scieee AI-readable full text Open interactive document viewer

A new species of Clematis sect. Tubulosae (Ranunculaceae) from Zhejiang, East China

Xu, Pan; Li, Jun-Ping; Wang, Xian-Ting; Zhang, Fen-Yao; Liang, Wei-Qing; Xie, Wen-Yuan; Yu, Li-Peng; Chen, Feng; Lou, Ke-Lang; Zhong, Jian-Ping; Pu, Jin-Bao; Chen, Zheng-Hai

Abstract

Clematis liana sp. nov., a new species of Ranunculaceae from Zhejiang and Anhui Provinces in eastern China, is described and illustrated. This species exhibits similarities in morphological features to C. urticifolia, with which it has a close evolutionary relationship. It is distinguishable by several discrete features, such as habit, reproductive strategy, morphology of cauline ridges, leaflets, bracts, and flowers, calycine color, number of carpels and stamens, length and indumentum of filaments, size of anthers and pollen grains, etc. The complete plastid genome sequence of C. liana sp. nov. comprises 159,759 bp, organized into a quadripartite structure containing two inverted repeat (IR: 31,084 bp each) regions, a small single copy (SSC: 18,135 bp) region, and a large single copy (LSC: 79,456 bp) region. It contains 136 functional, comprising 92 protein-coding, 36 tRNA and 8 rRNA genes.

Full text

93 A new species of Clematis sect. Tubulosae (Ranunculaceae) from Zhejiang, East China Pan Xu1,2 , Jun-Ping Li3, Xian-Ting Wang4, Fen-Yao Zhang5, Wei-Qing Liang1,2 , Wen-Yuan Xie5, Li-Peng Yu4, Feng Chen5, Ke-Lang Lou1,2 , Jian-Ping Zhong6, Jin-Bao Pu1,2 , Zheng-Hai Chen5,6 1 Center for Medicinal Resources Research, Zhejiang Academy of Traditional Chinese Medicine, Hangzhou 311300, Zhejiang, China 2 Zhejiang Engineering Research Center for Quality Assessment and Development of Dao-di Herbs, Hangzhou 311300, Zhejiang, China 3 Yongkang Forestry Bureau, Yongkang 321300, Zhejiang, China 4 Zhejiang Hynobius amjiensis National Nature Reserve Management Center, Anji 313304, Zhejiang, China 5 Zhejiang Forest Resources Monitoring Centre, Hangzhou 310020, Zhejiang, China 6 Zhejiang Forestry Survey Planning and Design Co. Ltd., Hangzhou 310020, Zhejiang, China Corresponding authors: Jin-Bao Pu ([email protected]); Zheng-Hai Chen ([email protected]) Copyright: © Pan Xu et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract Clematis liana sp. nov., a new species of Ranunculaceae from Zhejiang and Anhui Provinces in eastern China, is described and illustrated. This species exhibits similarities in morphological features to C. urticifolia, with which it has a close evolutionary relationship. It is distinguishable by several discrete features, such as habit, reproductive strategy, morphology of cauline ridges, leaflets, bracts, and flowers, calycine color, number of carpels and stamens, length and indumentum of filaments, size of anthers and pollen grains, etc. The complete plastid genome sequence of C. liana sp. nov. comprises 159,759 bp, organized into a quadripartite structure containing two inverted repeat (IR: 31,084 bp each) regions, a small single copy (SSC: 18,135 bp) region, and a large single copy (LSC: 79,456 bp) region. It contains 136 functional, comprising 92 protein-coding, 36 tRNA and 8 rRNA genes. Key words: Clematis, morphology, new species, phylogeny, plastid genome, taxonomy Introduction Sect. Tubulosae Decne. (1881: 203) is classified within the Ranunculaceae family, under the genus Clematis L. (1753: 543), subgenus Clematis. This section is endemic to East Asia, as documented by Tamura (1995), Wang and Li (2005), Wang and Xie (2007), and Lyu et al. (2023). According to the most recent taxonomic treatment, sect. Tubulosae has been divided into two subsections: subsect. Pinnatae (W.T. Wang) W. T. Wang and subsect. Tubulosae (Decne.) W.T. Wang (Wang and Xie 2007). The latter comprises ten taxa (eight species and two varieties) distributed across the Japanese Archipelago, the Korean Peninsula, Taiwan and mainland China (Wang 2001, Wang and Li 2005, Kadota 2006, Wang and Xie 2007, Lyu et al. 2023). Among these, C. heracleifolia DC. (1818: 138), C. tubulosa Turcz. (1837: 148), and C. tubulosa var. ichangensis (Rehder and E.H. Wilson) W.T. Wang (2006: 335) are native to mainland China. Academic editor: Andrey Erst Received: 8 May 2025 Accepted: 4 November 2025 Published: 3 December 2025 Citation: Xu P, Li J-P, Wang X-T, Zhang F-Y, Liang W-Q, Xie W-Y, Yu L-P, Chen F, Lou K-L, Zhong J-P, Pu J-B, Chen Z-H (2025) A new species of Clematis sect. Tubulosae (Ranunculaceae) from Zhejiang, East China. PhytoKeys 267: 93–108. https://doi.org/10.3897/ phytokeys.267.158140 PhytoKeys 267: 93–108 (2025) DOI: 10.3897/phytokeys.267.158140 94 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) C. heracleifolia and C. tubulosa are restricted to northern China, whereas C. tubulosa var. ichangensis occurs in southern part of subsect. Tubulosae, including Hubei, Henan, Hunan, Shaanxi, and Shanxi provinces, with scattered populations in Anhui, Zhejiang, and Guizhou (Wang 2001, Wang and Li 2005, Wang and Xie 2007, Zhang 2021, Lyu et al. 2023). The remaining seven taxa of sect. Tubulosae are narrow endemics found in the Korean Peninsula and adjacent East Asia. Among them, C. urticifolia Nakai ex Kitag. (1937: 346) is native to Korean, C. stans Siebold & Zucc. (1845: 177), C. stans var. austrojaponensis (Ohwi) Ohwi (1953: 513), C. speciosa (Makino) Makino (1918: 39) and C. satomiana Kadota (2006: 301) occur in the Japanese Archipelago (Wang 2001, Wang and Li 2005, Kadota 2006, Wang and Xie 2007, Lyu et al. 2023), while C. psilandra Kitag. (1937: 352) and C. tsugetorum Ohwi (1933: 153) are distributed in Taiwan (Yang and Huang 1996, Wang 2001, Wang and Bartholomew 2001, Wang and Li 2005, Wang and Xie 2007, Lyu et al. 2023). In 2013, during a survey of wild plant resources, Professor Gen-You Li from Jiyang College Zhejiang A&F University, and Zheng-Hai Chen discovered an unknown Clematis taxon on Longwangshan moutain in Anji County, Huzhou City, Zhejiang Province, eastern China. Subsequently, targeted field investigation was conducted to collect more data. The newly discovered plants are erect perennial herbs, characterized by urceolate flowers with four imbricate, erect sepals, creamy white or pale yellow, and narrowly ovate or lanceolate. The leaves are ternate. The pollen grains are pantoporate. Based on the current infrageneric classification derived from morphological traits (Wang and Li 2005, Wang and Xie 2007, Lyu et al. 2023), these plants are undoubtedly placed in subsect. Tubulosae, ser. Tubulosae Rehder & E.H. Wilson (1913: 320). Morphologically, they show the greatest similarity to C. urticifolia Nakai ex Kitag. (Kitagawa 1937; Wang and Xie 2007) from Korea. However, further research reveals considerable morphological distinctions between this newly found taxon and C. urticifolia, leading us to reassess its taxonomic identity. Materials and methods Morphological observation From 2013 to 2024, we conducted more than ten field surveys in the hope of finding new populations of new discovered species in Anji County and its surrounding areas. For the three previously confirmed subpopulations of C. liana sp. nov. in Longwangshan mountain, we established fixed-location observation plots to document phenology, morphological structure, and ecological habits through quarterly monitoring of tagged plants. At the same time, specimens in the collections of most herbaria in Zhejiang Province (HHBG, HTC, HZU, ZJFC, and ZM) (Thiers 2024) and photos of specimens on CVH (https://www.cvh.ac.cn/) were checked to identify specimens similar to the unknown taxon. High-definition images of similar species-type specimens from foreign herbaria (A, BM, DAO, K, L, M, P, and PH) (Thiers 2024) were also consulted. Based on field investigation and herbarium specimen observation, the morphology of this new species was documented by comparing with the protologue of C. urticifolia (Kitagawa 1937). 