XIX international scientific conference. Vienna. Austria. 20-21.11.2025

World science priorities Proceedings of the XIX International Scientific and Practical Conference 20-21 November 2025 Vienna. Austria 2025 UDC 001.1 BBC 1 XIX International Scientific and Practical Conference « World science priorities», November 20-21, 2025, Vienna. Austria. 84 p. ISBN 978-92-44514-77-1 DOI https://doi.org/10.5281/zenodo.17723007 Publisher: «World of Conferences» Main organization: Editor: Tarmo Vesik Layout: Asko Laar The conference materials are in the public domain under the CC BY-NC 4.0 International license. The publisher is not responsible for the materials published in the collection. All materials are provided in the author's edition and express the personal position of the participant of the conference. The sample of the citation for publication is: Farid Ibrahimov CONCEPT OF "SMART CITY" WORLD EXPERIENCE AND PLANS OF AZERBAIJAN // XIX International Scientific and Practical Conference «World science priorities», November 20-21, 2025, Vienna. Austria Pp.15-17. URL: https://conference-w.com/ Contact information Website: https://conference-w.com/ E-mail: [email protected] Content Agricultural sciences Lushchak Pavel Vasilievich, Amantaev Bekzak Omirzakovich, Tursynbekov Alibi Galymbekovich KAZAKHSTAN: GENOTYPING OF WHEAT VARIETIES USING "SNP AMPLIFLUOR" MARKERS FOR DROUGHT TOLERANCE 5 Arts Turlybay Aruzhan, Kenzikeev Ruslan COMPARATIVE ANALYSIS OF LITERARY IMAGERY AND ITS STAGE INTERPRETATION IN KAZAKHSTAN CHOREOGRAPHY 14 Biological sciences Biymyrsaeva Aidana Kamchybekovna, Myrzagalieva Elnura Baiterekovna DYNAMICS OF DEVELOPMENT PHASES OF MEDICINAL AND ESSENTIAL OIL PLANTS OF FOREIGN FLORA IN THE CHUI VALLEY 17 Chemical sciences Indira Rakhmatillayeva, Mavluda Yusupova, Mansur Ashirov ECO-FRIENDLY, LOW-COST, AND REUSABLE FIBER-OPTIC SENSOR FOR ENVIRONMENTAL MONITORING: DEVELOPMENT OF THE MORDANT BLUE 9 / PPA-1 SYSTEM 18 Avazyazov M.A., Ashirov M.A., Shaxidova D.N., Yusupova M.R. XRF ANALYSIS OF FERRON-MODIFIED SILK FIBROIN: SYNTHESIS, ACTIVATION, AND ELEMENTAL PROFILING 21 Sabirov N.Sh., Ashirov M.A., Palvanov N.S., Shaxidova D.N. HIGHLY EFFICIENT CAPTURE OF SILVER BY TIRON-FUNCTIONALIZED POLYETHYLENEPOLYAMINE FIBER: INSIGHTS INTO SILVER CHLORIDE PRECIPITATION AND ANALYTICAL INTERFERENCE VIA ADVANCED WAVELENGTH-DISPERSIVE X-RAY FLUORESCENCE SPECTROSCOPY 25 S.F. Samandarova, M.M. Boltayeva, M.A. Ashirov, Z.A. Smanova SPECTROPHOTOMETRIC DETERMINATION OF Co (II) IONS USING THE ERIOCHROME BLACK T REAGENT IMMOBILIZED ON FIBROIN FIBER TREATED WITH HIGH-FREQUENCY RADIATION 27 Pedagogical sciences Ayshan Nazim Rzayeva AI IN THE CLASSROOM: MAKING LEARNING PERSONAL, NOT AUTOMATED 29 Bazarova Dinara Askarovna, Koyanbekova Sara Bariyevna CONTEMPORARY FOREIGN-LANGUAGE HIGHER EDUCATION: THE FORMATION OF PROFESSIONALLYORIENTED COMPETENCE 32 Kazimli Farida Elchin gizi EDUCATORS FACING TECHNOPEDAGOGY 41 Olena Lutsenko THE IMPACT OF TEACHER WELL-BEING ON STUDENT MOTIVATION 45 Mariia Demyda, Olena Yashchuk ORGANIZATION OF THE EDUCATIONAL SPACE OF PRIMARY SCHOOL STUDENTS IN THE CONTEXT OF THE NEW UKRAINIAN SCHOOL: THEORY AND PRACTICE 47 Philological sciences Gulshan Jalal Musayeva HOW TO OVERCOME HIGH-CONTEXT vs LOW-CONTEXT MISCOMMUNICATION 49 Inna R. Sargsyan PERSPECTIVES OF COMPARATIVE RESEARCH (DIACHRONY–SYNCHRONY) 54 Mushfıg Chobanov (Borchalı) CONTEMPORARY AZERBAIJAN-GEORGIAN LITERARY RELATIONS: MADAD CHOBANOV AND LEYLA ERADZE 61 Aytan Parviz Mamedova, Aysel Nizami Baghirova ARTISTIC FEATURES OF V. V. MAYAKOVSKY’S SATIRE 76 Technical sciences Zhanuzakova NazerkeKazybekovna, Kassymov Samat Kairatovich ECONOMIC EFFICIENCY OF PRODUCING NEW NATURAL MEAT PRODUCTS BASED ON ZERO-WASTE TECHNOLOGY 80 M.A. Rustamova, G.A. Mammadova, R.J. Mammadova, L.N. Hasanova FREE VIBRATIONS OF TWO CONCENTRIC CYLINDRICAL SHELLS CONTAINING AN INTERMEDIATE FLUID LAYER 83 XIX international scientific conference. Vienna. Austria. 20-21.11.2025 5 Agricultural sciences KAZAKHSTAN: GENOTYPING OF WHEAT VARIETIES USING "SNP AMPLIFLUOR" MARKERS FOR DROUGHT TOLERANCE Lushchak Pavel Vasilievich Master of Agricultural Sciences, Doctoral Student S. Seifullin Kazakh Agrotechnical University Astana, Kazakhstan Amantaev Bekzak Omirzakovich Candidate of Agricultural Sciences, Associate Professor S. Seifullin Kazakh Agrotechnical University Astana, Kazakhstan Tursynbekov Alibi Galymbekovich Master’s Student S. Seifullin Kazakh Agrotechnical University Astana, Kazakhstan Abstract Global climate change has intensified the frequency and severity of extreme weather events, with drought representing one of the most detrimental stresses affecting wheat production. In Kazakhstan, spring wheat is a key crop ensuring national food security, yet its yield is strongly constrained by moisture deficiency in the sharply continental agroclimatic conditions of Central and Northern regions. According to UNDP projections, if current cultivation technologies remain unchanged, spring wheat yields in Kazakhstan may decline by 13–37% by 2030 and 20–49% by 2050. Therefore, the identification of drought-tolerant and highly productive genotypes is a priority for breeding programs. This study aimed to evaluate spring bread wheat (Triticum aestivum L.) varieties using SNP-based Amplifluor genotyping to identify allelic variants associated with drought tolerance. Eleven mid-ripening spring wheat varieties, including domestic and foreign cultivars, were analyzed using SNP markers developed for the TaDr1, Dreb1, TaLTP, TaPARG-2A, TaPPH-7A, 1fehw3, and COMT3B genes. These genes are known to participate in plant responses to water deficit, chlorophyll retention, lignin biosynthesis, and yield component formation under drought conditions. Genotyping was performed on the QuantStudio 7 Flex Real-Time PCR System using allele-specific primers designed via Primer-BLAST, UGENE, and OligoCalc. The results revealed significant allelic polymorphism for most genes, enabling the clear differentiation of tested varieties. Positive homozygous alleles associated with drought tolerance were identified in several cultivars: Lamis, Courier, Akmola 2, Karabalykskaya 90, Fantaziya, and Asyl Sapa for TaDr1; Taimas and Shortandinskaya 2014 for Dreb1; Taimas for TaPARG-2A; and Courier for TaPPH-7A. All varieties showed monomorphic heterozygous profiles for the 1fehw3 gene. For COMT3B, the drought-tolerant “aa” allele was detected in Lamis, Courier, Granny, Akmola 2, Karabalykskaya 90, Fantaziya, and Shortandinskaya 2014. The comprehensive SNP screening allowed the identification of wheat varieties carrying favorable allelic combinations for drought adaptability. Among the tested cultivars, Taimas and Courier demonstrated the highest potential for use in breeding programs aimed at improving drought tolerance in spring wheat under the conditions of Northern Kazakhstan. Keywords: spring wheat; drought tolerance; SNP markers; Amplifluor genotyping; functional genes; allelic variation; Kazakhstan; molecular breeding. Introduction The consequences of global climate change have led to an increase in the frequency of extreme events. Among these events, drought is the most multifaceted and severe stress, occurring unpredictably at any stage of plant development and negatively affecting wheat yield. According to numerous studies, the actual reduction in wheat yield due to drought stress over the past 10 years has ranged from 5.5% to 12%, depending on the growing seasons and conditions [1,2]. According to UNDP experts, if current cultivation technologies are maintained, the yield of spring wheat in the main grain-growing regions of the Republic of Kazakhstan is expected to decline by 13-37% by 2030, XIX international scientific conference. Vienna. Austria. 20-21.11.2025 6 and by 20-49% by 2050 [6]. This is due to the fact that the territory of the Republic of Kazakhstan is located inland and has a heterogeneous, sharply continental agroclimatic environment. Spring wheat is the main agricultural crop ensuring food security in the Republic of Kazakhstan. The sown area of spring wheat ranges from 10.74 to 13.81 million hectares, with an average yield of 10.9 centners per hectare over the past 10 years [3]. The annual gross grain harvest in Kazakhstan averages 9.36–13.23 million tons, with the majority exported to countries in the Middle East and the European Union. The average annual precipitation in the main grain-growing regions of Central and Northern Kazakhstan is 320-350 mm, so the main limiting factor for increasing spring wheat yields in this region is moisture deficiency. Mitigating the effects of climate change remains a major challenge in the main grain-growing regions of Central and Northern Kazakhstan. One reliable strategy for mitigating the impact of abiotic stress on wheat is the selection of highly drought-tolerant varieties. The aim of the research was to use SNP-based genotyping to select spring wheat varieties characterized by high productivity and drought tolerance. Drought tolerance is a complex trait determined by many factors, and several errors occur when evaluating the drought tolerance of different varieties using a single trait or a single type of trait. Currently, no single trait can be used to completely and accurately evaluate wheat drought tolerance; therefore, the selection of more comprehensive traits and appropriate evaluation methods is very important for the evaluation of wheat varieties. In addition, there was a certain degree of correlation between many traits, which led to overlapping responses as a source of stress tolerance traits in crops. Therefore, Mdluli, S., and others recommend using a multivariate analysis method to evaluate and screen complex traits associated with drought tolerance. PCA can reduce multiple variables to several principal factors while minimizing missing data, allowing more efficient clustering of drought-tolerant genotypes [4]. Materials and Methods The objects of the laboratory research were mid-ripening spring bread wheat varieties recommended for use in the Republic of Kazakhstan: Fantaziya, Lamis, Aina, Karabalykskaya 90 (Karabalyk Agricultural Experimental Station), Tselina 50, Akmola 2, Asyl Sapa, Taimas, Shortandinskaya 2014 (A.I. Baraev Research and Production Center of Grain Farming), as well as the foreign varieties Courier (France) and Granny (Australia) [5]. Genotyping of wheat samples was carried out using SNP Amplifluor markers. The Amplifluor-like SNP assay was performed according to the published protocol by Myakishev M. and Khripin Y. (2011), which was specifically developed for the analysis of candidate genes closely linked to such an important trait as drought tolerance, using the QuantStudio 7 Flex Real-Time PCR System (ThermoFisher–ABI), with modifications [6]. SNP (single-nucleotide polymorphism) refers to a variation at a single nucleotide position in the genome [100]. Amplifluor SNP genotyping is a technology based on an allele-specific PCR platform incorporating fluorescence resonance energy transfer (FRET) [7]. Markers for the TaLTP, TaPARG, and TaPPH genes were developed for genotyping the soft wheat varieties. These genes are involved in plant responses to abiotic stresses and, in particular, influence drought tolerance in bread wheat (Triticum aestivum L.). Marker development was carried out based on annotated SNPs (single-nucleotide polymorphisms) within these genes. In total, three SNP Amplifluor markers were developed and used in this study. The principle of SNP Amplifluor markers is based on allele-specific polymerase chain reaction (PCR), which enables precise identification of single SNP differences. The main components of the reaction are probes and specific primers whose 3′-terminal nucleotide perfectly matches the SNP position. A fluorescent label attached to the probe allows detection of amplification and determination of allelic variants for genotype identification. For SNP Amplifluor genotyping, specific primers were developed for the TaDr1, DREB, TaLTP, TaPARG, TaPPH, COMT, and FEH genes, as described previously. The sequences of the primers developed for genotyping are presented in Table 5. The set of marker primers for the TaLTP gene was designed according to SNP sites located in the promoter region of TaLTP, representing a G/A variation (position 207 bp, SNP). Based on the single-nucleotide polymorphism at position 207 bp, specific primers TaLTPs-F1, TaLTPs-F2, and TaLTPs-R were developed. For the development of the next set of primers, the sequence of the TaPARG gene was used. Genomespecific primer pairs for TaPARG-2A were designed based on genomic sequence polymorphisms. In the genomic region TaPARG-2A, an SNP (C/T) located in the second exon leads to an amino acid substitution (His/Tyr). XIX international scientific conference. Vienna. Austria. 20-21.11.2025 7 In addition, another primer was developed for the TaPPH-7A gene based on an annotated SNP. This polymorphism is located at position 1299 bp, and the molecular marker contains a G nucleotide that does not match the reference C. The 1fehw3 gene is located on chromosome 6B and carries a single-nucleotide substitution (C/T), where the favorable allele “T” has a significant effect on yield components, primarily the thousand-kernel weight of bread wheat under drought conditions. The COMT gene is located on chromosomes 3A, 3B, and 3D and has two allelic variants, TaCOMT3Ba and TaCOMT-3Bb, with a “T/G” SNP substitution, respectively. These variants also differ by a 222 bp insertion/deletion (InDel) in the 3′ untranslated region (3′-UTR). Samples carrying the TaCOMT-3Ba allele, characterized by the “T” polymorphism, exhibit increased lignin content, which contributes positively to wheat drought tolerance. Table 1 Primer sequences for drought-tolerance genotyping № Primer name Oligonucleotide sequence 1 KATU-W62-SNP2 -F5S GAAGGTGACCAAGTTCATGCTAGTGGTGTCCTCCTTCTAATTT 2 KATU-W62-SNP2-F5D GAAGGTCGGAGTCAACGGATTAGTGGTGTCCTCCTTCTAATTA 3 KATU-W62-SNP2-R TCATAGGGCGAGTGTGCATA 4 KATU-Х1- -F1 GAAGGTGACCAAGTTCATGCTTGTGATATGGATTGCCTTGATGAA 5 KATU-Х1- -F2 GAAGGTGACCAAGTTCATGCTTGTGATATGGATTGCCTTGATGAC 6 KATU-Х1- -R GATGGTTTCAGCAACCGAATC 7 TaLTPs -F1 GAAGGTGACCAAGTTCATGCTGGAGAAAAGATAAGCAATCGCGGCCG 8 TaLTPs -F2 GAAGGTCGGAGTCAACGGATTGGAGAAAAGATAAGCAATCGCGGCCA 9 TaLTPs -R GGTCCTAGATGCACTTACAGTTTGAC 10 TaPARG-2A-F1 GAAGGTGACCAAGTTCATGCTGTCGACAAGATCATGGCCAGCAACAC 11 TaPARG-2A-F2 GAAGGTCGGAGTCAACGGATTGTCGACAAGATCATGGCCAGCAACAT 12 TaPARG-2A-R CTTGTTGCGCCTGGCGAGC 13 TaPPH-7A -F1 GAAGGTGACCAAGTTCATGCTGTTGTAAGACTGACATAACAATC 14 TaPPH-7A -F2 GAAGGTCGGAGTCAACGGATTGTTGTAAGACTGACATAACAATT 15 TaPPH-7A -R GCTGGCTGTAAATGTTAATGTGTCTCC 16 1fehw_F1 GAAGGTGACCAAGTTCATGCTCTCCCCCCTTCCTTCTGTCC 17 1fehw_F2 GAAGGTCGGAGTCAACGGATTCTCCCCCCTTCCTTCTGTCT 18 1fehw_R AGGAAGACGGCCCGAGCTTT 19 COMT3B_F1 GAAGGTGACCAAGTTCATGCTGTGCTCGTGGAGTGCATCCTGCCT 20 COMT3B_F2 GAAGGTCGGAGTCAACGGATTGTGCTCGTGGAGTGCATCCTGCCG 21 COMT3B_R CCTTAGGCGTCGCCTCCGGGTTCA Primer design was carried out using the bioinformatic tools Primer-BLAST, Unipro UGENE, and OligoCalc (oligonucleotide calculator). The primer design for the TaPPH gene is shown below in Figure 1 as an example. Figure 1. Primer design for TaPPH-7A: F1, F2, R Genotyping was performed on a QuantStudio 7 Flex Real-Time PCR System using the developed markers. Each reaction contained the following master mix: PCR buffer, MgCl₂ (2.5 mM), 2.5 µM fluorescent universal probe, dNTPs (2 mM), two forward primers (1.5 µM each), and 7.8 µM reverse common primer, 0.5 units of ThermoFisher DNA polymerase (ThermoFisher, USA), with the addition of 3 µL passive dye ROX XIX international scientific conference. Vienna. Austria. 20-21.11.2025 8 (ThermoFisher, USA). The master mix was dispensed into microplates, and 2 µL of genomic DNA (20 ng/µL) was added to each well. For genotyping with markers targeting the 1fehw and COMT3B genes, an increased MgCl₂ concentration of 3.5 mM was recommended. This adjustment was implemented during optimization and resulted in efficient allele discrimination. Additionally, during optimization, the genotyping program was refined, using a shortened protocol with reduced annealing temperatures. The thermal cycling conditions were as follows: initial denaturation at 95 °C for 5 min; 20 cycles of 95 °C for 10 s, 52 °C for 2 min, 94 °C for 15 s, 50 °C for 2 min, followed by 62 °C for 5 min. Results and Discussion A total of 11 spring bread wheat varieties were subjected to molecular-genetic screening. As a result of the study, the varieties were clearly distinguishable using the KATU-W62-SNP2 primer, previously developed for the TaDr1 gene, and corresponded to one of the allelic variants: either matching the 18-4 genotype ‘bb’, or the drought-tolerant, high-yielding 18-5 genotype ‘aa’ (Figure 2). a) b) (a – 11 spring bread wheat accessions, Triticum spelta (18-4), [(T. aestivum cv. Novosibirskaya 67 / T. dicoccum)] – (18-5); b – amplification during genotyping) Note: Homozygous samples ‘aa’ and ‘bb’ are indicated in red and blue, respectively. Green indicates heterozygous plants ‘ab’. The control – sterile water instead of DNA – is shown as black squares. Figure 2. Genotyping results using the KATU W-62 primer Samples separated by the FAM fluorophore, representing allele 1 and indicated in red in both technical replicates, were selected as the best genotypes for the TaDr1B transcription repressor gene. Among the 11 studied spring wheat varieties, these genotypes include Lamis, Courier, Akmola 2, Karabalykskaya 90, Fantaziya, Asyl Sapa, along with the polymorphism carrier associated with drought tolerance, T. dicoccum (18-5) (Figure 4). For the Dreb1 gene, a specific primer KATU-X1 was developed. Samples separated by the FAM fluorophore, representing allele 1 and indicated in red (‘aa’), were selected as genotypes carrying the single-nucleotide polymorphism in Dreb1, which is linked to drought tolerance in wheat. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 15 Thus, the analysis of literary sources and their stage interpretations enables the conceptualization of Kazakhstani choreography as a manifestation of cultural memory, wherein past and present, word and movement, ethnic code and artistic universality are interwoven. Main Part In contemporary Kazakhstani choreography, literary and mythological sources function as the foundational element that integrates verbal and kinetic expression within a unified artistic framework. Literary texts produced across various historical periods serve not only as sources of creative inspiration but also as methodological substrata for the formation of stage language, through which dance conveys conceptual content, affective states, and philosophical meanings [1, p. 33]. "Kozy Korpesh – Bayan Sulu" The ballet received its inaugural staging by Dauren Abirov in 1971. The musical composition was created by Evgeny Brusilovsky. The libretto, choreographic arrangement, and directorial execution were undertaken by Dauren Abirov. The scenic design was conceived by Gulfayrus Ismailova. The conductordirector was Turgut Osmanov. The literary source represents an epic narrative centered on themes of love, fidelity, and sacrifice. In the ballet adaptation, the affective foundation is retained yet expressed through choreographic dramaturgy. The literary tension between obligation and passion is rendered through rhythmic juxtapositions: lyrical pas de deux alternate with dynamic ensemble sequences that reflect societal impediments. Whereas in the textual version tragedy unfolds through linguistic means, on stage it manifests as a corporeal metaphor for destiny. The choreographic medium thereby intensifies the dramatic potency of the narrative, accentuating its emotional and spiritual dimensions [2, p. 76]. A subsequent interpretation, choreographed by Georgy Kovtun, was presented to audiences in 2021. The libretto was authored by Georgy Kovtun and Saken Nogerbek. The scenic design was executed by Andrey Zlobin. The musical score was composed by Aktoty Raikulova. The performance was accompanied by the ethno-folkloric ensemble Turan. "Karagoz" This two-act ballet is set to the musical composition of Kazakh composer Gaziza Zhubanova. The directorial work was undertaken by Vakil Usmanov. The libretto was authored by Azerbaijan Mambetov and Georgy Aleksidze, based upon the drama of the same title by Mukhtar Auezov. The premiere occurred on December 5, 2014, at the Astana Opera Theatre. The ballet adapts one of the most philosophically profound works of Kazakh drama, wherein the central conflict resides in the tension between tradition and individual agency. In the ballet version, the protagonist's tragedy is conveyed through restrained yet intense movement vocabulary. The choreography synthesizes classical and folk elements, constructing a psychological portrait of a woman divided between duty and affection. While the literary text reveals her internal discourse through linguistic means, the stage version achieves this through facial expression, gesture, and rhythmic contrast. Consequently, the ballet becomes a visual analogue of the philosophical depth inherent in the original dramatic work. "Kyz Zhibek" This two-act ballet is based upon one of the most lyrical Kazakh epics. The musical composition was created by Evgeny Brusilovsky, with musical fragments derived from the opera of the same title. The libretto was written by Bulat Ayukhanov. The choreographic design and production were created by Bulat Ayukhanov and Shara Zhiyankulova. The ballet premiered in 1967 and was performed by the Young Ballet of Alma-Ata. The poetic refinement of the textual source is expressed through fluid linear forms, delicate gestures, and melodious movement phrases. Unlike the written version, wherein verbal aesthetics predominates, the ballet transposes poetic rhythm into somatic language. Here, plasticity embodies national femininity and spiritual resilience, preserving the musicality and affective tonality of the literary original. Conclusion The analysis of literary sources and their choreographic interpretations in Kazakhstan demonstrates that the transposition of narrative imagery into stage form represents a complex process of artistic transformation rather than simple adaptation. Kazakhstani choreography has established itself as an independent medium of cultural interpretation, wherein literary archetypes acquire new dimensions of meaning through kinetic and musical expression. The examined ballet productions—"Kozy Korpesh – Bayan Sulu," "Karagoz," and "Kyz Zhibek"—illustrate how choreographic language preserves the conceptual and emotional architecture of source materials while simultaneously creating autonomous aesthetic experiences. This synthesis of literary heritage and choreographic innovation contributes significantly to the preservation of national cultural identity and the formation of contemporary artistic consciousness. The methodological approach of analyzing stage interpretations through comparative analysis reveals that dance XIX international scientific conference. Vienna. Austria. 20-21.11.2025 16 art functions not as mere illustration but as a sophisticated form of philosophical and aesthetic discourse. Ultimately, the integration of literary sources into choreographic practice establishes Kazakhstan's dance tradition as a vital mechanism for cultural memory transmission and artistic evolution, wherein the ethnocultural code is maintained while engaging with universal themes and modern expressive possibilities. References 1. Moiseev E.S. Interpretation of folklore plots in Kazakhstani ballet (on the example of the performance "Kozy Korpesh — Bayan Sulu"). — "Bulletin of Culture and Arts", 2025. 2. Musrepov G.M. Kozy Korpesh and Bayan Sulu. — Moscow, 1945. — 147 p. 3. Auezov M.O. Karagoz. — Alma-Ata, 1975. — 112 p. 4. Kondybay S.A. Introduction to Kazakh mythology. — Almaty, 2008. — 376 p. 5. Esenberlin I.I. Nomads. — Alma-Ata, 1986. — 784 p. