Phylogenetic Relationships and Taxonomic Position of the Ribbon Worms of the Genus Parahubrechtia (Nemertea, Palaeonemertea) with Descriptions of Two New Species

© 2022 Academia Sinica, Taiwan Open Access Phylogenetic Relationships and Taxonomic Position of the Ribbon Worms of the Genus Parahubrechtia (Nemertea, Palaeonemertea) with Descriptions of Two New Species Alexei V. Chernyshev1,* , Neonila E. Polyakova1, and Shi-Chun Sun2 1A.V. Zhirmunsky National Scientific Center of Marine Biology, Far Eastern Branch, Russian Academy of Sciences, Palchevskogo Street 17, Vladivostok 690041, Russia. *Correspondence: E-mail: [email protected] (Chernyshev). E-mail: [email protected] (Polyakova) 2Institute of Evolution & Marine Biodiversity, Ocean University of China, 5 Yushan Road, Qingdao 266003, China. E-mail: [email protected] (Sun) Received 1 May 2021 / Accepted 13 May 2022 / Published 15 August 2022 Communicated by Benny K.K. Chan The genus Parahubrechtia Gibson and Sundberg, 1999 was first described within the family Hubrechtiidae (class Pilidiophora) and subsequently transferred to the family Callineridae (class Palaeonemertea). Here we describe two new species, Parahubrechtia rayi sp. nov. from the Sea of Japan (Russia) and P. peri sp. nov. from the South China Sea (China). A phylogenetic analysis based on partial sequences of five nuclear and mitochondrial gene regions, 18S rRNA, 28S rRNA, histone H3, 16S rRNA, and COI, has confirmed the monophyly of the genus Parahubrechtia, and indicated a close relationship to Callinera Bergendal, 1900, whose monophyly is not confirmed. Both genera belong to the family Tubulanidae, with its junior synonym being Callineridae. Three major subclades are distinguished within the Tubulanidae: subclade Tubulanus s. str., subclade Tubulanus punctatus, and subclade Parahubrechtia + Callinera. The further status of Parahubrechtia depends on whether the paraphyly of Callinera is confirmed or not and how the problem of paraphyly of the genus Tubulanus Renier, 1804 is resolved. Key words: Nemerteans, Callinera, Tubulanidae, cLSM, Phylogenetic analysis, Larva. BACKGROUND Nemerteans, or ribbon worms, are mostly marine, unsegmented, vermiform spiralians characterized by the unique, eversible proboscis located in a coelomlike chamber referred to as rhynchocoel. The phylum Nemertea, comprised of about 1340 species (Gibson 1995; Kajihara et al. 2008; Chernyshev 2021), is currently divided into three classes, Palaeonemertea, Pilidiophora, and Hoplonemertea (Strand et al. 2019). All pilidioporans and most hoplonemerteans have a pair of sensory cerebral organs connected with the brain. Among palaeonemerteans, the cerebral organs are absent in all species of the families Carinomidae Bürger, 1892, Cephalotrichidae McIntosh, 1873–1874, and Cephalotrichellidae Chernyshev, 2011, whereas in the family Tubulanidae Bürger, 1904 these organs are found only in the genus Tubulanus Renier, 1804. Parahubrechtia Gibson and Sundberg, 1999 is a tubulanid genus whose members lack the cerebral organs but have the epidermal lateral organs. These two traits are characteristic of species of the other two palaeonemertean genera, Callinera Bergendal, 1900 and Carinomella Coe, 1905, but both genera were originally attributed to palaeonemerteans, whereas Parahubrechtia was described as a genus of the family Hubrechtiidae Bürger, 1892 (Gibson and Sundberg 1999) from the class Pilidiophora (Thollesson and Norenburg 2003). Citatio: Chernyshev AV, Polyakova NE, Sun SC. 2022. Phylogenetic relationships and taxonomic position of the ribbon worms of the genus Parahubrechtia (Nemertea, Palaeonemertea) with descriptions of two new species. Zool Stud 61:38. doi:10.6620/ZS.2022.61-38. Zoological Studies 61:38 (2022) doi:10.6620/ZS.2022.61-38 1 © 2022 Academia Sinica, Taiwan The reason was a cladistic analysis based on 50 characters, which showed that the yet undescribed species HK sp.2 (= Parahubrechtia jillae Gibson and Sundberg, 1999) was a sister clade to the genera Hubrechtella Bergendal, 1902 and Tetramys Iwata, 1957, and Tubulanus lucidus Iwata, 1952 (Sundberg and Hylbom 1994). If the morphology of T. lucidus indicates that it belongs to the genus Hubrechtella, then P. jillae is more similar, in some characters, to palaeonemerteans of the genera Callinera and Carinesta Punnett, 1900 (Chernyshev 2002), which allowed placing the Parahubrechtia in the family Callineridae subsequently (Chernyshev 2011; Norenburg et al. 2022). A molecular phylogenetic analysis has confirmed that two species of Parahubrechtia, P. kvisti Chernyshev, 2016 and Parahubrechtia sp., are indeed closely related to Callinera (Kvist et al. 2015; Chernyshev and Polyakova 2019; Hookabe et al. 2020), but the status of both genera has not been discussed. In the present report, we describe two new species of Parahubrechtia and discuss the phylogenetic position of this genus within the Palaeonemertea on the basis of partial sequences of five nuclear and mitochondrial gene regions (18S rRNA, 28S rRNA, histone 3, 16S rRNA, and cytochrome c oxidase subunit I). Also, we address some taxonomic issues related to the family Tubulanidae, the largest and taxonomically most complex family in the class Palaeonemertea. MATERIALS AND METHODS Specimen collection and morphological observation Samples were collected from two localities: Peter the Great Bay, Sea of Japan (Russia) and Beihai, Guanxi Province, South China Sea (China) (see below for detailed collecting information). Live specimens of Parahubrechtia rayi sp. nov. were