A new sister species of Thaeides theia (Hewitson, 1870) from the Venezuelan Central Coastal Range (Lepidoptera: Lycaenidae: Theclinae).

ZOOBANK: https://zoobank.org/urn:lsid:zoobank.org:pub:AB52217C-E356-468E-BB3A-D644C7EF9323 ANNALES MUSEI HISTORICO-NATURALIS HUNGARICI Volume 117 Budapest, 2025 pp. 163–182 DOI: https://doi.org/10.53019/AnnlsMusHistNatHung.2025.117.163 HU-ISSN 0521-4726 (print) ISSN 2786-1368 (online) published: 2025. 11. 13. arrived: 2025. 08. 10. A new sister species of Thaeides theia (Hewitson, 1870) from the Venezuelan Central Coastal Range (Lepidoptera: Lycaenidae: Theclinae) Zsolt Bálint1,2,*, Gergely Katona1, Krisztián Kertész2, Gábor Piszter2, Nick Grishin3, Andrew F. E. Neild4, Francisco Romero5 & Mauro Costa6 1Hungarian National Museum Public Collections Centre, Budapest – Hungarian Natural History Museum, Department of Zoology, H–1088, Baross utca 13, Hungary. E-mails: [email protected]; [email protected] 2HUN-REN, Centre for Energy Research, Institute of Technical Physics and Material Science, Nanostructures Department, 1121 Budapest, Konkoly-Thege Miklós út 29–33, Hungary. E-mails:[email protected]; [email protected]; [email protected] 3Howard Hughes Medical Institute, Departments of Biophysics and Biochemistry, University of Texas. Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75390-9050, USA. E-mail: gri[email protected]ed.edu 4Research Associate, McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, PO Box 112710, Gainesville, FL 32611-2710, USA. E-mail: [email protected] 5Urbanización Las Acacias, Vereda 12, N° 13, Maracay, Edo. Aragua, Venezuela. 6Museo del Instituto de Zoología Agrícola, Universidad Central de Venezuela, Maracay, Venezuela. E-mail: [email protected] Abstract – A new butterfly species of Lepidoptera (Papilionoidea) is described on the basis of 70 type specimens mostly collected at Portachuelo Pass (Rancho Grande, Henri Pittier National Park, Aragua, Venezuela): Thaeides yepezi Bálint, Grishin, Romero & Costa, n. sp. (Lycaenidae: Theclinae: Eumaeini). The type locality, the male dorsal wing surface colouration and historical records of Thaeides from Venezuela are briefly discussed. With 13 figures and one table. Key words – Androconia, Cordillera de la Costa, Francisco Fernández Yépez, Portachuelo Pass, Serranía del Litoral Central, spectral characteristics Resumen – Una nueva especie hermana de Thaeides theia (Hewitson, 1870) de la Cordillera de la Costa Central de Venezuela (Lepidoptera: Lycaenidae: Theclinae): Se describe una nueva especie de Lepidoptera (Papilionoidea) sobre la base de 70 ejemplares casi todos recolectados en el Paso de Portachuelo de Rancho Grande (Parque Nacional Henri Pittier, Aragua, Venezuela): * Corresponding author. Bálint Zs. et al. 164 Annls Mus. hist.-nat. hung. 117, 2025 Thaeides yepezi Bálint, Grishin, Romero & Costa, n. sp. (Lycaenidae: Theclinae: Eumaeini). Se detalla la localidad tipo de la nueva especie, así como la coloración de las alas dorsales del macho y se mencionan los reportes históricos de Thaeides en Venezuela(13 figuras y 1 tabla). Palabras clave – Androconia, Cordillera de la Costa, Francisco Fernández Yépez, Paso de Portachuelo, Serranía del Litoral Central, características espectrales INTRODUCTION Two recently published studies highlighted that Thaeides theia (Hewitson, 1870), considered to be a monotypic eumaeine hairstreak lycaenid butterfly with Pan-American distribution from Mexico via Central America and the Andes to Bolivia and southeastern Brazil (Godman & Salvin 1877, Draudt 1919, D’Abrera 1995; Robbins 2004), includes several different taxa at the species level. Prieto et al. (2024) demonstrated distinct species status for populations that live in the Sierra Nevada de Santa Marta, Colombia, described as Thaeides ramoni Prieto, 2024. Concurrently, Costa et al. (2024) studied material from the highlands of southern Venezuela (Pantepui) and determined that the specimens collected there represent a distinct species, Thaeides hyperion Bálint, Costa & Grishin, 2024. This study continues our collaboration aimed at harnessing the power of genomics to discover and document new species of butterflies. The first goal of this collaboration is to provide DNA-based support for putative new species that were originally recognized