (Anura: Megophryidae). Molecular Phylogenetics and Evolution 124: 162–171. https://doi. org/10.1016/j.ympev.2018.02.020 Chen WC, Liao X, Zhou SC, Mo YM (2019) A new species of Leptobrachella (Anura: Megophryidae) from southern Guangxi, China. Zootaxa 4563(1): 067–082. https://doi. org/10.11646/zootaxa.4563.1.3 Chen JM, Xu K, Poyarkov NA, Wang K, Yuan ZY, Hou M, Suwannapoom C, Wang J, Che J (2020) How little is known about “the little brown frogs”: description of three new species of the genus Leptobrachella (Anura: Megophryidae) from Yunnan Province, China. Zoological Research 41(3): 292–313. https://doi.org/10.24272/j.issn.2095-8137.2020.036 Chen WC, Peng W, Pan W, Liao N, Liu Y, Huang Y (2021a) A new species of Leptobrachella Smith 1925 (Anura: Megophryidae) from southern Guangxi, China. Zootaxa 5020(3): 581–596. https://doi.org/10.11646/zootaxa.5020.3.8 Chen WC, Yu GD, Cheng ZY, Meng T, Wei H, Zhou GY, Lu YW (2021b) A new species of Leptobrachella (Anura: Megophryidae) from central Guangxi, China. Zoological Research 42(6): 783–788. https://doi.org/10.24272/j.issn.2095-8137.2021.179 Chen WC, Li P, Peng WX, Liu YJ, Huang Y (2024) The fourth species of Leptobrachella (Anura, Megophryidae) found at Shiwandashan National Nature Reserve, Guangxi, China. ZooKeys 1192: 257–279. https://doi.org/10.3897/zookeys.1192.98352 Cheng YL, Shi SC, Li J, Liu J, Li SZ, Wang B (2021) A new species of the Asian leaf litter toad genus Leptobrachella Smith, 1925 (Anura, Megophryidae) from northwest Guizhou Province, China. ZooKeys 1021: 81–107. https://doi.org/10.3897/zookeys.1021.60729 Dehling JM (2012) Eine neue Art der Gattung Leptolalax (Anura: Megophryidae) vom Gunung Benom, Westmalaysia / A new species of the genus Leptolalax (Anura: Megophryidae) from Gunung Benom, Peninsular Malaysia. Sauria 34: 9–21. Dehling JM, Matsui M (2013) A new species of Leptolalax (Anura: Megophryidae) from Gunung Mulu National Park, Sarawak, East Malaysia (Borneo). Zootaxa 3670(1): 33– 44. https://doi.org/10.11646/zootaxa.3670.1.2 Dring J (1983) Frogs of the genus Leptobrachella (Pelobatidae). Amphibia-Reptilia 4(2): 89–102. https://doi.org/10.1163/156853883X00012 Dubois A (1987) Miscellanea taxinomica batrachologica (I). Alytes 5: 7–95. Eto K, Matsui M, Nishikawa K (2015) Description of a new species of the genus Leptobrachella (Amphibia, Anura, Megophryidae) from Borneo. Current Herpetology 34(2): 128–139. https://doi.org/10.5358/hsj.34.128 Eto K, Matsui M, Nishikawa K (2016) A new highland species of dwarf litter frog genus Leptobrachella (Amphibia, Anura, Megophryidae) from Sarawak. The Raffles Bulletin of Zoology 64: 194–203. Eto K, Matsui M, Hamidy A, Munir M, Iskandar DT (2018) Two new species of the genus Leptobrachella (Amphibia: Anura: Megophryidae) from Kalimantan, Indonesia. Current Herpetology 37(2): 95–105. https://doi.org/10.5358/hsj.37.95 Fei L, Ye C, Huang Y (1990) Key to Chinese amphibians. Publishing House for Scientific and Technological Literature, 364 pp. 190 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Frost DR (2024) Amphibian Species of the World: an Online Reference. Version 6.2. American Museum of Natural History, New York, USA. https://doi.org/10.5531/db.vz.0001 Grismer LL, Grismer JL, Youmans TM (2004) A new species of Leptolalax (Anura: Megophryidae) from Pulau Tioman, West Malaysia. Asian Herpetological Research 10: 8–11. Günther ACLG (1872) On the reptiles and amphibians of Borneo. Proceedings of the Zoological Society of London 1872: 586–600. Günther A (1895) The reptiles and batrachians of the Natuna Islands. Novitates Zoologicae 2: 499–502. Hoang CV, Nguyen TT, Luu VQ, Nguyen TQ, Jiang JP (2019) A new species of Leptobrachella Smith 1925 (Anura: Megophryidae) from Thanh Hoa Province, Vietnam. The Raffles Bulletin of Zoology 67: 536–556. https://doi.org/10.26107/RBZ-2019-0042 Hou YM, Zhang MF, Hu F, Li SY, Shi SC, Chen J, Mo XY, Wang B (2018) A new species of the genus Leptolalax (Anura, Megophryidae) from Hunan, China. Zootaxa 4444(3): 247–266. https://doi.org/10.11646/zootaxa.4444.3.2 Inger RF, Stuebing RB (1992) A new species of frog of the genus Leptobrachella Smith (Anura: Pelobatidae), with a key to the species from Borneo. The Raffles Bulletin of Zoology 39: 99–103. Inger RF, Lakim M, Biun A, Yambun P (1997) A new species of Leptolalax (Anura: Megophryidae) from Borneo. Asiatic Herpetological Research 7: 48–50. https://doi. org/10.5962/bhl.part.18855 Inger RF, Orlov N, Darevsky I (1999) Frogs of Vietnam: A report on new collections. Fieldiana. Zoology 92: 1–46. Jiang K, Yan F, Suwannapoom C, Chomdej S, Che J (2013) A new species of the genus Leptolalax (Anura: Megophryidae) from northern Thailand. Asian Herpetological Research 4(2): 100–108. https://doi.org/10.3724/SP.J.1245.2013.00100 Kalyaanamoorthy S, Minh BQ, Wong TK, Von Haeseler A, Jermiin LS (2017) ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods 14(6): 587–589. https://doi.org/10.1038/nmeth.4285 Köhler J, Jansen M, Rodríguez A, Kok PJR, Toledo LF, Emmrich M, Glaw F, Haddad CFB, Rödel MO, Vences M (2017) The use of bioacoustics in anuran taxonomy: Theory, terminology, methods and recommendations for best practice. Zootaxa 4251(1): 1–124. https://doi.org/10.11646/zootaxa.4251.1.1 Lathrop A, Murphy RW, Orlov N, Ho CT (1998) Two new species of Leptolalax (Anura: Megophryidae) from northern Vietnam. Amphibia-Reptilia 19(3): 253–267. https:// doi.org/10.1163/156853898X00160 Li SZ, Liu J, Wei G, Wang B (2020) A new species of the Asian leaf litter toad genus Leptobrachella (Amphibia, Anura, Megophryidae) from southwest China. ZooKeys 943: 91–118. https://doi.org/10.3897/zookeys.943.51572 Li S, Li W, Cheng Y, Liu J, Wei G, Wang B (2024) Description of a new Asian Leaf Litter Toad of the genus Leptobrachella Smith, 1925 (Anura, Megophryidae) from southern Guizhou Province, China. Biodiversity Data Journal 12: e113427. https://doi. org/10.3897/BDJ.12.e113427 Lin SS, Li YH, Lu YH, Su HL, Wang SB, Zhang QQ, Mo MJ, Xiao SJ, Pan Z, Zeng ZC, Wang J (2022) A new species of the genus Leptobrachella (Anura, Megophryidae) from northwestern Guangdong Province, China. Herpetozoa (Wien) 35: 165–178. https:// doi.org/10.3897/herpetozoa.35.e89981 Liu J, Shi S, Li S, Zhang M, Xiang S, Wei G, Wang B (2023) A new Asian leaf litter toad of the genus Leptobrachella (Amphibia, Anura, Megophryidae) from central south China. ZooKeys 1149: 103–134. https://doi.org/10.3897/zookeys.1149.85895 191 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Luo T, Xiao N, Gao K, Zhou J (2020) A new species of Leptobrachella (Anura, Megophryidae) from Guizhou Province, China. ZooKeys 923: 115–140. https://doi.org/10.3897/ zookeys.923.47172 Luo T, Wang W, Peng D, Lei B, Deng H, Ji S, Huang H, Zhou J (2022) A new species of the Asian leaf litter toad genus Leptobrachella (Amphibia, Anura, Megophryidae) from Chongqing City, Southwest China. Asian Herpetological Research 13: 75–95. https:// cstr.cn/32242.14.j.cnki.ahr.210052 Luong AM, Hoang CV, Pham CT, Ziegler T, Nguyen TQ (2023) Two new species of Leptobrachella Smith 1925 (Amphibia: Megophryidae) from Cao Bang Province, Vietnam. Zootaxa 5369(3): 301–335. https://doi.org/10.11646/zootaxa.5369.3.1 Lyu JC, Dai LL, Wei PF, He YH, Yuan ZY, Shi WL, Zhou SL, Ran SY, Kuang ZF, Guo X, Wei G, Yuan G (2020) A new