scieee AI-readable full text Open interactive document viewer

Three New Species of the Sun Coral Genus Tubastraea (Scleractinia: Dendrophylliidae) from Hong Kong, China

Yiu, Sam King Fung; Qiu, Jian-Wen

Abstract

Yiu, Sam King Fung, Qiu, Jian-Wen (2022): Three New Species of the Sun Coral Genus Tubastraea (Scleractinia: Dendrophylliidae) from Hong Kong, China. Zoological Studies 61 (45): 1-12, DOI: 10.6620/ZS.2022.61-45, URL: http://dx.doi.org/10.5281/zenodo.12826714

Full text

© 2022 Academia Sinica, Taiwan Open Access Three New Species of the Sun Coral Genus Tubastraea (Scleractinia: Dendrophylliidae) from Hong Kong, China Sam King Fung Yiu1 and Jian-Wen Qiu1,2,3,* 1Department of Biology, Hong Kong Baptist University, Hong Kong, China. *Correspondence: E-mail: [email protected] (Qiu). E-mail: [email protected] (Yiu) 2Southern Marine Science and Engineering Guangdong Laboratory (Guangzhou), Guangzhou, China 3HKBU Institute of Research and Continuing Education, Shenzhen, China Received 9 February 2022 / Accepted 26 May 2022 / Published 12 September 2022 Communicated by Benny K.K. Chan Tubastraea is a genus of azooxanthellate scleractinian corals belonging to the family Dendrophylliidae, which are commonly called sun corals. This genus currently has only seven recognized species. In this paper, we report three new species of Tubastraea, including T. dendroida sp. nov., which has a tree-like colony, T. violacea sp. nov., which has violet polyps, and T. chloromura sp. nov., which has olive green polyps. These species are distinct in their septal structures, as well as their rDNA sequences including the entire ITS1, 5.8S and ITS2, and a segment of the 18S and 28S genes. Key words: Scleractinian coral, Azooxanthellate, Ahermatypic coral, Dendrophylliid, South China Sea. BACKGROUND Ahermatypic corals are scleractinian corals formed by a solitary individual or a small colony of individuals that do not develop into a reef structure (Scott 1984; Schumacher and Zibrowius 1985; Veron 1993). They are typically small, azooxanthellate and live in deeper waters, and therefore are often overlooked in coral community surveys (Lam et al. 2008). This is the case for Tubastraea Lesson, 1830, a genus of azooxanthellate ahermatypic corals in the family Dendrophylliidae. This genus consisting of the species commonly known as sun corals, is mainly distributed in the Indo-Pacific region, but also well-known in the Atlantic, where they were introduced (Creed et al. 2017). Tubastraea currently comprises only seven extant species (Hoeksema and Cairns 2021), including T. coccinea Lesson, 1830, T. diaphana (Dana, 1846), T. faulkneri Wells, 1982, T. floreana Wells, 1982, T. megacorallita Yiu, Chung & Qiu 2021, T. micranthus (Ehernberg, 1834) and T. tagusensis Wells, 1982. Recently, T. aurea (Quoy & Gaimard, 1833) was classified as Australopsammia aurea (Quoy & Gaimard, 1833) (Rowlett 2020). However, in this paper we consider T. aurea (Quoy & Gaimard, 1833) as the valid name, since the decision to classify it otherwise was based only on the fact that the type locality of this species is in the southern hemisphere, rather than on morphological and phylogenetic analysis. The change in classification contradicted the result of a phylogenetic study showing that it is nested within a clade of Turbastraea (Arrigoni et al. 2014). Species of Tubastraea share several characteristics: 1) their colonies develop from a common basal coenosteum by budding with clear connection among polyps, and their columella are small to moderate size and lack an epitheca; 2) their colonial coralla are firmly attached to substrate; 3) their septal cycles are hexamerally arranged and