on morphological grounds (but not yet formally described), and to further test the hypothesis of their distinctness at the species level. The second, perhaps more intriguing, objective is the serendipitous discovery of new species among specimens previously identified as known taxa but forming distinct clades in genome-wide phylogenetic trees. Costa et al. (2024) exemplify the first approach, starting with the hypothesis that T. hyperion represents a Pantepui-endemic new species, which we supported through genomic sequencing. Additional Thaeides Johnson, Kruse & Kroenlein, 1997 specimens from the Central Coastal Range (Cordillera de la Costa Central) in Venezuela were identified as T. theia and sequenced to compare T. theia with T. hyperion. However, inclusion of topotypic T. theia specimens from Ecuador revealed that they form a well-defined clade distinct from the Venezuelan “T. theia,” thus illustrating the second aspect of the collaboration. Genomic comparison suggested that the Venezuelan “T. theia” represents a separate, undescribed species. This hypothesis is further tested in the present study, which diagnoses and documents this already recognized but hitherto formally undescribed Thaeides species occurring in northern Venezuela. A new Thaeides from Venezuela 165 Annls Mus. hist.-nat. hung. 117, 2025 MATERIALS AND METHODS Nomenclature, dissecting and spectral measurement methods are identical to the ones used by Costa et al. (2024). Abbreviations – CAN = Collection of Andrew Neild (St. Albans, United Kingdom); CCF = Collection of Christophe Faynel (Montaud, France); CFR = Collection of Family Romero (Maracay, Venezuela); CMC = Collection of Mauro Costa (Caracas, Venezuela); CPB = Collection of Pierre Boyer (Le Puy-Sainte-Réparade, France); HNHM = Hungarian Natural History Museum (Budapest, Hungary); MIZA = Museo del Instituto de Zoología Agrícola, Facultad de Agronomía, Universidad de Venezuela (Maracay, Venezuela); NECJU = Nature Education Center, Zoological Museum, Jagiellonian University (Krakow, Poland); SP = Spectral Peak (see descriptive texts). Additional material used for comparison – Thaeides ramoni: COLOMBIA: Magdalena, Sierra Nevada de Santa Marta, 1900 m, above San Javier, 2023. IX. 22. (NECJU: 2 males); Thaeides theia: ARGENTINA: Catamarca, La Merced, 11mm, Costa del Totoral, La Merced, 2000. I. 12. (CPB: female). COLOMBIA: Magdalena, Sierra Nevada de Santa Marta, 2000 m, above San Javier, 2023. IX. 19. (NECJU: male). COSTA RICA: Heredia, 150 m, Porto Viejo, Salva Verde, 1993. II. 5. (CPB: male); Cartago, 800 m, Vallée de Tuis, 1993. II. 17 (CPB: male). ECUADOR: Pastaza, 1000 m, Puyo, 1996. VI. (CPB: female); ditto, km 25 Puyo–Tena road, 2016. XII. (CCF: male); PERU: San Martin, Jorge Chavez, 2008. III. (CCF: male). VENEZUELA: Edo. Merida, 1800–1850 m, via La Zulita, bajada de La Azulita, 2009. VIII. 1. Pyrcz T. & Zubek A. (NECJU: male). The terminology of wing venation follows the ComstockNeedham nomenclature system (Miller 1970). In genomic analysis, the following specimens (n = 6) were used: Thaeides annandon, male, Brazil, Rio Grande do Sul, São Francisco de Paula, 900 m, 3. V. 1998, Moser; Thaeides hyperion, female, Venezuela, Bolívar, Auyán Tepui, Entre Libertador y El Oso, 2200 m, 24. XII. 2012, Costa; Thaeides hyperion, male, Venezuela, Bolívar, Auyán Tepui, Entre el Danto y El Peñón, 1750 m, 25. III. 2013, Costa; Thaeides hyperion, male, Venezuela, Bolívar, Auyán Tepui, El Dragón, 1750 m, 3. II. 2019, Costa/Benmesbah; Thaeides theia, female, Venezuela, Aragua, Rancho Grande, 1100 m, X. 1967, Romero; Thaeides theia, male, Venezuela, Aragua, Rancho Grande, Cumbre, 1100 m, V. 1995, Romero. The protocol for genomic work followed previous publications (Li et al. 2019; Zhang et al. 2019). In brief, genomic DNA was extracted from a single leg, mate-pair libraries constructed and sequenced at 150 bp on Illumina platform. Protein-coding regions were assembled using DIAMOND (Buchfink et al. 2015) from the resulting sequence reads and a reference protein set of Calycopis cecrops (Fabricius, 1793) (Cong et al. 2016), and three phylogenetic trees were constructed using IQtree v1.6.12, utilizing the GTR+GAMMA model (Nguyen et al. 2015): (1) from autosomes in the nuclear genome, (2) from the gene Bálint Zs. et al. 166 Annls Mus. hist.