Argostemma sawmlianae (Rubiaceae, Argostemmateae), a new species from Northeast India under the Indo-Burma Hotspot

317 Argostemma sawmlianae (Rubiaceae, Argostemmateae), a new species from Northeast India under the Indo-Burma Hotspot Margaret Lalhlupuii1, Lal Tlanhlui1, Sandhyarani Devi Khomdram1, Sanatombi Devi Yumkham2 1 Department of Botany, Mizoram University, Aizawl–796004, Mizoram, India 2 Department of Life Sciences (Botany), Manipur University, Canchipur–795003, India Corresponding authors: Sandhyarani Devi Khomdram (sandhyakhomdr[email protected]); Sanatombi Devi Yumkham ([email protected]) Copyright: © Margaret Lalhlupuii et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract Argostemma sawmlianae (Rubiaceae), a new species from Mizoram, Northeast India, within the Indo-Burma hotspot, is described and illustrated. The species is compared with its allied species A. courtallense and A. sarmentosum, from which it differs by a set of distinctive morphological characters that include a pair of larger sessile leaves (11.5–18.5 cm long), longer peduncle (4–6.5 cm long), more flowers per cyme (8–33) and campanulate corolla with falcate lobes, reflexed and prominently rolled backward. The molecular analyses based on matK (cpDNA) and ITS2 (nrDNA) sequences support the morphological evidences confirming A. sawmlianae as a distinct new species. The newly discovered species is provisionally categorized as Critically Endangered (CR) in accordance with the IUCN Red List Categories and Criteria (IUCN 2024) based on available data. Key words: Argostemma, Indo-Burma hotspot, Mizoram, molecular, morphology, new species Introduction Argostemma Wall. (Wallich 1824: 324) is a genus that includes terrestrial and occasionally lithophytic or epiphytic herbaceous species. Most of the species are found widely distributed in tropical and sub-tropical Asia with the exceptions of Argostemma africanum K.Schum. (Schumann 1896: 423) and A. pumilum Benn. (Bennet 1838: 95) which are endemic to tropical Africa. Among the four subfamilies of Rubioideae under Rubiaceae, the tribe Argostemmateae, represents the largest genus with 220 described species (Verdcourt 1958; Bremer 1989; Sridith 2007; Bremer and Manen 2000). In India, the distribution of the genus is primarily confined to the Northeastern states and the Western Ghats which is evident from the reported cases of nine species so far, including the recent addition of Argostemma quarantena Balan & Robi (Balan et al. 2021: 48) and A. kamjongense Sadokpam, S.D.Khomdram & S.D.Yumkham (Sadokpam et al. 2023: 78). It may be noted that four species namely A. verticillatum Wall. (Wallich 1824: 325), A. sarmentosum Wall. (Wallich 1824: 324), A. fragile E. T. Geddes (Geddes 1927: Academic editor: Andre Simões Received: 19 June 2025 Accepted: 13 November 2025 Published: 25 November 2025 Citation: Lalhlupuii M, Tlanhlui L, Khomdram SD, Yumkham SD (2025) Argostemma sawmlianae (Rubiaceae, Argostemmateae), a new species from Northeast India under the IndoBurma Hotspot. PhytoKeys 266: 317–328. https://doi.org/10.3897/ phytokeys.266.162537 PhytoKeys 266: 317–328 (2025) DOI: 10.3897/phytokeys.266.162537 318 PhytoKeys 266: 317–328 (2025), DOI: 10.3897/phytokeys.266.162537 Margaret Lalhlupuii et al.: Discovery of a new Argostemma species from Northeast India 166), and A. khasianum C.B. Clarke (Clarke 1880: 43) have been reported so far from the state of Mizoram. (Choudhury 2002; Panday et al. 2020). During June 2022 to October 2024, botanical field explorations in Mizoram led to the collection of an unidentified species of Argostemma from the forest of Lungleng village, situated about 20 km from Aizawl. Mizoram, one of the North-eastern states