Full text
SCIENCE AND INNOVATION INTERNATIONAL SCIENTIFIC JOURNAL VOLUME 4 ISSUE 11 NOVEMBER 2025 ISSN: 2181-3337 | SCIENTISTS.UZ 34 INFLUENCE OF THE T3SS SYSTEM OF NODULE BACTERIA ON THE IMMUNE SYSTEM OF LEGUMEN PLANTS B.R. Umarov Ph.D., Senior Researcher, Tashkent Research Institute of Vaccines and Serums Republic of Uzbekistan, Tashkent, 100084, Chingiz Aitmatov St., 37 https://doi.org/10.5281/zenodo.17693923 Abstract. Rhizobia’s are soil bacteria capable of entering into symbiotic relationships with legumes. As a result, nodules form on the roots of host plants, where the rhizobium differentiates into bacteroids capable of fixing atmospheric nitrogen into ammonia. This ammonia is transferred to the plant in exchange for a carbon source and a favorable environment for bacterial survival. This process is strictly regulated by several control points that allow the infection to develop or be limited. The 3rd type of secretory system (T3SS) is a secretory system that injects proteins called effectors (T3E) directly into the host cell's cytoplasm, altering the host's metabolic pathways or suppressing the host's defense reactions. This secretory system may be absolutely necessary for the formation of tubers or blocking the formation of tubers in various types of leguminous plants. Rhizobial effectors influence the symbiotic phenotypes of plants. These phenotypes are diverse and emphasize the importance of T3SS in some symbioses of rhizobia and legumes. Keywords: 3rd type secretion system, T3SS, effector, symbiosis, rhizobium. INTRODUCTION The secretion of bacterial proteins is a key aspect of interaction between bacteria and their host plants [1]. However, to overcome the membrane of 9 bacterial protein secretions for the plant cell, bacteria developed seven specialized secretion systems (type’s I-IX), five of which encompass the bacterial double membrane [2]. Among them, T3SS represents a complex and wellstudied system that directly delivers effector proteins from the cytoplasm of gram-negative bacteria to eukaryotic organisms [3]. Pathogens use a set of effector proteins to facilitate their entry into host plants [4, 5, 6, 7, 8]. Recently, there have been many scientific studies on genomic secreted effector proteins. Bacterial phytopathogen T3SS can be used as an effector screening in plant cells. Studying this process is necessary to understand the interaction between plants and pathogens, as well as to develop crop resistance to diseases. Tuberous bacteria belonging to the genus Rhizobium, which live on the roots of leguminous plants, form symbiotic relationships with the latter. Penetrating the roots of plants and accumulating bacteroids, they form new organs - tubers. As a result of biochemical processes involving the bacterial nitrogenaza enzyme within the tubers, the reduction of molecular nitrogen (N2) to ammonia (NH3), available to plants, is catalyzed, allowing plants to actively feed on free nitrogen. In response, the plant provides bacteria with nutrients and shelter. This symbiosis, in turn, affects the plant's immune system. The immunity of a bean plant infected with root-growing bacteria is a complex phenomenon related to the symbiotic relationship between the plant and the bacteria. This immunity includes both innate plant defense mechanisms and adaptive reactions induced by symbiosis. T3SS (Type three secretion system) in Rhizobium genus bacteria is used to deliver effector proteins to host plant cells, which contributes to the formation and functioning of nodules, which
SCIENCE AND INNOVATION INTERNATIONAL SCIENTIFIC JOURNAL VOLUME 4 ISSUE 11 NOVEMBER 2025 ISSN: 2181-3337 | SCIENTISTS.UZ 35 affects nitrogen fixation efficiency. Rhizobium, Sinorhizobium, and Bradyrhizobium use T3SS to establish symbiotic relationships with leguminous plants. NopAA (GunA) in Sinorhizobium fredii belongs to the family of glycosidohydrolases 12 (GH12) and exhibits cellulose-xyloglucan activity, which is necessary for the destruction of soybean cell walls and promotes rhizobial infections. NopL, NopAB, NopC, NopE, and InnB are also specific effects for rhizobia. NopAB ORS3257 is the main effector determining the effectiveness of tubers in Vigna mungo and Vigna unguiculata. These proteins, introduced by bacteria into the host cell, can alter their functions. For example, suppressing the immune response or stimulating the reproduction of bacteria. In plant cells, effector proteins, which regulate cellular processes, contribute to the formation of Nod factors and the functioning of nodules. In some cases, T3SS can act independently of Nod factors. They play an important role in the initial stages of root infection, bacterial invasion of cells, and the formation of nodules. Effects delivered by T3SS can alter the cell's cytoskeleton, suppress the plant's immune response, and promote bacterial growth within the tubers. Different species of rhizobia can use different sets of effector proteins delivered through T3SS, which can affect the specificity of symbiosis and nitrogen fixation efficiency (Figures 1 and 2). From soybean tubers grown in Central Asian soils, we isolated tubers of the genus Sinorhizobium fredii and studied effector proteins, a complex process involving innate and induced defense mechanisms, as well as adaptation. Figure 1. T3SS components are identified using a unified nomenclature of Sct names {secretion and cellular translocation}. The figure shows the state of effector protein secretion. Om - outer membrane; PM - plant membrane; IM - inner membrane.