95 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) Taxon sampling On 5 August and 10 November, 2024, we collected six individuals from two populations in Longwangshan mountain, Anji County, Huzhou City, and Shunxiwu, Lin’an District, Hangzhou City, Zhejiang Province, respectively (Table 1). The leaves from six individuals were first placed in non-woven bags, and then stored in sealing bags containing allochroic silica gel for DNA extraction. The voucher specimens are preserved in the Herbarium of Medicinal Resources, Zhejiang Academy of Traditional Chinese Medicine (ZJMR), and the Zhejiang Museum of Natural History (ZM). DNA extraction, PCR amplification, and sequencing Genomic DNA was extracted using a modified CTAB protocol following the instructions of Plant Genomic DNA Kit (Tiangen Biotech Co., Beijing, China). The total gDNA sample was sequenced by Tsingke Biotechnology Co. (China). For ribosomal DNA (rDNA) amplification, the ITS as primer (Forward: 5'- ATGCGATACTTGGTGTGAAT3', Reverse: 5'- GACGCTTCTCCAGACTACAAT - 3') (White et al. 1990). PCR reaction program proceeded according to Xie et al. (2011). Briefly, DNA amplifications were conducted in 25 μL reaction containing 10–50 ng of total DNA, 20 mmol/L Tris buffer (pH 8.3, with 50 mmol/L KCl, 1.5 mmol/L MgCl2, and 0.1% Tween 20), 0.15 mmol/L of each dNTP, 5 μmol/L of each primer, and 0.2 μL of Taq polymerase. The PCR program consisted of an initial denaturation step at 94 °C for 2 min, followed by 38 cycles comprising 20 s of denaturation at 94 °C, 30 s of annealing at 52 °C, and 40 s of extension at 72 °C. The procedure concluded with a final extension at 72 °C for 5 mins. For plastid genome sequence, short-insert (350 bp) paired-end libraries preparation and 2 × 150 bp sequencing were performed on an Illumina (Novaseq 6000) genome analyzer platform. Plastid genome assembly and annotation Raw paired-end sequencing reads of the new species were filtered by the Fastp (v0.19.7) (Chen et al. 2018) to obtain high-quality clean data. The processed reads were then de novo assembled into the complete chloroplast genome using SPAdes v.3.14.1 software (Bankevich et al. 2012). Finally, it was annotated by PGA (Qu et al. 2019) with C. urticifolia (NC081060) as reference genome. The circular chloroplast genome map of the new species was drawn with OGDRAW (https://chlorobox.mpimp-golm.mpg.de/OGDraw.html) (Greiner et al. 2019). Table 1. List of analyzed samples of Clematis liana. Molecular specimen Voucher specimen Collection location Longitude and latitude Altitude(m) AJ-01 TXLAJ2024080501 Dongguan to Xianrenqiao, Longwangshan mountain, Anji County, Huzhou City 30°24'25.55"N, 119°26'35.69"E 1,248 AJ-05 TXLAJ2024080505 Dongguan to Xianrenqiao, Longwangshan mountain, Anji County, Huzhou City 30°24'27.58"N, 119°26'28.71"E 1,173 AJ-06 TXLAJ2024080506 Dongguan to Xianrenqiao, Longwangshan mountain, Anji County, Huzhou City 30°24'29.46"N, 119°26'22.52"E 987 LA-01 LATXL2024111001 Taoshuwan, Shunxiwu, Linan district, Hangzhou City 30°1'10"N, 118°56'24"E 1,028 LA-02 LATXL2024111002 Taoshuwan, Shunxiwu, Linan district, Hangzhou City 30°1'10"N, 118°56'24"E 1,028 LA-03 LATXL2024111003 Taoshuwan, Shunxiwu, Linan district, Hangzhou