-nat. hung. 117, 2025 predicted to be located in the Z chromosome, and (3) from the mitochondrial genome. Ultrafast bootstrap (Minh et al. 2013) was used to indicate statistical support of branches. KEY FOR THAEIDES SPECIES BASED ON MALE CHARACTERS 1 Dorsal wing surface colouration lighter blue with black apical colouration reaching the discal cell .............................................................................................................................................. 2 Dorsal wing surface colouration deeper blue with black apical colouration not reaching the discal cell .............................................................................................................................................. 3 2 Apical black colouration just reaches discal cell with larger oval-shaped scent pad more than 2 mm in length ........................................................................... Thaeides theia (Hewitson, 1875) Apical black colouration partly covers discal cell with minute oval-shaped scent pad less than 2 mm in length ............................................. Thaeides hyperion Bálint, Costa & Grishin, 2024 3 Dorsal wing surface discal cell with a larger circular-shaped scent pad more than 2,5 mm in length ................................................................................................. Thaeides ramoni Prieto, 2024 Dorsal wing surface discal cell with a smaller oval-shaped scent pad less than 2,5 mm in length ................................................. Thaeides yepezi Bálint, Grishin, Romero & Costa, n. sp. TAXONOMY Thaeides yepezi Bálint, Grishin, Romero & Costa, n. sp. (Figs 1–2, 5–8) Figures 1–2. Type specimens of Thaeides yepezi n. sp. in dorsal (above) and ventral (below) views (scale bar 10 mm): 1 = holotype male (MIZA 0105238), 2 = allotype female (MIZA 0105239) (photos by M. Costa). 1 2 A new Thaeides from Venezuela 167 Annls Mus. hist.-nat. hung. 117, 2025 Classification – Lepidoptera, Lycaenidae, Theclinae, Eumaeini, Thaeides Johnson, Kruse & Kroenlein, 1997 (type species: Thecla theia Hewitson, 1870). Generic placement – Representatives of Thaeides can be recognized by the warm-brown forewing ventral surface with dark-brown postbasal, median, postmedian, submarginal, and marginal transverse bands or lines from wing costa to inner margin. There is no similar member of the Lycaenidae with such a phenotype in the Neotropical fauna. Males have an oval-shaped scent pad (according to Faynel & Bálint 2012) in the forewing discal cell apical area. Phylogenetic analysis based on molecular sequencing results in grouping individuals of the new species within the same clade as the type species of Thaeides, indicating their sister relationship (Costa et al. 2024, fig. 14) (see “Genomic analysis” below). Type material – Holotype. Male (MIZA no. 0105238), set dorsally, in good condition (right forewing apex broken), forewing costa length 16 mm, labelled as “Rancho Grande [//] AR. Venezuela [//] 1100 m, 9. VII. 54 [//] F. Yepez Y.” (white oblong label, printed and digits handwritten). Allotype. Female (MIZA no. 0105239), set dorsally, in moderate condition (left forewing apex split, right hindwing tornus broken), forewing costa length 16 mm, labelled as “Rancho Grande [//] 1100 m, E. Aragua [//] Venezuela 2. VII. 54 [//] F. Fernández-Yépez” (white oblong label, printed and digits handwritten). Paratypes (n = 68). CAN paratype (n = 1): From Portachuelo Pass, 1120 m, 1984. VIII. 14., Neild A. (♀). CFR paratypes (n = 39), all from 1100 m, Portachuelo Pass, Rancho Grande (National Park Henri Pittier, Aragua, Venezuela), collected by F. Romero. Mounted specimens (n = 13): 1965. VI. (♂); 1967. X. (♀); 1969. VIII. (♀); 1972. VI. (♀); 1972. VII. (♂); 1975. VI. (♀); 1981. VI. (♂); 1987. VIII. (2 ♀); 1987. VIII. (♂); 1988. VIII. (1♀); 1995. VI. (♀); 2009. VI. (♀). Papered specimens (n = 26): 1967. IX. (♂, ♀); 1968. IX. (♂, 3 ♀); 1969. V. (♂, 3♀); 1969. VI. (3♂, ♀); 1969. IX. (♀); 1969. XII. (♀); 1970. VIII. (♀); 1972. VII. (♀); 1972. IX. (♀); 1975. VI. (2 ♀); 1975. IX. (2 ♂); 1982. VI. (♂); 1995. VI. (2 ♀). CMC paratypes (n = 2) ex CFR: Rancho Grande, Portachuelo Pass, 1100 m, VIII-1988 (♂); ditto (1 ♀); HNHM paratypes (n = 3): From the type locality, 