collected by dredge from depths 3–4 m and examined under a stereo microscope (Leica MZ 12.5) equipped with a camera (Leica DFC 290). Adults of Parahubrechtia peri sp. nov. were collected by digging muddy sand at the intertidal zone. Live specimens of P. peri sp. nov. were examined and photographed under a stereo microscope (Nikon SMZ800) equipped with a camera (Nikon DSL1) or a microscope (Nikon E600) equipped with a camera (Olympus DP72). Specimens for histological studies were anesthetised in a MgCl2 solution isotonic to seawater, fixed in Bouin’s fluid or 10% formalin for 72 h, and transferred to 70% EtOH through an ethanol series of increasing concentrations. Molecular materials (complete worms or the posterior region of some worms) were preserved in 95% ethanol, and kept at -20°C until DNA extraction. Serial paraffin sections 5–6 µm thick were stained by the Mallory’s trichrome method. The sections were photographed with an AxioCam Icc1 digital camera attached to a Zeiss Discovery V12 stereomicroscope, or with an AxioCam HR3 digital camera attached to a Zeiss Imager Z2 compound microscope. For confocal laser scanning microscopy (cLSM) studies, pieces of body and proboscis of P. ray sp. nov. were fixed for 4 h at room temperature (RT) with a 4% paraformaldehyde solution in phosphate-buffered saline (PBS), rinsed thrice in PBS (0.1 M), and stained for 2–8 h at RT with phalloidinAlexa Fluor 633 (Invitrogen) at 1 U per 100 mL of 1% Triton X-100 in PBS with 1 mg mL-1 DAPI (Invitrogen). To examine the serotonergic nervous system, pieces of the body tissues were transferred to a solution of antiserotonin primary antibody (5-HT, polyclonal, rabbit, diluted 1 : 2000, Immunostar, USA) in PBS with 1% bovine serum albumin (BSA, Immunostar, USA). The pieces were washed in PBS, immersed in Mowiol 4–88 (Aldrich), and mounted on glass slides. The specimens were examined under a LSM-780 confocal microscope (Carl Zeiss, Germany). The obtained image series was analyzed using the CLSM-780 software. Type specimens are deposited at the Museum of the A. V. Zhirmunsky National Scientific Center of Marine Biology FEB RAS, Vladivostok, Russia (MIMB) (see species descriptions). Abbreviations for descriptions are as follows: E, epidermis; D, dermis; DM, diagonal musculature; ICM, inner circular musculature; LM, longitudinal musculature; OCM, outer circular musculature. DNA extraction, PCR amplification, and sequencing The new sequences (Table 1), except sequences of P. peri, were obtained at the Laboratory of Genetics, A.V. Zhirmunsky National Scientific Center of Marine Biology FEB RAS. Total genomic DNA was extracted from the ethanol-preserved specimens using the DNAsorb-B-100 Blood Kit (CMD) and DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s protocol. Five markers of partial nuclear 18S rRNA, 28S rRNA, histone H3, mitochondrial 16S rRNA and cytochrome c oxidase subunit I (COI) sequences were amplified from the genomic DNA. Polymerase chain reaction (PCR) was carried out using the primers listed in table 1. PCR cycling profiles were as follows: COI – 2 min at 95°C, followed by 40 cycles of 40 s at 95°C, 40 s at 50°C, and 1 min at 72°C, and finally 7 min at 72°C; 16S – 2 min at 94°C, 35 cycles with 40 s at 94°C, 40 s at 48°C, and 1 min at 72°C, and finally 7 min at page 2 of 17Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan 72°C; 18S – 2 min at 94°C, 40 cycles with 1 min at 94°C, 1 min at 52°C, and 1 min at 72°C, and finally 7 min at 72°C (for primer pairs Tim A – 1100R and 3F-18Sbi), and 50°C (for primer pair 18Sa2.0 – 9R); 28S – 2 min at 94°C, 40 cycles with 40 s at 94°C, 40 s at 52°C, and 1 min at 72°C, and finally 7 min at 72°C; Histone H3 – 2 min at 94°C, 35 cycles of 40 s at 94°C, 40 s at 55°C, and 1 min at 72°C, and finally 7 min at 72°C. The amplified products were purified using ExoSAP (Fermentas, Lithuania). Sequencing in forward and reverse directions was carried out on an ABI Prism 3500 Genetic Analyzer (Applied Biosystems) under conditions recommended by the manufacturer, using a BigDye Terminator Cycle Sequencing Kit (ver. 3.1, Applied Biosystems, Foster City, CA, USA) and the same primers as for PCR. The sequences for P. peri were obtained at the Institute of Evolution and Marine Biodiversity, Ocean University of China. Total genomic DNA was extracted from the ethanol-preserved specimens using the MicroElute Genomic DNA Kit (Omega) according to the manufacturer’s protocol. PCR primers for 18S were EukF and SR7, those for COI, 16S and 28S were the same as aforementioned (Table 1). PCR cycling profiles were as follows: COI – 5 min at 94°C, followed by 35 cycles of 30 s at 94°C, 30 s at 52°C, and 1 min at 72°C, and finally 3 min at 72°C; 16S – 5 min at 94°C, 35 cycles with 30 s at 94°C, 30 s at 48°C, and 1 min at 72°C, and finally 3 min at 72°C; 18S – 5 min at 94°C, 35 cycles with 30 s at 94°C, 30 s at 52°C, and 1 min at 72°C, and finally 3 min at 72°C; Histone H3 – 5 min at 94°C, 35 cycles of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C, and finally 3 min at 72°C. Purification and sequencing (forward and reverse directions using the same primers as for PCR) were carried out at BGI (Shenzhen, China). All the new sequences were submitted to GenBank (accession numbers are listed in the Table 2). The sequences for all five markers were aligned using MAFFT ver. 7 (Katoh and Standley 2013) with default parameters. Ambiguous positions and gaps were discarded from the subsequent analysis using GBlocks (Castresana 2000), which resulted in a final