of India, is situated at the confluence of the IndoMalayan and Indo-Chinese biogeographic regions, which are part of the IndoBurma Biodiversity Hotspot, renowned for its rich floral diversity, including numerous endemic taxa. Based on morphological, palynological, molecular investigations, literature survey and herbarium specimen consultation, the Mizoram Argostemma plant was found to be an undescribed species. Molecular database of the newly described Argostemma species (matK and ITS2) was generated and phylogenetic analysis confirmed its novelty as a new species, and we hereby describe it as Argostemma sawmlianae. Materials and methods Morphological analyses Specimens of an unidentified Argostemma were collected during extensive field surveys from Mizoram during 2022–2024. Measurements of all morphological characteristics of the new species were taken from fresh samples collected from the type locality. Relevant literature (such as Hooker 1880; Ridley 1923, 1927; Bremer 1989; Sridith 1999, 2007; Sridith and Puff 2000; Choudhury 2002; Chen et al. 2011; Panday et al. 2020) and Argostemma materials from several herbaria (ARUN, ASSAM, CAL) were consulted. Additionally, numerous digital specimens, including type and general herbarium specimens, were examined from online resources such as the Natural History Museum, London (BM; https://www.nhm.ac.uk) and the Royal Botanic Gardens, Kew (K; https://data.kew.org) to confirm the novelty of the species. High resolution specimen images were also consulted from major global databases, including the Global Biodiversity Information Facility (https://www.gbif.org), JSTOR Global Plants (http://plants.jstor.org), Missouri Botanical Garden-TROPICOS (https://tropicos.org), Plants of the World Online (https://powo.science.kew.org). Terminology used in describing the new species follows Beentje (2016). The conservation status was assessed as per IUCN Red List Categories and Criteria (IUCN 2024). Photographs were taken by using DSC–W610 digital camera (Sony, Tokyo, Japan) and BT-E Benchtop biological digital microscope (Cilika, Thane, India). The palynological studies were done using fresh pollens and the size was expressed as Polar axis (P) × Equatorial axis (E) in micrometre (µm) (Schlag-Edler and Kiehn 2001). Terminologies given by Punt et al. (2007) and Halbritter et al. (2018) are used for describing the pollen characters. Seeds and pollen grains prepared for micromorphological analysis were dehydrated, subjected to critical point drying, and mounted on stubs coated with gold using Fine Coat Ion Sputter JFC-1100. The samples were subsequently examined and microphotographs were obtained using field emission scanning electron microscope (JEOL JSM-6360, Freising, Germany). 319 PhytoKeys 266: 317–328 (2025), DOI: 10.3897/phytokeys.266.162537 Margaret Lalhlupuii et al.: Discovery of a new Argostemma species from Northeast India Molecular analyses Genomic DNA from the fresh sample of the newly described Argostemma was extracted using CTAB method (Doyle and Doyle 1987). PCR amplification was done using matK (cpDNA) primer (FCGTACAGTACTTTTGTGTTTACGAG; R-ACCCAGTCCATCTGGAAATCTTGGTTC) and ITS2 (nrDNA) primer (FATGCGATACTTGGTGTGAAT; RGACGCTTCTCCAGACTACAAT). The PCR product was sequenced using Sanger sequencing method. The determined matK and ITS2 sequences were deposited in the GenBank (www.ncbi.nlm.nih. gov/Genbank) of National Center for Biotechnology Information (NCBI) with accession No. OR555879 and PP067885 respectively. Sequences obtained for the submitted taxa and closely related species were aligned using the ClustalW algorithm implemented in MEGA X software (Cheng et al. 2022). A phylogenetic tree was constructed in MEGA X