1967. X., Romero F. (♀); ditto, 1995. V., Romero F. (♂) (Fig. 5); La Cumbre, 1100 m, 1992. VII., Romero F. (♀) (Fig. 6). MIZA paratypes (n = 20), from the type locality, 1000–1100 m, Portachuelo Pass, Rancho Grande: 1951. II. 25., Fernández-Yépez (♀); 1951. IX. 2., Fernández-Yépez (♀); 1952. IX. 18., Fernández-Yépez (♀); 1952. VII. 10., Fernández-Yépez (♂); 1952. VII. 12., Fernández-Yépez (2 ♂); 1952. VII. 31., Requena J. (♀); 1952. VIII. 10., Fernández-Yépez (♀); 1952. VIII. 30., FernándezYépez (♀); 1952. VIII. 31., Fernández-Yépez (♂); 1953. VI. 19., Gonzales A. J. (♂); 1970. VIII. 21., Salcedo J. & Clavijo A. J. (♀); 1971. IV. 2., Fernández-Yépez & Salcedo J. (♂); 1972. X. 3., Salcedo J. & Clavijo A. J. (♂); 1974. IX. 26., Clavijo J. (♀); 1986. VI. 19., Fernández-Yépez (♀); 1986. VI. 19., Fernández-Yépez (♀); 1986. VII. 24., Deminirles J. (♀). From Miranda state, Caracas, Quebrada Caraburi, 1000 m, 1963. IX. 27, Ayala M. (♀). NECJU paratype (n = 2): From Bálint Zs. et al. 168 Annls Mus. hist.-nat. hung. 117, 2025 the type locality, 1985. IX., Pyrcz T. (♀); ditto, 2009. VII. 15–23., Pyrcz T. leg. (♀). From Edo. Vargas, El Tigre, 1400 m, route Petaquire vers Puerto Cruz km14, 2000. X. 22., Boyer P. leg. (CPB: ♀). Diagnosis – Compared to congeners, males of Thaeides yepezi n. sp. have a deep blue, almost purple coloured dorsal wing surface (SP: ~420 nm), that is only comparable to T. ramoni Prieto, 2024 (SP: ~400 nm), whilst all the other congeners are lighter (SP: >450 nm). The female dorsal wing surface is green (SP: 560 nm) (see Costa et al. 2024, fig. 16.), whilst congeners have blue coloured females (SP: <465 nm) (Fig. 3). Thaeides yepezi n. sp. has a somewhat smaller oval-shaped scent pad in the dorsal forewing discal cell compared with the larger oval shaped T. theia scent pad, whilst the scent pad of T. hyperion is minute, and the one of T. ramoni is large and circular (see Table 1). Ventral forewing pattern with a transverse band, the widest amongst the five transversing pattern elements of the wing surface, whilst in other congeners this band is narrower (T. hyperion, T. ramoni) or equal in width with the other bands (T. annandon, T. theia, Fig. 4). Male genitalia are close to other Thaeides but T. yepezi n. sp. has the valva terminus projecting upwards (in contrast with the downturned terminus of T. theia) and a large thorn-like cornutus in the aedeagus vesica (boomerangshaped in T. theia) (Figs 5, 7). Figure 3. Normalized male reflectance spectra of Thaeides species measured on all four wing dorsal surfaces: 1 = T. theia (Colombia: Sierra Nevada de Santa Marta), 2 = T. ramoni (Colombia: Sierra Nevada de Santa Marta), 3 = ditto; 4 = T. yepezi n. sp. (Venezuela: Aragua); 5 = T. theia (Venezuela: Mérida); 6 = T. hyperion (Venezuela: Bolívar); 7 = T. theia (Ecuador); 8 = ditto (Peru) (compiled by G. Piszer and K. Kertész). A new Thaeides from Venezuela 169 Annls Mus. hist.-nat. hung. 117, 2025 Figure 4. Thaeides male specimens dorsal (left) and ventral (right) views plus androconia (in the lower side of the figure): a = T. yepezi n. sp. (Venezuela: Aragua), b = T. theia (Venezuela: Merida), c = ditto (Ecuador), d = ditto (Peru), e = ditto (Colombia: Sierra Nevada de Santa Marta), f = T. hyperion (Venezuela: Bolívar), g–h = T. ramoni (Colombia: Sierra Nevada de Santa Marta); scale bars: 10 mm (photos and composition by G. Katona). Bálint Zs. et al. 170 Annls Mus. hist.-nat. hung. 117, 2025 Table 1. Dimensions of Thaeides scent pad in mm measured on specimens shown in Figure 4. Species (figure letter) locality of the specimen length width words used in diagnosis Thaeides yepezi n. sp. (a) Venezuela, Aragua 2.0 1.8 oval-shaped, smaller Thaeides theia (b) Venezuela, Merida 2.1 1.7 oval-shaped, smaller Thaeides theia (c) Ecuador 2.5 1.7 oval-shaped, larger Thaeides theia (d) Peru 2.5 1.5 oval-shaped, larger Thaeides theia (e) Colombia, Sierra Nevada de Santa Marta 2.9 1.8 oval-shaped, larger Thaeides hyperion (f) Venezuela, Bolívar 1.7 1.0 oval-shaped, minute Thaeides ramoni (g) Colombia, Sierra Nevada de Santa Marta 2.8 2.0 circular, larger Thaeides ramoni (h) Colombia, Sierra Nevada de Santa Marta 2.8 1.8 circular, larger Barcode sequence of a topotypic paratype – Sample NVG-23032D11, GenBank*, 658 base pairs: AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATATTAGGTACATCCCT AAGAATTTTAATCCGAATAGAATTAGGAACCCCAGGATCATTAATCGGAG ATGATCAAATCTATAATACTATTGTTACAGCTCATGCTTTTATTATAATCT TTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTAC CATTAATATTAGGAGCTCCTGATATAGCATTTCCACGAATAAATAATATAA GATTTTGATTATTACCCCCTTCATTAATATTATTAATTTCAAGAAGAATTG TAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCATTATCATCT AATATCGCCCATAGAGGATCGTCAGTTGATTTAGCCATTTTTTCTTTACA TTTAGCAGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACAACTAT CATCAATATACGAGTAAATAATTTATCTTTTGATCAAATATCATTATTTAT TTGAGCTGTAGGAATTACAGCTTTATTATTATTATTATCACTTCCTGTAT TAGCTGGAGCTATTACTATATTATTAACTGATCGTAATTTAAATACCTCAT TTTTTGATCCAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT * Will be deposited after U. S. government shutdown ends and services resume. A new Thaeides from Venezuela 171 Annls Mus. hist.-nat. hung. 117, 2025 Description – Wings (Figs 1– 2): Shape: costa length measured from base to apex 15–17 mm. (n = 23); hindwing vein Cu1 terminus with tail <1 mm, vein Cu2 terminus with filamentous tail longer than 2 mm; tornal area slightly lobed. Male (Fig. 1): Dorsal wing surface: fringes dark brown; forewing ground colour deep blue (SP: 410 nm), but black in costal, apical and marginal areas; hindwing with same blue with black costa and apex, tornal lobe with orange scaling, anal fold grey. Ventral wing surface: fringes dark brown; forewing ground colour warm brown with a complicated pattern comprised of five brown coloured transverse lines or bands: (1) postbasal cell area with a short straight band, (2) median area with dark band running straight from costa narrowing progressively to inner margin, (3) postmedian area with a nebulous but wide band, fainter near costa and absent at inner margin, (4) a dark submarginal band slightly bent parallel to outer margin from costa to inner margin, and (5) a lighter antemarginal line parallel to outer margin; hindwing ground colour as in forewing but with more complicated pattern comprised of transverse bands and lines basically separated by vein Cu2 to anterior and posterior regions; anterior region with pattern similar to forewing but bands and lines running towards tornal Thecla spot; posterior region with veins Cu2, 1A and 2A covered by black scales forming thin lines supplemented by a delicate line between vein 1A and outer margin, all running from base to tornal Thecla spot; space Cu1-Cu2 in submarginal area with large orange spot, additional but less extensive submarginal orange scaling in spaces between vein Cu1 and inner margin, tornal lobe black with long fringes. Female (Fig. 2): similar to male, but wing dorsal surface ground colour light green (SP: 560 nm), hindwing antemarginal pattern more developed in both wing surfaces; ventral wing surface ground colour lighter, hindwing submarginal orange scaling more extended than in males. Body: Male and female similar. Head: vertex and frontoclypeus covered by black hair-like scales, labial palpus with middle segment black-haired in its lower part with some white scales mixed, terminal segment short and pointed, eyes large and hairy; antennal flagellum and club dorsally black with white ventral scaling in each segment, club tip reddish brown. Thorax and legs: covered with dark hair-like scales, excluding tibia and tarsus with normal scaling. Abdomen: dorsally darker blue in male and green in female, ventrally lighter cream white in both sexes. Variation: The degree of variation in wing size (measured via forewing length in both sexes) is 15–17 mm, therefore it is negligible. Dimensions of androconia and pattern elements are also stable, showing no particular variability. However, a similarly large sample for other Thaeides species is necessary for mapping the variation in other taxa. Genitalia: Male capsule high and robust with prominent saccus and vinculum equal in length without tegumenal brush organ; tegumen large with a central depression visible only in dorso-ventral aspect, posterior parts sclerotized with a pair of strong gnathi bent 180 degrees in middle and with pointed apex, Bálint Zs. et al. 178 Annls Mus. hist.