dataset of 16S (453 bp), 18S (1699 bp), 28S (499 bp), COI (657 bp), and H3 (329 bp). A supermatrix was formed by concatenating the five markers (16S, COI, 18S, 28S, and histone H3) using SequenceMatrix (Vaidya et al. 2011), wherein the external gaps were coded as ‘missing data’ (Table 3). The simultaneous selection of the partition schemes, as well as the search for the optimal nucleotide substitution models for the supermatrix were carried out using PartitionFinder (Lanfear et al. 2012 2014) with implementation of the ‘greedy’ search scheme. Accordingly, the final supermatrix was divided into seven character sets (Table 3). The newly generated dataset (five species from three families) was combined with previously published partial sequences of 16S, 18S, 28S, COI, and H3 for 31–33 nemertean species from 10–11 families. Six out-group species of the genera Cephalothrix Oersted, 1843, Cephalotrichella Wijnhoff, 1913, and Balionemertes Sundberg, Gibson and Olson, 2003 were included in the phylogenetic analysis. A combined analysis based on the five concatenated genes was conducted using Bayesian inference (BI) and maximum likelihood (ML) analyses. BI analyses Table 1. List of primers used in the present study. Forward primer sequences are denoted in bold font Target locus Primer name Primer sequence 5′–3′ References 16S RNA ar-L br-H CGCCTGTTTATCAAAAACAT CCGGTCTGAACTCAGATCACGT Palumbi et al. 1991 Palumbi et al. 1991 COI LCO1490 HCO2198 GGTCAACAAAATCATAAAGATATTGG TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. 1994 Folmer et al. 1994 28S RNA LSU5 LSU3 ACCCGCTGAATTTAAGCAT TCCTGAGGGAAACTTCGG Littlewood 1994 Littlewood 1994 18S RNA Tim A 1100R 3F 18Sbi 18Sa2.0 9R EukF SR7 AMCTGGTTGATCCTGCCAG GATCGTCTTCGAACCTCTG GTTCGATTCCGGAGAGGGA GAGTCTCGTTCGTTATCGGA ATGGTTGCAAAGCTGAAAC GATCCTTCCGCAGGTTCACCTAC AACCTGGTTGATCCTGCCAGT GTTCAACTACGAGCTTTTTAA Noren and Jondelius 1999 Noren and Jondelius 1999 Giribet et al. 1996 Whiting et al. 1997 Whiting et al. 1997 Giribet et al. 1996 Sands et al. 2008 Vilgalys and Sun 1994 H3 aF aR ATGGCTCGTACCAAGCAGAC ATATCCTTRGGCATRATRGTGAC Colgan et al. 1998 Colgan et al. 1998 page 3 of 17Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan Table 2. List of species included in the phylogenetic analysis with GenBank accession numbers for sequences (sequences new to this study in bold) Species Locality 16S 18S Callinera grandis Sweden, Skagerak JF277570 JF293067 Callinera kasyanovi Russia, PGB, SJ KP270840 KP270790 Callinera sp. 7 Vostok Russia, PGB, SJ - MZ744957 Callinera sp. 17 Alaska USA, AK MZ744983 MZ744958 Callinera sp. IZ 45635 Russia, PGB, SJ KP270839 KP270789 Carinina plecta Japan -EU495307 Parahubrechtia kvisti IZ-45633 Vietnam, Nam Zu Is. KP270848 KP270798 Parahubrechtia peri A10 China, SCS, Beihai MZ744984 MZ744959 Parahubrechtia peri A15 China, SCS, Beihai MZ744985 MZ744960 Parahubrechtia peri A16 China, SCS, Beihai MZ744986 - Parahubrechtia rayi Russia, SJ, PGB, ZR MZ744987 MZ744961 Parahubrechtia rayi 29 Vostok Russia, SJ, PGB, VB - MZ744962 Parahubrechtia rayi IZ 45554 = Tubulanidae sp. IZ45554 Russia, SJ, PGB, VB KP270844 KP270794 Parahubrechtia rayi MS 2008 Russia, SJ, PGB, VB - EU495309 Tubulanidae sp.14DS Russia, between KKT and Kuril Is. MF512038 MF512063 Tubulanidae sp. 33DS Russia, SO MF512040 MF512065 Tubulanidae sp. 33Q California USA, CA MZ744988 MZ744963 Tubulanidae sp. IZ 45557 Abyssal plain adjacent to KKT KP270846 KP270796 Tubulanidae sp. Kurambio2 17 Russia, KKT MN211470 MN211371 Tubulanidae KuramBio2 77/1 Russia, KKT MN211469 MN211369 Tubulanidae KuramBio2 77/4 Russia, KKT - MN211370 Tubulanidae KuramBio2 90 Russia, KKT MN211471 MN211372 Tubulanidae Vema3 Vema Fracture Zone - - Tubulanidae Vema4 Vema Fracture Zone KY296889 MF512060 Tubulanidae Vema6 Vema Fracture Zone KY296890 MF512061 Tubulanus annulatus Sweden, Skagerak JF277599 JF293060 Tubulanus cf. ezoensis Russia, SO, Yerineyskaya Guba MZ744989 MZ744964 Tubulanus ezoensis Russia, SO, Iturup Is. MZ744990 MZ744965 Tubulanus izuensis Japan, Suruga Bay MT809229 MT809204 Tubulanus pellucidus USA, NC JF277595 JF293062 Tubulanus polymorphus USA, San Juan Is. JF277598 JF293061 Tubulanus punctatus Japan, Akkeshi Bay JF277597 JF293063 Tubulanus punctatus 3 Vostok Russia, SJ, PGB, VB MZ744991 MZ744966 Tubulanus rhabdotus USA, FL AJ436839 - Tubulanus riceae Panama, CS MZ744992 MZ744967 Tubulanus sexlineatus USA, Seattle JF277596 JF293064 Tubulanus sp. B Sakhalin Russia, SO, Sakhalin Is. (depth 475-484 m) MZ744993 MZ744968 Tubulanus sp. D Antarctica Antarctica, Prydz Bay MZ744994 MZ744969 Tubulanus sp. E Antarctica Antarctica, Mawson cape (depth 495 m) - MZ744970 Tubulanus sp. IZ 45552 Russia, SJ, PGB, VB KP270843 KP270793 Tubulanus sp. IZ 45559 Russia, SO, Iturup Is. KP270847 KP270797 Tubulanus tamias Japan, Tomioka Bay LC042091 LC042092 Balionemertes australiensis USA, Guam - MK309617 Cephalothrix bipunctata Spain KF935447 KF935279 Cephalotrichella echinicola Vietnam MK309618 MK309614 Cephalothrix filiformis Germany JF277593 JF293053 Cephalothrix hongkongiensis China JF277591 JF293057 Cephalothrix iwatai IZ 45650 Russia, SJ, Gamov Canyon KP270850 KP270800 page 4 of 17Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan Species 28S COI H3 References Callinera grandis - HQ848626 JF277709 Andrade et al. 2012 Callinera kasyanovi KP270816 KP270865 - Kvist et al. 2015 Callinera sp. 7 Vostok MZ744977 MZ772874 MZ772887 Present paper Callinera sp. 17 Alaska MZ744978 - MZ772888 Present paper Callinera sp. IZ 45635 KP270815 KP270864 - Kvist et al. 2015 Carinina plecta - EU489493 - Sundberg et al. 2009 Parahubrechtia kvisti IZ-45633 - KP270871 - Kvist et al. 2015 Parahubrechtia peri A10 - MZ772875 MZ772889 Present paper Parahubrechtia peri A15 - MZ772876 MZ772890 Present paper Parahubrechtia peri A16 - MZ772877 MZ772891 Present paper Parahubrechtia rayi - MZ772878 MZ772892 Present paper Parahubrechtia rayi 29 Vostok - MZ772879 MZ772893 Present paper Parahubrechtia rayi IZ 45554 = Tubulanidae sp. IZ45554 KP270820 KP270869 MN205445* Kvist et al. 2015; *Chernyshev and Polyakova 2019 Parahubrechtia rayi MS 2008 - EU489499 - Sundberg et al. 2009 Tubulanidae sp.14DS MF512089 MF512113 MF512132 Chernyshev and Polyakova 2018a Tubulanidae sp. 33DS MF512091 MF512115 MF512133 Chernyshev and Polyakova 2018a Tubulanidae sp. 33Q California MZ744979 - MZ772894 Present paper Tubulanidae sp. IZ 45557 KP270822 - - Kvist et al. 2015 Tubulanidae sp. Kurambio2 17 MN211424 MN205495 MN205443 Chernyshev and Polyakova 2019 Tubulanidae KuramBio2 77/1 MN211422 MN205494 MN205442 Chernyshev and Polyakova 2019 Tubulanidae KuramBio2 77/4 MN211423 - MN205443 Chernyshev and Polyakova 2019 Tubulanidae KuramBio2 90 MN211425 - MN205446 Chernyshev and Polyakova 2019 Tubulanidae Vema3 KY296899 KY296908 KY296917 Chernyshev and Polyakova 2018b Tubulanidae Vema4 KY296900 KY296909 KY296918 Chernyshev and Polyakova 2018b Tubulanidae Vema6 KY296902 KY296911 KY296920 Chernyshev and Polyakova 2018b Tubulanus annulatus HQ856901 HQ848622 JF277717 Andrade et al. 2012 Tubulanus cf. ezoensis - MZ772880 MZ772895 Present paper Tubulanus ezoensis MZ744980 MZ772881 MZ772896 Present paper Tubulanus izuensis - MT811763 LC581475 Hookabe et al., 2020 Tubulanus pellucidus HQ856900 HQ848625 JF277708 Andrade et al. 2012 Tubulanus polymorphus HQ856899 HQ848621 JF277716 Andrade et al. 2012 Tubulanus punctatus HQ856894 HQ848624 JF277748 Andrade et al. 2012 Tubulanus punctatus 3 Vostok - MZ772882 MZ772897 Present paper Tubulanus rhabdotus AJ436894 AJ436948 AJ436990 Thollesson and Norenburg 2003 Tubulanus riceae -MZ772883 MZ772898 Present paper Tubulanus sexlineatus HQ856895 JF277747 HQ848623 Andrade et al. 2012 Tubulanus sp. B Sakhalin - MZ772884 MZ772899 Present paper Tubulanus sp. D Antarctica MZ744981 MZ772885 MZ772900 Present paper Tubulanus sp. E Antarctica MZ744982 MZ772886 MZ772901 Present paper Tubulanus sp. IZ 45552 KP270819 KP270868 MZ772902* Kvist et al. 2015; *Present paper Tubulanus sp. IZ 45559 KP270823 KP270870 - Kvist et al. 2015 Tubulanus tamias AB854624 LC042093 LC042094 Kajihara et al. 2015 Balionemertes australiensis MK309624 MK307892 MK309328 Chernyshev et al. 2019 Cephalothrix bipunctata KF935335 KF935501 KF935391 Kvist et al. 2014 Cephalotrichella echinicola MK309621 MK307889 MK309325 Chernyshev et al. 2019 Cephalothrix filiformis HQ856843 HQ848617 JF277742 Andrade et al. 2012 Cephalothrix hongkongiensis HQ856839 HQ848614 JF277739 Andrade et al. 2012 Cephalothrix iwatai IZ 45650 KP270825 KP270873 MW328562 Kvist et al. 2015 Abbreviations: CS, Caribbean Sea; KKT, Kuril-Kamchatka Trench; PGB, Peter the Great Bay; SCS, South China Sea; SJ, Sea of Japan; SO, Sea of Okhotsk; VB, Vostok Bay; ZR, Zolotoy Rog Bay. Table 2. (Continued) page 5 of 17Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan were carried out in MrBayes (ver. 3.2, see http://www. mrbayes.net/; Ronquist et al. 2012), launching two parallel runs with four Markov chains in each run (three cold and one hot) during 2,500,000 generations. The values of run convergence indicated that a sufficient number of trees and parameters were sampled (Table 3). Based on the convergence of likelihood scores, 25% of sampled trees were discarded as burn-in. The rest was used to build the consensus tree while the nodes with posterior probabilities less than 0.5 were collapsed. The maximum-likelihood phylogenetic tree was inferred using the edge-linked partition model on the IQ-TREE web server (Nguyen et al. 2015); branch supports with the 1,000 ultrafast bootstrap replicates were obtained in the IQ-TREE software (Minh et al. 2013). RESULTS SYSTEMATICS Class Palaeonemertea Hubrecht, 1879 Family Tubulanidae Bürger, 1904 Genus Parahubrechtia Gibson and Sundberg, 1999 Diagnosis (modified from Gibson and Sundberg 1999): Body encircled with thin transverse ‘tubulanid ring’, lateral organs present. Body wall musculature composed of outer circular, diagonal, longitudinal, and inner circular layers. Rhynchocoel without muscle sac; rhynchocoel wall with two muscle layers, but inner longitudinal musculature can be reduced. Proboscis with outer circular, diagonal, longitudinal and inner (endothelial) circular muscle layers; two proboscis nerves present; special armament in middle region absent; pseudocnidae present. Cerebral sensory organs absent. Brain and lateral nerve cords located between epidermal basement membrane and body wall outer circular muscles; nervous system lacks neurochords and neurochord cells; buccal nerves paired; cephalic region with subepidermal nerve layer but without rhynchodaeum nerves. Frontal glands and apical organ absent. Intestine without lateral diverticula. Blood vascular system simple, without mid-dorsal and rhynchocoel vessels; pair of cephalic lacunae present; lateral vessels run internal to ICM in foregut region and external to ICM in intestine region. Excretory system simple, anteriorly penetrating lateral blood vessels. Dioecious. Remarks: All species of the genus Parahubrechtia, including the two described in this report, have a very similar internal structure. Although no sequences have been