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 17 Biological sciences UDC: 681:58.009(043.30) DYNAMICS OF DEVELOPMENT PHASES OF MEDICINAL AND ESSENTIAL OIL PLANTS OF FOREIGN FLORA IN THE CHUI VALLEY 1Biymyrsaeva Aidana Kamchybekovna research fellow, Laboratory of Plant Resources and Phytotechnologies, Institute of Chemistr and Phytotechnologies of National Academy of Sciences of Kyrgyz Republic 2Myrzagalieva Elnura Baiterekovna lecturer, International Higher School of Medicine Kyrgyzstan, Bishkek Abstract This study conducted phenological observations of the developmental stages of medicinal and essential oil plants of native and local flora in Chui Valley. Fifty-six plant species were selected for the experiment: half were native to Kyrgyzstan, half were native to other regions. Observations were conducted at the collection site of E. Gareyev Botanical Garden to study the dynamics of vegetation phases, flowering, fruiting, and dormancy periods. The results showed that the onset of vegetation for most species varied unevenly across years, due to temperature fluctuations and other climatic factors. For example, Vinca minor begins flowering 2–3 months after germination, with seeds maturing in August–September and dispersal in late autumn. Pimpinella saxifraga produces fruit in early August and completes its growing season by the end of summer, while Grindelia robusta germinates 14 days after sowing at stable temperatures, forming seeds in September. Among the studied non-regional species, the following deserve special attention: Solidago canadensis – seed ripening begins in early September; Hyssopus officinalis – its growing season ends in September; Iris germanica – seedlings appear in March, the plant is resistant to continental climates; Galega officinalis – seedlings appear from mid-March with sufficient moisture and symbiosis with nitrogen-fixing bacteria; Coreopsis grandiflora buds in June, with the above-ground portion dying off with the onset of cold weather; Nepeta pannonica L. germinated on March 18, with fruiting occurring from July to August; and Convallaria majalis L. blooms in May, with fruiting completed in the same month. Other species studied, such as Levisticum officinalis, Leonurus japonicus, Monarda didyma, Aegopodium podagraria, Thymus vulgaris, Salvia officinalis, Agastache rugosa, Digitalis lanata, Rudbeckia laciniata, Achyranthes bidentata, Heliánthus tuberósus, Platycodon grandiflorus, Echinacea purpurea, demonstrated germination in March–April with fruiting in July–August. The phenological observations conducted allow us to identify patterns in the growth, development, and reproduction of both native and non-native medicinal and essential oil plants. The data obtained have practical implications for alternative and traditional medicine, ornamental gardening, and agronomic use, and also serve as a basis for planning sowing dates, harvesting, and subsequent propagation of plants in the Chuya Valley. Keywords: phenology, medicinal plants, essential oil crops, Chuy Valley, growing season XIX international scientific conference. Vienna. Austria. 20-21.11.2025 18 Chemical sciences ECO-FRIENDLY, LOW-COST, AND REUSABLE FIBER-OPTIC SENSOR FOR ENVIRONMENTAL MONITORING: DEVELOPMENT OF THE MORDANT BLUE 9 / PPA-1 SYSTEM 1Indira Rakhmatillayeva 1Urgench State Medical Institute, Urgench, Uzbekistan 1Mavluda Yusupova 1PhD student of the Basic Doctoral Program at the Khorezm Mamun Academy 2Mansur Ashirov 2Khorezm Mamun Academy, Khiva, Uzbekistan Introduction. In recent years, the development of affordable, reusable, and highly sensitive systems for detecting heavy metal ions in the environment has become an urgent priority. Conventional analytical methods often require expensive equipment, significant energy consumption, and skilled personnel [1,2]. Consequently, dyebased chemical sensors have gained widespread application [3–5]. Mordant Blue 9 (MB-9) is an azo dye containing sulfonate groups, known to form stable complexes with metal ions [6,7]. Recent studies have investigated the photocatalytic [8,10], oxidative [2], and microbiological [3] degradation of MB-9. Research has also explored immobilizing dyes onto matrices such as polyamide and cellulose [4,5]. However, systematic data on its immobilization onto PPA-1 fiber remain limited. From this perspective, the primary objective of this work is to optimize the immobilization conditions of the MB-9 reagent onto PPA1 fiber and to study the spectral characteristics of the resulting material. Materials and Methods Mordant Blue 9 (CAS: 3624-68-8) was purchased from Shanghai Macklin Biochemical Co. A standard solution (1×10⁻³ M) was prepared in distilled water. PPA-1 fibers were pre-treated with 0.1 N HCl solution and rinsed with distilled water and ethanol. Immobilization was carried out using universal buffer (pH = 3–7), as well as citrate and ammonia buffer solutions. To determine optimal conditions, parameters including pH (3–7), temperature (20–50°C), time (1–600 minutes), and MB-9 concentration (1×10⁻⁴–1×10⁻³ M) were systematically varied. Sorption results were analyzed using UV-Vis spectrophotometry (λmax = 600 nm) and diffuse reflectance spectroscopy. Interactions were further characterized by FTIR spectroscopy (IRTracer-100, Shimadzu). Results and Discussion Optimal Conditions According to the experimental results, the highest degree of MB-9 immobilization onto PPA-1 fiber was achieved under the following conditions: Table 1 Optimal conditions for immobilization of Mordant Blue 9 onto PPA-1 fiber Parameter Tekshirilgan diapazon Optimal Range Note pH 3.0 – 7.0 4.5 – 5.0 Stable electrostatic interactions form between sulfonate and amine groups in a moderately acidic medium. Temperature (°C) 20 – 50 20 – 30 Reagent decomposition observed at elevated temperatures. Time (min) 1 – 600 2 – 8 Equilibrium is rapidly achieved; no significant changes observed after 10 minutes. MB-9 Concentration (mol/L) 1×10⁻⁴ – 1×10⁻³ 1×10⁻³ Further increase in concentration does not improve efficiency. Spectral Analysis UV-Vis spectra revealed a sharp decrease in the optical density (A) of the solution from 4.0 to 0.1–0.2 after immobilization, confirming that the reagent was predominantly bound to the fiber. Infrared (FTIR) spectroscopy was employed for an in-depth analysis of chemical interactions between the reagent and the fiber. The types of bonds formed are summarized below: XIX international scientific conference. Vienna. Austria. 20-21.11.2025 19 Table 2 Major vibration frequencies in FTIR spectra and their chemical interpretationsi Frequency (cm⁻¹) PPA-1 Assignment MB-9 Assignment PPA-1 + MB-9 (Composite) Assignment Note 217 → 3348 N–H stretching — Shift observed (hydrogen bonding) Amine groups of the fiber interact with sulfonate groups of the dye. 1697–1555 C=O, C=N stretching 1631 (aromatic C=C) 1693, 1614 (new/shifted peaks) Altered electron density due to covalent and hydrogen bonding. 1346–1156 — S=O (sulfonate) Retained with slight shift Sulfonate groups of MB-9 remain bound to the fiber. 964, 918, 887, 819 — Aromatic C–H deformation Retained Aromatic structure of the dye remains undisturbed. FTIR spectral analysis demonstrated three critical changes: a shift in the N–H stretching vibration from 3217 cm⁻¹ to 3348 cm⁻¹ attributable to hydrogen bonding; altered intensity in the C=O and C=N group vibrations (1697–1555 cm⁻¹) suggesting participation in covalent bonding; and the retention of characteristic S=O vibrations (1346–1156 cm⁻¹), confirming the structural integrity of MB-9’s sulfonate groups within the composite. Collectively, these spectral transformations provide definitive evidence for the formation of polar covalent and hydrogen bonds between MB-9 and PPA-1 [1,4,5]. Proposed immobilization mechanism: R–NH₂⁺ (PPA-1) + –OSO₂⁻ (MB-9) → R–NH₂⁺···⁻O₃S–MB Adsorption isotherm: ΔA values increased linearly with concentration (R² = 0.9953), confirming Langmuir-type monomolecular adsorption [4,6]. Conclusion This study successfully immobilized the organic reagent Mordant Blue 9 onto PPA-1 synthetic fiber. Optimal conditions were determined experimentally: pH = 4.5–5.0, T = 20–30°C, t = 2–8 min, concentration = 1×10⁻³ M. FTIR analyses confirmed strong chemical bonds (hydrogen and electrostatic) between the reagent and fiber. The resulting material can be used as a fiber-based chemical sensor for detecting heavy metal ions. This sensor is low-cost, reusable, highly sensitive, and exhibits broad applicability in environmental monitoring [3,7,9]. Keywords: MB-9, PPA-1 fiber, immobilization, pH, concentration, IR spectroscopy, chemical sensor. References 1. Yari M. R., Zakerhamidi M. S., Ghomi H. Plasma immobilization of azobenzene dye on polyamide 6 polymer // Scientific Reports. – 2023. – Vol. 13. – No. 1. – P. 983. 2. Pervez M. N. et al. Efficient degradation of mordant blue 9 using the fenton-activated persulfate system // Water. – 2019. – Vol. 11. – No. 12. – P. 2532. 3. Ngo A. C. R., Tischler D. Microbial degradation of azo dyes: approaches and prospects for a hazardfree conversion by microorganisms // International Journal of Environmental Research and Public Health. – 2022. – Vol. 19. – No. 8. – P. 4740. 4. Hassaan M. A. et al. Improved methylene blue adsorption from an aqueous medium by ozone-triethylenetetramine modification of sawdust-based biochar // Scientific Reports. – 2023. – Vol. 13. – No. 1. – P. 12431. 5. Nazim T., Lusina A., Cegłowski M. Recent developments in the detection of organic contaminants using molecularly imprinted polymers combined with various analytical techniques // Polymers. – 2023. – Vol. 15. – No. 19. – P. 3868. 6. Laureano-Anzaldo C. M., Robledo-Ortiz J. R., Manríquez-González R. Zwitterionic cellulose as a promising sorbent for anionic and cationic dyes // Materials Letters. – 2021. – Vol. 300. – P. 130236. 7. Mohamed S. M. I. et al. Removal of Cr⁶⁺ ions and mordant violet 40 dye from liquid media using Pterocladia capillacea red algae derived activated carbon-iron oxides // Scientific Reports. – 2023. – Vol. 13. – No. 1. – P. 18306. 8. Kamenická B., Weidlich T. A comparison of different reagents applicable for destroying halogenated anionic textile dye mordant blue 9 in polluted aqueous streams // Catalysts. – 2023. – Vol. 13. – No. 3. – P. 460. 9. Kumaravel R., Shanmugam V. K. Biomimetic and ecological perspective towards decolorization of industrial important Azo dyes using bacterial cultures – A review // Sustainable Chemistry for the Environment. – 2024. – Vol. 7. – P. 100130. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 20 10. Ćirković J. et al. Visible-light photocatalytic degradation of Mordant Blue 9 by single-phase BiFeO₃ nanoparticles // Journal of Environmental Chemical Engineering. – 2021. – Vol. 9. – No. 1. – P. 104587. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 21 XRF ANALYSIS OF FERRON-MODIFIED SILK FIBROIN: SYNTHESIS, ACTIVATION, AND ELEMENTAL PROFILING Avazyazov M.A.¹ Ashirov M.A.² Shaxidova D.N.3 Yusupova M.R.4 ¹ 1st Year Doctoral Student, Khorezm Mamun Academy, Uzbekistan ² PhD, Senior Researcher, Khorezm Mamun Academy, Uzbekistan 3PhD, Associate Professor, Mirzo Ulugbek National University of Uzbekistan 4 Doctoral Student, Khorezm Mamun Academy, Uzbekistan Abstract This study details the synthesis and elemental characterization of a functionalized silk fibroin biosorbent designed for the colorimetric detection of iron ions (Fe+2 and Fe+3). Natural Bombyx mori silk fibers were subjected to a rigorous degumming process followed by chemical activation using hydrochloric acid (HCl). Optimization studies indicated that a 10% HCl concentration provided the most effective surface modification for ligand uptake. Subsequently, 7-Iodo-8-hydroxyquinoline-5-sulfonic acid (Ferron) was immobilized onto the activated fiber matrix. The physicochemical properties of the resulting composite were investigated using Wavelength Dispersive X-Ray Fluorescence (WDXRF) spectrometry utilizing a Rigaku ZSX Primus III NEXT apparatus. The semi-quantitative analysis confirmed the successful incorporation of the ligand, evidenced by a dominant Iodine mass percentage of 58.3% and a Sulfur content of 22.6%, both of which serve as elemental markers for the Ferron molecule. Additionally, the detection of 3.96% Chlorine verified the mechanism of acid activation. These results substantiate the efficacy of the synthesis route and the potential of the material as a solid-state chemosensor. Keywords: Silk Fibroin, Ferron, Immobilization, XRF Analysis, HCl Activation, Biosorbent. Introduction Iron, an element indispensable to life, orchestrates a myriad of fundamental biological processes, ranging from oxygen transport and cellular respiration to DNA synthesis and enzymatic catalysis [1, 2]. Within the environment, iron participates in crucial biogeochemical cycles, influencing nutrient availability, microbial activity, and the overall health of ecosystems [1]. However, the very reactivity that underpins its biological utility also necessitates stringent control over its concentration and speciation. Both deficiency and overload of iron can precipitate severe physiological disorders, while in environmental contexts, fluctuations in iron levels, particularly in aquatic systems, can lead to issues such as eutrophication, the proliferation of harmful algal blooms, and the mobilization or immobilization of other trace contaminants [3]. Consequently, the accurate, sensitive, and selective detection and quantification of iron ions, specifically distinguishing between its ferrous (Fe²⁺) and ferric (Fe³⁺) oxidation states, are of paramount importance across diverse scientific disciplines, including clinical diagnostics, environmental monitoring, industrial process control, and food safety assurance [4, 5, 6, 3]. The development of robust analytical methodologies for iron determination, therefore, remains a critical area of ongoing research, driven by the need for reliable, cost-effective, and field-deployable solutions. This paper reports on the successful development and characterization of a novel functionalized biosorbent, "Fibro+Fer," created through the immobilization of the selective iron chelating agent 7-Iodo-8-hydroxyquinoline-5-sulfonic acid (Ferron) onto hydrochloric acid-activated silk fibroin fibers. The primary objective of this research was to engineer a robust material capable of the quantitative determination of Fe²⁺ and Fe³⁺ ions in aqueous solutions. The process involved a systematic approach, beginning with the preparation of degummed silk fibroin from natural cocoons, followed by a critical acid activation step using 10% HCl to protonate amino acid residues on the fibroin backbone. Subsequently, the activated fibers were immersed in a Ferron solution to facilitate ligand binding. The resulting "Fibro+Fer" material was then subjected to comprehensive analysis using Wavelength Dispersive X-Ray Fluorescence (XRF) spectroscopy. The XRF data provided compelling qualitative and semi-quantitative evidence for the successful immobilization of Ferron, revealing a high loading of iodine and sulfur—key elemental markers of the Ferron ligand—on the fiber surface. The detection of residual chlorine further validated the efficacy of the HCl activation protocol. The distinct elemental profile of "Fibro+Fer," characterized by a dominant iodine content of 58.3 mass% and a significant sulfur content of 22.6 mass%, strongly suggests that the material possesses the requisite chemical composition XIX international scientific conference. Vienna. Austria. 20-21.11.2025 22 and, by extension, the chelating capacity for effective interaction with iron ions. Based on these findings, it is concluded that the "Fibro+Fer" composite is a promising candidate for application in the quantitative determination of Fe²⁺ and Fe³⁺ ions, leveraging the high selectivity of Ferron and the advantageous properties of the silk fibroin support. This work contributes to the advancement of bio-based analytical tools for environmental monitoring and other fields requiring precise iron measurement. 2. Materials and Reagents The ligand 7-Iodo-8-hydroxyquinoline-5-sulfonic acid (Ferron, CAS No. 547-91-1) was obtained from Macklin with a purity of 98.5%. Analytical grade anhydrous Sodium Carbonate (Na2CO3), Sodium Bicarbonate (NaHCO3), and Hydrochloric Acid (HCl) were utilized without further purification. All aqueous solutions were prepared using bidistilled water. The silk fibroin source material consisted of natural cocoons. 3. Experimental 3.1. Preparation of Degummed Silk Fibroin Raw silk cocoons were first treated to remove sericin, the gummy protein coating the fibroin filaments. The degumming process involved immersing the cocoons in a boiling aqueous solution containing 0.2 M Na2CO3 and 0.2 M NaHCO3. The extraction was conducted at 85 °C with a bath ratio of 1:100 (mass of fiber to volume of solution). This process was repeated five times, with each cycle lasting one hour, to ensure complete removal of sericin. Following the chemical treatment, the fibers were rinsed thoroughly with distilled water to remove residual salts and subsequently cut into short segments measuring less than 0.5 cm in length. 3.2. Activation and Immobilization To optimize the fiber reactivity, the cut silk segments were subjected to acid activation. The fibers were treated with HCl solutions of varying concentrations (3%, 5%, 6%, and 10%) at 25 °C under constant stirring. The duration of activation was varied between 20 minutes and 48 hours. Evaluation of the varying conditions indicated that the 10% HCl solution provided the optimal activation for subsequent ligand binding. Consequently, fibers activated with 10% HCl were selected for the final immobilization step and analysis. For the immobilization of the chelating agent, 0.1 g of the 10% HCl-activated fiber was introduced into 20 ml of a 0.02 M Ferron solution. The mixture was stirred constantly for one hour at room temperature to allow for equilibrium adsorption and binding. The resulting functionalized fibers, labeled "Fibro+Fer," were filtered and dried prior to analysis. 3.3. XRF Analysis The elemental composition of the "Fibro+Fer" sample was determined using a ZSX Primus III NEXT (Rigaku) Wavelength Dispersive X-Ray Fluorescence spectrometer. The analysis was performed on October 21, 2025. The sample was mounted using a 10 mm mask, and measurements were corrected using a polypropylene (P.P.) film method. The instrument operated under vacuum conditions to minimize atmospheric absorption of low-energy fluorescence. Data processing was conducted using the built-in SQX (semi-quantitative) calculation software and qualitative peak identification algorithms. 4. Results and Discussion 4.1. Qualitative Spectral Analysis The qualitative analysis chart obtained from the XRF scan exhibited a distinct spectral footprint characteristic of the immobilized species. The spectrum was dominated by high-intensity peaks corresponding to heavy elements not inherent to the native silk structure. The peak identification results, summarized in Table 1, highlighted the most significant spectral lines detected during the analysis. The Iodine K-alpha (I-KA) line at 12.389 degrees (2-theta) and the Iodine K-beta1 (I-KB1) line at 10.923 degrees were the most prominent features. The net intensity of the I-KA peak was recorded at 3.274 kcps, representing the strongest signal in the entire spectrum. This high intensity is directly attributable to the iodine atom located at the 7-position of the Ferron ring structure. Table 1. Peak Identification Results for Fibro+Fer Sample Element Line Peak Position (°2𝜽) Net Intensity (kcps) Background Intensity (kcps) I -KB1 10.923 0.575 0.378 I -KA 12.389 3.274 0.604 Rh-KA 17.564 3.605 0.944 Zn-KA 41.780 0.217 0.163 I -LB2 86.233 0.101 0.010 Cl-KA 92.816 0.023 0.011 Si-KA 109.236 0.054 0.001 S -KA 110.752 0.512 0.019 Ca-KA 113.065 0.076 0.012 K -KA 136.625 0.088 0.011 XIX international scientific conference. Vienna. Austria. 20-21.11.2025 23 In addition to Iodine, significant peaks for Sulfur (S-KA) were observed at 110.752 degrees with an intensity of 0.512 kcps, and Chlorine (Cl-KA) at 92.816 degrees. It should be noted that peaks associated with Rhodium (Rh-KA) and their Compton scattering counterparts appeared in the spectrum as shown in Table 1; these are artifacts arising from the X-ray tube target of the spectrometer and do not represent elemental constituents of the sample. 4.2. Semi-Quantitative Elemental Composition The SQX calculation provided a mass percentage breakdown of the elements present on the fiber surface, as presented in Table 2. The analysis revealed that Iodine is the primary constituent of the analyzed matrix, accounting for 58.3 mass% of the sample. This result provides compelling evidence for the high-density loading of Ferron onto the fibroin, as native silk is composed exclusively of amino acids (carbon, hydrogen, oxygen, nitrogen) and lacks iodine entirely. Table 2. SQX Calculation Results for Elemental Composition Component Result (mass%) Detection Limit Element Line Intensity (kcps) I 58.3 0.08528 I -KA 3.2739 S 22.6 0.01074 S -KA 0.5121 Si 6.00 0.01518 Si-KA 0.0545 Cl 3.96 0.03149 Cl-KA 0.0229 K 3.55 0.01649 K -KA 0.0875 Ca 3.19 0.01724 Ca-KA 0.0756 Zn 2.43 0.02853 Zn-KA 0.2175 Sulfur was determined to be the second most abundant element, comprising 22.6 mass% of the sample. While native silk fibroin contains trace amounts of sulfur due to methionine and cysteine residues, the elevated concentration observed here confirms the presence of the sulfonic acid (-SO3H) groups from the Ferron ligand. The molar ratio of iodine to sulfur in pure Ferron is 1:1; however, the XRF mass ratio observed suggests an enrichment of sulfur relative to iodine, likely due to the cumulative signal from both the exogenous Ferron sulfonate groups and the endogenous sulfur within the protein matrix. 4.3. Verification of Activation Mechanism The XRF data also provided insight into the activation mechanism. As shown in Table 2, Chlorine was detected at a concentration of 3.96 mass%. This presence of chlorine is not intrinsic to silk or Ferron but is a direct residue of the activation process using 10% HCl. The acid treatment results in the protonation of the amino groups (-NH3+) on the fibroin backbone, which subsequently retain chloride ions (Cl-) as counter-ions to maintain charge neutrality. The detection of chlorine effectively validates that the fibers were chemically modified by the acid treatment, verifying the efficacy of the 10% HCl activation protocol. Minor constituents detected included Silicon (6.00 mass%), Potassium (3.55 mass%), Calcium (3.19 mass%), and Zinc (2.43 mass%). The silicon signal is likely attributed to the background scattering from the sample holder or P.P. film. The potassium and calcium residues are presumably remnants of the sodium carbonate and biological salts utilized during the degumming of the raw cocoons. 5. Conclusion The immobilization of 7-Iodo-8-hydroxyquinoline-5-sulfonic acid (Ferron) onto HCl-activated silk fibroin fibers was successfully achieved and quantitatively verified. The experimental protocol, utilizing a 10% HCl activation step followed by immersion in 0.02 M Ferron, yielded a composite material with a distinct elemental profile. XRF analysis confirmed the modification, revealing a dominant Iodine content of 58.3 mass% and a Sulfur content of 22.6 mass%, which correlates directly to the chemical structure of the immobilized ligand. Furthermore, the detection of residual Chlorine validates the role of hydrochloric acid in the activation of the polymer matrix. The resulting "Fibro+Fer" material exhibits the requisite chemical composition to function as a chelating biosorbent. Based on these results, the functionalized fiber is suitable for further application in the quantitative determination of Fe+2 and Fe+3 ions in aqueous solutions. References 1. de Mello Gabriel, G. V., Pitombo, L. M., Rosa, L. M. T., Navarrete, A. A., Botero, W. G., do Carmo, J. B., & de Oliveira, L. C. (2021). The environmental importance of iron speciation in soils: evaluation of classic methodologies. Environmental Monitoring and Assessment, 193(2), 63. 