typically inserted with spongy columella; and 4), their coralla exhibit a rough texture (Cairns 2001; Cairns and Kitahara 2012). Although in most Tubastraea species the septa are not arranged in a Citation: Yiu SKF, Qiu JW. 2022. Three new species of the sun coral genus Tubastraea (Scleractinia: Dendrophylliidae) from Hong Kong. Zool Stud 61:45. doi:10.6620/ZS.2022.61-45. Zoological Studies 61:45 (2022) doi:10.6620/ZS.2022.61-45 1 © 2022 Academia Sinica, Taiwan Pourtalès plan, those of T. megacorallita are. Because of this fact, Yiu et al. (2021a) removed the lack of this structure from the diagnostic features of this genus. Molecular phylogenetic analysis based on multigene markers (i.e., COI, intergenic spacer between COI and 16S, and a rDNA marker including ITS1, 5.8S, ITS2, and a segment of 18S and 28S) have clarified the classification of Dendrophylliidae (Arrigoni et al. 2014), revealing that, while most other genera of the family represented by at least two species are nonmonophyletic, Tubastraea is monophyletic with a strong bootstrap support. In Hong Kong, five species of Tubastraea have been recorded: T. coccinea, T. diaphana, T. faulkneri, T. megacorallita and T. micranthus (Scott 1984; Clark 1997; Lam et al. 2008; Yiu et al. 2021a). Compared to the zooxanthellate corals that mostly inhabit the shallow waters (< 10 m) (Yeung et al. 2021), azooxanthellate corals including these Tubatraea spp. are mainly distributed in the deeper waters (≥ 10 m), with the exception of T. aurea which was reported from “snorkelling depths” (Scott 1984). While implementing a project studying corallivorous nudibranchs in Hong Kong waters (Hu et al. 2020a b), we found four undescribed species of Tubastraea. One of them, T. megacorallita, has been described recently (Yiu et al. 2021a). In this paper we describe the other three species based on morphological and molecular analyses. MATERIALS AND METHODS Sample collection All samples were collected by SCUBA from Sung Kong and Waglan Island in eastern Hong Kong waters (Fig. 1). They were preserved in 95% ethanol and deposited in the Tropical Marine Biodiversity Collections of the South China Sea (TMBC), Chinese Academy of Sciences, Guangzhou. Morphological analysis Photographs of the specimens were taken using an Fig. 1. A map of Hong Kong showing the two sampling sites in this study (red dots), as well as the sampling sites (triangles) of ahermatypic corals in previous studies (Scott 1984; Clark 1997; Lam et al. 2008; Yiu et al. 2021a). page 2 of 12Zoological Studies 61:45 (2022) © 2022 Academia Sinica, Taiwan Olympus OM-D EM1markII camera with a M. Zuiko Digital ED 60mm f2.8 macro lens. Morphological characters defined by Cairns (2001) and Cairns and Kitahara (2012) were used for species description. They included whole colony size, corallite size, fossa depth, intercorallite distance and septa arrangement. The size measurements were performed using a ruler. The following abbreviations were used: GCD, greater calicular diameter; LCD, lesser calicular diameter; S, septa. DNA extraction, PCR, sequencing and analysis Genomic DNA was extracted from two specimens in each species using the CTAB method (Stewart and Via 1993). DNA quantity was measured, and purity determined using a NanoDrop ND1000 spectrophotometer (Thermo Fisher Scientific, USA). DNA quality was checked by 1% agarose gel electrophoresis. Sequences from two mitochondrial regions and one nuclear region were targeted. The first mitochondrial region covers a portion of cytochrome oxidase 1 (COI) gene, while the second mitochondrial region covers the 3' end of COI, intergenic spacer (IGR) between COI and trnM, trnM and the 5'-end of