obtained for the type species, P. jillae, we have no doubt that this species, P. kvisti Chernyshev, 2016, P. rayi sp. nov., and P. peri sp. nov. belong to a single genus. P. jillae and P. kvisti show particularly high similarity in their internal morphology. Parahubrechtia rayi sp. nov. (Figs. 1–5) urn:lsid:zoobank.org:act:AA3E9B9D-CCC5-482E-ADBB1D35E6B9E7AE Syn.: Parahubrechtia sp. IZ-45554 – Kvist et al. 2015; Parahubrechtia sp. – Chernyshev 2015; Magarlamov et al. 2021; Yurchenko et al. 2021. Material examined: Holotype (MIMB 41337), 3 August, 2009, Sea of Japan, Peter the Great Bay, Vostok Bay (42°54'36"N, 132°43'42"E), depth 5–6 m, mud, collected by A.V. Chernyshev; paratype (MIMB 41338), collected along with holotype; paratype (MIMB 41339), 22 September, 2000, Sea of Japan, Peter the Great Bay, Vostok Bay, depth 4–5 m, mud, collected by A.V. Chernyshev; paratype (MIMB 41340), 26 July, 2020, Sea of Japan, Peter the Great Bay, Vostok Bay, depth 5–6 m, mud, collected by A.V. Chernyshev. Other material examined: 10 specimens (MIMB), collected in Vostok Bay and Zolotoy Rog Bay of Peter the Great Bay. Table 3. The main parameters of model-based inferred phylogeny Data set Charset Optimal model ASDaHarmonic mean min ESSbPSRFc charset 1 16S GTR+I+G 0.004360 -33229.36 1053.21 1.000 charset 2 18S GTR+I+G charset 3 28S, H3_1dGTR+I+G Supermatrix charset 4 COI_1dGTR+I+G charset 5 COI_2d, H3_2dGTR+I+G charset 6 COI_3dGTR+G charset 7 H3_3dGTR+I+G aAverage standard deviation of split frequencies. bEstimated Sample Size. cPotential Scale Reduction Factor. dCodon position. page 6 of 17Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan Description: External morphology of live specimens: Live worms 10–40 mm long and 0.5–1 mm wide. Body cylindrical in foregut region, slightly flattened in posterior half. Head rounded, slightly wider than neck, but narrower than the following body region (Fig. 1A, D), flattened dorso-ventrally, with rhynchodaeum visible through integument. Mouth small, elongated (rounded when open). Cephalic furrows and ocelli absent. Body whitish in colour, partly translucent in gut region, so that gonads and gut visible through body wall (Fig. 1B, C). In nephridial region, body encircled with thin transverse epidermal ring (‘tubulanid ring’) (Fig. 1B); posteriorly to ring, epidermis opaque (Fig. 1B) due to large number of glands; pair of oval lateral organs located in area of epidermis opaque. Mature testes white; ovary pale pink or pale yellowish. Posterior 1/3 of body with irregularly spaced epidermal constrictions (Fig. 1B, C). Internal morphology: Body wall in foregut region: E 61–79 µm (up to 85–120 µm in precerebral region), D 1.5–2 µm, OCM 3–6 µm, LM 30–74 µm, ICM 4–7 µm (up to 15 µm in nephridial region); crisscrossed DM between OCM and LM present in cephalic and foregut regions (Fig. 2A). ICM not visible in transverse sections through the posterior half of body, but a very thin layer of ICM detected by cLSM (Fig. 2C, F). Longitudinal muscle plate between rhynchocoel and foregut present. Two muscle crosses (dorsal and ventral) present between body OCM and ICM: dorsal cross well-developed (Figs. 2D, E; 3G, H); ventral cross thinner and not detected in gut region. Welldeveloped rhynchodaeal glandular epithelium forms four folds (Fig. 3A, B). Rhynchocoel as long as half of body length; rhynchocoel wall consists of outer circular and inner longitudinal muscle layers, but longitudinal muscles reduced posterior to nephridial region (Fig. 2E, F); in some areas, inner longitudinal muscles scattered (Fig. 2D); posteriorly to nephridial region, rhynchocoel contains short inner tube with proboscis running inside (Fig. 3G); in posterior part, this tube connected first to dorsal wall of rhynchocoel (Fig. 3H), then with ventral wall. Anterior proboscis portion consists of four regions (Fig. 4A): (1) anteriorly located short muscular region without clear glandular epithelium (Fig. 4B); (2) short region with well-developed longitudinal musculature and thin epithelium with basophilic glands (Fig. 4C); (3) short region with thin musculature, wide lumen, and thick epithelium with numerous glandular cells stained with Orange G (Fig. 4D); (4) long region with typical morphology, i.e., four muscular layers (endothelial circular, longitudinal, diagonal, and outer circular) and well-developed glandular epithelium (Fig. 4E). Proboscis diagonal musculature crisscrossed (Fig. 4F); two very thin muscle crosses detected by cLSM (Fig. 4G, H). Rod-shaped pseudocnidae 1.6–1.9 µm in length, located in clusters of up to 300 pseudocnidae (Magarlamov et al. 2021). Middle proboscis region with thickening of longitudinal and radial muscles (Fig. 4I). Cephalic blood lacunae voluminous in transverse sections (Fig. 3A, B). Lateral vessels run internally to ICM in foregut region (Figs. 2B; 3C), but in posterior foregut region, lateral vessels run through this layer and continue posteriorly between ICM and LM (Figs. 2C, F; 3F). Endothelium of lateral vessels with thin circular Fig. 1. Parahubrechtia rayi sp. nov., A, unrelaxed live holotype, mature male (MIMB 41337); B, C, specimens (B, immature male; C, mature female) compressed under coverglass (arrows indicate epidermal constrictions); D, the head of the specimen compressed under coverglass. Abbreviations: br, brain; cl, cephalic lacuna; g, gonad; lo, lateral organ; m, mouth; pr, proboscis; rd, rhynchodaeum; tr. ‘tubulanid’ ring. Scale bars: A– C = 0.5 mm; D = 0.1 mm. page 7 of 17Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan musculature (Fig. 2C). Subepidermal nerve plexus well developed (Fig. 2G, I); transverse subepidermal nerves run/located in posterior foregut and gut region (Fig. 2G); neural plexus associated with cephalic blood lacunae (Fig. 2H) and rhynchocoel wall (Fig. 2I). Immediately anterior to mouth, two nerves extend from ventral part of ventral brain ganglia, fuse (Fig. 3D), and split up again (Fig. 3E), forming two large Fig. 2. Parahubrechtia rayi sp. nov., cLSM micrographs of the body labeled with phalloidin (A–F) and 5-HT (G–I). A, substack of longitudinal sections through the body-wall musculature with crisscrossed DM (arrowed) in the precerebral region; B, C, substacks of transverse sections through the body in the foregut region; D, substack of transverse sections through the body in the mouth region (arrows indicate isolated longitudinal muscles); E, F, substacks of transverse sections through the body in the post-nephridial region (arrows indicate ICM); G, z-projection of longitudinal sections through the anterior part of the body (ventral view) showing subepidermal neural plexus; H, substack of longitudinal sections of the anterior part of the head showing neural plexus of the cephalic lacunae; I, substack of transverse section through the body in the mouth region showing 5-HT positive nervous system. Abbreviations: bc, buccal cavity; bn, buccal nerves; dc, dorsal muscle cross; dm, diagonal musculature; dn, dorsal nerve; fg, foregut; icm, inner circular musculature; in, intestine; lm, longitudinal musculature; ln, longitudinal nerve cord; lv, lateral vessel; m, mouth; ocm, outer circular musculature; npl, neural plexus of blood lacunae; pr, proboscis; rh, rhynchocoel; rnp, rhynchocoel neural plexus; snp, subepidermal neural plexus; tn, transverse subepidermal nerves. Scale bars: A, C–E = 50 μm; B = 200 μm; F–H = 100 μm; I = 20 μm. page 8 of 17Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan buccal nerves (Fig. 2I). Dorsal nerve single, upper (Fig. 2I). Nephridial tubes with pair of narrow latero-dorsal openings and terminal glandular organ protruding into blood vessels laterally (Fig. 3I). Gonadal sacs paired, opening dorsally, with first pair located immediately posterior to rhynchocoel end (Fig. 1C). Ecology and reproduction: The species is found in habitats at depths of 4–9 m on mud and muddy sand. Development occurs in late July and in August at a water temperature of 18–20°C. Eggs are 40–45 µm in diameter, with translucent jelly coats of 185–210 µm in diameter. At 22–26 h after external fertilization, free-swimming planula-like larvae 100–105 µm in length with long apical tuft hatched from eggs; at 1–2 days after fertilization, the length of larvae reached 120–130 µm; provisional epithelium was detected by cLSM and phalloidin labeling (Fig. 5A–C); at 24 h and 48 h post-fertilization, a pair of posterior retractor muscles are present (Fig. 5A, B); at 72 h post-fertilization, body wall musculature consists of OCM, DM, and LM (Fig. 5C). Eyes are absent. Further development was not studied. Fig. 3. Parahubrechtia rayi sp. nov., transverse histological sections of the holotype (F–H) and paratypes (A-E, I). A, precerebral region; B, brain region; C, foregut region; D, E, mouth region showing fused (D, arrow) and split (E, arrows) buccal nerves; F, nephridial region; G, H, postnephridial region showing inner rhynchocoel tube (G, arrows) and ventral rhynchocoel caecum (H, arrows); I, nephridial region (arrows indicate terminal glandular organ). Abbreviations: br, brain; cl, cephalic lacuna; dc, dorsal muscle cross; fg, foregut; icm, inner circular musculature; in, intestine; ln, longitudinal nerve cord; lv, lateral vessel; m, mouth; n, nephridial tube; pr, proboscis; rd, rhynchodaeum; rh, rhynchocoel. Scale bars: A, B, G, H = 100 µm; C, F = 200 µm; D, E = 50 µm. page 9 of 17 Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan REFERENCES Andrade SCS, Strand M, Schwartz M, Chen H-X, Kajihara H, von Döhren J, Sun S, Junoy J, Thiel M, Norenburg JL, Turbeville JM, Giribet G, Sundberg P. 2012. Disentangling ribbon worm relationships: multi-locus analysis supports traditional classification of the phylum Nemertea. Cladistics 28:141–159. doi:10.1111/j.1096-0031.2011.00376.x. Bergendal D. 1900. Till kännedomen om de nordiska Nemertinerna. Öfversigt af Kongliga Vetenskaps-Akademiens Förhandlingar 57:581–602. Bergendal D. 1902. Zur Kenntnis der nordischen Nemertinen. 2. Eine der construierten Urnemertine entsprechende Palaeonemerine aus dem Meere der schwedischen Westküste. Zool Anz 25:421– 432. Bergendal D. 1903. Till kännedomen om de nordiska Nemertinerna. 4. Förteckning öfver vid Sveriges vestkust iakttagna Nemertiner. Arkiv för Zoologi 1:85–156. Bürger O. 1892. Zur Systematik der Nemertinenfauna des Golfs von Neapel. Nachrichten von der Königlichen Gesellschaft der Wissenschaften und der Georg-Augusts-Universität zu Göttingen 5:137–178. Bürger O. 1904. Nemertini. Tierreich 20:1–151. Castresana J. 2000. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17:540–552. doi:10.1093/oxfordjournals.molbev.a026334. Chernyshev AV. 1999. Nemertines of the family Carinomidae (Nemertea, Anopla). 