City 30°1'10"N, 118°56'24"E 1,028 96 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) Phylogenetic analyses For phylogenetic analyses, complete chloroplast genome sequences and ITS sequences of 10 Clematis species from subsect. Tubulosae were downloaded from the GenBank (Suppl. material 1). The chloroplast genome and ITS dataset were aligned independently using multiple alignment using fast Fourier transform (MAFFT) v7.490 implemented in Geneious Prime (Katoh and Standley 2013). Phylogenetic analyses based on ITS sequences and chloroplast genome sequences were conducted to explore the evolutionary relationship among the new species and other Clematis species using maximum likelihood (ML) method with MEGA 11.0 (Tamura et al. 2021). The Tamura 2-parameter model with Gamma distribution (T92+G) was employed for nucleotide substitution, with branch support assessed through 1,000 bootstrap replicates. Anemoclema glaucifolium (Franch.) W.T. Wang (Ranunculaceae), which exhibits significant morphological characteristics to the genus Clematis, serves as a stable reference for detecting ancestral traits in previous phylogenetic studies (Jiang et al. 2017, Xiao et al. 2022), and was thus chosen as an outgroup. Results and discussion Characteristics of the chloroplast genome The complete plastid genome sequence of Clematis liana sp. nov. comprises 159,759 bp, organized into a quadripartite structure containing two inverted repeat (IR: 31,084 bp each) regions, a small single copy (SSC: 18,135 bp) region, and a large single copy (LSC: 79,456 bp) region. The overall guanine and cytosine (GC) content of the plastid genome is 37.95%. The whole plastid genome contains 136 functional genes, including 92 protein-coding, 36 tRNA and 8 rRNA genes. The characteristics and statistics of plastid genome are summarized in Fig. 1 and Tables 2, 3. The complete plastid genome sequence of C. liana sp. nov. after annotation was deposited to GenBank under the accession No. PV335544–PV335546. Molecular analysis Phylogenetic analyses based on the plastid genome and ITS dataset consistently positioned the new species within subsection Tubulosae of the genus Clematis. The ITS sequences generated from our collected specimens have been deposited in GenBank under accession No. PV241489–PV241494. ML tree based on ITS data revealed that individuals of C. liana sp. nov. were clustered together with high bootstrap support alongside C. urticifolia (Fig. 2). In contrast, the ML tree based on the plastid genome data indicated that C. liana sp. nov. clustered with high bootstrap support within a clade comprising C. speciosa and C. stans var. austrojaponensis. Moreover, this clade of C. liana sp. nov. was further clustered with C. urticifolia (Fig. 3). The phylogenetic position of C. liana sp. nov. exhibits minor discrepancies between the plastid genome and ITS trees. Comparable inconsistencies between nuclear and plastid data have been observed in previous studies, indicating that interspecific hybridization events may be widespread in the genus Clematis (Xiao et al. 2022). 97 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) Morphological comparison The morphological characteristics of the new species, such as lifeform, stem, leaflet blade, inflorescence, flowers, sepal, and stamen were comprehensively studied and compared with related species, and the results showed that the new species is clearly different from other related species (Figs 4, 5). The distinguishing characteristics of the new species and the three relatives in subsect. Tubulosae are listed in detail in Table 4. The morphological analysis reveals that although C. liana sp. nov., C. urticifolia, C. satomiana, and C. stans var. austrojaponensis share similarities in certain traits, they exhibit distinct characteristics. Compared to C. liana sp. nov., C. urticifolia is a subshrub with Figure 1. Chloroplast genome map of Clematis liana. The thick lines on the outer circle indicate the inverted repeat regions (IRa and IRb). The gray histogram in the innermost circle displays the GC content. Genes located in inside circle of map transcribe counterclockwise, while those outside transcribe clockwise. Various functional genes are color-coded. 