species of the genus Leptobrachella Smith, 1925 (Anura, Megophryidae) from Guizhou, China. ZooKeys 1008: 139–157. https://doi. org/10.3897/zookeys.1008.56412 Mahony S, Foley NM, Biju SD, Teeling EC (2017) Evolutionary history of the Asian horned frogs (Megophryinae): Integrative approaches to timetree dating in the absence of a fossil record. Molecular Biology and Evolution 34(3): 744–771. https://doi. org/10.1093/molbev/msw267 Malkmus R (1992) Leptolalax pictus sp. nov. (Anura: Pelobatidae) vom Mount Kinabalu/ Nord Borneo. Sauria 14: 3–6. Matsui M (1997) Call characteristics of Malaysian Leptolalax with a description of two new species (Anura: Pelobatidae). Copeia 1997(1): 158–165. https://doi. org/10.2307/1447851 Matsui M (2006) Three new species of Leptolalax from Thailand (Amphibia, Anura, Megophryidae). Zoological Science 23(9): 821–830. https://doi.org/10.2108/zsj.23.821 Matsui M, Belabut DM, Ahmad N, Yong HS (2009) A new species of Leptolalax (Amphibia, Anura, Megophryidae) from Peninsular Malaysia. Zoological Science 26(3): 243–247. https://doi.org/10.2108/zsj.26.243 Matsui M, Hamidy A, Murphy RW, Khonsue W, Yambun P, Shimada T, Ahmad N, Belabut DM, Jiang JP (2010) Phylogenetic relationships of megophryid frogs of the genus Leptobrachium (Amphibia, Anura) as revealed by mtDNA gene sequences. Molecular Phylogenetics and Evolution 56(1): 259–272. https://doi.org/10.1016/j. ympev.2010.03.014 Matsui M, Nishikawa K, Yambun P (2014a) A new Leptolalax from the mountains of Sabah, Borneo (Amphibia, Anura, Megophryidae). Zootaxa 3753(3): 440–452. https:// doi.org/10.11646/zootaxa.3753.5.3 Matsui M, Zainudin R, Nishikawa K (2014b) A new species of Leptolalax from Sarawak, Western Borneo (Anura: Megophryidae). Zoological Science 31(11): 773–779. https://doi.org/10.2108/zs140137 Matsui M, Eto K, Nishikawa K, Hamidy A, Belabut D, Ahmad N, Panha S, Khonsue W, Grismer LL (2017) Mitochondrial phylogeny of Leptolalax from Malay Peninsula and Leptobrachella (Anura, Megophryidae). Current Herpetology 36(1): 11–21. https:// doi.org/10.5358/hsj.36.11 Matsui M, Panha S, Eto K (2023) Two new species of Leptobrachella from northern Thailand (Amphibia, Anura, Megophryidae). Current Herpetology 42(1): 83–97. https:// doi.org/10.5358/hsj.42.83 Nguyen LT, Schmidt HA, Von HA, Minh BQ (2015) IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum Likelihood Phylogenies. Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300 192 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Nguyen LT, Poyarkov NA, Le DT, Vo BD, Ninh HT, Duong TV, Murphy RW, Sang NV (2018) A new species of Leptolalax (Anura: Megophryidae) from Son Tra Peninsula, central Vietnam. Zootaxa 4388(1): 1–21. https://doi.org/10.11646/zootaxa.4388.1.1 Nguyen LT, Tapley B, Nguyen CT, Luong HV, Rowley JJL (2021) A new species of Leptobrachella (Anura, Megophryidae) from Mount Pu Ta Leng, northwest Vietnam. Zootaxa 5016(3): 301–332. https://doi.org/10.11646/zootaxa.5016.3.1 Oberhummer E, Barten C, Schweizer M, Das I, Haas A, Hertwig ST (2014) Description of the tadpoles of three rare species of megophryid frogs (Amphibia: Anura: Megophryidae) from Gunung Mulu, Sarawak, Malaysia. Zootaxa 3835(1): 59–79. https://doi. org/10.11646/zootaxa.3835.1.3 Ohler A, Marquis O, Swan S, Grosjean S (2000) Amphibian biodiversity of Hoang Lien Nature Reserve (Lao Cai Province, northern Vietnam) with description of two new species. Herpetozoa (Wien) 13(1/2): 71–87. Ohler A, Wollenberg KC, Grosjean S, Hendrix R, Vences M, Ziegler T, Dubois A (2011) Sorting out Lalos: Description of new species and additional taxonomic data on megophryid frogs from northern Indochina (genus