SCIENCE AND INNOVATION INTERNATIONAL SCIENTIFIC JOURNAL VOLUME 4 ISSUE 11 NOVEMBER 2025 ISSN: 2181-3337 | SCIENTISTS.UZ 36 Figure 2. The scheme of nodule formation using rhizobia (A) is accompanied by rhizobial colonization, infection, and invasion of NOD factors and flavonoids, as well as anaerobic processes during the tuber formation process. (B) Rhizobial external polysaccharides [exopolysaccharides (EPS), lipopolysaccharides (LPS), K-antigen polysaccharides (KPS) and cyclin glucans (CG) ] are necessary for the development of symbiosis as signaling molecules or as branches from other signaling molecules, as information carriers. (C) Effects of translocation of rhizobial secretion (T3SS), IV type of secretion (T4SS) or VI type of secretion (T6SS), modulating the host's response to bacterial infection. T6S can be used as a vehicle for killing with rhizospheric bacteria. MATERIALS AND METHODS: Cultivated soybean strains were grown in the experimental fields of the Research Institute. Tubers from 30-day-old plants were collected and used to isolate rhizobium using the method described earlier [8] with some modifications. Strains were sown in strips until individual colonies were obtained three times to ensure the purity of the culture. Colonies of different sizes and colors were representatively selected for PCR analysis of colonies to amplify the 16s rRNA gene. Colony PCR and sequencing: For PCR of the 16S rRNA gene, universal primers were used as described in the works of B. Umarov [8]. Test for tuber formation: isolated strains were inoculated with plants. Water and a Hoagland R.D. solution were used as controls [9]. The tubers were counted and then collected for weight and size measurement, preparation, and observation of color 2 weeks after inoculation. RESULTS: Isolation of rhizobia strains from soybean nodules from tested colonies that underwent PCR showed the presence of PCR products in 50 colonies without differences in amplicon size. 10 randomly selected PCR products for sequencing showed that five isolates belonged to the genus Bradyrhizobium with two unique sequences of 16S rRNA. Below we present PCR data with the search and amplification of node-forming genes on plant roots. • Nucleotide-nucleotide BLAST (blastn) • gi|37693290|emb|AJ560651.1|BSP560651 Bradyrhizobium sp. ISLU256 partial nodC gene for N-acetylglucosaminyltransferase, strain ISLU256 Length = 960 Score = 85.7 bits (43), Expect = 2e-13 Identities = 43/43 (100%) • Strand = Plus / Plus Query: 42 catatggtcgacctgcaggcggccgcgaattcactagtgatta 84 |||||||||||||||||||||||||||||||||||||||||||Sbjct: 17 catatggtcgacctgcaggcggccgcgaattcactagtgatta 59 Translated query vs. protein database (blastx) gi|37693291|emb|CAD90583.1|
SCIENCE AND INNOVATION INTERNATIONAL SCIENTIFIC JOURNAL VOLUME 4 ISSUE 11 NOVEMBER 2025 ISSN: 2181-3337 | SCIENTISTS.UZ 37 • N-acetylglucosaminyltransferase [Bradyrhizobium sp. ISLU256] Length = 320 Score = 33.5 bits (75), Expect = 7.9 Identities = 14/15 (93%), Positives = 14/15 (93%) • Frame = +2 Query: 38 LSYGRPAGGREFTSD 82 L YGRPAGGREFTSDSbjct: 5 LPYGRPAGGREFTSD 19 • Nucleotide-nucleotide BLAST (blastn) • >gi|37693290|emb|AJ560651.1|BSP560651 Bradyrhizobium sp. ISLU256 partial nodC gene for N-acetylglucosaminyltransferase, strain ISLU256 Length = 960 Score = 117 bits (59), Expect = 7e-23 Identities = 59/59 (100%) • Strand = Plus / Plus Query: 23 gcgttgggagctctcccatatggtcgacctgcaggcggccgcgaattcactagtgatta 81 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||Sbjct:1gcgttgggagctctcccatatggtcgacctgcaggcggccgcgaattcactagtgat