2. Liu, Z., Li, N., Liu, P., Qin, Z., & Jiao, T. (2022). Highly sensitive detection of iron ions in aqueous solutions using fluorescent chitosan nanoparticles functionalized by rhodamine B. ACS omega, 7(6), 55705577. 3. Alorabi, A. Q. (2025). Recent Developments in Colorimetric and Fluorimetric Sensing of Fe2+ and Fe3+ Ions: A Review (2021 to 2025). Critical Reviews in Analytical Chemistry, 1-18. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 24 4. Dong, S., Karimi-Maleh, H., Liu, Y., Xie, Q., He, Y., Fan, W., ... & Zhong, N. (2025). Recent advances in optical sensors for trace Iron-ion concentration. Coordination Chemistry Reviews, 545, 217024. 5. Paramparambath, S., Oflaz, K., Geetha, M., El-Azazy, M., El-Shafie, A. S., & Sadasivuni, K. K. (2025). A Dual Approach to Detecting Iron Ions and Analyzing Water Quality. Chemistry Africa, 8(3), 11151126. 6. Liu, Z., Li, N., Liu, P., Qin, Z., & Jiao, T. (2022). Highly sensitive detection of iron ions in aqueous solutions using fluorescent chitosan nanoparticles functionalized by rhodamine B. ACS omega, 7(6), 55705577. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 31 3. O’Connell, B., & Dubois, J. (2025). The Digital Divide and Algorithmic Amplification: Addressing Inherent Bias in AI-Powered Assessment Tools. International Journal of AI Ethics, 7(1), 88-105. 4. Schmidt, E., & Lee, K. (2024). Student Data Governance in the Age of AI: Establishing Privacy Frameworks and Parental Control. Educational Technology & Society, 27(3), 190-205. 5. Wang, X., & Al-Hassan, Z. (2025). The Human-in-the-Loop Model: Reasserting Teacher Agency and Intuition in AI-Augmented Classrooms. Policy and Practice in Education, 10(2), 24-41. 6. Zhu, F. (2024). Cultivating AI Literacy: A Curricular Framework for Fostering Student Resilience and Critical Engagement with Generative Models. Journal of Critical Pedagogy, 19(1), 12-30. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 32 CONTEMPORARY FOREIGN-LANGUAGE HIGHER EDUCATION: THE FORMATION OF PROFESSIONALLY-ORIENTED COMPETENCE Bazarova Dinara Askarovna Master of Philology, Department of State and Foreign Languages Almaty Technological University, Republic of Kazakhstan Koyanbekova Sara Bariyevna Doctor of Philological Sciences, Professor Department of State and Foreign Languages Almaty Technological University, Republic of Kazakhstan СОВРЕМЕННОЕ ИНОЯЗЫЧНОЕ ВЫСШЕЕ ОБРАЗОВАНИЕ: ФОРМИРОВАНИЕ ПРОФЕССИОНАЛЬНО-ОРИЕНТИРОВАННОЙ КОМПЕТЕНЦИИ Базарова Динара Аскаровна Магистр филологических наук, Кафедра «Государственный и иностранные языки» Алматинский технологический университет, Республика Казахстан Коянбекова Сара Бариевна Доктор филологических наук, Профессор, Кафедра «Государственный и иностранные языки» Алматинский технологический университет, Республика Казахстан Abstract The article explores contemporary trends in foreign-language higher education with an emphasis on how professionally-oriented competence is formed. Mainly, the article considers the reasons for the shift to the competence-based approach in higher education, overviewing the tendencies which take place in contemporary competence formation. Different types of competence are considered parallelly, including communicative, sociocultural, search-research, basic etc. The aim of the research is to theoretically substantiate and practically develop a model to the formation of foreign-language professionally-oriented competence in higher education and classify the outcomes of competence formation in learners. Approaches to the formation of professionallyoriented competence are considered and reviewed. Based on that, a model of professionally-oriented competence formation process is synthesized. The model covers both the theoretical and practical component of the mentioned competence along with their methods, tools, and outcomes, and also the general results of developing this competence in learners. The methods of theoretical and critical analysis, synthesis, and modeling are utilized. The novelty of this research lies in the practical character of the proposed model. Hence, the research outcomes may be used in further analysis and in the educational process. The findings are also significant for advancing the theoretical framework of competence-based education and have practical implications for enhancing teaching strategies in Kazakhstan and beyond. Аннотация В статье исследуются современные тенденции в области высшего образования по иностранным языкам с акцентом на формирование профессионально-ориентированной компетенции. Основное внимание уделяется причинам перехода к компетентностному подходу в высшем образовании, а также обзору тенденций, связанных с процессом формирования компетенций в современных условиях. Сравнительно рассматриваются различные виды компетенций, включая коммуникативную, социокультурную, поисково-исследовательскую, базовую и другие. Целью исследования является теоретическое обоснование и практическая разработка модели формирования иноязычной профессионально-ориентированной компетенции в области высшего образования и классификация результатов формирования компетенции у обучающихся. В статье изучаются и анализируются подходы к формированию профессионально-ориентированной компетенции. На основе проведенного анализа синтезируется модель процесса формирования профессионально-ориентированной компетенции. Эта модель охватывает как теоретический, так и практический компонент упомянутой компетенции, а также включает методы, инструменты и результаты, связанные с её развитием, и общие итоги формирования данной компетенции у обучающихся. Применяются методы теоретического и критического анализа, синтеза и моделирования. Новизна исследования заключается в практическом характере предложенной модели. Таким образом, результаты исследования могут быть использованы как в дальнейшем анализе, так и в образовательном процессе. Выводы исследования также имеют значение для углубления теоретической базы компетентностного образования и обладают практической ценностью для совершенствования методик преподавания в Казахстане и за его пределами. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 33 Keywords: foreign-language education, higher education, competence-based approach, professionallyoriented competence, intercultural communication, teaching technologies, innovation, didactics. Ключевые слова: иноязычное образование, высшее образование, компетенция, профессионально-ориентированная компетенция, межкультурно-коммуникативная компетенция, технология преподавания, инновационный подход, дидактический базис. Introduction The evolution of contemporary higher education is shaped by diverse factors and trends. Among these, the flourishing of the anthropocentric paradigm stands out as a major influence on the structure, methodology, and practices of higher education, particularly in foreign-language teaching. This paradigm emphasizes human cognition as central to knowledge systems, which fosters a multidisciplinary approach in education. Consequently, higher education has become a multidimensional phenomenon that integrates diverse methods and competences. Competences play a pivotal role in shaping the educational objectives for students, extending beyond mere skills to encompass a broad spectrum of capabilities essential for professional success. Professional-oriented competence, in particular, facilitates the practical application of specialized knowledge, enabling students to effectively address real-world challenges in their respective fields. The anthropocentric paradigm, which emerged in the mid-20th century, shifted focus from abstract theories to the practical implications of human cognition. The rise of cognitivism and its integration with disciplines such as linguistics, psychology, and anthropology reinforced this shift. Cognitivism emphasizes that language reflects thought, necessitating teaching approaches that prioritize applicability over rote memorization. This paved the way for the competence-based approach in education. Professional-oriented competence is integral to this framework, interacting with three other competences – intercultural, basic, and identificatory – to cultivate learners capable of addressing complex, interdisciplinary problems. These competences collectively promote the development of an individual mindset that adapts to dynamic professional environments. In this article, we make an attempt to overview the existing approaches to this competence and through this create a model that covers its main characteristics and the ways of its application to the teaching process. To reach this aim, the article also delves into the reasons for the emergence of competence based approach: mainly, the flourishment of anthropocentric paradigm and the requirements of a new, fully capitalistic world. The world science stepped into the anthropocentric paradigm in the middle of the XX century, when such fields as anthropology, psychology, linguistics and culturology started to merge. The emergence of cognitivism marked the reconsideration of previously solid beliefs and scientific hypotheses, shifting the center of attention from abstract to real, from the world to a human being, from the reality to its representation in mind. The fact that humans and their worldview influence pretty much all the aspects of objective reality made this scientific paradigm truly remarkable in its sense of putting a human mind in the center of everything. L. Peterson states that the main factor which marked the shift to a new paradigm was the introduction of the concept of activity as a part of the learning process [1]. Activity may be defined as a conscious attempt, an act of doing, the process which has a tangible result. These definitions contradict the initial idea of knowledge; if knowing is abstract, doing is concrete and solid. The notion of doing relates to the real world and sets a task that requires not only the knowledge as an idealized entity, but also a structured system of skills. Another important factor which has been influencing the area of teaching (specifically higher education sphere) is the emergence and development of cognitivism. Starting with a conference in 1951, cognitive science soon became one of the leading fields in the anthropocentric paradigm. Understanding the mechanism of thought and later linking it to the language made it impossible to stick to the outdated norms of teaching – in particular, teaching a language. According to cognitivists (and also cognitive linguists), language is the embodiment of thought, so its separation and abstraction are not the most successful ways of studying and teaching it. With mechanical learning technologies gone, there came a need to supply the educational field with new approaches, methods, and techniques which would ensure both the memorization and application of the obtained knowledge. This is when the competence-based approach came into existence. The word “competence” itself, first used by R. White in 1959, initially referred to the extent to which employees were able to fulfill practical tasks. With the flourishment of market economy, it became obvious that measuring the intelligence of potential employees was merely a waste of time if they were unable to utilize their respective knowledge in real-life situations. Capitalism, which was on the rise in the XX century, was leaving no room XIX international scientific conference. Vienna. Austria. 20-21.11.2025 34 for intelligence-based, slow-paced work style. Instead, candidates with a higher degree of competence, with practical orientation and the ability to solve case studies became the center of attention. Competence-based approach was then introduced to all the stages of teaching and specifically to higher education. For Kazakhstan, the shift to such approach was marked by its gradual development, the collapse of the USSR, the emergence and enhancement of independent education styles, and eventually by its inclusion in the Bologna process. In the State Program of Education for 2020-2025 of the Republic of Kazakhstan, it is stated that the aim of developing the educational system is to increase the global competitiveness of Kazakhstani learners and employees along with enhancing the role of science in all the spheres of citizens’ activity. This aim is closely connected to the development of the competence-based approach. Methods and materials The method of theoretical and critical analysis was utilized when reviewing the works related to the competence-based approach and to the formation of the professional-oriented competence. The method of synthesis was applied to constructing the schemes of implementing various educational technologies into the process of forming the mentioned competence. Eventually, the method of modeling was used to try and create a representation of how the educational process maintains the creation and sustenance of the competences. In particular, the created model covers the two basic components of the competence – theoretical and practical – along with their elements and the ways of implementing them. Results and discussion Competence-based approach is centered around the notion of competence, which can be defined in a variety of ways. Initially, during the first years of its implementation, the notion of competence described a set of skills necessary to transform the abstract knowledge and apply it to some real-life situations [2]. Though vague, the definition was used extensively to refer to how employees are able to solve problems and fulfill tasks. Studying the work patterns was important for the capitalistic system – another vast field, intercultural communication, emerged in the same years as a tool for working in a diversified company and forming strategic business alliances with the enterprises of other cultures. At the same time, the preliminary description of competence lacked certain aspects such as the cognitive, the personal, and the identificatory components. Further definitions of competence are based on linguistic, psychological, sociological, and educational approaches. 1. In psychology, I.A. Zimnyaya defines competence as an integrative personal quality that combines knowledge, skills, abilities, and the motivation necessary for effective interaction in specific contexts [3]. 2. In linguistics, N. Chomsky introduced the term “linguistic competence” to describe an individual’s inherent knowledge of the grammar and structure of their native language, distinguishing it from “performance,” which involves the actual use of language in communication [4]. 3. In teaching, according to A.V. Hutorskoy, competence in the educational context refers to the ability of an individual to effectively apply acquired knowledge, skills, and attitudes in solving specific problems or performing tasks in both professional and everyday life [5]. 4. In sociology, T. Yu. Bazarov defines competence as the readiness and ability of a person to perform social roles effectively, demonstrating responsibility, flexibility, and adaptability within a societal context [6]. 5. In business management, L.M. Spencer and S.M. Spencer in their work on competency models define competence as a combination of underlying characteristics of an individual – such as motives, traits, skills, and knowledge – that are causally related to effective or superior performance in a job or role [7]. 6. In education theory, A.A. Verbitsky highlights competence as a dynamic and systemic ability to successfully perform professional tasks [8]. S.S. Kunanbayeva, on the other hand, views competence as “a complex of knowledge, abilities, skills, and flexible thinking” [9]. Overviewing the definitions provided above, we can note the following components of competence: 1. Knowledge – the abstract cumulation of information related to a certain field. 2. Skills – the traits necessary to complete a certain real-life task. 3. Motivation – the necessity which dictates fulfilling the task, both inner and outer kinds. 4. Self-perception – the way an individual views and estimates their own ability to operate in a certain scientific, technological, and professional field. There have been numerous studies related to how competences are – and must be – formed in the educational field. Let us dwell on a few. E. Klimkovich examines the role of professionally oriented foreign language competence in the education of IT specialists. The study highlights the importance of integrating foreign language skills into the professional preparation of students in technical universities, emphasizing that such competence is critical for effective professional communication in globalized and technologically advanced environments [10]. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 35 D.T. Adyrbekov, Zh.D. Duisenbekova and L.B. Abdulina address the critical issue of defining and understanding the concept of professional competence among foreign language teachers [11]. It explores how new educational standards and reforms demand enhanced professional skills from educators. The authors emphasize that professional competence is an essential indicator of teacher quality and readiness to solve both subject-specific and pedagogical challenges. D.M. Dzhusubalieva and U. Adilzhanova explore methods for developing search-research competence in prospective foreign language teachers with the aid of digital technologies [12]. The theoretical part of the study highlights the importance of this competence as one of the core skills for teachers and its significance for professional growth. Search-research competence enables teachers to effectively locate, process, and apply information relevant to their field, especially in the digital era. The practical component of the article presents the results of an experimental study conducted with second-year students at a language university. The experiment involved activities like internet-based research, online interviews, and collaborative projects, which were designed to develop digital literacy and research skills. The study revealed that digital tools and online platforms significantly enhanced students’ abilities to gather and analyze information efficiently. E.F. Gerfanova, D.B. Shayakhmetova, and Ye.M. Nemtchinova explore a framework for evaluating foreign language (FL) textbooks based on cognitive and linguocultural approaches [13]. This, in turn, is also the assessment of how these textbooks aid in forming the intercultural competence of learners. The analysis framework includes: • Assessing activities for promoting both lower-order (e.g., memorization) and higher-order (e.g., synthesis, evaluation) cognitive skills. • Using visual-cognitive tools like diagrams and mind maps to foster understanding and creativity. • Ensuring a balance between “surface” culture (e.g., clothes, food, traditions) and “deep” culture (e.g., values) in the content. • Evaluating linguocultural elements through material-factual (e.g., artifacts), axiological (e.g., values), and speech-behavioral (e.g., norms) dimensions. K.T. Zhaiykbay and T.A. Kulgildinova dwell on the development of a pragma-professional communicative competence system specifically tailored for IT students in foreign language education [14]. This competence integrates professional, functional, linguistic, and communicative skills necessary for effective professional interaction in IT fields. The authors propose a methodology based on various principles, such as differentiated teaching and functional-situational conditioning, to create exercises aimed at enhancing professional communication skills in IT-related contexts. The exercises include types such as communicative-conceptual, analytical-predictive, situationalconditional, and situational-modeling. It is believed that current Kazakhstani education system operates within the process of forming four essential competences of learners: 1) Intercultural-communicative. 2) Professional-basic. 3) Professional-oriented. 4) Professional-identificatory. As S.S. Kunanbayeva believes, professional competence can be described as a combination of the following: 1. Mastery and the possession of skills and the life experience that helps perform tasks and solve problems. 2. The sophisticated individual resource which provides an opportunity to interact effectively within a group and face to face and in the scope of certain areas. 3. Motivation to perform high-quality work in the professional field, and valuing the profession. 4. Education level that suits the requirements and aids in solving certain cognitive problems and defines the personal position. 5. The degree to which a person is ready to perform in the given specialized field. 6. Personal psychological qualities which ensure mastery and self confidence. 7. Professionalism – a complex category which unites the knowledge and skills necessary for working in the given field [15]. It is noted that the formation of professional competences is just as important as the formation of intercultural-communicative competence. While the latter ensures an individual’s prosperity in the multicultural world, the former aids in creating a strategy of existing within the scope of market economy. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 36 After graduating, the future employee needs to demonstrate all the given competences in order to fit in the requirements of the market economy and the world which has gone through the fourth industrial revolution. As S.S. Kunanbayeva states, a better substitute of teaching is training – the notion which encompasses both the personal motivation and the outer influence aspects [15]. So, forming the professional-oriented competence takes place through certain steps and includes certain components. Generally speaking, those components may be broken down into the abstract and concrete – knowledge and skills, the opportunity and the ability, the theoretical and the practical. The theoretical aspect of forming the given competence encompasses the information provided for the students, ensuring the memorization and enhancement of that information, and various modes ofworking with specific, professionrelated data. The practical aspect deals with the realization of the skills the students have acquired, and it involves working within the scope of the didactic basis which includes the following technologies: project, creative constructive, practical analytical, and digital. Utilizing project technology in forming the mentioned competence is a successful way of achieving the selected goals within the limited period of time. A project itself is a task that is highly creative. Within the scope of KazUIRWL named after Ablai khan, the given technology is carried out using the following steps. Stage 1. The themes of the projects are distributed, and the learners get the general idea of what they will be researching. Stage 2. Identifying the problem, the object and subject, and defining the methods or the strategy of implementing the project. Stage 3. Working with the theoretical data in order to get the methodological background of what the theme narrates about. Stage 4. Working with the practical data, conducting empirical research, and corroborating the initial hypothesis. Stage 5. Conclusions and presentations. This preliminary scheme might omit specific steps required for projects in different fields, yet it describes the general idea of how a project work needs to be carried out in accordance with the competencebased approach. For instance, the students of the Bachelor degree might be asked to make a project work on the ecology of the country, which involves the realization of such skills as critical thinking, empirical research, induction, analytic thinking, generalization, abstraction, and synthesizing. At the same time, the learners of a Master’s degree can be given a task which is slightly more complex – identifying the reasons behind “blending” languages in a multicultural community. Taking Kazakhstan as an example and following the proposed scheme, the postgraduate learners might present a project which helps them realize their skills of real-life problem solving, decision making, modeling, abstraction and generalization, synthesizing, deduction and induction, etc. Practical orientation of the given projects helps integrate the findings in the professional activity of the graduate and postgraduate learners. Creative-constructive technology refers to developing the skills of synthesis and is aimed at creating certain methods, ways, strategies, and principles of solving a real-life problem. In the field of education, it encompasses the development of such components as analytical thinking, practical and deliberative thinking, and the orientation to success. For instance, the following task, given to the students of the Bachelor degree, is quite thought-provoking and aids in forming the mentioned competence: Create a scheme of how the language changes relate to the cultural changes. Taken from the field of linguoculturology, the task relates to the formation of interculturalcommunicative competence as well, though its practical orientation is closer to the professional-oriented competence. Now, to fulfill the given task, the learners are likely to undergo the following work stages: 1. Collecting data. 2. Operating the data in such a way that it reflects the changes indicated in the topic. 