-nat. hung. 117, 2025 with these a pair from the State of Panama [Volcan de Chiriqui] (both of them figured) agree very closely”. D’Abrera (1995: 1129) documented the Panama female and one of the Venezuelan specimens mentioned by Godman & Salvin. He remarked that one of the other females from Venezuela (Merida) “is purple on recto surface”, a phenomenon what has also been recorded for T. hyperion females. However, further studies are necessary to find out whether Thaeides theia and Thaeides yepezi n. sp. are sympatric in the Cordillera de Mérida, a situation similar to the Sierra Nevada de Santa Marta of Colombia, inhabited by two Thaeides species. Meanwhile, we can state that the 70 specimens of Thaeides collected to date in the Serranía del Litoral Central all belong to the new species Thaeides yepezi. Figures 12–13. The type locality of Thaeides yepezi n. sp. in Henri Pittier National Park (Rancho Grande): 12 = Portachuelo Pass, view to the north over the canopy towards the Caribbean see (photos by A. Fernández-Badillo); 13 = Zsolt Bálint at the southern entrance of Henri Pittier National Park in 2009 (photo by B. Benedek). 12 13 A new Thaeides from Venezuela 179 Annls Mus. hist.-nat. hung. 117, 2025 * Authorship contributions. Conceptualization: Zs. Bálint, M. Costa; correcting and editing: all the authors; figures: M. Costa, N. Grishin, G. Katona. G. Piszter; methodology: Zs. Bálint, M. Costa. N. Girshin, K. Kertész, G. Piszter; resources: M. Costa, A. Neild, F. Romero; writing original draft: Z. Bálint, M. Costa. All authors have read and agreed with the final version of the manuscript. Orcids. Zsolt Bálint: https://orcid.org/0000-0001-8174-878X Gergely Katona: https://orcid.org/0000-0002-3161-8060 Krisztián Kertész: https://orcid.org/0000-0001-8004-9135 Gábor Piszter: https://orcid.org/0000-0001-7155-4025 Nick Grishin: https://orcid.org/0000-0003-4108-1153 Andrew Neild: https://orcid.org/0009-0002-9514-4295 Mauro Costa: https://orcid.org/0009-00007771-3904 Acknowledgements. – We thank José Clavijo and Marco Gaiani, Jürg De Marmels, Quintín Arias (MIZA), Pierre Boyer (Le Puy Sainte Réparade, France), Jadwiga Lorenc-Brudecka (Kraków, Poland), and Conchita Romero (Maracay, Aragua, Venezuela) for their continuous support and collaboration; Charles Brewer Carías (Caracas, Venezuela) for providing detailed maps of Venezuela. NVG acknowledge the Texas Advanced Computing Center (TACC) at The University of Texas at Austin, for providing HPC resources and grants from the National Institutes of Health (GM127390) and the Welch Foundation (I-1505). REFERENCES Beebe C. W. 1949a: Insect migration at Rancho Grande in north-central Venezuela. General account. – Zoologica 34(2): 107–110, pls. 1–2, 1 fig. Beebe C. W. 1949b: Migration of Papilionidae at Rancho Grande, north-central Venezuela. – Zoologica 34(3): 119–126,1 pl., 1 fig. Beebe C. W. 1950a: Migration of Danaidae, Ithomiidae, Acraeidae and Heliconiidae (butterflies) at Rancho Grande, north-central Venezuela. – Zoologica 35(1): 57-68. Beebe C. W., 1950b: Migration of Pieridae (butterflies) through Portachuelo Pass, Rancho Grande, north-central Venezuela. – Zoologica 35(1): 189–196, 1 pl. Beebe C. W., 1951: Migration of Nymphalidae (Nymphalinae), Brassolidae, Morphidae, Libytheidae, Satyridae, Riodinidae, Lycaenidae and Hesperiidae (butterflies) through Portachuelo Pass, Rancho Grande, north-central Venezuela . – Zoologica 36(1): 1–16, 2 pls. Buchfink B., Xie C. & Huson D. H. 2015: Fast and sensitive protein alignment using DIAMOND. – Nature Methods 12: 59–60. https://doi.org/10.1038/nmeth.3176 Costa M., Viloria L. Á., Attal S., Benmesbah M, Neild A. F. E., Grishin V. N., Kertész K. & Bálint Zs., 2024: Lepidoptera from the Pantepui. Part XVI: A new species of Thaeides Johnson, Kruse & Kroenlein, 1997 (Lycaenidae: Theclinae: Eumaeini). – Annales Musei Historico-Naturalis Hungarici 116: 275-295. Bálint Zs. et al. 180 Annls Mus. hist.