98 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) polygamous and purple flowers, an urceolate or tubular-urceolate calyx, 12–16 stamens, lanceolate-linear filaments that are 7–9 mm long and pilose near the apex, linear anthers that are 4–5 mm long, and ca. 12 carpels. Unlike C. liana sp. nov., C. satomiana is a subshrub with dioecious, pale violet flowers, featuring a tubular-urceolate or tubular calyx that is 18–20 mm long, strongly recurved sepals with sagittate and slightly dilated apical parts, and filaments that are 3 mm long, shorter than the anthers and glabrous. Moreover, C. stans var. austrojaponensis differs from C. liana sp. nov. in that it is a subshrub with dioecious, pale violet or pale purplish, nodding flowers, featuring a tubular-urceolate calyx 1.0–2.6 mm long and sepals with apices strongly recurved to 180 degrees. Table 2. Summary of whole plastid genome of Clematis liana. Characteristic Clematis liana Size (bp) 159,759 LSC length (bp) 79456 SSC length (bp) 18135 IR length (bp) 31084 Number of genes 136 Protein-coding genes 92 rRNA genes 8 tRNA genes 36 GC (%) 37.95 Table 3. Genes encoded in plastid genome of Clematis liana. Group of genes Gene name tRNA genes trnA-UGC* (×2), trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA, trnfM-CAU, trnGGCC, trnG-UCC*, trnH-GUG, trnI-CAU (×2), trnI-GAU* (×2), trnK-UUU*, trnL-CAA (×2), trnL-UAA*, trnL-UAG, trnM-CAU, trnN-GUU (×2), trnP-UGG, trnQ-UUG, trnR-ACG (×2), trnR-UCU, trnS-GCU, trnS-GGA, trnS-UGA, trnT-GGU, trnV-GAC (×2), trnV-UAC*, trnW-CCA, trnY-GUA rRNA genes rrn16 (×2), rrn23 (×2), rrn4.5 (×2), rrn5 (×2) Ribosomal small subunit rps2, rps3 (×2), rps4*, rps7 (×2), rps8 (×2), rps11, rps12** (×2), rps14, rps15, rps16*, rps18, rps19 (×2) Ribosomal large subunit rpl2* (×2), rpl14 (×2), rpl16* (×2), rpl20, rpl22 (×2), rpl23 (×2), rpl32, rpl33, rpl36 DNA-dependent RNA polymerase rpoC1*, rpoC2, rpoB, rpoA Photosystem I psaA, psaB, psaC, psaI, psaJ Photosystem II psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ Large subunit of rubisco rbcL NADH dehydrogenase ndhA*, ndhB* (×2), ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK Cytochrome b/f complex petA, petB*, petD*, petG, petL, petN ATP synthase atpA, atpB, atpE, atpF*, atpH, atpI Maturase matK (The matK is localized between the exons coding for the trnK-UUU) Subunit of acetyl-CoA carboxylase accD Envelope membrane protein cemA Protease clpP** Translational initiation factor infA C-type cytochrome synthesis ccsA Conserved open reading frames ycf1 (×2), ycf2 (×2), ycf3**, ycf4 Genes containing one or two introns are marked with one (*) or two (**) asterisks, respectively. Those located in the IR regions are denoted by the (× 2) symbol. 