3. Synthesizing different models of how language changes and cultural changes might influence each other. 4. Creating the given scheme. Practical-analytical technology refers to solving real-life problems, using different styles of conflict management, the skills of team work, and other such interpersonal components of the professional competence. Case studies, conflict situations, and critical incidents are good examples of how this technology is being implemented in the university. For example, Master degree students are offered to solve the case of how the methods of linguistic research might be used in Google database. To fulfill the given task, the learners need to approach the topic critically, judging it properly and offering the ways and strategies which might be used in this case. Thinking in a complex way and considering XIX international scientific conference. Vienna. Austria. 20-21.11.2025 37 all the possibilities, taking into account the developmental strategies of the entire world are among the welcomed modes of solving the problem. Eventually, within the scope of forming a learner’s professional-oriented competence, digital technologies are utilized. While these do not necessarily involve problem-solving or decision-making, they sure help in considering the world as a whole and working with various types of media. Digital technologies that help develop the professional-oriented competence might be roughly divided into two extended categories: the tools which help the teacher (various teaching sources, slide show generators, Grammarly and such, and database sets) and the tools which help the learner (mostly, AI-based tools). ChatGPT, for instance, is believed to fall into both the categories. Utilizing AI ethically is one of the most crucial aspects of today’s education process. Including the digital component into the model of professionallyoriented paradigm align. The following model summarizes the above-mentioned data and provides an overview of how the professional-oriented competence is realized and developed within the scope of higher education. Let us dwell on some individual parts of this scheme. As it illustrates, we divided the general essence of the professional-oriented competence into two main components: theoretical and practical. For each component, we provided the essence, methods and tools, and outcomes. Other than that, the model also includes some intermediary processes which take place when it is being formed – immersive techniques (case studies and real life simulations such as the model UN project) and reflective practices (self-assessment) along with the enhanced outcomes. Below are some close-up views of the individual components of the competence scheme. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 38 XIX international scientific conference. Vienna. Austria. 20-21.11.2025 39 Conclusion The modern system of foreign language education is considered as a unity of organizational and technological characteristics aimed at achieving orderliness and consistency in the field of education with socio-economic conditions that reveal cause-and-effect relationships that determine the goals of most parameters of education management. The modern system of foreign language education must anticipate the pace and strategy of the socioeconomic state, correspond to the characteristics of national development and the needs of society, be flexible and open to innovation and the accelerated pace of development of the country. Consequently, innovative dimensions in foreign language education, based on a competence-based approach and modern technologies, correspond to the general concept of the educational standard adopted in most developed countries. The direction of Kazakhstan’s graduate and postgraduate foreign language education into the integrated global intercultural space is focused on the system of competences and the design of educational content and systems for monitoring its quality in terms of updating its content and methodology. The theoretical part of professional-oriented competence is focused on familiarization with the methodology of branch science, research apparatus, and an updated system of concepts and categories. The practical subject-technical part of the competence is focused on the content of the didactic basis and advanced teaching technologies, through the use of technologies such as design, creative-construction, practical-analytical and digital. In this way, an adequate level of professionally significant competencies is formed. The reflexive-corrective component includes technologies of self assessment, self-development, selfmanagement, and improvement of skills through a system of pragmatic and professional tasks. Modern information technologies and an integrated approach are implemented through the educational program of graduate and postgraduate education for the organization of classroom and independent work of students. The relevance and features of the competence-based approach in foreign language education, regardless of specific ideas and interpretations, are associated with the Kazakhstani characteristics of intercultural communication, immersion in a special cultural and educational context, and entering the world stage of employment and learning. These factors require the implementation and development of the competence-based approach which guarantees the achievement of real-life goals and the preparation of a competitive, professional, capable generation which suits the requirements of the fourth industrial revolution. References 1. Peterson L.G. «Novaja paradigma» obrazovanija: metafora ili vector razvitiya? [New paradigm of education: a metaphor of a development vector?] // 2. Pedagogical education and science. – 2014. – 47 s. [in Rus.] 3. Bergsmann E. et al. Evaluation of competence-based teaching in higher education: From theory to practice //Evaluation and program planning. – 2015. – V. 52. – P. 1-9. 4. Zimnyaya I. A. Obshchaya kul’tura i sotsial’no-professional’naya kompetentnost’ cheloveka [General culture and social-professional competence of a person] // Vysshee obrazovanie segodnya. – 2005. – № 11. – S. 14-20. [in Rus.] 5. Chomsky N. Aspects of the Theory of Syntax. – Cambridge, MA: MIT Press, 1965. – 118 p. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 40 6. Hutorskoy A. V. Didakticheskaya evristika. Teoriya i tekhnologii kreativnogo obucheniya [Didactic heuristics: Theory and technologies of creative education]. – Moscow: MGU press, 2003. – 254 s. [in Rus.] 7. Bazarov T. Yu. Kompetentsii budushchego: kvalifikatsiya? 8. kompetentnost’? kriterii kachestva? [Competencies of the future: Qualification? 9. Competence? Quality criteria?]. – 2008. Retrieved from http://www.tltsu.ru.8080/ 10. razum.tltsu.ru/publectures/lecture [in Rus]. 11. Spencer L. M., & Spencer S. M. Competence at Work: Models for 12. Superior Performance. – New York, NY: Wiley, 1993. – 319 p. 13. Verbitsky, A. A. Kontekstnoe obuchenie v kompetentnostnom podkhode 14. [Contextual learning in the competency-based approach] // Vysshee obrazovanie 15. v Rossii. – 2006. – №11. – S. 38-52. [in Rus.] 16. Kunanbayeva S.S. Teorija i praktika sovremennogo inoyazychnogo 17. obrazovanija [Theory and practice of contemporary foreign language education]. – Almaty, 2010. – 340 s. [in Rus.] 18. Klimkovich E.Ya. Inoyazychnaya professionalno-orientirovannaya 19. kommunikativnaya kompetentsiya kak neot’emlemaya chast professionalnoy 20. kompetentnosti budushchikh spetsialistov v oblasti informatsionnykh tekhnologiy 21. [Foreign language professionally-oriented communicative competence as an 22. integral part of the professional competence of future specialists in the field 23. of information technology] // SibADI Bulletin. – 2012. – №2 (24). https:// 24. cyberleninka.ru/article/n/inoyazychnaya-professionalno-orientirovannaya kommunikativnayakompetentsiya-kak-neotemlemaya-chast-professionalnoy 25. (retrieved on 10.10.2024). [in Rus.] 26. Adyrbekov D.T., Duysenbekova Zh.D., Abdullina L.B. Professionalnaya 27. kompetentsiya prepodavateley inostrannogo yazyka [Professional competence of foreign language teachers] // Bulletin of Ablai khan KazUIRWL, Pedagogy series. – 2020. – № 3 (58). – S. 24-31. [in Rus.] 28. Dzhusubaliyеva D., Adilzhanova U. Ispolzovanie tsifrovykh tekhnologii 29. dlya formirovaniya poisko-issledovatelskoy kompetentsii budushchikh uchiteley 30. inostrannogo yazyka [The use of digital technologies for developing the inquiry 31. research competence of future foreign language teachers] // Bulletin of Ablai khan KazUIRWL, Pedagogy series. – 2021. – №4 (63). – S. 123-133. [in Rus.] 32. Gerfanova E.F., Shayakhmetova D.B., Nemchinova E.M. FL textbook analysis: cognitive and linguocultural approaches // Bulletin of Ablai khan KazUIRWL, Pedagogy series. – 2022. – №2 (65). – P. 7484. 33. Zhaiykbay K.T., Kulgildinova T.A. The system of exercises for the formation of pragmaprofessional communicative competence of IT specialists // Bulletin of Ablai khan KazUIRWL, Pedagogy series. – 2022. – №67 (4). – P. 43-56. 34. Kunanbayeva S.S. Educational paradigm: implementation of the competence-based approach to the higher school system // International journal of environmental and science education. – V. 11, No 18. – P. 12699-12710. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 47 ORGANIZATION OF THE EDUCATIONAL SPACE OF PRIMARY SCHOOL STUDENTS IN THE CONTEXT OF THE NEW UKRAINIAN SCHOOL: THEORY AND PRACTICE Mariia Demyda master’s degree applicant in specialty 013 Primary Education, Pavlo Tychyna Uman State Pedagogical University, Ukraine Scientific supervisor: Olena Yashchuk. PhD in Pedagogy, Associate Professor ОРГАНІЗАЦІЯ ОСВІТНЬОГО ПРОСТОРУ МОЛОДШИХ ШКОЛЯРІВ В УМОВАХ НОВОЇ УКРАЇНСЬКОЇ ШКОЛИ: ТЕОРІЯ ТА ПРАКТИКА Демида Марія здобувачка другого (магістерського) рівня вищої освіти спеціальності 013 Початкова освіта, Уманський державний педагогічний університет імені Павла Тичини. Науковий керівник: Ящук Олена Миколаївна кандидат педагогічних наук, доцент Становлення Нової української школи актуалізує потребу переосмислення ролі освітнього простору як системоутворювального фактора розвитку молодших школярів. Сьогодні простір перестає виконувати лише функцію матеріального забезпечення навчання і дедалі частіше розглядається науковцями як педагогічний інструмент, що формує стиль взаємодії між учасниками освітнього процесу, визначає емоційний фон навчання, мотивує до пізнання та впливає на формування життєво важливих компетентностей. Таким чином, освітній простір постає середовищем з високим виховним потенціалом, у якому поєднуються соціальні, культурні, психологічні та організаційні складники. У сучасних педагогічних студіях простір початкової школи визначається як динамічна, багатовимірна, інтегрована система, де кожен структурний елемент – від розташування меблів до стилю спілкування між учителем і дитиною впливає на освітні результати. Низка науковців (О. Савченко, Н. Бібік, І. Бех, О. Пометун, Д. Гоулмен, CASEL) наголошує, що молодший шкільний вік є чутливим періодом до соціально-емоційних переживань і стимулів середовища, а відтак саме структура й атмосфера класу можуть або активізувати пізнавальну діяльність, або, навпаки, гальмувати розвиток особистості. У межах магістерського дослідження було встановлено, що освітній простір виступає одночасно: – носієм змісту освіти, адже фізична й цифрова інфраструктура визначає, які види діяльності є можливими; – детермінантою педагогічної взаємодії, оскільки простір задає модель поведінки (співпраця → кругова посадка; конкуренція → фронтальна розсадка тощо); – механізмом соціалізації, що формує відчуття успіху, захищеності, визнання або, навпаки, тривожності та соціальної ізоляції; – джерелом навчальної мотивації, бо емоційно сприятлива атмосфера підсилює внутрішнє бажання пізнавати нове. Констатувальний етап дослідження виявив, що у більшості початкових шкіл освітнє середовище модернізоване переважно в матеріальному вимірі (нові меблі, мультимедійне обладнання, дидактичні матеріали), однак система взаємодії та організаційно-педагогічні механізми розвитку дитини оновлені недостатньо. Зокрема, виявлено такі проблеми: – недостатня гнучкість простору (переважання фронтальної роботи, обмеження рухливості дитини); – фрагментарна реалізація інклюзії; – епізодичність педагогіки партнерства у взаємодії «учень – учитель – родина»; – нестача системної підтримки соціально-емоційного благополуччя дітей; – брак умов для формування самостійності та ініціативності. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 48 Для вирішення зазначених суперечностей було розроблено й експериментально перевірено модель організації освітнього простору молодших школярів, що інтегрує чотири взаємопов’язані компоненти: Компонент моделі Функції та зміст Просторово-предметний мобільне розташування меблів, навчальні осередки, зони тиші/творчості/досліджень, вільний доступ до матеріалів, естетичність Соціальнопсихологічний безпечне середовище, культура ненасильницької комунікації, профілактика булінгу, розвиток SEL-компетентностей Педагогічнометодичний діяльнісний підхід, інтерактивні методи, проєкти, дослідження, цифрові ресурси, диференціація навчання Організаційноуправлінський педагогіка партнерства, співпраця з батьками та громадою, методична підтримка вчителя Формувальний експеримент (40 учнів 1–4 класів; Савранський ліцей та Дубинівська філія; вересень–листопад 2025 р.) засвідчив ефективність моделі. За результатами підсумкової діагностики в експериментальній групі спостерігалося: Показник Динаміка Навчальна мотивація +34 % збільшення частки учнів із високим рівнем Комунікативна активність стабільне підвищення залученості в групові форми роботи Самостійність помітне зростання відповідальності за результат власної навчальної діяльності Емоційне ставлення до школи зменшення шкільної тривожності та зростання задоволення навчанням Комфортність перебування формування атмосфери підтримки, прийняття та взаємоповаги На противагу цьому, у контрольній групі зафіксовано лише незначні позитивні зміни, що підтверджує прямий вплив цілеспрямованої організації освітнього простору на розвиток особистості молодшого школяра. Таким чином, отримані результати підтверджують, що ефективний освітній простір – це не сукупність матеріальних об’єктів, а інтегрована, педагогічно організована система, у якій: – дитина є суб’єктом, а не об’єктом навчання; – комфорт і безпека стають умовою пізнання; – середовище підтримує дитину в її індивідуальності, а не підлаштовує під єдиний шаблон; – помилка розглядається як ресурс навчання, а не як привід для покарання; – мотивація забезпечується інтересом і взаємодією, а не зовнішнім примусом. Отже, створення компетентнісно орієнтованого та психологічно безпечного освітнього простору має виступати стратегічним напрямом удосконалення сучасної початкової освіти. Модель, розроблена у межах дослідження, є придатною до впровадження у практику закладів загальної середньої освіти та може бути використана для підвищення якості освітнього середовища, професійного розвитку педагогів і розбудови педагогіки партнерства у школі. References 1. Bekh, I. (2019). Personality-oriented education: theoretical and practical foundations. Kyiv: Pedahohichna Dumka. 2. Bibik, N. (2020). The New Ukrainian School: competency-based approach in primary education. Kyiv: MOE of Ukraine. 3. Goleman, D. (2020). Social and Emotional Learning in Education. New York: Bantam Books. 4. Pometun, O., & Pyrozhenko, T. (2018). Interactive teaching methods in modern school. Kyiv: A.S.K. 5. Morozova, H. (2022). Comfortable educational environment as a factor of students’ well-being. Educational Studies Journal, 18(2), 45–53. 6. CASEL. (2023). The CASEL Guide to Schoolwide Social and Emotional Learning. Chicago: Collaborative for Academic, Social, and Emotional Learning. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 49 Philological sciences HOW TO OVERCOME HIGH-CONTEXT vs LOW-CONTEXT MISCOMMUNICATION Gulshan Jalal Musayeva EFL instructor Baku Business University Abstract The concept of high and low context cultures refers to the significance of contextual clues in message interpretation. Low context cultures communicate more directly and explicitly, whereas high context cultures base their communication style on body language, tone, and general context. Every culture has a dominating communication style that is influenced by certain standards, social conventions, and values. In contrast to high context cultures, which emphasize not only what individuals say but also when, where, and how they say it, as well as what they do not say at all, low context cultures place more emphasis on the precise meaning of words. While the social context and individual perceptions are crucial in fostering understanding and trust, a great deal of meaning is implied. In other words, people from low context cultures are fairly direct and mean what they say as they say it, whereas people from high context cultures tend to keep some things to themselves. Keywords: High-context culture, Low-context culture, implicit message, explicit message, cultural differences, business relations Introduction People from different cultural backgrounds and communication styles working on the same project face potential misunderstandings and even conflicts. To someone from a high context culture, low context communicators can seem impersonal, distant or untrustworthy. Vice versa, high context communicators could be seen as intrusive or even impolite. These differences are a risk to collaboration, creativity and efficiency of the team, which is why recognizing and adapting social settings and communication styles is necessary. Highcontext and low-context cultures are terms used to classify different societies on how they communicate. The definitions were developed in the 1970s by anthropologist Edward T. Hall as a means of categorizing intercultural communication. (Hall) Edward T. Hall was an American anthropologist who pioneered the field of intercultural communication. In the 1930s, Hall worked in the southwestern United States, observing the Navajo and Hopi peoples. Hall noted that the Navajo and Hopi had different cultural concepts of time than people of Western societies. They did not understand time in "hours" or "days" but rather as recurring cycles of passing time. This resulted in some confusion when members of the two cultures tried to communicate. Murdoch University Edward T. Hall introduced the distinction between highand lowcontext cultures, noting that high-context cultures rely heavily on implicit communication, shared understanding, and non-verbal cues, whereas low-context cultures prioritize explicit, direct verbal communication. Subsequent scholars have built on Hall’s framework. Geert Hofstede linked context to cultural dimensions, suggesting that collectivist and long-term oriented societies tend to be high-context, while individualistic and short-term oriented societies are generally low-context. Hofstede didn’t directly use Hall’s terminology but his work on cultural dimensions (e.g., uncertainty avoidance, individualism-collectivism) complements the high/low context framework. Cultures high in collectivism and long-term orientation tend to be more high-context, while individualistic, short-term oriented cultures lean low-context. Some scholars argue the high/low context distinction is overly simplistic and that context varies situationally, even within one culture. Contemporary research suggests hybrid contexts exist (e.g., multinational corporations using a mix of highand low-context communication depending on setting). Scholars also note digital communication blurs traditional high/low distinctions, because online messages may lack non-verba (Stella Ting-Toomey ) Focuses on intercultural communication and face-negotiation. High-context communication often emphasizes relational harmony, indirectness, and implicit understanding. Low-context communication values clarity, directness, and task completion. Misinterpretation occurs when one style meets the other Stella Ting-Toomey emphasized the interpersonal implications, arguing that high-context communication promotes relational harmony and indirectness, whereas low-context communication favors clarity and taskoriented interaction. Contemporary research, however, critiques the high/low-context dichotomy as overly XIX international scientific conference. Vienna. Austria. 