large ribosomal subunit (16S), namely IGR in the rest of the text. The nuclear region covered a portion of rDNA including the entire sequences of ITS1, 5.8S and ITS2, and a portion of 18S and 28S. Polymerase chain reaction (PCR) was conducted using the extracted DNA as templates to amplify the COI, IGR and rDNA. The partial COI (~750 bp) was amplified using primers designed by Arrigoni et al. (2014): COIDENL (5'- CGCTGGGCGTTTTCTACTAA -3') and COIDENR (5'-GAAATCATTCCAAAGCCAGGT -3'). The amplification program consisted of an initial denaturation step of 94°C for 2 min, followed by 35 cycles of 94°C for 30 sec, 53°C for 1 min, 72°C for 1 min and finally a 7 min extension step at 72°C. The IGR (~500 bp) was amplified using primers designed by Arrigoni et al. (2014): AGAL (5'-CGCATTGAAACACGAGCTTA -3') and DENF (5'-TTTGCTGGTTGGAATTTGGT -3'). Amplification reactions were carried out using the following program: 94°C for 4 min, 35 cycles of 94°C for 1 min, 51°C for 1 min, 72°C for 1 min and a final phase at 72°C for 5 min. The rDNA (~750 bp) was amplified using primers A18S (5'- GATCGAACGGTTTAGTGAGG -3') (Takabayashi et al. 1998) and ITS4 (5'-TCCTCCGCTTATTGATATGC -3') (White et al. 1990), amplifications were performed with the following program; 94°C for 4 min, 40 cycles of 15 sec at 94°C,1 min at 55°C, 30 sec at 72°C and a final phase at 72°C for 5 min. PCR products were sent to BGI Hong Kong for sequencing on an ABI 310 Genetic Analyzer. All new sequences were deposted into GenBank (Table S1). Alignments of the three genes were conducted separately and trimmed manually to 601 bp for COI, 448 bp for IGR and 684 bp for rDNA using MEGA 7. Sequences were concatenated using SequenceMatrix v.1.7.8 (Vaidya et al. 2011) and then imported to the website version of IQ-Tree (http://iqtree.cibiv.univie. ac.at/; Nguyen et al. 2015) for Maximum Likelihood tree reconstruction with 1,000 ultrafast bootstrap pseudoreplicates (Hoang et al. 2017). ModelTest (Kalyaanamoorthy et al. 2017) incorporated in IQTree was applied for each partition of the concatenated sequences, which detected TPM3u+F+I as the best model for COI, HKY+F+G4 for IGR and K2P+I+G4 for rDNA based on Bayesian Information Criterion. MrBayes v.3.2.7a (Ronquist and Huelsenbeck 2003) was used to perform the Bayesian Inference analysis with four Metropolis-coupled Markov Chain Monte Carlo applied to 10 million generations, sampled at every 1,000 generations with a 25% burn-in. Since the best models detected for the concatenated dataset by ModelTest were not available in MrBayes, they were substituted by the closest overparameterized models (Huelsenbeck and Rannala 2004): GTR+I+G for COI, HKY+I+G for IGR and K2P+I+G for rDNA. The phylogenetic trees were visualized and edited using FigTree v1.4.4. Pairwise genetic distances for the respective COI, IGR and rDNA genes were estimated using MEGA 7 separately based on the p-distance method using the bootstrap method with 10,000 pseudoreplicates for variance estimation. Rates among sites were gamma distributed with invariant sites (G+I) and the gamma parameter was set to four. RESULTS SYSTEMATICS Class ANTHOZOA Ehrenberg, 1834 Order SCLERACTINIA Bourne, 1900 Family DENDROPHYLLIIDAE Gray, 1847 Genus Tubastraea Lesson, 1830 Tubastraea dendroida sp. nov. (Fig. 2) urn:lsid:zoobank.org:act:774c42bb-bd84-4f0f-b00f256ba8d1c90d Materials examined: Holotype: Colony with 74 corallites, 60 mm in length and 94 mm in height (TMBC030974). Paratype: Colony with 74 corallites, 13.5 mm in page 3 of 12Zoological Studies 61:45 (2022) © 2022 Academia Sinica, Taiwan Fig. 2. Tubastraea dendroida sp. nov. A–C, photographs of colonies taken in the field. D, skeleton