-nat. hung. 117, 2025 Cong Q., Shen J., Borek D., Robbins K. R., Otwinowski Z. & Grishin V. N. 2016: Complete genomes of hairstreak butterflies, their speciation, and nucleo-mitochondrial incongruence. – Scientific Reports 6(24863): 1–15. https://doi.org/10.1038/srep24863 Draudt M. 1919–1921: Familie: Lycaenidae. In: Seitz A. (Ed.): Die Gross-Schmetterlinge der Erde. Die Amerikanischen Tagfalter. – Stuttgart, Alfred Kernen Verlag, 5(281): 744–752 (24 November 1919), (281): 753–768(6 December 1919), (282): 769–776 (12 January 1920), (283): 777–800 (3 February 1920), (285): 801–808 (3 February 1920), (288): 809–816 (10 December 1920), (289): 817–824 (11 January 1921), (294): 825–831 (24 January 1921), pls. 144–159. Faynel C. & Bálint Zs. 2012: An overview of alar organs in French Guiana hairstreaks (Lepidoptera: Lycaenidae: Theclinae, Eumaeini), pp. 46–54, 35 figs. In: Lacomme D. & Manil L. (Eds.): Lépidoptères de Guyane. Tome 5. Lycaenidae. – Paris, Association des Lépidoptéristes de France, 65 pp. Godman F. C. & Salvin O. 1887–1888: Biologia Centrali-Americana. Insecta. Lepidoptera– Rhopalocera. – London, Dulau & Co., Bernard Quaritch, 2(58): 1–32, pls. 48–50 (May 1887), (59): 33–48, pl. 51 (June 1887), (60): 49–64, pl. 52 (August 1887), (61): 65–96, pl. 53 (September 1887), (62): 97–104, pl. 54 (October 1887), pl. 55 (November 1887), (64): 105–112, pl. 56 (December 1887), (65): pl. 57 (January 1888), (66): pl. 58 (February 1888). Kawahara Y. A., Storer C., Carvalho S. P. A., et al., Lohman J. D. 2023: A global phylogeny of butterflies reveals their evolutionary history, ancestral hosts and biogeographic origins. – Nature Ecology & Evolution 7: 903–913. https://doi.org/10.1038/s41559-023-02041-9 Lamas G., McInnis L. M., Busby C. R. & Robbins K. R. 2021: The lycaenid fauna (Lepidoptera) of Cosñipata, Peru: annotated checklist, elevational patterns, and rarity. – Insecta Mundi 861: 1–34, 4 figs., 4 tabs. Li W., Cong Q., Shen J., Zhang J., Hallwachs W., Janzen D. H. & Grishin N. V. 2019: Genomes of skipper butterflies reveal extensive convergence of wing patterns. – Proceedings of the National Academy of Sciences of the United States of America 116(13): 6232–6237. https://doi.org/10.1073/pnas.1821304116 Miller D. L. 1970: Nomenclature of wing veins and cells. – Journal of Research on the Lepidoptera 8: 37–48. https://doi.org/10.5962/p.333547 Minh B. Q., Nguyen A. M. & von Haeseler A. 2013: Ultrafast approximation for phylogenetic bootstrap. – Molecular Biology and Evolution 30(5): 1188–1195. https://doi.org/10.1093/molbev/mst024 Neild A. F. E. & Bálint Zs. 2014: Notes on the identity of Evenus coronata (Hewitson, 1865) (Lepidoptera: Lycaenidae: Theclinae: Eumaeini) with the description of a remarkable overlooked sibling species. – Tropical Lepidoptera Research 24(2): 105–120, 15 figs., 3 tabs. Nguyen L. T., Schmidt H. A., von Haeseler A. & Minh Q. B. 2015: IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. – Molecular Biology and Evolution 32(1): 268–274. https://doi.org/10.1093/molbev/msu300 Prieto H. C., Pinilla C., Lorenc-Brudecka J. & Balke M. 2024: Integrative description of Thaeides ramoni sp. nov. (Lepidoptera: Lycaenidae), a sympatric sibling species of Thaeides theia (Hewitson, 1870) found in the Sierra Nevada de Santa Marta, Colombia. – Zootaxa 5501(1): 181–190, 13 figs., 1 tab. A new Thaeides from Venezuela 181 Annls Mus. hist.-nat. hung. 117, 2025 Viloria L. A., Adamas J. M., Pyrcz T. W. & Romero F. 2001: Noticia histórica sobre satíridos venezolanos coleccionados por Karl Moritz (1797-1866) y discusión de la identidad taxonómica y la distribución de Pedaliodes pisonia (Hewitson, 1862) (Lepidoptera: Nymphalidae, Satyrinae). – SHILAP Revista lepidopterología 29(113): 31– 42. Zhang J., Cong Q., Shen J., Brockmann E. & Grishin N. V. 2019: Genomes reveal drastic and recurrent phenotypic divergence in firetip skipper butterflies (Hesperiidae: Pyrrhopyginae). – Proceedings of the Royal Society B: Biological Sciences 286(1903): 20190609. https://doi.org/10.1098/rspb.2019.0609 ∙ A Thaeides theia (Hewitson, 1870) új testvérfaja Venezuela tengerparti Karibi-hegységéből (Lepidoptera: Lycaenidae: Theclinae) Bálint Zsolt1,2,*, Katona Gergely1, Kertész Krisztián2, Piszter Gábor2, Nick Grishin3, Andrew F. E. Neild4, Francisco Romero5 & Mauro Costa6 1Magyar Nemzeti Múzeum Közgyűjteményi Központ – Magyar Természettudományi Múzeum, Állattár, 1088, Baross utca 13, Magyarorzág. E-mails: [email protected]; [email protected] 2HUN-REN, Energiatudományi Kutatóközpont, Műszaki Fizikai és Anyagtudományi Intézet, Nanoszerkezetek Osztály, 1121 Budapest, Konkoly-Thege Miklós út 29–33, Magyarorzág. E-mails:[email protected]; [email protected]; [email protected] 3Howard Hughes Medical Institute, Departments of Biophysics and Biochemistry, University of Texas. Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75390-9050, USA. E-mail: gri[email protected]ed.edu 4külső munkatárs, McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, PO Box 112710, Gainesville, FL 32611-2710, USA. E-mail: [email protected] 5Urbanización Las Acacias, Vereda 12, N° 13, Maracay, Edo. Aragua, Venezuela. 6Museo del Instituto de Zoología Agrícola, Universidad Central de Venezuela, Maracay, Venezuela. E-mail: [email protected] Összefoglalás – Egy Pillangóalakú (Papilionoidea) lepkefaj leírása 70 típuspéldány alapján, melyeket a Portachuelo-hágón (Rancho Grande, Henri Pittier Nemzeti Park, Aragua, Venezuela) gyűjtöttek: Thaeides yepezi Bálint, Grishin, Romero és Costa, n. sp. (Lycaenidae: Theclinae: Eumaeini). Az új faj leírása mellett annak típuslelőhelyét, a hímek szárnyfelszínének színezetét és a történeti adatokat röviden ismertetjük vagy elemezzük. 13 ábrával és egy táblázattal. * Levelező szerző. Bálint Zs. et al. 182 Annls Mus. hist.-nat. hung. 117, 2025 Kulcsszavak – Androconia, Cordillera de la Costa , Francisco Fernández Yépez, Portachuelohágó, Serranía del Litoral Central, spektrális jellemzők. ÁBRA ÉS TÁBLAMAGYARÁZATOK 1–2. ábra. A Thaeides yepezi n. sp. típuspéldányai felülés alulnézetben (méretléc: 10 mm): 1 = holotípus hím (MIZA 0105238), 2 = allotípus nőstény (MIZA 0105239) (fotók: M. Costa). 3. ábra. Thaeides fajok normalizált hím spektrumai mind a négy szárny felszínén mérve: 1 = T. theia (Kolumbia: Sierra Nevada de Santa Marta); 2 = T. ramoni (Kolumbia: Sierra Nevada de Santa Marta); 3 = ugyanaz; 4 = T. yepezi n. sp. (Venezuela: Aragua); 5 = T. theia (Venezuela: Mérida); 6 = T. hyperion (Venezuela: Bolívar); 7 = T. theia (Ecuador); 8 = ugyanaz (Peru) (összeállította: Piszer G. és Kertész K.). 4. ábra. Thaeides hím példányok felülés alulnézeti képei, plusz illatpikkelyfolt (az ábra alsó részén): a = T. yepezi n. sp. (Venezuela: Aragua), b = T. theia (Venezuela: Merida), c = ugyanaz (Ecuador), d = ugyanaz (Peru), e = ugyanaz (Kolumbia: Sierra Nevada de Santa Marta), f = T. hyperion (Venezuela: Bolívar), g–h = T. ramoni (Kolumbia: Sierra Nevada); méretléc: 10 mm (fotók és kompozíció: Katona G.). 5–7. ábra. Thaeides ivarszervek oldal- (balra) és alulnézetből (jobbra): 5 = T. yepezi n. sp. HNHM paratípus hím; 6 = ugyanaz, HNHM paratípusú nőstény; 7 = T. theia NECJU hím (Venezuela: Merida); méretléc: 1 mm (fotók: Bálint Zs. (5–6. ábra) és J. Lorenc-Brudecka (7. ábra); a táblát Katona G. állította össze). 8. ábra. Észak-Venezuela fő hegyvonulatait és azok egymástól való elszigeteltségét bemutató fizikai térkép; a piros pont a Henri Pittier Nemzeti Parkot (Rancho Grande) jelöli, a Thaeides yepezi n. sp. típuslelőhelyét (térkép: C. Brewer Carías és M. Costa). 9. ábra. Dr. Francisco Fernández-Yépez gyűjt a Portachuelo-hágónál 1986-ban (fotó: A. Fernández-Badillo). 10. ábra Thaeides fajok hím példányainak elülső szárny felszínén mért normalizált spektrumok: 1 = T. theia (Kolumbia: Sierra Nevada de Santa Marta); 2 = T. ramoni (Kolumbia: Sierra Nevada de Santa Marta); 3 = ugyanaz; 4 = T. yepezi n. sp. (Venezuela: Aragua); 5 = T. theia (Venezuela: Mérida); 6 = T. hyperion (Venezuela: Bolívar); 7 = T. theia (Ecuador); 8 = ugyanaz (Peru) (összeállította: Piszer G. és Kertész K.). 11. ábra. A Thaeides filogenetikai fái és fehérjéket kódoló régiókból következtetett külcsoportok: a = a nukleáris genom (autoszómák, 4 647 810 pozíció), b = a Z kromoszóma (213 555 pozíció, túl kevés pozíciót szekvenáltak az NVG-23032D12-ben ahhoz, hogy ebbe a fába beletartozzon), c = a mitokondriális genom. A SAMN18673399 szekvenciája Kawahara és munkatársai (2023) által megadott illesztésből származik. Minden példány esetében a faj nevét a DNS-minta száma (NVG-előtag nélkül), a típusstátusz (ha releváns: HT = holotípus; PT = paratípus), az általános lelőhely és a gyűjtés éve (ha ismert) egészíti ki (összeállította: N. Grishin). 12-13. ábra. A Thaeides yepezi n. sp. típuslelőhelye a Henri Pittier Nemzeti Parkban (Rancho Grande): 12 = Portachuelo-hágó, kilátás északi irányba a lombkorona felett a Karib-tenger felé; 13 = Bálint Zsolt a Henri Pittier Nemzeti Park déli bejáratánál 2009-ben (fotó A. FernándezBadillo: 12. ábra, B. Benedek: 13. ábra). 1. táblázat. A Thaeides illatpikkelyfolt méretei mm-ben, a 4. ábrán látható mintákon mérve.