20-21.11.2025 50 rigid, noting that communication context can vary situationally and be influenced by globalization and digital media. Overall, scholars agree that understanding context is essential for effective cross-cultural communication, though its application requires flexibility. Communication styles determine how we make and manage agreements, negotiations, and decisions, which is crucial for any business. Understanding different cultural characteristics and preferences can help team leaders adjust and plan their approach to different groups. In low-context cultures, people and teams tend to take spoken communication at face value and expect thorough details in advance of a meeting or task. They rely on clear agendas, detailed briefs, and structured meeting notes to guide their work. Conversely, high-context cultures are less dependent on formal documentation and may view such detailed materials as overly rigid or unnecessary. They favor in-person interactions, believing that building relationships and maintaining close personal contact are essential for achieving shared understanding. Means of communication can be adapted based on these differences – in high context cultures, people understand messages more through testimonials or personal stories, best practices, and real-life examples. On the contrary, low context countries focus on comprehensive information and data in brochures, presentations, briefs, etc. Both styles have their good and bad sides when it comes to doing business. Low context can mean more precision, planning, and detail, while high context is good for establishing more personal and solid bonds between business partners. A clash of these two sides can end with a lot of misunderstandings and unfinished business. But, if teams are aware of cultural impacts and work to gain an understanding of each other’s perspectives, they can learn from one another and accomplish good results – and even more than that, they will benefit from diverse approaches and perspectives to problem-solving. Recognizing the differences between high-context and low-context cultures is vital in today’s workplaces. In high-context environments, for instance, a business owner might choose to establish a personal relationship with a potential investor before addressing formal matters. Because of this, employees in diverse organizations and teams need to understand the cultural nuances that may arise. High-Context Cultures According to Hall, a high-context culture is one that relies primarily on implicit communication. Close social bonds are common in high-context cultures. These interactions lead to an instinctive understanding of cultural rules that do not need to be communicated within the society. Individuals are defined by their place in the larger social group, and there is a clear distinction between members of the group and "outsiders." As a result, communication between high-context cultures and those unfamiliar with their rules can be difficult. In high-context societies, relationships can take a while to form and rely on mutual trust. However, these partnerships are typically stable once they are created. Instead of pursuing personal achievements, people view themselves as essential members of a family, community, or professional team. These groups have a highly centralized social structure with a distinct authority figure serving the interests of the group as a whole. Because high-context cultures have strong social bonds, personal space is considered to be community space. When speaking, people usually stand closer to one another with little regard for privacy. Information and feelings may be expressed by nonverbal means, such as body language, gestures, eye contact, or tone of voice. Verbal communication tends to be indirect, with a person's context more meaningful than the actual words. For example, if someone says he is hungry, that may be a cue that he would like someone to prepare food for him. The sensitive nature of such cultures means people are more attuned to disagreements. Personal offenses are taken seriously and must be resolved or avoided to ensure harmony within the group. Tradition is an essential element in high-context societies and change is slow to occur. Communities tend to be close-knit and long-lasting, having occupied the same geographical areas for several generations. Time is thought of as a more casual concept. Day-to-day life moves along at its own pace, without the need of time constraints. Individual or group considerations often take precedence over the need to conform to a strict schedule. As a result, it is not as important when something gets done but rather that it eventually gets accomplished. Knowledge is considered part of the overall fabric of society and is passed down through group experience. Thinking is more logical and deductive with knowledge evolving from the general to the specific. While learning is important, how well a person learns is also valued. People learn by watching others, and develop their skills by practicing the observed knowledge. For example, in Africa, some young people are temporarily sent away from the whole group to learn about life skills from older group members. China, Japan, Korea, and other Asian nations are some examples of high-context cultures. These societies have a long history of tradition with little change in their cultural demographics. African societies rooted in tribal customs are also high-context cultures. Other examples include cultures from Muslim nations, India, XIX international scientific conference. Vienna. Austria. 20-21.11.2025 51 Latin America, the Pacific islands, France, Greece, Ireland, Italy, and Russia. In the United States, Native Americans and Hawaiian Islanders are also high-context societies. Low-Context Cultures Low-context cultures exhibit many of the opposite attributes of high-context cultures. According to Hall, they rely on explicit communication between members. Words are more important than meanings in lowcontext societies, with the culture's rules and expectations required to be defined in advance. Such cultures tend to be more goal-oriented with individual achievements taking precedence over group accomplishments. In low-context cultures, the boundaries of smaller social groups are not clearly established. Individuals can enter and exit a social group with little to no disturbance. Relationships can develop swiftly and end quickly. For instance, in low-context cultures, where people may have many intimate connections throughout their lives, dating is more informal. Some relationships are formed with a specific goal; the association ends once that goal is reached. A person may enter a business relationship that lasts only until a product is delivered or the work is done. In most cases, highly detailed legal contracts are required before a business transaction can occur. Authority within a social group is decentralized, with several tiers of community and government leaders establishing the rules and responsibilities for the group. Individuality and privacy are highly valued in low-context cultures. Community intrusions into personal business are discouraged. When people communicate, they tend to stand farther apart out of respect for other’s personal space. Messages are more direct, with the use of nonverbal cues kept to a minimum. Communications are expected to be spelled out in clear language and expressed by written or spoken word. Communication serves a purely functional purpose and is meant as a means of exchanging ideas and information. Disagreements are generally not personalized. Conflict is often resolved by avoiding the problem or finding a logical solution to the issue. Time is a highly regulated concept in low-context cultures. Tasks and events are expected to follow a schedule and be finished within a specific time frame. The increased focus on time management can often mean efficiency is one of the most highly valuable commodities in performing tasks. Life in low-context societies moves at a faster pace and can change quickly. As a result, styles, trends, and socially accepted norms can vary over a relatively short period. Individuals are responsible for managing their own time and need not conform to a group dynamic. Strategies for Engaging Mixed Highand Low-Context Audiences ▪ Clear and open communication: Make it clear that questions and discussions are welcome anytime. Explicitly state that you value both direct questions and more nuanced, contextual feedback. This openness can help bridge the gap between the different communication styles. ▪ Structured content with flexibility: Start with a structured presentation that outlines the key points and steps clearly and concisely. This approach targets low-context communicators who prefer direct and specific information. Follow this with a more open-ended segment that encourages discussion, questions, and sharing of experiences, appealing to high-context communicators. ▪ Include interactive components like Q&A sessions, discussions in small groups, and hands-on demos. Encourage people to ask questions and express their opinions during these events. This method gives lowcontext communicators the clear information they require while enabling high-context communicators to interact in a more relational and contextual way. ▪ Dual-style feedback mechanism: Provide opportunities for both written and verbal feedback. For instance, use direct surveys or feedback forms for low-context communicators and hold informal discussions or focus groups for high-context communicators. Multiple feedback options ensure that all participants can share their views in a manner they are comfortable with. Suggestions for High-Context Communicators When Communicating with Low-Context Communicators ⚫ Be direct and unambiguous: When describing a new farming method, avoid heavily relying on proverbs or metaphors. Give detailed directions with concise justifications for each step. ⚫ Accept directness: If a farmer asks questions that appear straightforward, don't take offense. To make wise selections, they are merely looking for precise facts. ⚫ Clearly clarify your intentions: When asking farmers for their opinions, make it clear which areas of your program you want their input on. They will give you feedback that is pertinent to your needs if you give them clear instructions. ⚫ Instead of asking, "How was the workshop?" inquire, "What specific topics from the workshop would you find most helpful on your farm?" Focused and useful input is encouraged by specific questions. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 52 ⚫ Ask for clarification: If farmers are being forthright, don't be afraid to ask them to clarify their queries or worries. Interacting with individuals or groups from diverse cultural backgrounds necessitates an awareness of cultural norms, values, and communication styles. This is known as intercultural communication. (Holliday). Mastering intercultural communication could help to navigate people from different backgrounds effectively (Martin & Nakayama). Challenges in intercultural communication often stem from differences in language, nonverbal communication, and cultural perceptions. However, these challenges also present opportunities for personal and professional growth as individuals learn to cooperate with people from multicultural backgrounds (Chen & Starosta). High-context cultures are typically collectivist, strongly emphasizing group harmony and indirect communication, where much of the meaning is conveyed through nonverbal cues and the surrounding context. In contrast, low-context cultures are often individualistic, with communication being more direct and explicit, focusing on the content of the message itself rather than the relational context (Hofstede, Kittler ). Navigating the differences between highand low-context communication can be important for fostering effective interactions across cultural groups. For individuals from high-context cultures, maintaining relationships and social harmony often takes precedence in communication (Croucher). Misunderstandings from low-context communication can damage relationships within Extension audiences, risking conflicts and reducing trust in Extension advice. For instance, an Extension educator delivering instructions on a new agricultural technique in a high-context community might prioritize building rapport and understanding the audience's existing practices before diving into specifics. This indirect approach can fail if the audience from a low-context background expects clear and concise instructions from the beginning. Moreover, the effective communication of indirect messages, essential in high-context communication, becomes compromised by challenges posed by low-context interaction, leading to communication failures and misinterpretations. Extension educators frequently rely on metaphors, analogies, or storytelling to convey messages in high-context communities. However, the intended learning outcomes may not be achieved if the audience interprets these messages literally due to low-context communication preferences. Conclusion The aforementioned suggestions could be considered when working in a multicultural group with highand low-context cultures. The suggestions can be sent out via email to allow individuals time to reflect and respond, or they can be posed in the initial group meeting. These suggestions are designed to help individuals explore their communication preferences within the group so they can understand and align with each other’s expectations. The group can enhance collaboration and work toward more effective communication practices by fostering mutual understanding of different communication styles. Recognizing the differences between high-context and low-context cultures is essential for effective communication, especially in an increasingly interconnected world. In high-context cultures, much of the message is conveyed through tone, implicit meaning, and nonverbal signals, making trust-building and strong interpersonal relationships central to communication. In contrast, low-context cultures rely on direct, explicit exchanges where clarity, brevity, and efficiency are emphasized. Ultimately, by understanding these communication styles and adopting strategies that strengthen intercultural competence, Extension educators can better connect with diverse communities, foster cultural awareness, and support meaningful social changes. References 1. Aleassa, L., Nasaji, H., & Archibald, J. Apology strategies in high vs. Low context cultures. Doctoral dissertation, Jordan University of Science and Technology, 2023 2. Alexander, R. Usability themes in high and low context cultures: A comparative study Doctoral dissertation, 2019 3. Cardon, P. W. A critique of Hall's contexting model: A meta-analysis of literature on intercultural business and technical communication. Journal of Business and Technical Communication, 22(4), 399–428, 2008 4. Chen G. and Starosta W. The Development and Validation of the Intercultural Sensitivity Scale. Human Communication, 3, 1-15,2000 5. Croucher, S. M., Bruno, A., McGrath, P., Adams, C., McGahan, C., Suits, A., & Huckins, A. Conflict styles and high–low context cultures: A cross-cultural Extension. Communication Research Reports, 29(1), 64–73, 2012 6. Hall, E. T. Beyond culture. New York: Doubleday, 1976 XIX international scientific conference. Vienna. Austria. 20-21.11.2025 53 7. Hall, E.T. & Hall, M.R. Understanding cultural differences: German, French, and Americans, Yarmouth, ME: Intercultural Press, 1990 8. Hofstede, G. Culture's consequences: Comparing values, behaviours, institutions and organizations across nations. London: Sage publications, 2001 9. Holliday, A., Hyde, M., & Kullman, J. (2021). Intercultural communication. In Routledge Books, 2021 10. Hornikx, J., & Pair, R. L. The influence of high-/low-context culture on perceived ad complexity and liking. Journal of Global Marketing, 30(4), 228–237, 2017 11. Kittler, M. G., Rygl, D., & Mackinnon, A. Special review article: Beyond culture or beyond control? Reviewing the use of Hall’s high-/low-context concept. International Journal of Cross–Cultural Management, 11(1), 63– 82. Journal of Education, Innovation, and Communication (JEICOM), 2011 12. Liu, Meina. "Verbal Communication Styles and Culture." Oxford Research Encyclopedia, Nov. 2016 13. Martin, J.N. and Nakayama, T.K. Intercultural Communication in Contexts. 5th Edition, McGrawHill, New York, 2010 14. McKay‐Semmler, K. L. High‐ and low‐context cultures. The International Encyclopedia of Intercultural Communication, 1–5, 2017. 15. Madill, Holly. "Recognizing High and Low Context Cultures." Michigan State University, 16 Aug. 2022 16. Sandel, Todd L. "Language and Intercultural Communication." Global Perspectives on Intercultural Communication, edited by Stephen M. Croucher, Routledge, 2017, pp. 129–37. 17. Ting-Toomey S. Communicating across Cultures. The Guilford Press, New York, 1999,261. 18. Usunier, J. C., & Roulin, N. The influence of highand low-context communication styles on the design, content, and language of business-to-business web sites. International Journal of Business Communication, 47(2), 189–227, 2010 19. Warner, L., Israel, G. D., & Diaz, J. M. (2019). “Identifying and Meeting the Needs of Extension’s Target Audiences: AEC673 WC336, 5 2019”. EDIS 2019(3). XIX international scientific conference. Vienna. Austria. 20-21.11.2025 54 PERSPECTIVES OF COMPARATIVE RESEARCH (DIACHRONY–SYNCHRONY) Inna R. Sargsyan Doctor of Pedagogical Sciences, Professor Professor of the Department of Russian Language and Professional Communication, Russian-Armenian University, Republic of Armenia, Yerevan ПЕРСПЕКТИВЫ СОПОСТАВИТЕЛЬНЫХ ИССЛЕДОВАНИЙ (ДИАХРОНИЯ–СИНХРОНИЯ) Инна Робертовна Саркисян Доктор педагогических наук, профессор Профессор кафедры русского языка и профессиональной коммуникации, Российско-Армянский униврситет, Республика Армения, Ереван Abstract The article examines the formation, development and modern functioning of the comparative method in linguistics. The historical background of the method's formation is analyzed, as well as the contribution of key scientists — E.D. Polivanov, A.A. Reformatsky, I.A. Baudouin de Courtenay, and others. The differences between comparative, comparative-historical and comparative approaches are revealed. Special attention is paid to the role of the comparative method in teaching foreign languages, translation studies, typology, and cognitive linguistics. Tables, diagrams, and theoretical models are presented that demonstrate the multilevel structure of comparative analysis. The relevance of the method for solving the problem of interlanguage interference and improving the effectiveness of teaching foreign languages is substantiated. Аннотация В статье рассматривается становление, развитие и современное функционирование сопоставительного метода в лингвистике. Анализируются исторические предпосылки формирования метода, вклад ключевых учёных — Е.Д. Поливанова, А.А. Реформатского, И.А. Бодуэна де Куртенэ и др. Раскрываются различия между сравнительным, сравнительно-историческим и сопоставительным подходами. Особое внимание уделяется роли сопоставительного метода в методике преподавания иностранных языков, переводоведении, типологии и когнитивной лингвистике. Представлены таблицы, схемы и теоретические модели, демонстрирующие многоуровневую структуру сопоставительного анализа. Обосновывается актуальность метода для решения проблемы межъязыковой интерференции и повышения эффективности обучения иностранным языкам. Keywords: comparative linguistics, comparative historical method, interference, typology, Baudouin de Courtenay, Polivanov, Reformatsky, comparative analysis, methods of teaching foreign languages, translation studies, bilingualism, intercultural communication. Ключевые слова: сопоставительное языкознание, сравнительно-исторический метод, интерференция, типология, Бодуэн де Куртенэ, Поливанов, Реформатский, сопоставительный анализ, методика преподавания иностранных языков, переводоведение, билингвизм, межкультурная коммуникация. Введение. Сопоставительная типология языков занимает одно из ключевых мест в современном лингвистическом знании, представляя собой не только методологический инструмент анализа, но и самостоятельную научную дисциплину, позволяющую глубоко исследовать механизмы функционирования языковых систем. В центре её внимания находятся универсальные и специфические черты языков, закономерности их структурного устройства, а также динамика их развития в синхронном и диахронном аспектах. Ещё с античных времён учёные стремились выявить природу сходств и различий между языками, а сравнение и сопоставление постепенно превращались в эффективный способ постижения языковой природы, её внутренних закономерностей и внешних проявлений. На самых ранних этапах развития языкознания сопоставление осуществлялось преимущественно на уровне наблюдений и эмпирических описаний. Однако уже в XIX веке, синхронно с формированием индоевропеистики и развитием сравнительно-исторического языкознания, сопоставительный подход XIX international scientific conference. Vienna. Austria. 20-21.11.2025 55 получает системность и научную строгость. В этот период появляются первые фундаментальные труды, посвящённые изучению родственных языков, их реконструкции и установлению закономерностей исторического развития. Одновременно формируются предпосылки для возникновения структурно-типологических исследований, которые в XX веке перерастают в полноценную научную парадигму. С XX века сопоставительный метод получает не только признание, но и серьёзное теоретическое переосмысление. Работы представителей Пражской лингвистической школы, американской дескриптивистики, позднее — структурной и генеративной лингвистики демонстрируют возможность анализа языков не только на основе их исторического родства, но и на уровне их структурно-функциональных параметров. Именно в этот период складывается понимание сопоставительного и типологического исследования как двух взаимосвязанных, но не тождественных направлений. Сопоставительная лингвистика начинает рассматриваться как дисциплина, сравнивающая конкретные языки или группы языков, тогда как типология направлена на выявление универсальных закономерностей языковой организации. Несмотря на значительные успехи сопоставительных исследований, термин «сопоставление» до сих пор трактуется неоднозначно в различных научных школах и традициях. Отсутствие единого подхода к его интерпретации приводит к размытости понятийных границ между сравнительным, сравнительно-историческим и собственно сопоставительным методами. Некоторые исследователи рассматривают сопоставление исключительно как инструмент описания различий между двумя или несколькими языками, другие — как часть типологического анализа, третьи — как элемент межъязыковой интерференции или перевода. Таким образом, в современном языкознании отсутствует консенсус относительно ключевых характеристик сопоставительного метода, в частности: ➔ определения его сущности и структуры, ➔ чёткого разграничения области применения, ➔ соотношения с типологией и структурной лингвистикой, ➔ роли в методике преподавания иностранных языков, ➔ значимости для прикладных направлений — переводоведения, межкультурной коммуникации, двуязычия, компьютерной лингвистики. Одновременно наблюдается интересная методологическая ситуация: при отсутствии строгой дефиниции метод сопоставления демонстрирует исключительно высокую практическую продуктивность. Он активно применяется в широком спектре исследований — от морфологической и синтаксической типологии до изучения прагматики, дискурса, речевых стратегий и межъязыковых соответствий. Сопоставительный подход стал важнейшим инструментом в преподавании иностранных языков, где выявление межъязыковых сходств и различий позволяет минимизировать интерференцию, прогнозировать трудности обучения и разрабатывать эффективные методики формирования билингвальной компетенции. Особенно важную роль сопоставительный анализ играет в условиях возросшей актуальности межкультурного взаимодействия, мобильности и глобализации. Сегодня он востребован не только как часть теоретической лингвистики, но и как инструмент решения прикладных задач — в переводоведении, компьютерной лингвистике, корпусных исследованиях, автоматической обработке естественного языка и межъязыковой семантике. Таким образом, несмотря на дискуссионность терминологии и разнообразие подходов, сопоставительная типология остаётся одной из наиболее динамично развивающихся областей лингвистики. Её универсальность, гибкость и междисциплинарность обеспечивают ей устойчивое место в современной гуманитарной науке, а также делают её незаменимым инструментом в практических сферах, связанных с изучением языков, перевода, коммуникации и языковой политики. Исторические предпосылки и становление метода Справедливо указывает Э. Ш. Исаев, что одним из подлинных основоположников сопоставительного подхода в отечественном языкознании был Е. Д. Поливанов, опубликовавший в начале XX века ставшую классической работу «Восприятие звуков иностранного языка». В контексте общего развития лингвистической мысли того времени эта работа стала методологическим прорывом: Поливанов одним из первых научно обосновал необходимость изучения не только объективных характеристик чужого языка, но и субъективных механизмов его восприятия носителем родной языковой системы. Учёный показал, что при столкновении с иной звуковой системой у носителя родного языка неизбежно активируются устойчивые фонологические модели, сформированные в ходе естественного онтогенеза. Именно они определяют то, каким образом воспринимаются, интерпретируются и воспроиз- XIX international scientific conference. Vienna. Austria. 