Leptolalax, Megophryidae, Anura). Zootaxa 3147(1): 1–83. https://doi.org/10.11646/zootaxa.3147.1.1 Palumbi SR, Martin R, Romano S, McMillan WO, Stice L, Grabowski G (1991) The Simple Fool’s Guide To PCR, v2.0. Special publication of the University of Hawaii Department of Zoology and Kewalo Marine Laboratory. Qian TY, Xia X, Cao Y, Xiao N, Yang D (2020) A new species of Leptobrachella (Anura: Megophryidae) Smith, 1925 from Wuling Mountains in Hunan Province, China. Zootaxa 4816(4): 491–526. https://doi.org/10.11646/zootaxa.4816.4.4 Ronquist F, Teslenko M, Van Der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP (2012) Mrbayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61(3): 539–542. https://doi.org/10.1093/sysbio/sys029 Rowley JJ, Hoang DH, Le TT, Dau QV, Cao TT (2010) A new species of Leptolalax (Anura: Megophryidae) from Vietnam and further information on Leptolalax tuberosus. Zootaxa 2660(1): 33–45. https://doi.org/10.11646/zootaxa.2660.1.3 Rowley JJL, Stuart BL, Neang T, Emmett DA (2010a) A new species of Leptolalax (Anura: Megophryidae) from northeastern Cambodia. Zootaxa 2567(1): 57–68. https://doi. org/10.11646/zootaxa.2567.1.3 Rowley JJL, Stuart BL, Richards SJ, Phimmachak S, Sivongxay N (2010) A new species of Leptolalax (Anura: Megophryidae) from Laos. Zootaxa 2681(1): 35–46. https://doi. org/10.11646/zootaxa.2681.1.3 Rowley JJ, Hoang HD, Dau VQ, Le TT, Cao TT (2012) A new species of Leptolalax (Anura: Megophryidae) from central Vietnam. Zootaxa 3321(1): 56–68. https://doi. org/10.11646/zootaxa.3321.1.4 Rowley JJ, Dau VQ, Nguyen TT (2013) A new species of Leptolalax (Anura: Megophryidae) from the highest mountain in Indochina. Zootaxa 3737(4): 415–428. https:// doi.org/10.11646/zootaxa.3737.4.5 Rowley JJ, Stuart BL, Neang T, Hoang HD, Dau VQ, Nguyen TT, Emmett DA (2015a) A new species of Leptolalax (Anura: Megophryidae) from Vietnam and Cambodia. Zootaxa 4039(3): 401–417. https://doi.org/10.11646/zootaxa.4039.3.1 Rowley JJL, Tran DT, Frankham GJ, Dekker AH, Le DT, Nguyen TQ, Dau VQ, Hoang HD (2015b) Undiagnosed cryptic diversity in small, microendemic frogs (Leptolalax) from the Central Highlands of Vietnam. PLOS ONE 10(5): e0128382. https://doi. org/10.1371/journal.pone.0128382 193 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Rowley JJ, Tran DT, Le DT, Dau VQ, Peloso PL, Nguyen TQ, Hoang HD, Nguyen TT, Ziegler T (2016) Five new, microendemic Asian Leaf-litter Frogs (Leptolalax) from the southern Annamite mountains. Zootaxa 4085(1): 63–102. https://doi.org/10.11646/ zootaxa.4085.1.3 Rowley JJL, Dau QV, Cao TT (2017a) A new species of Leptolalax (Anura: Megophryidae) from Vietnam. Zootaxa 4273(1): 61–79. https://doi.org/10.11646/zootaxa.4273.1.5 Rowley JJL, Dau VQ, Hoang HD, Le DT, Cutajar TP, Nguyen TT (2017b) A new species of Leptolalax (Anura: Megophryidae) from northern Vietnam. Zootaxa 4243(3): 544– 564. https://doi.org/10.11646/zootaxa.4243.3.7 Shi SC, Hou YM, Song ZB, Jiang JP, Wang B (2021) A new leaf litter toad of Leptobrachella Smith, 1925 (Anura, Megophryidae) from Sichuan Province, China with supplementary description of L. oshanensis. Asian Herpetological Research 12(2): 143–166. https://doi.org/10.16373/j.cnki.ahr.200118 Shi SC, Shen T, Wang X, Jiang JP, Wang B (2023) Multiple data sources reveal a new Asian Leaf Litter Toad of Leptobrachella Smith, 1925 (Anura, Megophryidae) from southwestern China. Asian Herpetological Research 14: 65–94. https://doi. org/10.16373/j.cnki.ahr.220065 Smith MA (1925) Contributions to the herpetology of Borneo. Sarawak Museum Journal 3: 15–34. Smith MA (1931) The herpetology of Mt. Kinabalu, North Borneo, 13,455 ft. Bulletin of