99 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) Figure 2. Maximum likelihood tree inferred from rDNA ITS sequences of Clematis to elucidate the phylogenetic position of C. liana Figure 3. Maximum likelihood tree inferred from the chloroplast genome of Clematis to elucidate the phylogenetic position of C. liana 100 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) Table 4. Morphological comparison between Clematis liana and its allied species. Characters C. lianaδC. urticifoliaβ,γ C. satomianaαC. stans var. austrojaponensisα,γ Lifeform perennial herb subshrub deciduous subshrub deciduous subshrub Reproductive strategy hermaphroditic polygamous dioecious polygamous Stem erect, 0.5–1.0 m tall, sharply 6-ridged or narrowly winged, deeply 6-sulcated, initially sparsely white puberulous, glabrescent erect, up to 2 m tall or more, longitudinally sulcate, puberulous, lower part woody erect, 0.5–2.0 m tall, to 3 cm in diam. at base, sulcate, sparingly strigose, lower part woody erect or sometimes ascending, up to 1 m tall, sulcate, sparingly strigose or glabrous, lower part woody petiole up to 20 cm long 8.5–16.3 cm long 1.5–8.0 cm long, densely tomentose, not tendrilous 4–20 cm long, strigose, not tendrilous Terminal leaflet blade chartaceous, broadly ovate, ovate-circular to suborbicular, 8–14 × 5–14 cm, shallowly 3-lobed or undivided apically, apex acute to shortly-acuminate, base rounded or cuneate, adaxially subglabrous, abaxially sparsely pubescent along veins, margin irregularly dentate, teeth tip short-pointed papery, broadly rhombic, rhombic, broadly ovate, elliptic, or obovate, 3-lobed or 3-lobulate, 7–16 × 4–11 cm, apex acuminate, base broadly cuneate or rounded, adaxially appressedpuberulous, abaxially reticulate, pubescent, margin irregularly dentate coriaceous, obovate to narrowly obovate, sometimes ovate or widely lanceolate, shallowly trilobed, 9–15 × 5–8.5 cm, apex acuminate to acute, base cuneate to rounded, abaxially tomentose along veins, margin coarsely serrate coriaceous, widely ovate, medially trilobed, 5–14 × 3–11 cm wide, apex acuminate, base rounded to widely cuneate or subtruncate, abaxially sericeous, tomentose along veins, margin coarsely serrate Lateral leaflet blade smaller, asymmetrical smaller, obliquely ovate ovate to lanceolate, almost simple, coarsely serrate / Inflorescence cymose 1–3-flowered, fasciculate, axillary panicles terminal, 3–40 cm long, 2–3 times branched, 10–manyflowered compound cymose terminal and axillary, 3–20 cm long, flowers many compound cymose, terminal ones 5–16 cm long, axillary ones 4–10 cm long, shorter than leaves, flowers many Involucral bract ovate to oblanceolate, asymmetrical, apex 2or 3-teeth, 12–15 mm long, puberulous foliaceous or simple, obovate trilobed to simple and lanceolate, sometimes large and foliaceous, 10 × 10 cm trifid to simple Floral bract narrowly ovate to narrowly ovate-lanceolate, 5–8 mm long, puberulous linear-lanceolate or triangular, 1.2–5 mm long, densely puberulous / / Pedicel stout, 2–9 mm,1.5–1.7 mm in diam., short pubescence robust, 0.5–3 mm long, 1.2–1.8 mm in diam., velutinous 8–12 mm long, sericeoustomentose 3–10 mm long, densely tomentose Flower urceolate, ca. 1.8 cm in diam., fragrant urceolate or tubular-urceolate, 8 mm in diam., often 3-costate, violet, glabrous inside, appressed-velutinous outside, velutinous on margin tubular-urceolate (♀), or tubular (♂), 18–20 × 3 mm, pale violet, erect to oblique or horizontal, abaxial surface sericeoustomentose, tubular-urceolate (♀), 1–2 cm long, or urceolate (♂), 8-16 mm long, pale purplish, nodding Sepal creamy white or pale yellow with pale purple apices, narrowly ovate or lanceolate, ca. 1.5 × 5.5 mm, apex acuminate, recurved outward purple, oblong-lanceolate or narrowly ovate, 12–15 × 3–6 mm, apex acuminate, recurved strongly recurved, with sagittate and slightly dilated apical parts, connate at 1–9 mm from base (♀), or connate at 2–7 mm from base or free (♂) apex attenuated and gently recurved to 180 degrees, connate at 7–12 mm from base (♀), or slightly dilated and strongly recurved to 360 degrees or more, connate at 2–5 mm from base or almost free (♂) Stamen 