20-21.11.2025 56 водятся звуки иностранного языка. Поливанов детально описал явление, которое позднее станет основой теории интерференции: носитель другого языка «слышит» и «произносит» иностранные звуки сквозь призму собственной фонологической системы, что приводит к устойчивым системным искажениями в восприятии и артикуляции. Наблюдения Поливанова о «фонологическом воспроизведении, свойственном родному языку», были революционными для своего времени. Впервые был чётко сформулирован принцип: межъязыковое сопоставление должно учитывать психологические, когнитивные и перцептивные механизмы, а не только объективные различия фонетических систем. Именно поэтому труды ученого впоследствии стали фундаментальными не только для теории интерференции, но и для психолингвистики, методики преподавания иностранных языков и общей теории билингвизма. Идеи Поливанова получили дальнейшее развитие в работах А. А. Реформатского, одного из крупнейших представителей отечественной структурной лингвистики. Развивая методологическое наследие, он последовательно уточнял понятийные границы между сравнительным и сопоставительным методами. Реформатский подчёркивал, что сравнительный метод исходит из поиска сходств, общих корней и реконструкции «прасистем», будучи в первую очередь историческим по своей сущности. В отличие от него сопоставительный метод ориентирован не на генетическую связь языков, а на выявление различий, структурных асимметрий и индивидуальной специфики каждого языка как автономной системы. Это концептуальное разграничение стало важным этапом методологического оформления сопоставительной лингвистики как самостоятельного направления. Реформатский утверждал, что сопоставление необходимо проводить не ради классификации языков, а ради выявления тех различий, которые определяют особенности функционирования отдельных языковых уровней — фонетического, морфологического, синтаксического, лексико-семантического и др. Таким образом, вклад Поливанова и Реформатского заключается не только в создании методологической базы для сопоставительных исследований, но и в формировании нового научного взгляда на природу межъязыковых отношений. Оба учёных предложили рассматривать сопоставительное изучение как инструмент обнаружения механизмов восприятия и функционирования языков, а не как вспомогательный метод описания фактов. Их идеи остаются актуальными и в современной лингвистике, где сопоставительный анализ служит основой для решения задач интерференции, перевода, билингвального обучения и межкультурной коммуникации. Сравнительный vs. сопоставительный методы Признак Сравнительный метод (исторический) Сопоставительный метод (синхронный) Временной аспект Диахрония Синхрония Цель Выявление родства, общности, праязыка Установление различий и контрастов Объект Родственные языки Родственные и неродственные Методологическая база Историческая реконструкция Структурное сопоставление Эта принципиальная разница оказала огромное влияние на развитие лингвистики XX века. Развитие сопоставительного метода в русской лингвистике Как отмечает Л.С. Андреева, становление сопоставительного языкознания в России связано с деятельностью И.А. Бодуэна де Куртенэ, который рассматривал сравнение языков как основу типологических и семасиологических обобщений. В работе «О смешанном характере всех языков» он подчёркивал природную гибридность языков и необходимость анализа их взаимодействий, контактов и пересечений в синхронии. Бодуэн де Куртенэ фактически предвосхищал современные идеи: ➔ языковых контактов, ➔ билингвизма, ➔ интерференции и транспозиции, ➔ многоуровневой типологии, ➔ когнитивной обусловленности языковой структуры. Его последователи развивали метод как теоретически, так и практически — в области методики преподавания иностранных языков. С точки зрения Л.И. Анохиной, сопоставительный метод сыграл ключевую роль в доказательстве генетического родства языков и формировании аргументированной системы классификации языков мира. Однако позднее этот метод стал самостоятельным направлением, не сводимым только к историческому анализу. Эволюция термина и современное понимание метода XIX international scientific conference. Vienna. Austria. 20-21.11.2025 63 və Leyla Eradze, həmçinin Leyla Eradze və Dilarə Əliyeva dostluğu ötən əsrin ortalarında istər elmi, istərsə də, bədii tərcümə və ədəbi əlaqələr sahəsində ən yaxşı dövrünü yaşamışdır. (Bu barədə “Səməd Vurğun və Karlo Kaladze”, “Səməd Vurğun və Georgi Leonidze”, “Səməd Vurğun və Leyla Eradze”, “Leyla Eradze və Dilarə Əliyeva” və s. sərlövhəli məqalələrimizdə də ətraflı məlumat vermişik. – M.Ç.) Bu ənənə daha sonralar professor Leyla Eradze (1930-1998) və professor Mədəd Çobanov (1937-2023) tərəfindən yeni bir kontekstdə davam etmiş, bu elmi, ədəbi-bədii tandem Azərbaycan və gürcü ədəbiyyatında özünün yeni bir inkişaf mərhələsinə qədəm qoymuş, bu dostluq əlaqələri qısa bir müddətdə, həm ədəbiyyatşünaslıq, həm də bədii tərcümə və ədəbi əlaqələr müstəvisində yeni bir mərhələ təşkil etmişdir. Sözsüz ki, bunu doğuran müəyyən səbəblər vardı; hər şeydən əvvəl, professor Mədəd Çobanov 1937-ci ildə Gürcüstanda, Bolnisi rayonun Darbaz kəndində dünyaya göz açmış, burada böyüyüb boya-başa çatmış, doğma kəndində orta məktəbi müvəffəqiyyətlə bitirdikdən sonra Tbilisidə ali təhsil almış, ömrünün təxminən 60 ilini Gürcüstanda yaşamış, uzun müddət doğma kəndində, vaxtilə orta təhsil aldığı Darbaz kənd orta məktəbində və vaxtilə ali təhsil aldığı A.S.Puşkin adına Tbilisi Dovlət Pedaqoji Universitetində filologiya fakültəsinin Azərbaycan şöbəsində - Azərbaycan dili və ədəbiyyatı kafedrasında müəllim, dosent, professor, kafedra müdirinin müavini, kafedra müdiri və elmi-metodiki şuranın sədri vəzifələrində çalışmış (sonralar S.S.Orbelianinin adını daşıyan həmin ali məktəb hazırda İlya Universiteti adlanır. - M.Ç.), pedaqoji fəaliyyətlə yanaşı, həm də elmi yaradıcılıqla məşğul olmuş, Azərbaycan-gürcü ədəbi əlaqələrinin inkişafı naminə bir sıra məqalələr yazmış, kitablar nəşr etdirmiş, daha sonralar Bakıda yaşasa da, ömrünün sonuna kimi Gürcüstanla əlaqəni kəsməmiş, vaxtilə çalışdığı kollektivlə müntəzəm olaraq əlaqə saxlamış, hər il ən azı 4-5 dəfə Gürcüstana səfər etmiş, keçmiş gürcü həmkarları ilə, həmçinin Gürcüstanda yaşayan azərbaycanlı şair və yazıçılarla görüşmüş, Tiflis ədəbi mühitində və buradakı ədəbi prosesdə yaxından iştirak etmiş, onun həyat və yaradıcılığı haqqında Gürcüstan mətbuatında silsilə məqalələr dərc olunmuş və bütün bunlar Azərbaycan və gürcü xalqları arasındakı dostluq əlaqələrini daha da intensivləşdirmişdir. Tədqiqat Ötən əsrin 2-ci yarısından başlayaraq Azərbaycan-gürcü ədəbi əlaqələrinin akademik şəkildə tədqiqi və təbliği ilə məşğul olan Leyla Eradze tanınmış gürcü türkoloq alimləri Venera Cankidze, Elizbar Çavelidze, Georgi Şaqulaşvili, Mixeil Çinçaladze və başqaları ilə yanaşı tanınmış Gürcüstan və Azərbaycan alimi, görkəmli türkoloq, 60-dan artıq kitabın, yüzlərlə elmi və publisistik məqalələrin müəllifi, uzun müddət A.S.Puşkin (sonralar S.S.Orbeliani) adına Tbilisi Dovlət Pedaqoji Universitetində filologiya fakültəsinin Azərbaycan şöbəsində çalışmış görkəmli alim, tanınmış türkoloq, filologiya elmləri doktoru, professor Mədəd Çobanovla da daim elmi təmasda olmuşdur. Prof.Mədəd Çobanov Azərbaycan-gürcü ədəbi əlaqələrinin inkişafı naminə xeyli əmək sərf etmişdir. Belə ki, o, ilk dəfə olaraq Azərbaycan və gürcü dillərinin, həmçinin Azərbaycan və gürcü ədəbiyyatlarının qarşılıqlı əlaqəsini, ədəbi əlaqələrin inkişaf tarixini elmi tədqiqata cəlb etmiş və bu mövzuda yüzlərlə elmi, elmi-publisistik və ədəbi-tənqidi məqalələr yazmış və həmin məqalələri Azərbaycanda AMEA-nın, BDU-nun, ADPU-nun Elmi Əsərlərində, «Azərbaycan», «Respublika», «Xalq», «Ədəbiyyat və incəsənət», «Ədəbiyyat qəzeti», «Azərbaycan müəllimi», «Sərqin səsi», «Ziya», «Təhsil», «Elm və təhsil» qəzetlərində; Gürcüstanda isə Azərbaycan, gürcü, rus və erməni dillərində nəşr olunan müxtəlif mətbuat orqanlarında, o cümlədən, Azərbaycan dilində nəsr olunan «Sovet Gürcüstanı» («Gürcüstan»), «Qələbə bayrağı»; gürcü dilində nəşr olunan «Saxalxo qanatleba» («Xalq maarifi»), «Soplis tsxovreba» («Kənd həyatı»), «Tbilisi», «Qamardjvebis droşa» («Qələbə bayrağı») qəzetlərində, gürcü dilində nəşr olunan «Skola da sxovreba» («Məktəb və həyat») və «Kartuli ena da literatura skolaşi» («Məktəbdə gürcü dili və ədəbiyyatı» jurnallarında; rus dilində nəşr olunan «Zarya Vostoka», «Veçerniy Tbilisi» və «Molodyoj Qruzii» qəzetlərində; erməni dilində nəşr olunan «Sovetakan Vrastan» («Sovet Gürcüstanı») qəzetində, həmçinin, S.S.Orbeliani adına Tbilisi Dövlət Pedaqoji İnstitutunun «Elmi əsərləri»ndə rus və Azərbaycan dillərində çap olunmuşdur. “A.Bakıxanov və Tiflis mühiti” (“Qələbə bayrağı”, 21.06.1969), “Ə.Haqverdiyev və Gürcüstan” (“Qələbə bayrağı”, 16.05.1970), “Azərbaycan şairləri və Gürcüstan” (“Qələbə bayrağı”, 23.05.1970), “Koroğlu dastanı gürcü dilində” (“Gürcüstan”, 15.07.1972), “Gürcü alimi Füzulini öyrənir” (“Gürcüstan”, 19.08.1972) və s. kimi dəyərli məqalələrin müəllifi olan professor Mədəd Çobanov Güney Qafqaz xalqlarının tarixində ilk dəfə olaraq, “Azərbaycanca-gürcücə qısa danışıq lüğəti” hazırlayıb (dosent M.Çinçaladze ilə birlikdə) üç dəfə 1977, 1991 və 2000-ci illərdə nəşr etdirmişdir ( Tbilisi, “Qanatleba”, 1977, 1991. Bakı, “Borçalı”, 2000) . Azərbaycan və gürcü xalqlarının mədəni və mənəviyyat cəhətdən yaxınlaşmasında böyük rol oynamış həmin lüğətlər bu günün özün də də böyük əhəmiyyət kəsb edir. Tanınmış yazıçı və tədqiqatçı Nəriman Əbdülrəhmanlının tanınmış alim-pedaqoq Fərhad Xubanlı ilə birlikdə "Azərbaycan müəllimi" qəzetinin 24 may 1989-cu il tarixli N:40 /6822/ sayında dərc etdirdiyi “Lüğətçiliyə yeni hədiyyə” adlı məqalədə oxuyuruq: "Azərbaycan və gürcü xalqlarının mədəni və mə'nəviyyat XIX international scientific conference. Vienna. Austria. 20-21.11.2025 64 cəhətdən yaxınlaşmasında da lüğətçilik az rol oynamamışdır. Hələ 1977-ci ildə Tbilisinin "Qanatleba" /"Maarif"/ nəşriyyatı "Azərbaycanca-gürcücə qısa danışıq lüğəti"ni çapdan buraxmışdır. İki qardaş xalqın leksikoqrafiyasında ilk addım olan bu kitabı A.S.Puşkin adına TDPİ-nin dosentləri M.Çobanov və M.Çinçaladze tərtib etmişlər. Kitab istər azərbaycanlı, istərsə də gürcü oxucuları üçün qiymətli vəsaitdir". Həmçinin professor Mədəd Çobanovun tərtib və nəşr etdirdiyi “Sevirəm Gürcüstanı” (Bakı, “Azərnəşr”, 1977) və “Dostluq nəğmələri” (Tbilisi, “Merani”, 1978) adlı almanaxlar Azərbaycan və gürcü oxucuları tərəfindən böyük maraqla qarşılanmış, hər iki kitab “ Azərbaycan-gürcü ədəbi əlaqələrinin genişlənməsinə atılmış ilk və önəmli addımlar” kimi yüksək dəyərləndirilmişdir. "Sevirəm Gürcüstanı" /almanax, Azərbaycan şairləri Gürcüstan haqqında, tərtib edəni Mədəd Çobanov, Bakı, “Azərnəşr”, 1977/ kitabı haqqında yazılmış rəylərdə oxuyuruq: "Azərbaycan xalqı ilə gürcü xalqının dostluğu, qardaşlığı qədimdir. Bu məhəbbətin poetik ifadəsi olan "Sevirəm Gürcüstanı" kitabında Azərbaycan şairlərinin qardaş Gürcüstana, onun füsunkar təbiətinə, şən, mehriban adamlarına həsr etdikləri şeirlərdən nümunələr verilmişdir. Toplunun tərtibçisi Mədəd Çobanovdur." /"Ədəbiyyat və incəsənət" qəzeti, N:2, 7.I.1978/. "Qədim Gürcüstan torpağı", qonaqpərvər gürcü xalqı, "Qafqazın Paris"i Tbilisi", Qafqazın vena damarı Kür. Bunlar ta lap qədimdən tutmuş bu günə qədər Azərbaycan ədəbiyyatının dönə-dönə, həvəslə müraciət etdiyi mövzulardandır. Çox az Azərbaycan yazıçısı və şairi tapmaq olar ki, onun yaradıcılığında Gürcüstanla bağlı motivlər olmasın... Əgər şair Məmməd Arazın dili ilə desək: "poetik münasibət ən ülvi münasibətdir... bir xalqın digər xalqa bundan əziz, bundan müqəddəs töhfəsi ola bilməz". Bizcə, məhz Azərnəşrin bu yaxınlarda çapdan buraxdığı "Sevirəm Gürcüstanı" adlı kitabı gürcü xalqı üçün belə bir layiqli töhfə hesab etmək olar. Kitabı A.S.Puşkin adına TDPİ-nin müəllimi Mədəd Çobanov tərtib etmişdir". /”Azərnəşr”in bədii ədəbiyyat redaksiyasının redaktoru, şair Səfalı Nəzərli, "Sevirəm Gürcüstanı", "Sovet Gürcüstanı" qəzeti, N:63/7748/, 26.V.1977/. "Azərbaycan və gürcü xalqlarının mehriban qardaşlıq, qonşuluq əlaqələrinin kökləri qədimdir... Hər iki xalq yadelli düş-mənlərə qarşı illərlə mübarizə aparmış, bir-birinə arxa olmuşdur. Tarixin neçə unudulmaz səhifələrində bu birgə mü-barizənin əks-sədası həkk olunub yaşayır... Bu yaxınlarda çapdan buraxılmış "Sevirəm Gürcüstanı" kitabında qardaş xalqlarımızın sarsılmaz dostluğunu tərənnüm edən şe'rlər toplanmışdır. Məcmuəni Mədəd Çobanov tərtib etmiş, şair Məmməd Araz ön söz yazmışdır". /Dilsuz Musayev, "Sevirəm Gürcüstanı", "Qızıl bayraq", N:122/3804/, 11.X.1977; "Ədəbiyyat və incəsənət" qəzeti, N:9, 25.II.1978/. "Sevirəm Gürcüstanı" kitabı haqqında filologiya elmləri namizədi Həmid Vəliyevin rə'yi və kitabın şəkli Tbilisidə rus dilində, nəşr olunan "Молодежь Грузии" qəzetində /N:63 /8078/, 26.V.1977/, Tbilisidə erməni dilində nəşr olunan "Sovetakan Vrastan" qəzetində /N:66 /11856/, 2.VI.1977/, Y.Boboxidzenin geniş rəyi və kitabın şəkili Bolnisi şəhərində Azərbaycan və gürcü dillərində nəşr olunan "Qələbə bayrağı" - "Qamardjvebis droşa" qəzetində /N:55/4679/, 26.IV.1980/ dərc olunmuşdur. "Sevirəm Gürcüstanı" kitabından Azərbaycan Sovet Ensiklopediyasının VI cildində "Gürcüstan SSR" məqaləsində istifadə olunmuşdur. /Bakı, 1982, VI c., səh.135/. Prof.Mədəd Çobanovun XII əsrdən bəri klassik Azərbaycan şairlərinin Gürcüstan və gürcü xalqı haqqında qələmə aldıqları səmimi hiss və duyğularını toplayaraq tərtib etdiyi və 1977-ci ildə Bakıda “Azərnəşr” Azərbaycan Dövlət Nəşriyyatında çap olunmuş “Sevirəm Gürcüstanı” adlı kitabı yüksək dəyərləndirən tanınmış gürcü alimi və şairi Leyla Eradze , yenə də Mədəd Çobanovun tərtib etdiyi, müasir Azərbaycan şairlərinin Gürcüstanla bağlı deyilmiş poetik nümunələrinin toplandığı “Dostluq nəğmələri” adlanan kitabı gürcü dilinə tərcümə etmiş və 1978-ci ildə Tbilisidə “Merani” Gürcüstan Dövlət Nəşriyyatında çap etdirmişdir . Kitabın redaktoru Sosialist Əməyi Qəhrəmanı, şair Qriqol Abaşidzedir. Kitaba Azərbaycanın xalq şairi Bəxtiyar Vahabzadə ön söz yazmışdır. Kitab Azərbaycanın xalq şairi Səməd Vurğünun “Rustaveliyə” şeiri ilə başlayır. Şeirdə gürсü ədəbiyyatı korifeyinin əzəməti bütün varlığı ilə tərənnüm edilir. (Onu da qeyd edək ki, bu gözəl şeirin üzə çıxarılması da bilavasitə Leyla Eradzenin adı ilə bağlıdır. Bu barədə bir qədər sonra ətraflı qeyd edəcəyik.- M.Ç.) Məcmuədə Süleyman Rüstəmin «Öpürəm torpağını», «Tiflis», «Gürcü qızına», «Titsian Tabidze», Məmməd Rahimin «Tbilisi», «Əbədi məşəl», Osman Sarıvəllinin «İki nəğmə» şerləri dost xalqa məhəbbət sədası kimi səslənir. Əhməd Cəmilin «Gürcüstan», Mİrvarid Dilbazinin «İlya Çavçavadzeyə», Nəbi Xəzrinin «Gürcü qardaşlarıma», Cabir Novruzun «Gürcü qızı» əsərləri də gürcü oxucusuna xoş təsir bağışlayır. Azərbayсan sovet poeziyasının orta nəslinə mənsub olan istedadlı şairlərdən Adil Babayev, Əliağa Kürçaylı, Hüseyn Arif, Nəriman Həsənzadə, Məmməd Araz, Fikrət Qocanın şeirləri tərcümədə xüsusilə uğurlu çıxmışdır. Kitabda Gürсüstanda doğulub böyümüş, poeziya aləmində ilkin addımlarını bu torpaqda atmış, sonralar Bakıda yazıb-yaratmış istedadlı şairlərdən İsa İsmayılzadə, Abbas Abdulla, həmçinin, Tbilisidə fəaliyyət göstərmiş Dünyamalı Kərəm və Əlixan Binnətoğlunun yaradıcılığından verilmiş nümunələr diqqəti xüsusilə cəlb edir. Həmin şeirlərin ruhu gürcü poeziyasına yaxın olduğu üçün geniş oxucu kütləsi tərəfindən səmimi qarşılanır. Ümumiyyətlə, poeziyamızın tərcüməsi sahəsində tanınmış gürcü XIX international scientific conference. Vienna. Austria. 20-21.11.2025 65 şairi və alimi, ədəbiyyatımızın bilicisi və yaxın dostu Leyla Eradzenin zəhməti böyükdür. O, 20-dən çox kitabı Azərbaycan dilindən gürcü dilinə böyük ustalıqla tərcümə etmişdir. "Dostluq nəğmələri" (gürcü dilində, tərtib edəni Mədəd Çobanov, tərcümə edəni Leyla Eradze, Müasir Azərbaycan şairləri Gürcüstan haqqında, Tbilisi, “Merani”, 1978) kitabı haqqında "Sovet Gürcüstanı" qəzetində dərc olunmuş rəydə oxuyuruq: “...Mədəd Çobanovun tərtib etdiyi, Leyla Eradzenin isə gürcü dilinə çevirdiyi bu kitabda müasir Azərbaycan şairlərinin Gürcüstan haqqında yazılmış əlliyə yaxın şeiri toplanmışdır... Həmin şeirlərin ruhu gürcü poeziyasına yaxın olduğu üçün geniş oxucu kütləsi tərəfindən səmimi qarşılanır... Ümumiyyətlə, Gürcüstanda sovet ədəbiyyatı günləri ərəfəsində buraxılmış "Dostluq nəğmələri" kitabını Azərbaycan və Gürcüstan ədəbi əlaqələri sahəsində təqdirəlayiq hal hesab etmək lazımdır" /V.Cangidze, Ə.İsmayıllı, "Dostluq nəğmələri", "Sovet Gürcüstanı", N:139 /7979/, 21.XI.1978/. Bəli, "Gürcüstan lap əzəldən bəri şairlərimizin dönə-dönə müraciət etdikləri mövzulardan biri olmuşdur. Hələ XII əsrdə Əfzələddin Xaqani "Baqrationların qapısı mənim üçün açıqdır" demişdir... Şübhəsiz, bu, onların yaradıcılıqlarında öz bariz ifadəsini tapmaya bilməzdi... Azərbaycan şairləri Gürcüstan mövzusundan öz yaradıcılıqlarında dostluq rəmzi, qardaşlıq, mehriban qonşuluq simvolu kimi daha geniş istifadə etmişlər. Bu yaxınlarda Tbilisidəki "Merani" nəşriyyatının gürcü dilində çapdan buraxdığı "Dostluq nəğmələri" məcmuəsində Azərbaycan şairlərinin Gürcüstana həsr etdikləri şeirlər toplanmışdır. Bu işdə tərtibatçı, tanınmış alim Mədəd Çobanovun və tərcüməçi Leyla Eradzenin zəhmətini qeyd etmək lazımdır. Kitab öz nəfis tərtibatı cəhətdən diqqətəlayiqdir. Bircə iradımız var. Məcmuəni daha iri həcmdə buraxmaq lazım idi. Çünki Azərbaycan sovet şairlərinin Gürcüstana həsr etdikləri şeirlər kitabdakından daha çoxdur. Bəzi görkəmli sənətkarlarımızın, o cümlədən Mikayıl Müşfiqin, Hüseyn Cavidin, Əhməd Cavadın və digərlərinin bir şeiri, yaxud əsərlərindən parça belə verilməməsi təəssüf doğurmaya bilməz. Kitabın tərtibatında şairlərin yaş xüsusiyyətlərini də nəzərə almaq, onların yaradıcılıqları haqqında gürcü oxucusuna qısa da olsa, məlumat vermək olardı." /Şurəddin Məmmədov, Qardaşlıq rəmzi kimi, "Ədəbiyyat və incəsənət" qəzeti, N:1/1876/, 4.I.1980/. Ömrünün sonuna kimi Azərbaycan ədəbiyyatının qızğın təbliğatçısı olan Leyla Uşanqi qızı Eradze (ლეილა უშანგის ასული ერაძე) 1930-cu il (bəzi mənbələrdə 1933-cü il) fevralın 13-də Tiflisdə dünyaya gəlmiş, ilk və orta təhsilini də elə Tiflisdə də almışdır. 1953-cü ildə (1955) Tbilisi Dövlət Universitetinin şərqşünaslıq fakültəsinin türk dili və ədəbiyyatı şöbəsini Fərqlənmə diplomu ilə bitirdikdən sonra bir müddət “Dila” (“დილა”- “Səhər”) jurnalının redaksiyasında poeziya şöbəsinə rəhbərlik etmiş, daha sonra Gürcüstan dövlət radiosunda mədəniyyət şöbəsinin müdiri vəzifəsində çalışmışdır. 1965-1969-cu illərdə Gürcüstan Elmlər Akademiyasının Şota Rustaveli adına Ədəbiyyat İnstitutunun aspiranturasında təhsilini davam etdirmişdir. O, “Azərbaycan yazıçıları və Gürcüstan” mövzusunda mövzusunda namizədlik dissertasiyasını 1971ci ildə Tbilisidə uğurla müdafiə etmişdir. Leyla Eradze daha sonralar Gürcüstan Dövlət Radio və Televiziya Komitəsində, Gürcüstan Elmlər Akademiyasının Şota Rustaveli adına Gürcü Ədəbiyyatı İnstitutunda işləmişdir. O, “Gürcü-Azərbaycan ədəbi əlaqələri” mövzusunda doktorluq dissertasiyasını isə 1990-cı ildə Bakıda uğurla müdafiə etmişdir. Leyla Eradzenin elmi tədqiqat sahəsinə diqqət etdikdə, aydın görünür ki, onun istər namizədlik, istərsə də doktorluq dissertasiyasının mövzuları, ədəbiyyat elminin eyni kardinal probleminin müxtəlif cəhətlərinə - milli ədəbiyyatların qarşılıqlı əlaqəsinə və qarşılıqlı təsirinə həsr olunmuşdur. Daim məhsuldar işləyən, əsl tədqiqatçı üçün lazım olan bütün keyfiyyətlərə malik şərqşünas alim kimi tanınmış L.Eradzenin elmi araşdırmalarının ümumi mövzusu Azərbaycan-Gürcüstan ədəbi əlaqələrinin problemləri, bu əlaqələrin tarixini izləmək və inkişaf etdirmək olub, elmi-ədəbi, ictimai fəaliyyətini Azərbaycan və gürcü xalqlarının ədəbi-mədəni əlaqələrinin tədqiqinə və inkişafına həsr edib. Gürcüstan-Azərbaycan ədəbi əlaqələrinə aid 2 monoqrafiyanın, 100-ə qədər məqalənin müəllifı olan Leyla Eradze Azərbaycan ədəbiyyatının bir çox problemlərini tədqiq etmiş və eyni zamanda, Azərbaycan ədəbiyyatından xeyli nümunələri gürcü dilinə çevirmişdir. Onun gərgin əməyi sayəsində formalaşan, xeyli genişlənın, dərinləşən Azərbaycan-Gürcüstan ədəbi-mədəni əlaqələri hazırda böyük intensivliklə inkişaf edir. Filologiya elmləri doktoru (1990), Gürcüstan-Azərbaycan Dostluq və Əməkdaşlıq Cəmiyyətinin vitseprezidenti (1992), İ.Maçabeli adına Gürcüstan Dövlət mükafatı laureatı (1994), professor (1995) Leyla Eradze həm də “Azərbaycanın Əməkdar mədəniyyət işçisi” fəxri adına, PEN Klubun Beynəlxalq Ədəbi Mükafatına (1995), Rəsul Rza mükafatına (1996) və s. layiq görülmüşdür. L/Eradze Azərbaycan ədibləri arasından ilk olaraq görkəmli Azərbaycan şairi, dramaturq, tərcüməçi, ədəbiyyatşünas, Azərbaycanın ilk xalq şairi (1956), 2 dəfə "Stalin" mükafatı laureatı (1941, 1942) və 2 dəfə "Lenin" ordeni laureatı, Azərbaycan Yazıçılar İttifaqının sədri (1941–1948), Azərbaycan SSR Ali Sovetinin deputatı, Azərbaycanın Xarici Ölkələrlə Mədəni əlaqə Cəmiyyətinin sədri, Azərbaycan Elmlər Akademiyasının təsisçilərindən biri (1945), Azərbaycan Elmlər Akademiyasının akademiki (1945) və vitseprezidenti (1954–1956) Səməd Vurğunu (1906-1956) elmi tədqiqata cəlb etmiş və onun əsərlərini sevə-sevə və böyük ustalıqla gürcü dilinə çevirmişdir. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 66 “…Mənim (Leyla Eradzenin – M.Ç.) 25 yaşım olanda onun (Səməd Vurğunun – M.Ç.) «Azərbaycan» şeirini gürcü dilinə tərcümə etmişdim. Bizi İosif Noneşvili tanış etdikdə o (Səməd Vurğun – M.Ç.), gülərək dedi: - Çox şadam ki, məni böyük Rustavelinin nəvələri öz dillərində oxuyurlar…” (Məmmədov, Aydın. 1978) - deyə Səməd Vurğunu böyük hörmət və ehtiramla xatırlayan Leyla Eradze sonralar şairin «Zəncinin arzuları» poemasını və bir sıra şeirlərini Georgi Leonidzenin təklifi ilə orijinaldan tərcümə etmiş və 1958-ci ildə Tbilisidəki «Sabçota Sakartvelo» nəşriyyatında ayrıca kitab halında çap etdirmişdir. Heç şübhəsiz ki, həmin kitabdakı tərcümələrin müvəffəqiyyətli çıxmasında o vaxtlar gənc mütərcimin böyük gürcü şairinə hesabat verməsi də az rol oynamamışdır. Təsadüfi deyil ki, bu tərcümələri G.Leonidze oxuyub bəyənmiş və çapını məsləhət görmüşdür. “Seçilmiş əsərlər” (“ რჩეული ”- “Rçeuli”) adlanan həmin kitab şairin “Mən tələsmirəm” şeiri ilə açılır. Bu şeiri rus dilinə ilk dəfə məşhur rus şairi Konstantin Simonov tərcümə etmişdir. K.Simonovun Səməd Vurğunla dostluğu, onun bir sıra şeirlərinin, xüsusilə, “Şair, nə tez qocaldın sən” şeirini rus dilinə böyük sənətkarlıqla tərcümə etməsi məlumdur. Lakin tanınmış şair-tərcüməçi Abbas Abdulla yazmışdır ki, “tərəddüd etmədən demək olar ki, Leyla Eradzenin “Mən tələsmirəm”in gürcü dilinə tərcüməsi K.Simonovun rus dilinə tərcüməsi ilə cəsarətlə rəqabətə girə bilər və bir sıra cəhətlərinə görə üstün gələr.” (Abdulla, Abbas. 30 mart, 1976) Dostlar, badələri qaldırın içək! Gecə, ulduzludur, hava da sərin. Demirəm məst olub dünyadan keçək… Deyirəm mehriban düşüncələrin İsti qucağında qızınaq bir az… Səməd Vurğunun “Mən tələsmirəm” şeirinin ilk bəndinin sonucu misralarını Konstantin Simonov belə tərcümə etmişdir: “Не говорю: “Забудем всё на свете!” “Согреемся немного”, – говорю”. Məlumdur ki, Səməd Vurğun sadəcə olaraq «İsinmək» istəmir, bu isinməyin məkanını, yerini də deyir: “Mehriban düşüncələrin isti qucağında”. Leyla Eradzedənin tərcüməsi, demək olar ki, orijinalda olduğu kimi səslənmişdir: ცხოვრების დიდ წიგნს დავასრულებ, მე ასე ვგონებ, ვერას დამაკლებს, გადიქროლონ დროთა ქარებმა, ოღონდ ჩემს კალამს დიდხანს შერჩეს ძალა და ღონე, არ მეჩქარება, მე არსაით არ მეჩქარება! Leyla xanımın tərcüməçilik məharəti bir də ona görə diqqəti cəlb edir ki, o, Səməd Vurğun yaradıcılığına xas olan hikmətli, aforizm kimi səslənən fikirləri, frazeoloji və idiomatik ifadələri gürcü dilində qoruyub saxlamağa səy göstərmiş və bunu məharətlə bacarmışdır. O, şairin “Salam, Moskva!”, “Ziyafət”, “Maarkısın qəbri üstündə”, “Alman bənnası və sovet zabiti”, “Deyin, gülün, övladlarım” və s. şeirlərini böyük ustalıqla tərcümə etmişdir. Onun tərcüməsi demək olar ki, nöqsansızdır və tərcümə ədəbiyyatının nailiyyəti hesab oluna bilər. “Bahar düşüncələri”, “Düşüncələr”, “Körpünün həsrəti”, “Təyyarə meydanında”, “Rəssamın son əsəri”, “Gödəkcə”, “Göz aydınlığı”, “Dörd saz”, “Mən və Bahar”, “Ürək”, “Ananın öyüdü”, “Həsrət”, “Azərbaycan”, “Bahar”, “Anama”, “Orduya”, “Şikəstəyə məktub”, “Gecə”, “Əzilmə”, “Tarla nəğməsi” və s. şeirlərin eləcə də, “Muğan” poemasından “Muğanlı qız” parçasının və “Zəncinin arzuları” poemasının tərcümələri haqqında da eynilə xoş sözlər söyləmək olar. Onu da qeyd edək ki, Səməd Vurgunun Leyla Eradzenin tərcüməsi ilə 1958-ci ildə Tbilisidə gürcü dilində çap olunmuş “Seçilmiş əsərləri” (“Rçeuli”) kitabında işıqüzü görmüş əsərlərin bəziləri gürcü dilinə müxtəlif tərcüməçilər tərəfindən bir neçə dəfə tərcümə olunub. O cümlədən, “Azərbaycan” şeiri üç dəfə, “Zəncinin arzuları” poeması iki dəfə. “Zəncinin arzuları”nın ilk tərcüməsi Otar Kupravaya məxsusudur. “Axalqazrda kommunisti” qəzetinin 1954-cü il 20 iyul tarixli sayında dərc olunmuşdur. Doğrudur, poema həm O.Kupravanın, həm də Leyla Eradzenin tərcüməsində müvəffəqiyyətli çıxmışdır. Lakin qeyd etməliyik ki, birinci tərcüməçi əsərin rus tərcüməsinə (poemanı rus dilinə M.Aliger çevirmişdir), ikinci tərcüməçi isə əsərin orijinalına sadiq qalmışdır. O.Kuprava poemanı rus dilində olduğu kimi “Neqr qovorit”- “Labaraqobe zanqi”- “Zənci danışır”, Leyla Eradze isə orijinalda olduğu kimi “Zəncinin arzuları”- “Zanqis survilebi” adlandırmışdır. O.Kupravanın poemanı rus dilindən çevirməsi əsərin XIX international scientific conference. Vienna. Austria. 