2. Origin and taxonomic position of Carinomidae. Zool Zh 78:1407–1416. (in Russian with English abstract) Chernyshev AV. 2002. A new nemertean, Callinera zhirmunskyi sp. n., from the Pacific coast of Canada with a special reference to Callineridae taxonomy. Russ J Mar Biol 28:132–135. Chernyshev AV. 2011. Comparative morphology, systematics and phylogeny of the nemerteans. Dalnauka: Vladivostok. (in Russian) Chernyshev AV. 2015. CLSM analysis of the phalloidin-stained muscle system of the nemertean proboscis and rhynchocoel. Zool Sci 32:547–560. doi:10.2108/zs140267. Chernyshev AV. 2016. Nemerteans of the coastal waters of Vietnam. In: A.V. Adrianov and K.A. Lutaenko (eds) Biodiversity of the Western Part of the South China Sea. Dalnauka, Vladivostok. Chernyshev AV. 2021. An updated classification of the phylum Nemertea. Invertebr Zool 18(3):188–196. doi:10.15298/ invertzool.18.3.01. Chernyshev AV, Polyakova NE. 2018a. Nemerteans from deep-sea expedition SokhoBiol. with description of Uniporus alisae sp. nov. (Hoplonemertea: Reptantia s.l.) from the Sea of Okhotsk. Deep Sea Res. Part II Top. Stud Oceanogr 154:121–139. doi:10.1016/j.dsr2.2017.09.022. Chernyshev AV, Polyakova NE. 2018b. Nemerteans of the VemaTRANSIT expedition: First data on diversity with description of two new genera and species. Deep Sea Res. Part II Top Stud Oceanogr 148:64–73. doi:10.1016/j.dsr2.2017.06.004. Chernyshev AV, Polyakova NE. 2019. Nemerteans from the deepsea expedition KuramBio II with descriptions of three new hoplonemerteans from the Kuril-Kamchatka Trench. Prog Oceanogr 178:102148. doi:10.1016/j.pocean.2019.102148. Chernyshev AV, Polyakova NE, Britayev TA, Bratova O, Mekhova ES. 2019. Cephalotrichella echinicola sp. nov. (Palaeonemertea, Cephalotrichellidae), a new nemertean associated with sea urchins from Nha Trang Bay (South China Sea). Invertebr Syst 33:518–529. doi:10.1071/IS18080. Chernyshev AV, Polyakova NE, Hiebert TC, Maslakova SA. 2021. Evaluation of the taxonomic position of the genus Carinina (Nemertea: Palaeonemertea), with descriptions of two new species. Invertebr Syst 35:245–260. doi:10.1071/IS20061. Coe WR. 1895. Descriptions of three new species of New England palaeonemerteans. Trans Conn Acad Arts Sci 9:515–522. Coe WR. 1905. Nemerteans of the west and northwest coasts of America. Bull Mus Compar Zool Harvard College 47:1–318. Colgan DJ, McLauchlan A, Wilson GDF, Livingston SP, Edgecombe GD, Macaranas J, Cassis G, Gray MR. 1998. Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Austral J Zool 46:419–437. doi:10.1071/ZO98048. Corrêa DD. 1954. Nemertinos do litoral Brasileiro. Bol Fac Filos Cienc Univ S Paulo 19:1–122. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek RC. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299. Gibson R. 1995. Nemertean genera and species of the world: an annotated checklist of original names and description citations, synonyms, current taxonomic status, habitats and recorded zoogeographic distribution. J Nat Hist 29:271–562. Gibson R, Sundberg P. 1999. Six new species of palaeonemerteans (Nemertea) from Hong Kong. Zool J Linn Soc 125:151–196. doi:10.1006/zjls.1997.0147. Giribet G, Carranza S, Baguna J, Riutort M, Ribera C. 1996. First molecular evidence for the existence of a Tardigrada + Arthropoda clade. Mol Biol Evol 13:76–84. doi:10.1093/ oxfordjournals.molbev.a025573. Griffin BB. 1898. Description of some marine nemerteans of Puget Sound and Alaska. Ann NY Acad Sci 11:193–217. Hookabe N, Asai M, Nakano H, Kimura T, Kajihara H. 2020. A new bathyal tubulanid nemertean, Tubulanus izuensis sp. nov. (Nemertea: Palaeonemertea), from Japanese waters. Proc Biol Soc Wash 133:122–133. doi:10.2988/PBSW-D-20-00006. Hubrecht AAW. 1879. The genera of European nemerteans critically revised, with description of several new species. Note Leyden Mus 1:193–232. Hubrecht AAW. 1885. The Nemertea. Narrativ of the Cruise of H.M.S. Challenger Expedition 1:830–833. Hylbom R. 1957. Studies on palaeonemerteans of the Gullmar Fiord area (west coast of Sweden). Ark Zool, Ser 2 10:539–582. Iwata F. 1952. Nemertini from the coasts of Kyusyu. J Fac Sci Hokkaido Univ Ser 6 Zool 11:126–148. Iwata F. 1957. Nemerteans from Sagami Bay. Publ Akkeshi Mar Biol Stat 7:1–31. Kajihara H. 2006. Four palaeonemerteans (Nemertea: Anopla) from a tidal flat in middle Honshu, Japan. Zootaxa 1163:1–47. doi:10.11646/zootaxa.1163.1.1. Kajihara H. 2007. Callinera emiliae sp. nov. (Nemertea: Palaeonemertea) from Negros Island, the Philippines. Zootaxa 1454:39–47. doi:10.11646/zootaxa.1454.1.3. Kajihara H, Chernyshev AV, Sun S, Sundberg P, Crandall FB. 2008. Checklist of nemertean genera and species (Nemertea) published between 1995 and 2007. Species Divers 13:245–274. doi:10.12782/specdiv.13.245. Kajihara H, Kakui K, Yamasaki H, Hiruta SF. 2015. Tubulanus tamias sp. nov. (Nemertea: Palaeonemertea) with two different types of epidermal eyes. Zool Sci 32:596–604. doi:10.2108/zs140250. Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30:772–780. doi:10.1093/molbev/mst010. Kvist S, Laumer CE, Junoy J, Giribet G. 2014. New insights into the phylogeny, systematics and DNA barcoding of Nemertea. Invertebr Syst 28:287–308. doi:10.1071/IS13061. page 16 of 17Zoological Studies 61:38 (2022) © 2022 Academia Sinica, Taiwan Kvist S, Chernyshev AV, Giribet G. 2015. Phylogeny of Nemertea with special interest in the placement of diversity from Far East Russia and northeast Asia. Hydrobiologia 760(1):105–119. doi:10.1007/s10750-015-2310-5. Lanfear R, Calcott B, Ho SYW, Guindon S. 2012. PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol Biol Evol 29:1695–1701. doi:10.1093/molbev/mss020. Lanfear R, Calcott B, Kainer D, Mayer C, Stamatakis A. 2014. Selecting optimal partitioning schemes for phylogenomic datasets. BMC Evol Biol 14:1–14. doi:10.1186/1471-2148-1482. Littlewood DTJ. 1994. Molecular phylogenetics of cupped oysters based on partial 28S rRNA gene sequences. Mol Phylogenet Evol 3:221–229. doi:10.1006/mpev.1994.1024. Magarlamov TYu, Turbeville JM, Chernyshev AV. 2021. Pseudocnidae of ribbon worms (Nemertea): ultrastructure, maturation, and functional morphology. PeerJ 9:e10912. doi:10.7717/peerj. 