using the Maximum Likelihood method with the Kimura-2-Parameter model and a discrete Gamma distribution, supported by 1000 bootstrap replicates. The best-fit nucleotide substitution model was selected based on the lowest BIC score. Twenty-nine matK sequences of thirteen genera and twenty-five ITS2 sequences of twelve genera were obtained from GenBank and used in phylogenetic analyses, with Cinchona officinalis L. as outgroup. The resulting tree was analysed to determine the placement of the sequences about the known taxa. The NCBI accession numbers of the Rubiaceae members including the outgroup used in this study are detailed in Suppl. material 1: table S1. Taxonomy Argostemma sawmlianae Lalhlupuii, Tlanhlui, S.D.Khomdram & S.D.Yumkham, sp. nov. urn:lsid:ipni.org:names:77363110-1 Figs 1–3 Type. IndIa. • Mizoram, Aizawl district, Lungleng village, 23.66581, 92.66353, 1003 m alt., 05 July 2022, Lalhlupuii 128870 (holotype: ASSAM!; isotype: MZUH!, MUMP!). Diagnosis. It is similar to Argostemma courtallense Arn. and A. sarmentosum Wall., but differs from the two in having one pair of larger sessile leaves (11.5– 18.5 cm long), longer peduncle (4–6.5 cm long), more flowers per cyme (8–33), and campanulate corolla with falcate petals which are reflexed and strongly rolled backwards (Fig. 3, Table 1). Description. Epilithic, perennial herb, 7–17 cm tall, attached to substratum with dense, much-branched, non-tuberous matted roots. Stem semi-erect, terete, unbranched, 1.5–7 cm long, greenish white, pubescent. Leaves opposite, strongly anisophyllous, paired, sessile, reticulate eucamptodromous, secondary veins 6, ovate, 11.5–18.5 × 10–13.3 cm, base cordate, margin entire, apex acute, pubescent on both sides; small pair of rudimentary leaves, sessile, broadly ovate to elliptic, 3–7 × 3–4 mm, green, pubescent. Stipule sessile, ovate, 5–7 × 3–4 mm, base cordate, apex acute, green, margin pubescent. Inflorescence umbelliform, flowers basipetal, single, rarely 2–4, 8–33 flowered. Bracts foliaceous, 4–6, fused, unequal size, whorled, elliptic to ovate, 320 PhytoKeys 266: 317–328 (2025), DOI: 10.3897/phytokeys.266.162537 Margaret Lalhlupuii et al.: Discovery of a new Argostemma species from Northeast India Figure 1. Argostemma sawmlianae Lalhlupuii, Tlanhlui, S.D.Khomdram & S.D.Yumkham, sp. nov. A, B. Habit; C. Anisophyllous leaves with inflorescence (inverted view); D. Leaf with stipule; E, F. Anisophyllous leaves; G. Flower with bract; H. Inflorescence; I. Foliaceous bracts; J. Rudimentary leaves; K. Petaloid calyx with green tips; L. Corolla with green blotched tubes; M. Corolla with reflexed and backwardly rolled lobes; N. Single falcate shaped corolla lobe; O. Corolla lobes; P. Single stamen with curved filament; Q. Androecium with loosely arranged stamens. (photos by Margaret Lalhlupuii & Lal Tlanhlui). 321 PhytoKeys 266: 317–328 (2025), DOI: 10.3897/phytokeys.266.162537 Margaret Lalhlupuii et al.: Discovery of a new Argostemma species from Northeast India Figure 2. Argostemma sawmlianae Lalhlupuii, Tlanhlui, S.D.Khomdram & S.D.Yumkham, sp. nov. A. Single flower; B. Pistil; C. Cross section of ovary; D. Seeds (LM image); E. Seed (SEM image); F. Pollen (SEM image); G. A. sawmlianae in type locality; H, I. A. verticillatum from Manipur; J. A. kamjongense from Manipur; K. A. sarmentosum from Meghalaya. (photos by Margaret Lalhlupuii, Lal Tlanhlui & Yumkham). 