20-21.11.2025 67 istənilən parçasının tərcüməsi ilə müqayisədə nəzərə çarpır. Leyla Eradzenin tərcümə etdiyi “Zəncinin arzuları” isə Səməd Vurğun sənətkarlığının bir sıra cəhətlərini - yüksək şeiriyyətini, hikmətliliyini, ləngərli, ağır siqlətli misralar yaratmaq bacarığını, böyük vətəndaşlıq ehtirasını və pafosunu özündə cəmləşdirmişdir. Abbas Abdulla haqlı olaraq yazmışdır ki, beynəlxalq problemlərə həsr olunmuş əsərlər içərisində özünə layiqli yer tutan “Zəncinin arzuları” poemasını tərcümə eləmək həm məsuliyyətli, həm də şərəfli işdir və tərcüməçilər arasında bu məsuliyyəti ən çox Leyla Eradze hiss etmişdir. Elə buna görə də onun tərcüməsi daha müvəffəqiyyətli çıxmışdır. (Abbas Abdulla. 30 mart, 1976) Leyla Eradze S.Vurğun poeziyasının gürcü dilinə tərcüməsi üzərində yaradıcılıq işini daim uğurla davam etdirmiş, şairin yeni-yeni əsərlərini gürcü dilinə çevirmişdir. Elə buna görə də, ədəbiyyatımızın bu sadiq dostuna sevimli şair-tərcüməçimiz Abbas Abdulla öz sevgi və duyğularını yazmaqla bərabər yeri gəldikcə bəzi iradlarını da söyləməyi unutmamışdır. O, təəssüf hissi ilə qeyd etmişdir ki, “Bahar”, “Düşünələr” şeirlərinin tərcüməsi orijinaldan çox aşağı durur. Leyla xanım da bəzi tərcüməçilər kimi bəzən «ixtisarçılığa» meyl göstərmişdir: “Zəncinin arzuları” poemasının bir hissəsi, «Muğan» poemasında şairin pambıqçı qızla söhbəti və həmin poemadakı “Olur” rədifli qoşma xeyli ixtisarla tərcümə olunmuşdur. “Azərbaycan” şeirində isə: “Havalansın Xanın səsi, // Qarabağın şikəstəsi” - beyti, “დე ისმოდის საზის ჰანგი, // და სიქასტა ყააბაკის”, - “(De ismodis sazis hanqi, // Da Şikasta Qarabağis.)”.- şəklində tərcümə olunmuşdur ki, bu da düzgün deyil. Görünür, mütərcim buradakı “Xan” sözünün mənasını düzgün başa düşməmiş, onun məşhur Azərbaycan müğənnisi Xan Şuşinskinin adı olduğunu bilməmiş, ona görə də “Xan”ı “saz”la əvəz etmişdir. Bu iradlardan sonra A.Abdulla öz arzularını da bildirmişdir: “Azərbaycan ədəbiyyatını, xüsusən şeirimizi, S.Vurğun irsini böyük məhəbbətlə sevən Leyla xanımın yeni tərcümələrinin sənətkarlıq baxımından daha kamil olacağına böyük ümidlər bəsləyirik. Axı, o, haqqında danışdığımız əsərləri təxminən qırx il bundan qabaq tərcümə edib.” Bəli, Leyla Erazde bu xeyirxah işi sonralar da uğurla davam etdirmiş və sözün əsl mənasında mahir tərcüməçi kimi tanınmışdır. Azərbaycan ədəbiyyatının gürcü dilinə çevirməsində və təbliğ olunmasında onun böyük xidmətləri olmuşdur. L.Eradze Gürcüstanda Azərbaycan ədəbiyyatının qızğın tərcüməçilərindən, tədqiqatçılarından və təbliğatçılarından biri kimi Azərbaycan ədəbi mühitində də tanınmağa başlamış və qısa bir müddətdə özünü bu sahədə ustad təsdiq etmişdir. O, Səməd Vurğundan sonra bir çox Azərbaycan ədiblərinə müraciət etmiş və onların xeyli sayda əsərlərini də böyük ustalıqla öz ana dilinə çevirmişdir. Leyla Eradze 1978-ci ildə Bakıda keçirilmiş Zaqafqaziya şairlərinin beynəlmiləl poeziya gecəsində iştirak etdiyi zaman demişdir: “Azərbaycan dilini bilməyim qarşımda zəngin bir sənət xəzinəsinin qapılarını açmışdır. Yaradıcı əməyimin böyük bir hissəsini Azərbaycan xalqının zəngin və gözəl söz sənətindən nümunələri gürcü dilinə çevirməyə sərf etmişəm. Tbilisidə buraxdırdığım kitablar haqqında “Ədəbiyyat və incəsənət” qəzeti vaxtaşırı məlumat verdiyinə görə bu barədə geniş danışmaq istəmirəm. Nəşr olunan hər yeni əsər məni Azərbaycan ədəbiyyatı ilə daha çıx bağlayır: yeni-yeni dostlar qazanıram. Yuxarı Salahlıda böyük Səməd Vurğunun adını daşıyan Poeziya Evində Zaqafqaziya Respublikaları Yazıçılar İttifaqlarının birləşmiş katibliyində mən də iştirak etmişdim. Qardaş respublikaların paytaxtlarında poeziya gecələri keçirmək ideyası o vaxt yaranmışdı. Bakıdakı bu ilk görüşdə iştirak etməyimə sevinirəm. Mənimlə birlikdə tanınmış gürcü şairləri R.Margiani, N.Qureşidze, M.Kaxidze Bakıya gəliblər. Revaz Margiani Azərbaycan haqqında gözəl şeirlər müəllifidir. N.Qureşidze də, M.Kaxidze də həmçinin… Bakıya bu gəlişimdə də əziz həmkarlarıma deməyə sözüm var: Mədəd Çobanovun tərtib etdiyi “Dostluq təranələri” (Azərbaycan şairləri Gürcüstan haqqında) adlı yeni məcmuəni tərcümə edib nəşriyyata vermişəm. Kitabda Xaqanidən başlayaraq bir sıra görkəmli söz ustalarının yüksək beynəlmiləlçilik duyğusu ilə yazılmış əsərləri toplanmışdır. Azərbaycan Yazıçılar İttifaqının İdarə Heyətinin katibi İmran Qasımov kitaba ön söz yazıb.” (Beynəlmiləlçi poeziya gecəsinin iştirakçılarının ürək sözləri. «Ədəbiyyat və incəsənət» qəzeti, 18 fevral, 1978.) “Mən görmüşəm Gürcüstanı, oylağıdır gözəlliyin, Coşğun axan çayları var, bulaqları sərin-sərin. Yaz gələndə çox sıx olur Gürcüstanın ormanları, Yel əsdikcə dörd bölünür bu dağların dumanları.” (Nəzirli, 1996, s.241) -deyən Xalq şairi Səməd Vurğun Gürcüstanı öz Vətəni kimi sevmiş, gürcü ədəbiyyatının təbliği üçün çox iş görmüşdür. Onun yaradıcılığında qonşu gürcü xalqının qəhrəmanlığı və milli istiqlaliyyət uğrunda mübarizəsi geniş şəkildə əks olunmuşdur. S.Vurğun 1928-ci ildə yazdığı "Tiflis maralı" adlı şeirində Tiflisi gözəllikdə cənnətə bənzətdiyi kimi, gürcü gözəllərini də cənnətdə yaşayan mələklərə bənzətmişdir. Şair “Vaqif”, “Xanlar” dramlarında Tamara, Şaliko və Koba kimi müsbət gürcü surətləri yaratmışdır. Xalqlar dostluğunun alovlu tərənnümçüsü olan S.Vurğunun “Yoldaş, hinger, amxanaqo”, “Rəhbərin Vətəni” şerləri və bir neçə publisistik yazıları gürcü xalqına böyük məhəbbətin ifadəsidir. O, Zaqafqaziya xalqları arasında heç bir fərq qoymamış, onları daha da "bir can kimi" birləşməyə çağırmışdır: XIX international scientific conference. Vienna. Austria. 20-21.11.2025 68 Qarışsın Qazağa Dilcan dərəsi, Daha da birləşib olsunlar bir can Yoldaş Azərbaycan, Hinger Hayastan, Bir də axmanaqo qızıl Gürcüstan. (Sevirəm Gürcüstanı, 1976, s.3) Məlumdur ki, Səməd Vurğunun yaradıcılığında Gürcüstan mövzusu əsas yer tutduğu kimi, onun çıxış, məruzə və məqalələrində də gürcü ədəbiyyatına, onun klassiklərin, çağdaş nümayəndələrinə etdiyi müraciətlər və istinadlar da çoxluq təşkil. Tərcüməçi Leyla Eradze böyük Azərbaycan şairi Səməd Vurğunun poetik şeirlərini gürcü dilinə tərcümə etməklə yanaşı həm də, onun yaradıcılığının Gürcüstanla bağlı məsələlərini tədqiq etməyə nail olmuşdur. Xüsusilə, S.Vurğun yaradıcılığında gürcü xalqının tarixi keçmişinin və bugününün geniş yer tutması L.Eradzenin məhz bu mövzuda araşdırmalar aparmasını şərtləndirmişdir. Onun fikrincə, Gürcüstan mövzusu şairin təkcə “Kür çayı”, “Rəhbərə salam” şeirlərində deyil, “Vaqif” və “Xanlar” dramlarında da müəyyən yer tutur. Şair bu şeirlərində gürcü torpağını, onun təbiətini tərənnüm etmişdir. Tədqiqatçı “Səməd Vurğunun naməlum şeiri” məqaləsində belə bir nəticəyə gəlir: “Əgər Səməd Vurğun yuxarıda adları çəkilən şeirlərdə gürcü torpağını, onun zəngin, ecazkar təbiətini, xalqlar dostluğunu tərənnüm etmişsə, pyeslərində gürcü obrazlarını, onların psixologiyasını, təbiətini ifadə edən personajlar yaratmağa müvəffəq olmuşdur” (Eradze, L. 1970, 18 iyul). Tədqiqatçının “Vaqif”dəki Şaliko, “Xanlar”dakı Koba obrazları barədə dedikləri bir daha göstərir ki, L.Eradze S.Vurğun yaradıcılığına yaxşı bələd olmuş və dərindən araşdırmışdır. L.Eradze yazır ki, Səməd Vurğunun arxivində işləyərkən gürcü ədəbiyyatı ilə bağlı iki sənədə rast gəlmişdir. Bunlardan biri S.Vurğunun gürcü şairi David Quramaşvilinin həyat və yaradıcılığına həsr olunmuş 21 səhifəlik makina yazısında bir məqalənin əlyazması, ikincisi isə “Rustaveli” adlı şeirinin əlyazmasıdır. D.Quramaşvili haqqında əlyazması sübut edir ki, şair onun yubileyinə ciddi hazırlaşaraq həyat və yaradıcılığı ilə hərtərəfli tanış olmuşdur. Məlumdur ki, S.Vurğun gürcü şairi Ş.Rustavelinin “Pələng dərisi geymiş pəhləvan” əsərini tərcümə etməklə kifayətlənməmiş, müxtəlif münasibətlərlə etdiyi çıxışlarda, məruzə və məqalələrində onun adını çəkmiş, yaxud istinadlar etmişdir. Ona görə də, tədqiqatçı-tərcüməçi L.Eradze gürcü xalqının dostu olan böyük Azərbaycan şairi S.Vurğunun XII əsr gürcü ədəbiyyatının klassiki Şota Rustaveliyə həsr olunmuş şeirinə rast gələrkən böyük sevinc hissini də gizlətməmişdir: “Səməd Vurğunun arxivində təsadüf etdiyimiz ikinci maraqlı sənəd şairin “Rustaveli” adlı şeirinin əlyazmasıdır. Şeir S.Vurğunun nəşr edilmiş əsərlərinə daxil edilməmişdir” (Eradze, L. 1970, 18 iyul). Tədqiqatçı bu fikirdədir ki, həmin şeir böyük gürcü şairi Şota Rustavelinin yubileyi ərəfəsində qələmə alınmış, bəlkə çıxışlarının birində oxumuşdur da. Həm şeirin üzə çıxarılması, həm də L.Eradzenin şeir haqqında fikirləri Azərbaycan ədəbiyyatşünaslığı üçün də bir yenilik idi: “Heca vəznində 16-lıqla yazılmış şeirin sonunda verilmiş “...bu dünya boş nimçəmidir” yarım misradan aydın olur ki, şeir tamamlanmamışdır. Ümumiyyətlə, şeirin ümumi ruhundan, yazılışından görünür ki, S.Vurğun şeiri bitirməmiş, üzərində yaradıcılıq işini davam etdirməyi nəzərdə tutmuşdur. Çox güman ki, elə buna görə də şeiri nəşr etdirməmişdir” (Eradze, L. 1970, 18 iyul). Leyla Eradze “Səməd Vurğun və Gürcüstan” (Eradze, L. 1970, N:10) sərlövhəli məqaləsində araşdırmalarını bir qədər də genişləndirmiş, onun yaradıcılığa başladığı ilk illərdə Gürcüstana gəldiyinin zamanını təyin etmişdir. O, S.Vurğunun 1929-cu ildə yazdığı “Kür çayı” şeiri üzərində dayanaraq, bu şeirdə Azərbaycan insanı ilə qardaş gürcü xalqının birliyini tərənnüm etdiyi qənaətinə gəlir. Şeirin adının da “Kür çayı” seçilməsi təsadüfi deyildir; bu rəmz hər iki xalqı birləşdirən fiziki və mənəvi amildir. Şairin “Tiflisin arxası, Qazağın beli, / Hər ikisi sənin, sənə dost eli” misralarında bu amilin poetik təsviri aydın şəkildə görünür. Bu şeirdən çıxış edərək tədqiqatçı belə bir qənaətə gəlir ki, Səməd Vurğun yaradıcılığının sonrakı mərhələləri də göstərir ki, “bu motivlər şairin yaradıcılığında təsadüfi səciyyə daşımamış, onun idealları ilə ülvi şəkildə bağlı olmuşdurş” (Eradze, L. 1970, N:10, s.198) Tədqiqatçı S.Vurğunun “Vaqif” dramına da müraciət etmiş, əsərdəki Şaliko və Tamara obrazları üzərində xüsusilə dayanmışdır. Onun fikrincə, pyesdə şairin yaratdığı gürcü obrazları diqqətəlayiqdir. Şaliko xalqın düşmənə qarşı mübariz bir oğlu, öz qanını son damlasına qədər əsirgəməyən bir igid kimi təsvir edilir. Tədqiqatçı S.Vurğun yaradıcılığında mühüm yer tutan dostluğun hər iki xalqın keçmiş ənənələrindən gəldiyinə əmin olduğunu bildirir: “Səməd Vurğun Azərbaycan xalqı ilə gürcü xalqının siyasi mənafeyinin birliyindən tez-tez yazmışdır. Böyük vətən müharibəsi illərində “Bizim andımız” məqaləsində şair Zaqafqaziya xalqlarının birlikdə alman işğalçılarına qarşı mübarizəsindən, onların tarixi qəhrəmanlığından danışır.” (Eradze, L. 1970, N:10, s.199) Leyla Eradze S.Vurğunla bağlı araşdırmalarında onun gürcü şair və yazıçıları ilə dostluq əlaqələrindən də söhbət açır. Gergi Leonidze ilə Səməd Vurğun dostluğu bunun bariz nümunəsidir. Tədqiqatçı bu fikirdədir ki, S.Vurğunla G.Leonidze arasında böyük yaradıcılıq qohumluğu vardır. Bu yaxınlıq iki şairin şəxsi dostluğu ilə xalqların dostluğuna çevrilir. Onların bir-birinə olan məktublarında da bir-birilərinin yaradıcılığına olan isti münasibət aydın görünür. Buna misal olaraq, G.Leonidzenin “Drujba narodov” jurnalında nəşr edilən XIX international scientific conference. Vienna. Austria. 20-21.11.2025 69 “Portaxala” poemasını və bu poema haqqında S.Vurğunun məktubunu göstərir. G.Leonidzenin yaratdığı ana obrazının S.Vurğunu mütəəsir etməsinin səbəblərini axtarır və bu mövzunun ona da çox yaxın və doğma olduğu nəticəsinə gəlirdi. Bunu S.Vurğunun G.Leonidzeyə məktubuna istinad edərək yazırdı: “Sənin poemandan aldığım böyük təəssüratı bir məktubda izah etmək çox çətindir... Sən onu lirik poema adlandırırsan. Ancaq bu gözəl lirik poemanı mən poemanın fəlsəfəsinin təsdiq etdiyi kimi, əsrlərlə yaşamış, əməkdən daim zövq almış, həm də əzab çəkmiş... və nəhayət məhz namuslu zəhməti və mənəvi cəsarəti sayəsində ölməzlikəbədilik hüququ qazanmış qüdrətli gürcü xalqı haqqında əsil epopeya hesab edirəm.” (Eradze, L. 1970, N:10, s.201) Georgi Leonidzenin “Portaxala” poemasının S.Vurğunda bu qədər böyük təəssürat yaratmasının başqa bir səbəbi də Ana obrazı olmuşdur. Bu gözəl gürcü qadının obrazı, şairin məktubundan da göründüyü kimi, heç vaxt xatirindən silinməmişdir. Leyla Eradze görkəmli Azərbaycan yazıçıs, tanınmış nasir, ədəbiyyatşünas, publisist, yazıçı, pedaqoq, ssenarist, Azərbaycan Yazıçılar İttifaqının üzvü (1949), Azərbaycanın xalq yazıçısı (1984), Azərbaycan SSR komsomolu mükafatı laureatı (1976), filologiya elmləri namizədi (1954), Azərbaycan Respublikası Ali Sovetinin deputatı (1986, 1990), Azərbaycan Yazıçılar İttifaqının sədri (1986-1987), Azərbaycan Yazıçılar Birliyinin Ağsaqqallar Şurasının sədri (1991), M.F.Axundov adına ədəbi mükafat laureatı (1991) İsmayıl Şıxlının (1919-1995) da yaradıcılığını tədqiq etmişdir. O, yazıçının “Dəli Kür” romanını gürcü dilinə tərcümə etməklə yanaşı, Azərbaycan nəsrində gürcü mövzusu problemini də araşdırmış, bu əsərin məzmunu, obrazları haqqında da fikir yürütmüşdür. Bu da Azərbaycan bədii nəsrinin bu nümunəsinə kənar ədəbi tənqidin münasibətini əks etdirmək baxımından maraqlıdır. Məlumdur ki, “Dəli Kür” romanında Qori seminariyasının təsvirinə də geniş yer verilmişdir. Qori seminariyasının Qafqaz xalqlarının mədəni həyatındakı rolunu yüksək qiymətləndirən tədqiqatçı bu fikrində haqlıdır ki: “Bu məktəblərdə (Çar Rusiyasının Qafqazda Qori seminariyası tipli məktəblər açmasında-M.Ç.) mütləqiyyətin müstəmləkəçilik siyasətinin daşıyıcıları ilə yanaşı demokratik ideyalar ilə silahlanmış xalq maarifçiləri də fəaliyyət göstərirdi.” (Eradze, L. 2015, s. 12) İ.Şıxlının həyat və yaradıcılığı haqqında gürcü oxucularına ətraflı məlumat verən tədqiqatçı əsərin ideyasını da düzgün müəyyənləşdirərək “Əsərin ideyası köhnə, məhvi labüd olan cəmiyyətin tədricən dağılması və onun faciəli şəkildə sona yetməsidir. Yazıçı əsasən bir ailənin faciəsini sinfi münaqişə fonunda ümumiləşdirmiş və ona geniş ictimai məna vermişdir” (Eradze, L. 2015, s. 12) - qənaətinə gəlirdi. Tədqiqatçı L.Eradze Cahandar ağa obrazı üzərində geniş dayanaraq bu ailədə baş verən prosesləri də təhlilə cəlb edir və Cahandar ağanı təkcə mülkədar sinfinin nümayəndəsi kimi deyil, bir şəxsiyyət olaraq dəyərləndirir. Cahandar ağa sövqi-təbii hiss edir ki, hər şey dəyişir, heç nə əvvəlki kimi qalmayacaq və bu dəyişimə hazır olmanı belə gözdən keçirir: “Atadan-babadan bərqərara olmuş aləmin və onun sərt qanunlarının dəyişdirilməsinin nəsə təsəvvür olunmadığı bu feodal-patriarxal quruluşunun insanında yeniliyin qığılcımları baş qaldırır və oğlunu bilik almaq məqsədilə Qori seminariyasına göndərməyi lazım bilir.” (Eradze, L. 2015, s.12) Tədqiqatçı əsərin ruhunu yaxşı duymuş və Cahandar ağanın Göytəpənin çar kazaklarından qorumasının əsl səbəblərini doğru müəyyənləşdirmişdir. Cahandar ağa yeni qaydalara uyğunlaşmaq istəmir, ancaq onu da görür ki, zaman köhnə qaydalarla yaşamağa da imkan vermir. Yazıçının daim coşğun, çılğın Kür çayını zamanın rəmzi kimi verməsini də ayrıca qeyd edir. Bir sözlə, Leyla Eradze İ.Şıxlının “Dəli Kür” romanını Azərbaycan nəsrinin ən sanballı əsərlərindən biri kimi yüksək qiymətləndirmiş və gürcü ədəbiyyatında bu prosesləri əks etdirən hər hansı bir əsərin hələ yazılmadığına təəssüf etdiyini bildirmişdir. (Eradze, L. 2015, s. 12) Leyla Eradze əsərlərində Qori seminariyasını bitirmiş, bir müddət Tiflisdə yaşayıb-yaratmış görkəmli Azərbaycan yazıçısı, "Molla Nəsrəddin" ədəbi məktəbinin banisi və ideya rəhbəri, tənqidi realist ədəbi cərəyanın, ilk mənzum alleqorik dram əsərinin banisi, yenitipli ictimai satiranın yaradıcısı, Azərbaycan ədəbiyyatında kiçik hekayənin böyük ustadı kimi tanınan, məşhur dramaturq, jurnalist, həmçinin Azərbaycanda və Şərqdə ilk feminizm, qadınların və kişilərin hüquq bərabərliyi ideologiyasının əsasını qoymuş ictimai xadim Mirzə Cəlil Məmmədquluzadədən də bəhs etmiş və onun "Eşşəyin itməkliyi" əsərini gürcü dilinə tərcümə etmişdir. Azərbaycan ədəbiyyatının peşəkar mütərcimi, tədqiqatçısı və təbliğatçısı Leyla Eradze 1977-ci ildə "Dostluq - könüldən-könülə körpüdür" adlı monoqrafiyasını “Sovet Gürcüstanı” Gürcüstan SSR Dövlət Nəşriyyatında gürcü dilində nəşr etdirərək oxucuların ixtiyarına verilmişdir. Professor Mədəd Çobanov Tbilisidə nəşr olunan «Sovet Gürcüstanı» qəzetinin 16 mart 1978-ci il tarixli №32(7872) sayında dərc etdirdiyi eyniadlı məqaləsində L.Eradzenin "Dostluq-könüldən-könülə körpüdür" kitabı haqqında oxuculara geniş məlumat vermiş və həmin kitabı gürcü oxucuları üçün ən qiymətli hədiyyə adlandırmışdır. Professor M.Çobanov qeyd etmişdir ki, kitabın ilk fəsli "Gürcü-Azərbaycan ədəbi əlaqələrinin tarixi kökləri" adlanır. Bu fəsildə Azərbaycan-gürcü ədəbi əlaqələrinin tarixi kökləri yığcam şəkildə təhlil olunmuşdur. Monoqrafiyanın ikinci fəsli "Gürcü-Azərbaycan ədəbi əlaqələrinin sovet dövrü"nə, üçüncü fəsli XIX international scientific conference. Vienna. Austria. 20-21.11.2025 70 isə Ş.Rustavelinin "Pələng dərisi geymiş pəhləvan" poemasının Azərbaycan dilinə tərcüməsi tarixinə həsr olunmuşdur. Müəllif dördüncü fəsli "Gürcü mətbuatı səhifələrində Azərbaycan mövzusu" adlandırsa da, burada əsas etibarilə böyük ədib M.F.Axundovun əsərləriniн gürcü dilinə tərcümə olunması, səhnəyə qoyulması, gürcü ədəbi-tənqidində onun mövqelərini, əsərlərinin ilk nəşri, Tiflis ictimaiyyəti ilə yaxından əlaqəsi və onun yetişməsində Tifliis mühitinin rolu yığcam şəkildə təhlil edilmişdir. Kitabın beşinci fəslində məşhur Azərbaycan nasiri İ.Şıxlının "Dəli Kür" tarixi romanının geniş təhlili verilmişdir. "Azərbaycan sovet poeziyasında Gürcüstan mövzusu" fəslində isə Azərbaycanın xalq şairləri S.Vurğunun və S.Rüstəmin poeziyasında Gürcüstan mövzusu öz bədii ifadəsini tapmışdır. (Çobanov M.N, 16 mart, 1978) Leyla Eradze özünün elmi tədqiqat əsərlərində əslən Gürcüstandan olan görkəmli Azərbaycan ziyalısı, məşhur şair, yazıçı, dramaturq, publisist, pedaqoq, ədəbiyyatşünas, tərcüməçi, 1934-cü ildən Azərbaycan Yazıçılar Birliyinin üzvü, Azərbaycan uşaq ədəbiyyatının banilərindən biri, Azərbaycan SSR əməkdar incəsənət xadimi Abdulla Şaiqin (1881-1959) yaradıcılığını yüksək qiymətləndirmişdir. O, Abdulla Şaiq haqqında yazdığı iki məqalədən, birini Gürcüstanda, digərini isə Azərbaycanda çap etdirmişdir. “Abdulla Şaiq Talıbzadənin yaradıcılığında Gürcüstan” adlanan birinci məqalə Tbilisidə “Soplis tsxovreba” (“Kənd həyatı”) qəzetinin 1971-ci il 27 aprel sayında, “Abdulla Şaiq və Gürcüstan” sərlövhəli ikinci məqalə isə Bakıda “Ədəbiyyat və incəsənət” qəzetinin 1971-ci il 8 may sayında işıqüzü görmüşdür. Həmin məqalələrdə uşaqlığından dünyaya göz açdığı Tiflisin və Borçalı dağlarının ecazkar təbiəti qoynunda və Azərbaycan folklorunun sirli-sehrli əfsanə və nağıllar aləmində saf uşaq xəyallarının nəhayətsiz qanadlarında vətəninə və xalqına, onun təbii və mənəvi sərvətlərinə sonsuz məhəbbət duyğusu ilə bağlanan A.Şaiqin mənalı və şərəfli ömür yolu, zəngin bədii və elmi yaradıcılğı, pedaqoji və ictimai fəaliyyəti haqqında ətraflı məlumat verilmişdir. Tanınmış gürcü ədəbiyyatşünas alimi, şair-tərcüməçi və ictimai xadim Leyla Eradze Gürcüstanda yaşayıb-yaradan Azərbaycan ədiblərinin yaradıcılığını da daim diqqət mərkəzində saxlamış, müntəzəm olaraq onların əsərlərinə müraciət etmiş, yeri gəldikcə tərcümə edərək gürcü oxucularının öhtəsinə vermişdir. Əzim İsmayllının tərtib etdiyi, 1980-ci ildə Tbilisidəki “Merani” nəşriyyatında çap olunaraq L.Eradze, M.H.Bəxtiyarlı və Ə.İsmayllıdan ibarət Redaksiya heyəti tərəfindən oxuculara təqdim edilən “Çeşmə” ədəbi məcməsinə Leyla Eradzenin yazdığı ön sözdən məlum olur ki, kitabda Gürcüstanda yaşayan Azərbaycan aşıqların, şair və yazıçıların, xüsusilə də, Tbilisidə Azərbaycan dilində nəşr olunan yeganə mətbuat orqanı olan “Gürcüstan” qəzetinin nəzdində fəaliyyət göstərən “Çeşmə” ədəbi dərnəyinin üzvlərinin əsərlərindən, eləcə də onların tərcümələrində gürcü yazıçılarının yaradıcılıq əsərlərindən seçilmiş ən yaxşı nümunələr, bir-birindən maraqlı şeirlər, hekayələr və bir pyes toplanıb. Burada verilmiş əsərləri vaһid bir ideya - vətənpərvərlik, beynəlmiləlçilik və xalqlar dostluğu ideyası birləşdirir. “İstər poeziya, istərsə də nəsr nümunələrinin ruћu müasir һəyatla sıx bağlıdır. Məcmuədəki һər misranı, һər sətri, һər dialoqu insan idrakının məһsulu kimi kötürsək, ona nə qədər zəһmət çəkildiyi, alın təri töküldüyü aydın olar.” (Eradze, L. Çeşmə, “Ön söz”. 1980, s.3) Ön sözdə ayrı-ayrı müəllifləri və onların əsərlərini ayrı-ayrılıqda təqdir və təһlil etmək fikrində olmamasının səbəbini isə L.Eradze, butun bunların «Gürcüstanı» qəzetinin redaktoru S.Suleymanovun almanaxa yazdığı “Çaylar ümmanlara qovuşur...” (Süleymanov, S. Çeşmə, 1980, s.4-18) sərlövhəli geniş müqəddimədə əһatə olunması ilə əsaslandırmışdır. (Eradze, L. Çeşmə, “Ön söz”. 1980, s.3;) Umumiyyətlə, “Gürcüstan” qəzetinin redaksiyası nəzdində yaradılan “Çeşmə” ədəbi birliyinin fəaliyyətini yüksək qiymətləndirən L.Eradze həmin məcmuəni qəzetin yaradıcı gənclərlə işi yaxşılaşdırmaq һaqtındakı qərarının һəyata keçirilməsinin parlaq təzaһürü adlandırmış, qəzetin vaxt-aşırı olaraq öz səһifələrində gənclərin ədəbi yaradıcılığına geniş yer verməklə, onların vətənpərvərlik ruһunda böyüyübtərbiyə olunmasında faydalı və xeyirxaһ iş gördüyünü vurğulamışdır. İlk addım olan “Çeşmə” ədəbi məcmuəsini də elə һəmin faylalı və xeyirxaһ işin bəһrəsi olduğunu bildirən L.Eradze bu şərəfli yolda qələm dostlarına uğurlan arzulamışdır. (Eradze, L. Çeşmə, 1980, s.3) Belə bir ön sözün yazılması, əslində, qonşu xalqın işində milli ədəbiyyatı yaşadan yazıçı və şairlər üçün bir növ həm də böyük bir dəstək idi. Leyla Eradze tanınmış ədəbiyyatşünas-alim, bacarıqlı və zəhmətkeş bir tədqiqatçı olmaqla yanaşı, həm də istedadlı şair tanınmış və eyni zamanda, təcrübəli tərcüməçi kimi də fəaliyyət göstərmişdir. Məqalələri, şeirləri və tərcümələri 1955-ci ildən mətbuatda dərc olunan, “Mən kitabla gəlirəm” (1975), “Tərəzi ilə gəlirəm” (1978), “Şeirlər” (1979), “Aprel bilir” (1987), “Qurtuluş” (1994) və s. şeir toplularının və bir-birindən maraqlı uşaq şeirlərinin, həm də “Dostluq könüldən-könülə körpüdür” (1977), “Gürcüstan-Azərbaycan ədəbiyyatının tipoloji əlaqələri” (Azərbaycan dilində, 1984, Bakı) və s. kitabların, bir-birindən qiymətli elmi əsərlərin müəllifi müəllifi olan, Gürcüstan-Azərbaycan mədəniyyətində baş verən mühüm hadisələrə həmişə öz yaradıcılığı ilə cavab verən Leyla Eradze müntəzəm olaraq səmərəli tərcümə işi ilə də məşğul olmuşdur. Leyla Eradze hələ ötən əsrin 70-ci illərin əvvəllərində tanınmış Azərbaycan şairləri Rəsul Rzanın “Bahar”, Məmməd Rahimin “Oktyabr”, Mirvarid Dilbazinin ”Zaman və Şair”, Bəxtiyar Vahabzadənin “Qonaq”, Nigar Rəfibəylinin “Ayrılıq”, Nəbi Xəzrinin “Günbəgün” şeirlərini Azərbaycan dilindən gürcü XIX international scientific conference. Vienna. Austria. 