ta 59 • Translated query vs. protein database (blastx) gi|37693291|emb|CAD90583.1| Nacetylglucosaminyltransferase [Bradyrhizobium sp. ISLU256] Length = 320 Score = 43.5 bits (101), Expect = 0.012 Identities = 19/19 (100%), Positives = 19/19 (100%) • Frame = +2 Query: 23 ALGALPYGRPAGGREFTSD 79 ALGALPYGRPAGGREFTSDSbjct: 1 ALGALPYGRPAGGREFTSD 19 Characteristics of the isolated strains. These Bradyrhizobium strains formed nodules using Nod genes on the roots of all soybean plants inoculated with these strains. CONCLUSION: The role of the type 3 secretory system of Rhizobial bacteria in the symbiosis of plants with bacteria is the first evidence of the penetration of microorganisms into a foreign organism using Rhizobial T3SS. These systems are also present in many microbes, Sinorhizobium fredii. Evidence has also been obtained that S.fredii releases certain proteins into the extracellular environment during flavonoid induction. In our experiments, the data shows that they have an impact: they are necessary for the formation of nodules. Studying the role of T3S in creating chemical barriers for pathogenic bacteria, we came to the conclusion that the structural and functional properties of the T3S complex and posttranslational modifications of T3S subunits affect the secretion of effectors. Therefore, we have studied the possibility of interaction of pathogenic bacteria with effector molecules. To better understand the regulation of T3S, we tested the Nod genes to see if the secretion complex could influence signaling processes. To better understand the regulation of T3SS, we investigated new proteins that may influence the signaling processes preceding the secretory system complex. In these studies, we have identified several uncharacterized proteins that may play a crucial role in the regulation of T3SS. REFERENCES 1. Deng W., Marshall N.C., Rowland J.L et all., Assembly, structure, function and regulation of type III secretion systems. Nat. Rev. Microbiol. 2017. 15, 323–337. 2. Costa T.R., Felisberto-Rodrigues C., Prevost et all. Secretion systems in Gram-negative bacteria: structural and mechanistic insights. Nat. Rev. Microbiol. 2015, 13, 343–359. [ 3. GaLanl G.E., CoLLmer A. Type III secretion machines: bacterial devices for protein delivery into host cells. Science. 1999, 284, 1322–1328. 4. Hann D.R., Gimenez-Ibanez S., Rathjen JP. Bacterial virulence effectors and their activities. Curr. Opin. Plant Biol. 2010, 13, 388–393.
SCIENCE AND INNOVATION INTERNATIONAL SCIENTIFIC JOURNAL VOLUME 4 ISSUE 11 NOVEMBER 2025 ISSN: 2181-3337 | SCIENTISTS.UZ 38 5. Koeck M., Hardham A.R., Dodds P.N. The role of effectors of biotrophic and hemibiotrophic fungi in infection. Cell Microbiol. 2011, 13, 1849–1857. 6. Sharma S., Hirabuchi A., Yoshida, K. et all. Deployment of the Burkholderia glumae type III secretion system as an efficient tool for translocating pathogen effectors to monocot cells. Plant J. 2013, 74, 701–712. 7. J.HM Stassen., Guido Van den Ackerveken. How do oomycete effectors interfere with plant life? Curr. Opin. Plant Biol. 2011, 14, 407–414. 8. B.R. Umarov. Nodule formation on soybean roots. Journal Science and Innovation. 2024. Volume 3. Issue D8.Pages 57-59. 9. Ali Majidi., Reza Shahhoseini., Hossein Salehi-Arjmand et all. Effect of Hoagland’s nutrient solution strengths and sodium silicate on growth, yield and biochemical parameters of Carla (Momordica Charantia L.) under hydroponic conditions. Scientific Reports volume 15, Article number: 7838.2025.