10912. McIntosh WC. 1873–1874. A Monograph of the British Annelids Part I. The Nemerteans. Ray Society, London, pp. 1–96, pls I–X in 1873; pp. 97–214, pls XI–XXIII in 1874. Minh BQ, Nguyen MAT, von Haeseler A. 2013. Ultrafast approximation for phylogenetic bootstrap. Mol Biol Evol 30:1188–1195. doi:10.1093/molbev/mst024. Montagu G. 1804. Description of several marine animals found on the south coast of Devonshire. Trans Linn Soc Lond 7:61–85. Müller OF. 1776. Zoologiae danicae prodromus, seu animalium Daniae et Norvegiae indigenarum characteres, nomina, et synonyma imprimis popularium. Havniae. Typis Hallageriis. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQTREE: A fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Mol Biol Evol 32:268–274. doi:10.1093/molbev/msu300. Noren M, Jondelius U. 1999. Phylogeny of the Prolecithophora (Platyhelminthes) Inferred from 18S rDNA Sequences. Cladistics 15:103–112. doi:10.1111/j.1096-0031.1999.tb00252.x. Norenburg J, Gibson R, Herrera BA, Strand M. 2022. Callineridae Bergendal, 1901. In: World Nemertea Database. Available at: http://www.marinespecies.org/nemertea/aphia.php?p= taxdetails&id=1451610. Accessed 15 May 2022. Oersted AS. 1843. Forsog til en ny classification af Planarierne (Planariea Duges) grundet paa mikroskopisk-anatomiske Undersogelser. Naturhistorisk Tidsskrift 4:519–581. Palumbi S, Martin A, Romano S, McMillan WO, Stice L, Grabowski G. 1991. The simple fools guide to PCR, ver. 2.0. Honolulu: Department of Zoology and Kewalo Marine Laboratory, University of Hawaii, USA. Punnett RC. 1900. On some South Pacific nemertines collected by Dr. Willey. Zoological Results Based on Material from New Britain, New Guinea, Loyalty Islands and elsewhere, Collected during the years 1895, 1896 and 1897 by Arthur Willey, Part 5:569–584. Renier SA. 1804. Prospetto della Classe dei Vermi. Padua, pp. xv– xxvii. Ritger RK, Norenburg JL. 2006. Tubulanus riceae new species (Nemertea: Anopla: Palaeonemertea: Tubulanidae), from South Florida, Belize and Panama. J Nat Hist 40:931–942. doi:10.1080/00222930600833867. Rogers AD, Gibson R, Thorpe JP. 1992. A new species of Callinera (Nemertea, Anopla, Palaeonemertea) from the Isle of Man. Zool Scr 21:119–128. doi:10.1111/j.1463-6409.1992.tb00314.x. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61:539–542. doi:10.1093/sysbio/sys029. Sands CJ, Convey P, Linse K, McInnes SJ. 2008. Assessing meiofaunal variation among individuals utilising morphological and molecular approaches: an example using the Tardigrada. BMC Ecology 8:7. doi:10.1186/1472-6785-8-7. Strand M, Norenburg J, Alfaya JE, Fernández-Álvarez FÁ, Andersson HS, Andrade SCS, Bartolomaeus T, Beckers P, Bigatti G, Cherneva I, Chernyshev A, Chung BM, von Döhren J, Giribet G, Gonzalez-Cueto J, Herrera-Bachiller A, Hiebert T, Hookabe N, Junoy J, Kajihara H, Krämer D, Kvist S, Magarlamov TYu, Maslakova S, Mendes CB, Okazaki R, Sagorny C, Schwartz M, Sun S-C, Sundberg P, Turbeville JM, Xu C-M. 2019. Nemertean taxonomy—implementing changes in the higher ranks, dismissing Anopla and Enopla. Zool Scr 48:118–119. doi:10.1111/zsc.12317. Sundberg P, Hylbom R. 1994. Phylogeny of the nemertean subclass Palaeonemertea (Anopla, Nemertea). Cladistics 10(4):347–402. doi:10.1111/j.1096-0031.1994.tb00185.x. Sundberg P, Gibson R, Olsson U. 2003. Phylogenetic analysis of a group of palaeonemerteans (Nemertea) including two new species from Queensland and the Great Barrier Reef, Australia. Zool Scr 32:279–296. doi:10.1046/j.1463-6409.2002.00032.x. Sundberg P, Chernyshev AV, Kajihara H, Kanneby T, Strand M. 2009. Character-matrix based descriptions of two new nemertean (Nemertea) species. Zool J Linn Soc 157(2):264–294. doi:10.1111/j.1096-3642.2008.00514.x. Takakura U. 1898. Misaki-kinbôsan-himomushirui-(Nemertine)-nobunrui [A classification of the nemerteans of the Misaki region]. Zool Mag 10:116–120. (in Japanese) Thollesson M, Norenburg JL. 2003. Ribbon worm relationships: A phylogeny of the phylum Nemertea. Proc R Soc Lond B 270:407–414. doi:10.1098/rspb.2002.2254. Vaidya G, Lohman DJ, Meier R. 2011. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 27:171–180. doi:10.1111/j.1096-0031.2010.00329.x. Vilgalys R, Sun BL. 1994. Ancient and recent patterns of geographic speciation in the oyster mushroom Pleurotus revealed by phylogenetic analysis of ribosomal DNA sequences. Proc Nat Acad Sci USA 91:4599–4603. doi:10.1073/pnas.91.10.4599. Whiting MF, Carpenter JM, Wheeler QD, Wheeler WC. 1997. The Strepsiptera problem: Phylogeny of the holometabolous insect orders inferred from 18S and 28S ribosomal DNA sequences and morphology. Syst Biol 46:1–68. doi:10.1093/sysbio/46.1.1. Wijnhoff G. 1913. Die Gattung Cephalothrix und ihre Bedeutung für die Systematik der Nemertinen. II. Systematischer Teil. Zool Jb Abt Syst Ökol Geogr Tiere 34:291–320. Yamaoka T. 1940. The fauna of Akkeshi Bay. IX. Nemertini. J Fac Sci Hokkaido Imperial Univ, Ser 6 Zool 7:205–263. Yurchenko OV, Neznanova SYu, Chernyshev AV. 2021. A comparative morphological study of the testes, spermatogenesis, and spermatozoa in two nemertean species, Callinera sp. and Parahubrechtia sp. (Palaeonemertea, Tubulanidae). Zool Anz 294:114–127. doi:10.1016/j.jcz.2021.08.005. page 17 of 17Zoological Studies 61:38 (2022)