16–18, 9–11 mm long; filaments 5–6 mm long, glabrous; anthers 2.9–3.6 mm long; connective sparsely pilose, apex finely pointed 12–16, 9–13 mm long; filaments lanceolate-linear, 7–9 mm long, 1-veined, pilose near apex; anthers 4–5 mm long, linear, apex apiculate; connective very developed, with a purple top ca. 8 mm long (♂), or ca. 5 mm long, sterile (♀); filaments 3 mm long, shorter than anthers, glabrous (♂); anthers 5 mm long, linear-ovate (♂); connective sericeous-villose, with exserted tips 0.5 mm long (♂) filaments 2–3 times longer than the anthers, glabrous; anthers 3–4 mm long, linear-ovate; connective sericeous-villose, with exserted tips ca. 1 mm long (♂) Pollen grains pantoporate, 25.0 μm in diam. pantoporate, 21.8 μm in diam. /pantoporate, 21.4 μm in diam. Carpel 19–20, 2.5 –3.0 mm long, densely white sericeous-villous ca. 12, 4 mm long, densely villous style ca. 1 cm long, plumose (♀), or abortive, sterile (♂) / Achene slightly compressed, ovoid, 3.1–4.2 × 2.2–3.7 mm, reddishbrown, sparsely appressedpuberulous; persistent styles 1.1–2.5 cm long, plumose. compressed, broadly ovate or broadly elliptic, 3–3.2 × 2.8–3.2 mm, pilose, not or slightly rimmed; persistent style ca. 2.5 cm long, plumose ovoid, 3–4 mm long, light reddish brown, hirsute; persistent style 16–20 mm long, yellowish, plumose obovoid, 2–3.5 mm long, dark brown, hirsute; persistent style 15–20 mm long, yellowish, plumose Phenology flowering late July-August, fruiting late October-November /flowering from August to September flowering from August to October Habitat in gravel accumulations under deciduous broad-leaved forests; alt. 640–1,463 m a.s.l. at forest edges or in sparse forests on slopes; alt. 700–1,300 m a.s.l. beside and in summer-green forests beside and in summer green forests in calcareous areas; 200–1,500 m a.s.l. Distribution China: Zhejiang and Anhui S Korea Japan: Honshu Japan: Shikoku and Kyushu Based on Kadota 2006α, Kitagawa 1937β, Wang and Xie 2007γ; and own measurements at ZMδ. “/” represents data deficient. 101 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) Taxonomic treatment Clematis liana Z. H. Chen, J.P. Li, J.B. Pu et W.Y. Xie, sp. nov. urn:lsid:ipni.org:names:77372763-1 Figs 4–6 Chinese name: 安吉铁线莲 (Ān Jí Tiě Xiàn Lián) Type. China • Zhejiang Province: Huzhou City, Anji County, Longwangshan mountain, Dongguan to Xianrenqiao, shaded valley under deciduous broadleaved forest, 30°24'25.55"N, 119°26'35.69"E, alt. 1,248 m a.s.l., 5 August 2024, Jun-Ping Li, Xian-Ting Wang, Zheng-Hai Chen, Wei-Qing Liang et al. TXLAJ2024080501 (holotype: ZM [barcode NH0067429!]; isotypes: ZM [barcode NH0067430!], ZJMR [barcode 00015501!]). Diagnosis. C. liana sp. nov. is morphologically similar to C. urticifolia Nakai ex Kitag., but differs by the following characters: perennial herb with hermaphroditic flowers (vs. subshrub with polygamous flowers); floral bracts narrowly ovate to narrowly ovate-lanceolate, subentire, 5–8 mm long (vs. linear-lanceolate or triangular, 1.2–5 mm long); flowers bisexual, urceolate (vs. urceolate or tubular-urceolate); calyx creamy white or pale yellow with pale purple apices (vs. entirely purple); stamens 16–18 (vs. 12–16), filaments narrowly oblong, 5–6 mm long, glabrous (vs. lanceolate-linear, 7–9 mm long, pilose apically), anthers narrowly lanceolate, 2.9–3.6 mm long (vs. linear, 4–5 mm long), pollen grain 25.0 μm in diam. (vs. 21.8 μm); carpels 19–20 (vs. ca. 12); stems and petioles sharply longitudinal-edged or narrowly winged (vs. blunt longitudinal-ridged); leaflet blade broadly ovate, ovate-circular to subcircular, apex shortly acuminate (vs. broadly rhombic to obovate, apex acuminate). Description. Perennial herb, 0.5–1.0 