the Raffles Museum 5: 3–32. Stuart BL, Rowley JJL (2020) A new Leptobrachella (Anura: Megophryidae) from the Cardamom Mountains of Cambodia. Zootaxa 4834(4): 556–572. https://doi. org/10.11646/zootaxa.4834.4.4 Sung YH, Yang J, Wang Y (2014) A new species of Leptolalax (Anura: Megophryidae) from southern China. Asian Herpetological Research 5(2): 80–90. https://doi. org/10.3724/SP.J.1245.2014.00080 Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis version 11. Molecular Biology and Evolution 38(7): 3022–3027. https://doi. org/10.1093/molbev/msab120 Taylor EH (1962) The amphibian fauna of Thailand. The University of Kansas Science Bulletin 43(8): 265–599. https://doi.org/10.5962/bhl.part.13347 Veith M, Fromhage L, Kosuch J, Vences M (2006) Historical biogeography of Western Palaearctic pelobatid and pelodytid frogs: A molecular phylogenetic perspective. Contributions to Zoology (Amsterdam, Netherlands) 75(03–04): 109–120. https:// doi.org/10.1163/18759866-0750304001 Vences M, Thomas M, Van der Meijden A, Chiari Y, Vieites DR (2005) Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians. Frontiers in Zoology 2(1): 5. https://doi.org/10.1186/1742-9994-2-5 Wang J, Yang JH, Li Y, Lyu ZT, Zeng ZC, Liu ZY, Ye YH, Wang YY (2018) Morphology and molecular genetics reveal two new Leptobrachella species in southern China (Anura, Megophryidae). ZooKeys 776: 105–137. https://doi.org/10.3897/zookeys.776.22925 Wang J, Li YL, Li Y, Chen HH, Zeng YJ, Shen JM, Wang YY (2019) Morphology, molecular genetics, and acoustics reveal two new species of the genus Leptobrachella from northwestern Guizhou Province, China (Anura, Megophryidae). ZooKeys 848: 119– 154. https://doi.org/10.3897/zookeys.848.29181 Wang J, Lyu ZT, Qi S, Zeng ZC, Zhang WX, Lu LS, Wang YY (2020) Two new Leptobrachella species (Anura, Megophryidae) from the Yunnan-Guizhou Plateau, southwestern China. ZooKeys 995: 97–125. https://doi.org/10.3897/zookeys.995.55939 194 ZooKeys 1260: 171–194 (2025), DOI: 10.3897/zookeys.1260.161514 Wei-Cai Chen et al.: A new species of Leptobrachella from Guangxi Yang JH, Wang YY, Chen GL, Rao DQ (2016) A new species of the genus Leptolalax (Anura: Megophryidae) from Mt. Gaoligongshan of western Yunnan Province, China. Zootaxa 4088(3): 379–394. https://doi.org/10.11646/zootaxa.4088.3.4 Yang JH, Zeng ZC, Wang YY (2018) Description of two new sympatric species of the genus Leptolalax (Anura: Megophryidae) from western Yunnan of China. PeerJ 6(e4586): 1–32. https://doi.org/10.7717/peerj.4586 Yu GD, Qin K, Meng T, Li P, Peng WX, Chen WC (2024) A new species of the genus Leptobrachella (Amphibia, Anura, Megophryidae) from Dayaoshan National Nature Reserve, Guangxi, China. ZooKeys 1219: 105–122. https://doi.org/10.3897/zookeys.1219.121027 Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT (2020) PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 20(1): 348–355. https://doi.org/10.1111/1755-0998.13096 Zheng DS, Qin L (2022) Evaluation of carbon sequestration and oxygen release service function of forest vegetation in Darongshan Nature Reserve of Guangxi Autonomous region. South China Agriculture 16(18): 107–109. Ziegler T (2000) Research on the herpetofauna in a wetland preserve in the south of North Vietnam. PhD Thesis, University of Bonn. Supplementary material 1 Supplementary figure S1 Authors: Wei-Cai Chen, Yong-Jian Bei, Peng Li Data type: pdf Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/zookeys.1260.161514.suppl1 Supplementary material 2 Supplementary tables S1–S4 Authors: Wei-Cai Chen, Yong-Jian Bei, Peng Li Data type: xlsx Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/zookeys.1260.161514.suppl2