322 PhytoKeys 266: 317–328 (2025), DOI: 10.3897/phytokeys.266.162537 Margaret Lalhlupuii et al.: Discovery of a new Argostemma species from Northeast India Figure 3. A. Holotype of Argostemma sawmlianae Lalhlupuii, Tlanhlui, S.D.Khomdram & S.D.Yumkham, sp. nov. (Lalhlupuii 128870, ASSAM!); B. Herbarium Specimen of A. courtallense [K000030994] (reproduced with permission from http://specimens.kew.org/herbarium/K000030994); C. Herbarium specimen of A. sarmentosum [K000030998] (reproduced with permission from http://specimens.kew.org/herbarium/K000030998); D. Herbarium specimen of A. sarmentosum [MUMP001591] 323 PhytoKeys 266: 317–328 (2025), DOI: 10.3897/phytokeys.266.162537 Margaret Lalhlupuii et al.: Discovery of a new Argostemma species from Northeast India 8–11 × 4–6 mm, green, margin pubescent, whorled, isomorphic with number of inflorescences (1–4); peduncle 4–6.5 cm long, greenish white, glabrous. Flowers pedicellate, 4-merous, actinomorphic, 1.8–2.2 cm, pedicel 7–10 mm long, white, pubescent. Calyx 4-lobed, lobes basally connate, ovate, 6–10 × 4–5 mm, petaloid, white, calyx teeth tip green, become completely green after anthesis, glabrous. Corolla 4, white, falcate, 6–8 × 2–3 mm; ¾ lobes reflexed, tube green blotched, 1–2 × 1–3 mm, tuff haired at tip of corolla lobe. Stamens 4, equal, anthers free, loosely arranged, basifixed, 6 mm long, yellow, exserted from the corolla tube, glabrous; filaments 2–3 mm, free, S-like curvature, white. Style 1–1.2 cm long, white, glabrous; stigma club shaped, yellow; ovary inferior, bilocular, axile placentation, hairy; ovule numerous, yellow. Seeds numerous, minute, triangular, 600 × 300 μm, black, testa reticulate, central mamilla in each cavity (Fig. 2D, E). Pollen grains. Monad, heteropolar, very small 8–9 × 8–9 µm, triangular amb, isodiametric (P/E ratio 1), triradiate colpi (dry) (Fig. 2F). Phenology. Flowering from June–July and fruiting from July–August. Distribution and ecology. The plant was found growing on a damp rockwall along a stream with mosses, pteridophytes (Selaginella sp., Asplenium sp.) and Begonia spp. (Begoniaceae). The plant was collected from Lungleng village in Aizawl District of Mizoram, India which is located at 23°39'57"N, 92°39'41"E, south of Aizawl city. Positioned at an elevation of 1011 m above sea level, Lungleng receives an average annual rainfall of about 2500 mm, with temperature ranging from 26 °C–31 °C. The settlement lies atop a hill and is encircled by a narrow belt of dense community reserve forest comprising subtropical broad-leaved evergreen mixed forest and with patches of secondary forest surrounding the reserved area. Conservation status. The newly described species was found growing as a lithophyte at its type locality only, represented by a single population of 39 mature individuals which are less than 50. The habitat which is situated along a roadside faces significant threats from frequent landslides and ongoing Table 1. Comparison of Argostemma sawmlianae, A. courtallense and A. sarmentosum. Characters A. sawmlianae A. courtallense A. sarmentosum Rhizomes Non-tuberous Tuberous Tuberous Stem size 1.5–7 cm 8–20 cm 10–20 cm Leaves 1-pair, anisophyllous, broadly ovate to elliptic, 11.5–18.5 cm long 2-pairs, isophyllous, elliptic ovate, 7 cm long 2-pairs, anisophyllous, elliptic ovate, 2–10 cm long Stipule Ovate, 5–7 × 3–4 mm Ovate, 7–8 × 1–2 mm Broadly ovate or elliptic, 1.5–2 × 2 mm Petiole Sessile 0–2 cm 0.2–0.3 cm Number of flowers per cyme 8–33 flowered 3 to many flowered 6–10 flowered Bract 4–6, basally connate Free 2–3, free Peduncle 4–6.5 cm 3–6 cm 3–6 cm Calyx Lobes 4, 6–10 × 4–5 mm, sequential colour changes from white to green Lobes 4, 3 × 2 mm, sequential colour changes from white to green Lobes 5, 9–10 × 4–5 mm long, persistent green Corolla Campanulate, lobes falcate, 7–10 × 3–6 mm, reflexed and strongly rolled backwards Star shaped, lobes ovate, 7–8 × 2–2.5 mm, not reflexed Star shaped, lobes narrowly triangular, 7–8 × 2.5–3 mm, rarely reflexed Stamen Filament 2–3 