of holotype (left, TMBC030974) and paratype (right, TMBC030975). E, Cross-sectional view of a corallite showing three septal cycles. F, lateral view of a corallite. Scale bars: A–C = 3 cm; D = 1 cm; E– F = 2.5 mm. page 4 of 12Zoological Studies 61:45 (2022) © 2022 Academia Sinica, Taiwan length and 202 mm in height (TMBC030975). Type locality: Both specimens were collected from Sung Kong (22°11'26.5"N, 114°16'48.4"E) on 28/09/2021 at 17 m depth (Fig. 1). Etymology: Tubastraea dendroida sp. nov. looks like a tree branch. The species epithet reflects this morphological character. Geographic distribution: Currently only known in Hong Kong. Habitat: Exposed sites with moderate current, rocky substrate, 10–25 m water depth. Description: Living specimen (Fig. 2A–C) with bright orange tissue covering epithecal wall and corallite. Tentacles yellow, usually withdrawn. Colony dendroid, branching uniplanar, with one elongate, straight axial corallite, and several side branches formed by extra-tentacular budding (Fig 2D). Each specimen with up to 74 corallites varying between 13.5–60 mm in length and 94–202 mm in height. Colony height up to 50 cm. Corallites circular or slightly elliptical (6–8 mm in GCD and 5–7 mm in LCD) with a thin wall. Axial corallites usually biggest among all corallites in a colony. A total of 24 septa present, with 10 to 16 of the septa fused with columella (Table 1). Septa hexamerously arranged (Table 2), containing 3 cycles, with size increasing from inner to outer as S1 = S2 > S3. Septa usually arranged in a Pourtalès plan (Fig. 2E), curving from edge to columella. Columella (Fig. 2E) Table 1. Comparison of gross morphological characters among Tubastraea species Species Growth form Intercorallite distance Corallites Columella Fossa Shape LCD × GCD (mm) LCD × GCD (mm)/Size Depth (mm) T. coccineaa,b,c,d Plocoid Closely spaced Circular 10.0–13.0 Large Moderately deep T. chloromura sp. nov. Phaceloid Closely spaced Circular 6.0–10.0 × 6.0–11.0 1.5–4.0 × 4.0–6.0 4.0–8.0 T. dendroida sp. nov. Dendroid/Branching uniplanar Closely spaced/ widely spaced Circular 5.0–7.0 × 6.0–8.0 1.0–2.0 × 2.0–3.0 3.0–11.0 T. diaphanac,e Dendroid/Phaceloid Circular 6.0–11.0 Deep T. faulknerb,e,f Plocoid Closely spaced/ widely spaced Circular 5.2–7.8/8.0–13.0 Large Deep and spongy/Shallow T. floreanae,f Phaceloid Closely spaced/ widely spaced Cylindrical 4.0–6.0 Rudimentary 4.0–5.0; moderately deep T. megacorallitagPhaceloid Closely spaced/ widely spaced Elliptical 6.3–19.1 × 8.0–24.6 0.9–3.7 × 1.9–10.1 2.5–18.1 T. micranthusc,h,i Dendroid/Branching uniplanar Circular 4.5–6.5 × 5.0–7.5 Rudimentary 4.0–9.0 T. tagusensisb,f Phaceloid Closely spaced Cylindrical < 10.0 Rudimentary Deep T. violacea sp. nov. Phaceloid Closely spaced/ widely spaced Cylindrical 8.0–14.0 × 10.0–18.0 2.5–4.0 × 6.0–8.0 9.0–11.0 aWells (1983), bCairns (1991), cCairns & Zibrowius (1997), dCairns (1994), eLam et al. (2008), fWells (1982), gYiu et al. (2021a), hNemenzo (1960), iOgawa & Takahashi (1993). Table 2. Comparison of septal arrangement among Tubastraea species Species Arrangement Total number No. of septa fused with columella No. of cycles Size Fusion T. coccineaa,b,c,d Normal Up to 48 12 4 S1 = S2 > S4 > S3S4 united with S3 T. chloromura sp. nov. Normal 34–40 10–12 4 S1 > S2 > S3 = S4S3 fused with S4 T. dendroida sp. nov. Pourtalès plan 24 11–12 3 S1 > S2 = S3No T. diaphanac,e Normal 4 S1 > S2 >> S3 > S4; S1 = S2 > S4 = S3 T. faulknerb,e,f Normal 48+ 4 S1 > S2 > S4 > S3 T. floreanae,f Normal 24 3 S1 = S2 > S3No T. megacorallitagPourtalès plan 34–92 10–26 5 S1 = S2 > S3 > S4 = S5S5 fused with S4 and S3 T. micranthusc,h,i Normal S1 > S2 >> S3 T. tagusensisb,f