m tall. Roots woody, brownish. Stems erect, robust, green, sharply 6-ridged or narrowly winged, deeply 6-sulcated, initially sparsely white-puberulent, glabrescent at maturity. Leaves ternate (upper leaves simple, trilobate to subtrilobate); petioles stout, up to 20 cm long, adaxially deeply sulcated, abaxially sharply-ridged, basally slightly widened and connate to opposite petiole, often tinged purple, initially sparsely pubescent, glabrescent at maturity; terminal leaflets chartaceous, broadly ovate to suborbicular, 8–14 × 5–14 cm, shallowly 3-lobed or undivided apically, apex acute to shortly acuminate, base rounded or cuneate, adaxially green, subglabrous (veins impressed), abaxially pale green (veins prominent, sparsely pubescent along veins), margin irregularly dentate (teeth tip short-pointed), petiolules 3–4 cm long, often tinged purple; lateral leaflets smaller, asymmetrical, petiolules 3–8 mm long, base tinged purple. Inflorescence cymose 1–3-flowered, fasciculate, axillary, subsessile; involucral bracts ovate to oblanceolate, asymmetrical, apex 2or 3-dentate, 12–15 mm long (including stalk), puberulous; floral bracts narrowly ovate to narrowly ovate-lanceolate, subentire, puberulous, 5–8 mm (including stalk); stalk adaxially base often tinged purple. Flowers bisexual, urceolate, ca. 1.8 cm in diam., fragrant; pedicels stout, 2–9 mm long, 1.5–1.7 mm in diam., short-pubscent; sepals 4, imbricate, erect, creamy white or pale yellow with pale purple apices, narrowly ovate or lanceolate, ca. 15 × 5.5 mm, apex acuminate, recurved outward, outer surface densely appressed-puberulent (velutinous on margins), inner surface glabrous, 3-veined; stamens 16–18, 9–11 mm; filaments narrowly oblong, S-shaped, 5–6 mm, white, glabrous; anthers 108 PhytoKeys 267: 93–108 (2025), DOI: 10.3897/phytokeys.267.158140 Pan Xu et al.: A new species: Clematis sect. Tubulosae (Ranunculaceae) Wang WT, Xie L (2007) A revision of Clematis sect. Tubulosae (Ranunculaceae). Zhiwu Fenlei Xuebao 45(4): 425–457. https://doi.org/10.1360/aps06114 White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (Eds) PCR protocols: a guide to methods and applications. Academic Press, San Diego, 315–322. https://doi.org/10.1016/B978-0-12-372180-8.50042-1 Xiao J, Lyu R, He J, Li M, Ji J, Cheng J, Xie L (2022) Genome-partitioning strategy, plastid and nuclear phylogenomic discordance, and its evolutionary implications of Clematis (Ranunculaceae). Frontiers in Plant Science 13: 1059379. https://doi.org/10.3389/ fpls.2022.1059379 Xie L, Wen J, Li L (2011) Phylogenetic analyses of Clematis (Ranunculaceae) based on sequences of nuclear ribosomal ITS and three plastid regions. Systematic Botany 36(4): 907–921. https://doi.org/10.1600/036364411X604921 Yang TYA, Huang TC (1996) Clematis L. In: Huang TC (Ed.) Flora of Taiwan 2. The Editorial Committee of the Flora of Taiwan, Second Edition, Taipei, 515–545. Zhang FY (2021) Clematis L. In: Li GY (Ed.) Flora of Zhejiang (New Edition) 2. Zhejiang Science and Technology Press, Hangzhou, 363–397. Supplementary material 1 NCBI accessions of studied samples Authors: Pan Xu, Jun-Ping Li, Xian-Ting Wang, Fen-Yao Zhang, Wei-Qing Liang, Wen-Yuan Xie, Li-Peng Yu, Feng Chen, Ke-Lang Lou, Jian-Ping Zhong, Jin-Bao Pu, Zheng-Hai Chen Data type: docx Copyright notice: This dataset is made available under the Open Database License (http://opendatacommons.org/licenses/odbl/1.0/). The Open Database License (ODbL) is a license agreement intended to allow users to freely share, modify, and use this Dataset while maintaining this same freedom for others, provided that the original source and author(s) are credited. Link: https://doi.org/10.3897/phytokeys.267.158140.suppl1