mm, anther 6 mm Flament 3 mm, anther 3 mm Filament 2.5–2.8 mm, anther 6 mm 324 PhytoKeys 266: 317–328 (2025), DOI: 10.3897/phytokeys.266.162537 Margaret Lalhlupuii et al.: Discovery of a new Argostemma species from Northeast India developmental activities such as road construction and expansion. The estimated area of occupancy (AOO) is less than 10 km2. Based on current field observations, the species is provisionally assessed as Critically Endangered [CR B2 ab (ii, iii, v) c (ii, iii, iv) D] according to the IUCN Red List Categories and Criteria (IUCN 2024). Further research is necessary for thorough and long-term population assessment to yield a more precise conservation evaluation. Etymology. The specific epithet sawmlianae is to honour Mal Sawmliana, a forest conservator and naturalist, as a recognition of his efforts and contribution in exploring the flora and fauna for conservation measures in Mizoram. Suggested common name. Sawmliana par (Mizo) Molecular studies of Argostemma sawmlianae After analysis of the matK and ITS2 sequences from Argostemma sawmlianae, it was observed that the consensus length of the matK sequence is 766 bp with 29.51% G:C content and that of ITS2 is 438 bp with 52.69% G:C content. A Maximum Likelihood (ML) tree was constructed using matK and ITS2 sequences in MEGA X (Molecular Evolutionary Genetics Analysis, X) to analyze the placement of A. sawmlianae among different members of Rubiaceae with Cinchona officinalis as an outgroup species (Figs 4, 5). Figure 4. Phylogenetic tree of Argostemma sawmlianae reconstructed based on Maximum Likelihood (ML) as a cladistic method comprising 31 matK nucleotide sequences using MEGA X. Red solid circle indicates the placement of A. sawmlianae among A. hookeri, A. yappi and Argostemma sp. in the phylogenetic tree. 325 PhytoKeys 266: 317–328 (2025), DOI: 10.3897/phytokeys.266.162537 Margaret Lalhlupuii et al.: Discovery of a new Argostemma species from Northeast India Phylogenetic analyses based on matK and ITS2 regions of the newly described species and available database from NCBI (Suppl. material 1: table S1) confirmed the placement of the newly described species within Argostemma (Rubiaceae). These findings align with Bremer (2009), who established the monophyly of the Rubiaceae family. The matK phylogenetic tree shows that A. sawmlianae clusters closely with A. hookeri King and A. yappii King, supported by bootstrap values ranging from 45 to 98. Similarly, in the ITS2 phylogenetic tree, A. sawmlianae forms a well-supported clade with A. yappii (bootstrap 85), together constituting a distinct Argostemma group. The genomic data for allied taxa Argostemma courtallense Arn. and A. sarmentosum Wall. were not available in the NCBI database, and therefore, these species could not be included in the phylogenetic analysis. Discussion The comparative analyses based on morphological characters confirm that Argostemma sawmlianae sp. nov. is morphologically distinct from closely related species such as A. courtallense and A. sarmentosum (Table 1). Key differentiating traits include its short semi-erect stem, large anisophyllous pair of leaves, more number of flower count per cyme, uniquely connate and foliaceous bracts, glabrous peduncle and its distinctive campanulate corolla with reflexed, falcate lobes. These consistent and non-overlapping characteristics support its recognition as a novel species within the genus Argostemma. Figure 5. Phylogenetic tree of Argostemma sawmlianae reconstructed based on Maximum Likelihood (ML) as a cladistic method comprising of 27 ITS2 nucleotide sequences using MEGA X. Red solid circle indicates the placement of A. sawmlianae with A. yappi in the phylogenetic tree.