Normal 24/48 3 or 4 S1 = S2 > S3 > S4; S1 = S2 = S3 > S4No T. violacea sp. nov. Pourtalès plan 75–87 23–26 5 S1 = S2 > S3 > S5 > S4S5 fused with S4 and S3 aWells (1983), bCairns (1991), cCairns & Zibrowius (1997), dCairns (1994), eLam et al. (2008), fWells (1982), gYiu et al. (2021a), hNemenzo (1960), iOgawa & Takahashi (1993). page 5 of 12Zoological Studies 61:45 (2022) © 2022 Academia Sinica, Taiwan spongy (2–3 mm in GCD and 1–2 mm in LCD). Fossa 3–11 mm deep. Costae granular. Intercostal striae porous (Fig. 2F). Taxonomic remarks: Tubastraea dendroida sp. nov. resembles T. micranthus and Dendrophyllia ijimai in that their colonies are uniplanar (Filander et al. 2021). It can be distinguished from T. micranthus in that the latter has a slimmer main “stem”, its three septal cycles are not arranged a Pourtalès plan, and it is usually in dark green or brown colour (Schuhmacher 1984; Cairns and Zibrowius 1997; Sammarco et al. 2010; Filander et al. 2021). However, Tachikawa (2005) reported that T. micranthus had both dark green and orange colour morphs in Japan, with the dark green morph more dominant. Whether this is true, or the orange morph is T. dendroida sp. nov. needs to be determined when specimens are available for examination. The septa of Dendrophyllia ijimai are also arranged in a Pourtalès plan, but this species differs from the new species in having four septal cycles instead of three septal cycles. It is the second species of Tubastraea known to have a Pourtalès plan. Tubastraea chloromura sp. nov. (Fig. 3) urn:lsid:zoobank.org:act:1d107473-b405-468f-92128a2fe77db739 Materials examined: Holotype: Colony with 26 corallites, 45 mm in length and 32 mm in height (TMBC030976). Paratype: Colony with 16 corallites, 57 mm in length and 30 mm in height (TMBC030977). Type locality: Both specimens were collected from Waglan Island (22°10'51.4"N, 114°18'11.8"E) on 14/03/2021 at 10 m depth (Fig. 1). Etymology: Tubastraea chloromura sp. nov. has a distinct olive green epithecal wall. The species epithet chloromura (Latin chloro = green, murus = wall) reflects this morphological character. Geographic distribution: Currently only known in Hong Kong. Fig. 3. Tubastraea chloromura sp. nov. A, a colony of the new species (olive green) next to a colony of T. coccinea (red) in the field, a nudibranch Phestilla melanobranchia (pointed by a white arrowhead). B, a colony of the new species (olive green) next to a colony of T. coccinea (red) in laboratory aquarium. C, open polyp. D, skeleton of holotype. E, cross-sectional view of a corallite showing four septal cycles. F, lateral view of a corallite. Scale bars: A–B = 1 cm; C = 5 mm; D = 1 cm; E–F = 5 mm. page 6 of 12Zoological Studies 61:45 (2022) © 2022 Academia Sinica, Taiwan Habitat: Exposed sites with moderate current, rocky substrate. Description: Living specimen (Fig. 3A–B) with olive green tissue covering epithecal wall of corallite, and light green tentacles. Colony phaceloid. Corallites formed by extratentacular budding (Fig 3B), consisting of 16–26 corallites. Colonies between 45–57 mm in length and 30–32 mm in height. Corallites circular (6–10 mm in GCD and 6–11 mm in LCD) with a thin wall. A total of 34–40 septa present, with 10 to 12 of the septa fused with columella (Table 1). Septa hexamerously arranged (Table 2), containing 4 cycles, with increasing size from inner to outer as S1 > S2 > S3 = S4. Septa normally inserted. Septa spongy, highly porous (Fig. 3D). Columella (Fig. 3D) spongy (1.5–4 mm in GCD and 4–6 mm in LCD). Fossa 4–8 mm deep. Costae granular. Intercostal striae porous (Fig. 3E). Taxonomic remarks: Tubastraea chloromura sp. nov. resembles T. coccinea in gross