20-21.11.2025 71 dilinə tərcümə edərək "მნათობი" (“Mnatebi”-"İşıq") adlı aylıq ədəbi-bədii, ictimai-siyası jurnalının 1972-ci il 9-cu (sentyabr) nömrəsində “Qardaş Respublikanın poeziyası” rubrikası altında çap etdirmişdir. (İşıq, 1972, N: 9) Leyla Eradze elə həmin illərdən görkəmli Azərbaycan şairi, 1945-ci ildən Azərbaycan Yazıçılar Birliyinin üzvü, Azərbaycanın Əməkdar incəsənət xadimi (1974), "Qırmızı əmək bayrağı" (1975) və "Oktyabr inqilabı" ordenləri (1984) kavaleri, Azərbaycanın xalq şairi (1984), Azərbaycan SSR Dövlət mükafatı laureatı (1976), SSRİ Dövlət mükafatı laureatı (1984), M.F.Axundov adına ədəbi mükafatın laureatı (1989), Azərbaycan Respublikası Ali Sovetinin deputatı (1990), Azərbaycan Respublikası Milli Məclisinin üzvü, millət vəkili (1995, 2000), 1992–2005-ci illərdə Azərbaycanın ən ali dövlət təltifi hesab olun "İstiqlal" ordeni ilə ilk təltif olunmuş 3 nəfərdən biri, tanınmış ədəbiyyatşünas-alim, filologiya elmləri doktoru (1964), professor (1965), Azərbaycan Milli Elmlər Akademiyasının həqiqi üzvü, akademik (2000) Bəxtiyar Vahabzadə (1925-2009) ilə də ədəbi yaradıcılıq əlqalərində olmuş, onun da yaradıcılığına diqqət yetirmiş, çairin bir neçə şeirini gürcü dilinə çevirmişdir. Bəxtiyar Vahabzadənin yaradıcılığının Gürcüstanla bağlı səhifəsində xüsusi yer tutan "Qonaq" şeirdə qonaqpərvərlik, sevgi və doğma yurda bağlılıq kimi ülvi hisslər tərənnüm olunur. Şair qonağın gəlişi ilə evə sevinc və işıq gəldiyini, onunla birlikdə xoşbəxtliyin gəldiyini ifadə edir. Şeirdə qonaq obrazı sadəcə bir qonaq deyil, həm də dost, sirdaş, evə sevinc gətirən bir varlıq kimi təqdim olunur. Şair qonağın gəlişi ilə evdə yaranan müsbət atmosferi, onunla olan söhbətlərin doğurduğu xoş hissləri və evin işıqlanmasını tərənnüm edir. Şeirin sonunda isə qonağın yola salınması ilə evdə yaranan kədər və ayrılıq hissi təsirli şəkildə ifadə olunur. სტუმარი ვისაც ეგონა, სტუმარი ვარ ამა ქვეყნისა, მას პატრონობა მიწა-წყლისა აღარ ეღირსა. ისე ცხოვრობდა, ვით სტუმარი უცხო ბინაზე, ხელს არ ანძრევდა, უქმად იჯდა სხვების ჯინაზე. პალტო და ქუდი გასაქცევად მზად ჰქონდა მუდამ, და რაც გააჩნდა სულ ფლანგავდა, შენახვა სძულდა. ხვალინდელ დღეზე ფიქრით თავს არ იღლიდა იგი, დღეის იცოდა იმ სტუმარმა წესი და რიგი. არ შეგაწყენდათ, სულ ერთავად იყო მდუმარი, ისე წავიდა ამ ქვეყნიდან, როგორც სტუმარი. (İşıq, 1972, N: 9, s.6) "Qonaq" şeiri, Bəxtiyar Vahabzadənin yaradıcılığına xas olan sadəlik, səmimiyyət və dərin hisslərlə dolu bir şeirdir. Şeirdəki hər misra qonaqpərvərliyin, dostluğun və doğma yurda bağlılığın yüksək dəyərlərini əks etdirir: Şeirdən bir parça: Qonaq gələndə evə nur dolar, Qonaq gedəndə evdə qəm qalar... (İşıq, 1972, N: 9, s.6) Şair “Qonaq” (İyul, 1956) adlı başqa bir eyniadlı şeirində isə yazmışdır: "Beş günlük qonağam" - deyib dünyada, Özünü aparır çoxu qonaqtək. Ömrünü, gününü verib o bada, Deyir: "Bu dünyada ancaq kef çəkək!" Qaydadır, yad evdə axmaq bir qonaq Yeməyə, içməyə güc verər ancaq. (Vahabzadə, B, 2008, s.177) Leyla Eradze daha sonralar Azərbaycan ədəbiyyatının görkəmli nümayəndələrindən 40-a yaxın poetik və nəsr əsərini gürcü dilinə çevirmiş və ayrıca kitab şəklində nəşr etdirmişdir. Azərbaycan şairlərindən Səməd Vurğunun “Şeirlər” (1960), Nəbi Xəzrinin “Xəzərin kənarında” (1965), Nəriman Həsənzadənin “Şeirlər” XIX international scientific conference. Vienna. Austria. 20-21.11.2025 72 (1983), həmçinin, Süleyman Rüstəm, Cabir Novruz, İsa İsmayılzadə və başqalarının şeirlər kitablarını gürcü dilinə çevirmiş və ayrıca kitab şəklində oxucuların öhtəsinə vermişdir. O, həm də Azərbaycan dilindən gürcü dilinə tərcümə etdiyi əsərlər əsasında “Azərbaycan poeziyası antologiyası” (1980), “Azərbaycan şairləri Gürcüstanı vəsv edirlər” (1981) və s. adlı ayrıca kitab, toplu və məcmuələri tərtib və nəşr etdirmişdir. Leyla Eradze Azərbaycan ədəbiyyatından bir çox yazıçıların nəsr nümunələrini də gürcü dilinə tərcümə etmişdir. O cümlədən, İsmayıl Şıxlının “Dəli Kür” (1982), Mirzə İbrahimovun “Pərvanə” (1984, D.Qulişvili ilə birlikdə), İlyas Əfəndiyevin “Söyüdlü arx” romanlarını, Həsən Seyidbəylinin “Telefonçu qız” povestini, eləcə də, Cəlil Məmmədquluzadənin, İsa Hüseynovun, Ələviyyə Babayevanın və başqalarının roman və hekayələr kitablarını da gürcü oxucularına tədqim etmişdir. Həmin kitablar arasında Cəlal Məmmədovun "Ulduzlar sönəndə" hekayələr kitabı xüsusi yeri vardır (Məmmədov, C. "Ulduzlar sönəndə" (gürcü dilində). "Nakaduli" nəşriyyatı, Tbilisi, 1980.) Azərbaycan ədəbiyyatının peşəkar tədqiqatçısı və tərcüməçisi, filologiya elmləri doktoru, professor Leyla Eradzenin jurnalist Dmitri Qulisaşvili ilə birlikdə gürcü dilinə çevirərək 1980-ci ildə Tbilisidəki "Nakaduli" nəşriyyatında kütləvi tirajla çap etdirdiyi kitabda indiyədək "Nuranə" adlı kino povesti və bir çox hekayələri ilə oxuculara yaxşı tanış müəllifin 20-yə yaxın yeni hekayəsi, miniatürləri və mənzum şeirləri verilmişdir. Kitabı oxuculara təqdim edən professor Mədəd Çobanov «Ədəbiyyat və incəsənət» qəzetində çap olunmuş məqaləsində yazmışdır ki, “tanınmış yazıçı Cəlal Məmmədovun gürcü dilində nəşr olunan bu kitabında insanları maraqlandıran, düşündürən, oxucularda hiss, həyəcan doğuran bədii obrazlar, ümumiləşdirmələr, incə hisslər, dostluqda və sevgidə sadiqlik motivləri qardaş gürcü oxucularına bədii şəkildə çatdırılmışdır.” Qabaqcıl bəşəriyyətin sülh, azadlıq, bərabərlik və səadət uğrunda mübarizəsini təsvir edən "Missis Narkinskin etüdləri" və "Alov donmur" hekayələri gürcü dilində çox yaxşı səslənir. Nizami Gəncəvinin və Molla Pənah Vaqifin həyatından bədii səhifələr olan "Portret" və "Duman içində" hekayələri də məzmunu və bədii tərcümə manerası ilə oxucunun diqqətini cəlb edir. Böyük Vətən müharibəsi illərində alman faşistlərinə qarşı ön cəbhədə qəhrəmanlıqla vuruşan döyüşçülərimizin cəbhə həyatına, onların Vətənimizi və Qızıl Moskvanı qorumaq, onu düşmən zərbəsindən müdafiə etmək üçün silaha sarılması səhnələrinə həsr olunmuş "Ürəklər", "Cəbhədən məktublar", "Quşlar oxuyarkən" hekayələri də tərcümə olunmuşdur. Kitaba həmçinin "Gəlirəm, Sagül!", "Redaktor və Şövqiyyə", "Nalə", "Kamilə", "Odtəkin", "Zəriflik haqqında hekayə", "Bəs, sən", "Filankəs" hekayələri və "Ana ceyran", "Ayırma", "Dəniz kimi", "Sevdim" miniatürləri də daxil edilmişdir. Bir sözlə, professor Mədəd Çobanovun da qeyd etdiyi kimi, yazıçı Cəlal Məmmədovun bu əsərlərində “müasirlərimizin həyatı, əmək qəhrəmanlığı, zəngin və nəcib mənəviyyatı, saflığı öz bədii əksini tapmışdır”. (Çobanov, M.N. 22 may, 1981) Gürcüstan Yazıçılar İttifaqının sədri Qriqol Abaşidze Azərbaycan ədəbiyyatına Gürcüstanda böyük maraq göstərildiyini və bu işdə Azərbaycan-gürcü ədəbi əlaqələrinin memarlarından olan L.Eradzenin böyük xidmətləri olduğu qənaətinə gələrkən L.Eradzeninin adını xüsusi olaraq qeyd edirdi: “Bir çox yazıçılarımız qardaş respublikadan olan qələm yoldaşlarının əsərlərini əsl məhəbbətlə gürcü dilinə tərcümə etmiş və edirlər. Bir sıra şairlərimizin tərcümələrində Süleyman Rüstəmin şeir məcmuəsi, konfrans iştirakçısı Leyla Eradzenin tərcüməsində Mirzə İbrahimovun “Pərvanə” romanı yaxın vaxtlarda çapdan çıxacaqdır” (Abaşidze, Q. 1980, 4 noyabr, s.2) Leyla Eradze həm də istedadlı şair idi. Onun bir çox lirik və uşaq şeirləri indi də dillər əzbəridir. Şeirləri Azərbaycan, rus, italyan, slovak və b. dillərə tərcümə olunub. Bütün yaradıcılığı ilə özünü Azərbaycan xalqının dostu, Azərbaycan ədəbiyyatının, Azərbaycan mədəniyyətinin təbliğatçısı olaraq sübut edən L.Eradsze. “Mənə doğmasan, Bakı” şeirlər kitabına yazdığı “Ön söz əvəzinə” adlı yazısında Azərbaycan xalqına doğmalığını və sevgisini belə ifadə etmişdir: “Şüurlu ömrümün böyük bir hissəsini sizinlə-sizin ədəbiyyat və mədəniyyətinizi öyrənməklə keçirmişəm, sizin yazıçıların əsərlərini tərcümə etməklə yuxulamış, səhərimi açmışam. Qədim mədəniyyətinizə, çoxəsrlik ədəbiyyatınıza məftunam.” (Eradze, L. 1990, s. 5) Kitabın adından da göründüyü kimi, Leyla Eradze Azərbaycan xalqına məhəbbətini təkcə tərcümə, elmi yaradıcılıqla bildirməmiş, eyni zamanda məhəbbət duyğularını poetik şəkildə də ifadə etmişdir. “Mənə doğmasan, Bakı” şeirində Bakını ikinci doğma şəhəri hesab edir, elə bir şəhər ki, birinci qədər doğma və əzizdir. Hər dəfə bu şəhərə gələndə iki əlilə onu qucaqlayır, doğma qapılarını üzümə açır: Çatırıq qocaman Biləcəriyə, Bu qədim Keşlədir, keçdi, Bu da ki... Sənsən, doğma şəhər, mehriban Bakı... Hamı mehribanım, Doğmam, tanışıqm, Hamı mən bildiyim XIX international scientific conference. Vienna. Austria. 20-21.11.2025 79 В отличие от классической сатиры, основанной на иронии и косвенном высмеивании, Маяковский использует прямолинейное, экспрессивное, публичное воздействие: интонация крика, лозунг, памфлет, монтаж. Его сатира динамична, театрализована, эмоционально заряжена и всегда связана с актуальным историческим контекстом [4, c. 162]. Эта художественная система оказала значительное влияние на развитие советской поэзии, агитационной литературы и визуальной пропаганды 1920-х годов. В то же время она остаётся предметом исследования и дискуссий, поскольку сочетает в себе художественный эксперимент и идеологическую функцию. Таким образом, сатира Маяковского — это яркий пример того, как поэтический язык способен преобразовывать реальность, превращая художественный текст в инструмент социальной критики и культурного воздействия [3, c. 119]. Список литературы 1. Левин Ю. И. Поэтика русской литературы XX века. — Москва: Языки славянской культуры, 2014. — 256 с. 2. Гаспаров М. Л. Маяковский и культура авангарда. — Санкт-Петербург: Академический проект, 2011. — 304 с. 3. Харджиев В. В. История русского футуризма. — Москва: Новое литературное обозрение, 2010. — 352 с. 4. Лавров А. В. Русский футуризм. — Москва: АСТ, 2012. — 288 с. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 80 Technical sciences ECONOMIC EFFICIENCY OF PRODUCING NEW NATURAL MEAT PRODUCTS BASED ON ZERO-WASTE TECHNOLOGY Zhanuzakova NazerkeKazybekovna First-year PhD student Kassymov Samat Kairatovich candidate of technical sciences, associate professor ҚАЛДЫҚСЫЗ ТЕХНОЛОГИЯ НЕГІЗІНДЕ ƏЗІРЛЕНГЕН ЖАҢА ТАБИҒИ ЕТ ӨНІМДЕРІН ӨНДІРУДІҢ ЭКОНОМИКАЛЫҚ ТИІМДІЛІГІ Жанузакова Назерке Казыбековна 1 курс докторанты Касымов Самат Кайратович т.ғ.к., қауымдастырылған профессор Abstract This article examines the economic efficiency of producing new natural meat products using zero-waste technology. The study analyzes ways to reduce production costs, generate additional revenue, and save energy and resources through comprehensive raw material processing and the utilization of by-products. The experience and economic benefits of implementing zero-waste technology in the meat industry of Kazakhstan are presented. The results indicate that zero-waste technology, while preserving the biological value of products, enhances economic efficiency, reduces environmental impact, and allows for the development of a diversified product range. Аннотация Бұл мақалада қалдықсыз технология негізінде əзірленген жаңа табиғи ет өнімдерін өндірудің экономикалық тиімділігі қарастырылған. Зерттеу барысында шикізатты кешенді қайта өңдеу жəне жанама өнімдерді пайдалану арқылы өнімнің өзіндік құнын төмендету, қосымша табыс алу, энергия мен ресурстарды үнемдеу жолдары талданды. Қазақстандағы ет өнеркəсібіндегі қалдықсыз технологияны енгізудің тəжірибесі мен экономикалық тиімділігі көрсетілді. Мақала нəтижелері бойынша қалдықсыз технология өнімнің биологиялық құндылығын сақтай отырып, өндірістің экономикалық тиімділігін арттыруға, экологиялық зиянды азайтуға жəне жаңа өнім ассортиментін дамытуға мүмкіндік беретіні анықталды. Keywords: zero-waste technology, natural meat products, economic efficiency, by-products, biological value, environmental safety. Түйінді сөздер: қалдықсыз технология, табиғи ет өнімдері, экономикалық тиімділік, жанама өнімдер, биологиялық құндылық, экологиялық қауіпсіздік. Қазақстан – мал шаруашылығы дамыған ел, бұл ет өндірісінің дамуына негіз болып отыр. Дəстүрлі ет өндірісі барысында көптеген жанама өнімдер мен қалдықтар пайда болады: сүйек, тері, май қалдықтары, қан, ішек-қарын жəне ішкі органдар. Бұл қалдықтарды тиімді пайдаланбау қоршаған ортаға зиян келтіріп, өндірістің экономикалық тиімділігін төмендетеді [1]. Қалдықсыз технология – өндіріс процесінде шикізатты толық пайдалануға жəне барлық жанама өнімдерді екінші реттік өнімдерге айналдыруға бағытталған жүйе [2]. Бұл технология өнімнің өзіндік құнын төмендетуге, қосымша табыс алуға, энергия мен ресурстарды үнемдеуге мүмкіндік береді. Сонымен қатар, жаңа табиғи ет өнімдері экологиялық қауіпсіз, биологиялық белсенді жəне функционалды болып келеді. Қалдықсыз технология енгізу ет өнеркəсібінде экономикалық тиімділікті арттыруға жəне экологиялық зиянды азайтуға мүмкіндік береді. Қалдықсыз технологияның келесі негізгі принциптері мен бағыттарын атап өтейік. Шикізатты кешенді қайта өңдеу. Қалдықсыз технология шикізатты кешенді пайдалануды көздейді. Сойылған малдың барлық бөліктері тиімді пайдаланылады: XIX international scientific conference. Vienna. Austria. 20-21.11.2025 81 • Қан негізіндегі өнімдер – шұжық, паштет, гемоглобин концентраты. Қан өнімдері темірге бай болып, функционалды тағам ретінде ұсынылады [3]. • Сүйек жəне шеміршек негізіндегі өнімдер – желатин, сүйек ұнтағы. Бұл өнімдер кондитерлік жəне балалар тағамында кеңінен қолданылады [4]. • Ішек-қарын қалдықтарынан өнімдер – шұжық қабықтары, ферменттік препараттар. Органикалық шұжық қабықтары табиғи, қауіпсіз жəне органолептикалық сапасы жоғары [5]. • Май қалдықтарынан өнімдер – тазартылған май, фосфолипидтер жəне биологиялық белсенді қоспалар. Биологиялық белсенді май қышқылдары тағамдық құндылығын арттырады [6]. Жанама өнімдерді қайта өңдеу. Жанама өнімдер фармацевтика, биотехнология жəне ауыл шаруашылығында қосымша табыс көзі ретінде қолданылады. Мысалы: • Май қалдықтарын биогаз өндіруде пайдалану энергияны үнемдейді; • Сүйек ұнтағын экспортқа шығару арқылы қосымша табыс алу мүмкіндігі; • Қан өнімдерін нан-тоқаш жəне кондитерлік өндірісінде табиғи бояғыш ретінде қолдану [7]. Шикізатты кешенді қайта өңдеу жəне жанама өнімдерді пайдалану өндірістің экономикалық тиімділігін арттыруға мүмкіндік береді. Қалдықсыз технологияның экономикалық тиімділігі. - Өнімнің өзіндік құны Өзіндік құнды есептеу кезінде шикізат, еңбек, энергия, су жəне логистика шығындары ескеріледі. Қалдықсыз технология негізгі өнімді өндіру кезінде жанама өнімдерді де шығарады, сондықтан негізгі өнімнің өзіндік құны төмендейді [8]. - Қосымша табыс Жанама өнімдер арқылы қосымша табыс алу мүмкіндігі экономикалық тиімділікті арттырады. Мысалы, желатин мен шұжық қабықтарын сату жалпы кірістің 20–25%-ын құрайды [9]. - Энергия жəне ресурстарды үнемдеу Май қалдықтарын биогазға айналдыру, суды қайта пайдалану жəне жылуды үнемдеу арқылы өндіріс шығындарын 10–15% төмендетуге болады [10]. Қалдықсыз технология өнімнің өзіндік құнын төмендетеді, қосымша табыс əкеледі жəне энергия мен ресурстарды үнемдейді. Қазақстандағы қалдықсыз технологияны енгізу тəжірибесіне тоқтала кетейік. Қазақстанда бірнеше ірі ет комбинаттары қалдықсыз технологияны енгізген. Мысалы: • «Қазақ Ет» ЖШС қан жəне сүйек негізіндегі өнімдерді шығара отырып өнімнің өзіндік құнын 10–15% төмендетті; • Май қалдықтарынан алынған биологиялық белсенді қоспалар экспортқа шығарылды; • Ферменттік препараттар мен шұжық қабықтары ішкі нарыққа сатылды [11]. Қазақстанда қалдықсыз технологияны енгізу нақты экономикалық пайда əкеліп, экспорттық əлеуетті арттырады. Қалдықсыз технологияның тиімділігін талдау. - Өнімнің өзіндік құны мен кірісі Есептеулер көрсеткендей, қалдықсыз технология арқылы өнімнің өзіндік құны орта есеппен 12– 18% төмендейді, ал қосымша өнімдерден түсетін табыс жалпы кірістің 20–25%-ын құрайды [9]. - Инвестициялық тиімділік Бастапқы инвестиция қажет болса да, 2–3 жыл ішінде шығындарды өтеп, таза пайда əкеледі. Ішкі табыс нормасы (IRR) 18–22% деңгейінде бағаланды [10]. - Экологиялық аспект Қалдықсыз технология қоршаған ортаға зиянды азайтып, экологиялық шығындарды төмендетеді, бұл да экономикалық тиімділікке əсер етеді [2]. Қысқаша қорытынды: Қалдықсыз технология өнімнің өзіндік құнын төмендетіп, кірісті арттырып, инвестициялық тиімділікті жəне экологиялық жағдайды жақсартады. Қалдықсыз технология негізінде əзірленген жаңа табиғи ет өнімдерін өндірудің экономикалық тиімділігі: • өнімнің өзіндік құны төмендейді; • қосымша өнімдер арқылы табыс өседі; • энергия, су жəне шикізат ресурстары үнемделеді; • инвестициялық тиімділік жоғары; • экологиялық шығындар азаяды [1–11]. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 82 Қазақстанда ет өнеркəсібінде қалдықсыз технологияны кеңінен енгізу өндірістің экономикалық тиімділігін арттырады, сонымен қатар халықты сапалы, табиғи жəне əртараптандырылған өнімдермен қамтамасыз етуге мүмкіндік береді. Бұл тəсіл халықаралық нарықта бəсекеге қабілеттілікті арттырады. Қалдықсыз технология негізінде əзірленген жаңа табиғи ет өнімдерін өндіру Қазақстандағы ет өнеркəсібін экономикалық тиімді əрі экологиялық қауіпсіз етуге бағытталған маңызды тəсіл болып табылады. Зерттеу нəтижелері көрсеткендей: 1. Өнімнің тағамдық жəне биологиялық құндылығы жоғары – ақуыз, минералдар, витаминдер жəне биологиялық белсенді қосындылар сақталады, бұл өнімдерді балалар мен спортшыларға арналған функционалды тағам ретінде пайдалануға мүмкіндік береді. 2. Экономикалық тиімділік артады – өнімнің өзіндік құны төмендеп, жанама өнімдер арқылы қосымша табыс алу мүмкіндігі қамтамасыз етіледі. Энергия, су жəне шикізат ресурстары тиімді пайдаланылады, инвестициялық тиімділік жоғарылайды. 3. Экологиялық зиян азаяды – шикізат толық өңделетіндіктен қалдықтар қоршаған ортаға түспейді, бұл экологиялық шығындарды азайтып, заңнамалық талаптарға сəйкес өндірісті жүргізуге мүмкіндік береді. 4. Өндіріс əлеуеті кеңейеді – қалдықсыз технологияны енгізу арқылы жаңа өнім түрлері шығарылады, ассортимент əртараптандырылып, ішкі нарықтағы жəне экспорттық əлеуеті артады. Осылайша, қалдықсыз технологияны енгізу тек өндірістің экономикалық тиімділігін арттырып қана қоймай, халықты сапалы, табиғи жəне əртараптандырылған ет өнімдерімен қамтамасыз етуге, сондай-ақ халықаралық нарықта бəсекеге қабілеттілікті нығайтуға жол ашады. References 1. Abdykadyrov A., Suinbayev B. Application of Zero-Waste Technology in the Meat Industry. – Almaty, 2022. – 120 p. 2. Nurlanova G. Processing of Livestock Products. – Nur-Sultan, 2021. – 98 p. 3. Zhumabayev T. Food Products Based on Blood and Bone. – Almaty, 2023. – 112 p. 4. Ivanov S. Microbiology of Meat Products. – Moscow, 2019. – 150 p. 5. Petrova L. Organoleptic Evaluation of Food Products. – Saint Petersburg, 2020. – 85 p. 6. AOAC Official Methods of Analysis. – 20th Edition, 2016. 7. Smirnov V. Chemical Composition of Meat By-Products. – Moscow, 2018. – 110 p. 8. Tleuberdieva A. Energy Efficiency in the Meat Industry. – Almaty, 2021. – 100 p. 9. “Kazakh Meat” LLP. Industrial Practice of Implementing Zero-Waste Technology. – Almaty, 2022. 10. Zhansseitova M. Economic Analysis and Investment Efficiency. – Nur-Sultan, 2020. – 90 p. 11. Baimukhamedova L. Economic Aspects of Implementing Zero-Waste Technology. – Almaty, 2021. – 105 p. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 83 FREE VIBRATIONS OF TWO CONCENTRIC CYLINDRICAL SHELLS CONTAINING AN INTERMEDIATE FLUID LAYER M.A. Rustamovaa G.A. Mammadovab R.J. Mammadovaa L.N. Hasanovaa aAzerbaijan University of Architecture and Construction, Baku, Azerbaijan bAzerbaijan Technical University, Baku, Azerbaijan Abstract This study examines the free vibrations of two concentric cylindrical shells separated by a viscous fluid layer, a configuration commonly found in engineering applications such as heat exchangers and nuclear fuel rods. The interaction between the shells and the fluid significantly affects the system’s dynamic behavior, as the fluid contributes added mass and energy dissipation. Accurate understanding of these effects is essential for predicting vibration characteristics and ensuring reliable structural performance. The shells are modeled using classical shell theory, assuming small-amplitude oscillations and neglecting axial displacements. The fluid is treated as a potential flow, with the pressure related to the fluid velocity potential. Coupling is introduced through boundary conditions connecting the shells’ normal velocities to the radial gradient of the fluid potential. Harmonic displacement potentials are used to analyze the natural vibrations, leading to characteristic equations expressed with Bessel functions. These equations show how natural frequencies depend on shell geometry, material properties, and fluid characteristics. Results indicate that the first vibration mode increases rapidly and approaches a limiting value, while higher modes are strongly influenced by fluid–structure interaction. Even thin fluid layers can significantly alter the system’s vibrational behavior. This study provides insight into fluid–structure interaction in concentric cylindrical systems and offers a basis for accurate vibration prediction and engineering design in applications involving fluid-filled layered structures. Keywords: Free vibrations; concentric cylindrical shells; fluid–structure interaction; natural frequencies; viscous fluid; Bessel functions. Accurate estimation of the natural frequencies and vibration amplitudes of elastic elements operating in a fluid medium—such as cylindrical fuel rods in nuclear reactors or tubes in heat exchangers—requires consideration of the added mass and damping effects induced by the surrounding liquid. Experimental investigations [1,2,3] have demonstrated that the viscosity of the fluid has a considerable influence on both the magnitude of the added mass and the damping characteristics of oscillations. Furthermore, these parameters depend on the spatial configuration of the stationary boundaries enclosing the cylinder. In the study presented in [4], the transverse oscillations of an infinite cylinder immersed in a fluid and surrounded by a rigid concentric shell were analyzed. The present work focuses on the free vibration analysis of two concentric cylindrical shells with a viscous fluid confined between them. Such systems are of practical significance in the design of heat exchangers and similar engineering structures, where fluid–structure interaction plays an essential role. Using the assumptions of the engineering theory of shells, and neglecting displacements in the axial direction, the equations of motion can be formulated in the following form [5]. 1 𝑅1 8𝜕8𝜑1 𝜕𝛽8+12(1−𝜈2) ℎ1 2𝑅1 6𝜕4𝜑1 𝜕𝛽4+𝑞1 𝐸ℎ1𝑅1 4𝜕6𝜑1 𝜕𝛽4𝜕𝑡2+𝑧1= 0 1 𝑅2 8𝜕8𝜑2 𝜕𝛽8+12(1−𝜈2) ℎ2 2𝑅2 6𝜕4𝜑2 𝜕𝛽4+𝑞2 𝐸ℎ2𝑅2 4𝜕6𝜑2 𝜕𝛽4𝜕𝑡2+𝑧2= 0 (1) Here, 𝜑 - denotes the potential function describing the displacement field, 𝛽 -represents the angular coordinate, 𝑅 and ℎ - are the radius and thickness of the shell, respectively, 𝐸 - stands for Young’s modulus, 𝑧−is the pressure exerted by the fluid, and 𝑞 - indicates the mass per unit area of the shell (kg/m²). For small-amplitude oscillations, the fluid motion is assumed to be potential. XIX international scientific conference. Vienna. Austria. 20-21.11.2025 84 𝑧1= −𝜌𝜕𝜙 𝜕𝑡|𝑟=𝑟1 , 𝑧2= −𝜌𝜕𝜙 𝜕𝑡|𝑟=𝑟2 (2) Here, 𝜌 denotes the density of the liquid, and 𝜙 represents the velocity potential that characterizes the fluid motion. The velocity potential of the fluid complies with the governing equation: 𝜕2𝜙 𝜕𝑟2+1 𝑟𝜕𝜙 𝜕𝑟 +1 𝑟2𝜕2𝜙 𝜕𝑟2=1 𝑎2𝜕2𝜙 𝜕𝑡2 (3) By relating the fluid velocity potential to the displacement velocity of the shell at the boundaries, one obtains: 𝜕5𝜑1 𝜕𝛽4𝜕𝑡 =𝜕𝜙 𝜕𝑟|𝑟=𝑟1; 𝜕5𝜑2 𝜕𝛽4𝜕𝑡 =𝜕𝜙 𝜕𝑟|𝑟=𝑟2 (4) To analyze the natural vibrations, particular solutions of the system of equations (1) and (4) are examined. 𝜑𝑖= 𝜑𝑖 0𝑒𝑖𝜔𝑡 𝑠𝑖𝑛𝑛𝛽 и 𝜙 = 𝜙𝑛 0𝑒𝑖𝜔𝑡 𝑠𝑖𝑛𝑛𝛽 (5) By introducing the notation 𝛺 = 𝜌𝜔𝑎 𝜔0 2−𝜔2, we arrive at 𝛺 = 𝛽 ±√𝛽2−4𝛼𝑐 2𝛼 here 𝛼 = 𝐽𝑛(𝜔𝑟1 𝑎)𝑁𝑛(𝜔𝑟2 𝑎)±𝐽𝑛(𝜔𝑟2 𝑎)𝑁𝑛(𝜔𝑟1 𝑎) 𝛽 = 𝐽𝑛 ′(𝜔𝑟1 𝑎)𝑁𝑛(𝜔𝑟2 𝑎)+𝐽𝑛(𝜔𝑟1 𝑎)𝑁𝑛 ′(𝜔𝑟2 𝑎)−𝐽𝑛 ′(𝜔𝑟2 𝑎)𝑁𝑛(𝜔𝑟1 𝑎)±𝐽𝑛(𝜔𝑟2 𝑎)𝑁𝑛 ′(𝜔𝑟2 𝑎) 𝑐 = 𝐽𝑛 ′(𝜔𝑟1 𝑎)𝑁′(𝜔𝑟2 𝑎)−𝐽𝑛 ′(𝜔𝑟2 𝑎)𝑁𝑛 ′(𝜔𝑟1 𝑎) This study investigated the free vibrations of two concentric cylindrical shells with a viscous fluid layer. The natural frequencies were found to depend strongly on the shell geometry, stiffness, and fluid properties. The first mode frequency rises rapidly before approaching a limit, while higher modes are influenced by the interaction between shell motion and fluid dynamics. These results demonstrate the importance of fluid–structure interaction in engineering applications such as heat exchangers and nuclear fuel rods, providing a basis for accurate vibration prediction and design. References 1. Ibragimov M.Kh. Sinyavsky V.F., Belyakov A.G., et al., Investigation of Added Mass and Damping Coefficients in Cylinder Oscillations within Viscous Fluids. Preprint FEI-585. Obninsk, 1975. – 23 pages. 2. Chen S.S., Wambsganss M.W., Jendrzejczyk J.A., Added Mass and Damping of a Vibrating Rod in a Confined Viscous Fluid, Journal of Applied Mechanics, Transactions of ASME, 1976, Issue 2, pp. 325–329. 3. Eynatollah A. Taheri, Rustamova Mahsati (2010) Investigation of Free Vibrations Of Spherical Inclusion Containing Elastically Suspended Mass Situated in Acoustic Medium by the Inverse Method //International Journal of Nanosystems, ,vol.3, p.23-25 4. Sinyavsky V.F., Fedotovsky V.S., Kukhtin A.B., On the Oscillations of a Cylinder in a Viscous Fluid, Applied Mechanics, Vol. XVI, No. 1, pp. 62–67. 5. Filippov A.P., Oscillations of Deformable Systems, Moscow: Mashinostroenie, 1970.