colony morphology, but its tissues are olive green. It was thought by the first author as a colour variant of T. coccinea when he collected the samples. This new species exhibits sympatric distribution with T. coccinea (Fig 3A). In addition to having a unique tissue colour, T. chloromura sp. nov. has a thinner and more porous septal texture than other Tubastraea species. Tubastraea violacea sp. nov. (Fig. 4) urn:lsid:zoobank.org:act:972E5F06-D434-45CB-89618CD65BC6DE38 Materials examined: Holotype: Colony with 130 corallites, 160 mm in length and 83 mm in height (TMBC030978). Paratype: Colony with 16 corallites, 35 mm in length and 40 mm in height (TMBC030979). Fig. 4. Tubastraea violacea sp. nov. A, a colony of in the field and opened polyp at right top corner. B, open polyps. C, skeleton of part of the holotype (TMBC030978). C, cross-sectional view of corallite showing the five septal cycles. D, lateral view of a corallite. Scale bars: A–C = 1 cm; D– E = 5 mm. page 7 of 12Zoological Studies 61:45 (2022) © 2022 Academia Sinica, Taiwan Type locality: The holotype was collected from Sung Kung (22°11'26.5"N, 114°16'48.4"E) (Fig. 1) on 14/03/2021 at 10 m depth. The paratype was collected from Waglan Island (22°10'51.4"N, 114°18'11.8"E) on 28/09/2021 at 10 m depth. Etymology: Tubastraea violacea sp. nov. has violet tissue covering the corallites. The species epithet reflects this morphological character. Geographic distribution: Hong Kong (this study) and Canal Woodin, New Caledonia (based on the sequences of Tubastraea sp 2. in Arrigoni et al. 2014) Habitat: Exposed sites with moderate current, rocky substrate. Description: Living specimen (Fig. 4A) with pale purple tissue covering epithecal wall, violet tissue covering corallite and translucent yellow tentacles. Colony phaceloid with each long corallite having its own wall. Corallites formed by extratentacular budding (Fig. 4B), consisting of 16–130 corallites. Colonies 35– 160 mm in length and 40–83 mm in height. Corallites cylindrical (10–18 mm in GCD and 8–14 mm in LCD) with a thick wall. A total number of 75–87 septa present, with 23–26 of the septa fused with columella (Table 1). Septa hexamerously arranged (Table 2), containing 5 cycles, with the size order of S1 = S2 > S3 > S5 > S4. Septa arranged in a Pourtalès plan. Columella (Fig. 4C) spongy (6.0–8.0 mm in GCD and 2.5–4.0 mm in LCD). Fossa 9–11 mm deep. Costae granular. Intercostal striae porous (Fig. 4D). Taxonomic remarks: Tubastraea violacea sp. nov. is unique among the congeneric species in having violet tissue covering the corallites. It is also remarkable in having a Pourtalès plan of septal arrangement, and that is the third species of Tubastraea has this character. Yiu et al. (2021a) observed that the Pourtalès plan is absent in small corallites of T. megacorallita but it is usually present in corallites at least 17 mm × 15 mm (GCD × LCD) in size. However, all corallites of the type specimens of T. violacea sp. nov. were observed to exhibit a Pourtalès plan. Besides, the same as T. megacorallita, T. violacea sp. nov. has five septal cycles. All other Tubatraea species have three to four septal cycles. Moreover, T. violacea sp. nov. can be distinguished from T. megacorallita in having cylindrical corallites rather than elliptical corallites. Also, the two species are different in their septal size orders. Molecular analyses The alignment and concatenation resulted in a dataset of 1.733 bp (COI: 601 bp, IGR: 448 bp, rDNA: 684 bp). Pair-wise sequence comparisons were conducted to determine the interand intra-specific p-distances (Table 3). Intraspecific p-distances in the three species are in general very small, with 0% for COI, 0% for IGR, and 0.15% for rDNA in T. violacea sp. nov., 0% for COI, 0.22% for IGR, and 0% for rDNA in T. chloromura sp. nov., and 0% for COI, 0.22% for IGR, and 1.79% for rDNA in T. dendroida sp. nov. The relatively large rDNA p-distances between the two specimens of T. dendroida sp. nov. and between the two species of T. micrnthus indicate the potential of cryptic speciation in this species. Tubastraea violacea sp. nov. is most closely related to Tubastraea sp. 2. HS2883, an undescribed species collected from Caledonia (Arrigoni et al. 2014); the sequences between them had a p-distance of 0% for COI, 0% for IGR, and 0.32–0.48% for rDNA, indicating they are conspecific, despite their differences in tissue colour. The species closest to T. chloromura sp. nov. and Tubastraea dendroida sp. nov. is T. micranthus. Between T. chloromura sp. nov. and T. micranthus, the p-distance was 0.17% for COI, 0–0.22% for IGR, and 0.96% for rDNA. Between T. dendroida sp. nov. and T. micranthus, the p-distance was 0% for COI, 0–0.22% for IGR and 1.29–1.45% for rDNA. In Table 3. Tubastraea intraand inter-specific uncorrected p-distances (%) for COI/IGR/rDNA. Data obtained in this study are in bold 1234567891011 1T. violacea sp. nov. 2T. violacea sp. nov. 0/0/0.15 3T. chloromura sp. nov. 0.17/0/2.26 0.17/0/2.11 4T. chloromura sp. nov. 0.17/0.22/2.26 0.17/0.22/2.11 0/0.22/0 5T. dendroida sp. nov. 0/0/3.62 0/0/3.47 0.17/0/1.96 0.17/0.22/1.96 6T. dendroida sp. nov. 0/0.22/3 0/0.22/2.85 0.17/0.22/1.35 0.17/0/1.35 0/0.22/1.79 7T. coccinea (AQ2) 0/0/1.43 0/0/1.27 0.17/0/2.06 0.17/0.22/2.06 0/0/3.01 0/0.22/2.69 8T. diaphana (AO101) -/0.67/3.18 -/0.67/3.03 -/0.67/4.13 -/0.89/4.13 -/0.67/3.97 -/0.89/4.29 -/0.67/3.5 9T. megacorallita 0/0/4.6 0/0/4.44 0.17/0/4.28 0.17/0.22/4.28 0/0/4.43 0/0.22/4.59 0/0/3.96 -/0.67/4.77 10 T. micranthus (HS3129) 0/0/1.61 0/0/1.45 0.17/0/0.96 0.17/0.22/0.96 0/0/1.45 0/0.22/1.29 0/0/1.29 -/0.67/3.55 0/0/3.54 11 T. sp._1 (MY105) 0.83/0.45/5.14 0.83/0.45/4.98 1/0.45/4.65 1/0.67/4.65 0.83/0.45/4.82 0.83/0.67/4.82 0.83/0.45/4.65 -/0.67/5.15 0.83/0.45/6.1 0.83/0.45/4.22 12 T. sp._2 (HS2883) 0/0/0.48 0/0/0.32 0.17/0/2.06 0.17/0.22/2.06 0/0/3.01 0/0.22/2.85 0/0/1.27 -/0.67/3.34 0/0/4.43 0/0/1.29 0.83/0.45/5.14 page 8 of 12Zoological Studies 61:45 (2022) © 2022 Academia Sinica, Taiwan comparison, the p-distance between T. micranthus and T. coccinea was 0% for COI, 0% for IGR and 1.29% for rDNA. Overall, these genetic distances support our designation of the three new species. The ML and BI trees constructed using the concatenated sequences showed the same topology (Fig. 5), with species of the genus Tubastraea forming a monophyletic clade within the family Dendrophylliidae. This result is in agreement with Arrigoni et al. (2014), and supports retention of the name T. aurea, rather than reclassifying the species as Australopsammia aurea (Rowlett 2020). Among the species of Tubastraea used in this analysis, T. dendroida sp. nov. is sister to T. chloromura sp. nov. The (T. dendroida sp. nov. + T. chloromura sp. nov.) clade is sister to T. micranthus. Tubastraea violacea sp. nov. along with Tubastraea sp. 2 HS2883 are sister to Tubastraea sp. 2 HS2884. The ((T. violacea sp. nov. + Tubastraea sp. 2 HS2883) + Fig. 5. Phylogenetic tree of the concatenated COI/IGR/rDNA dataset constructed using the Maximum Likelihood method and Bayesian Inference method. Bootstrap values > 70 and Bayesian Inference posterior probability values > 0.7 are shown in the nodes. Data obtained in this study are indicated by an asterisk. # indicates the species name in Rowlett (2020) was Australopsammia aurea. page 9 of 12Zoological Studies 61:45 (2022)