A New Genus and Species of the Springendemic Ostracoda (Cypricercinae, Cyprididae) and its Genetic Population Structure among Rheocrenic Springs in Japan

© 2024 Academia Sinica, Taiwan Open Access A New Genus and Species of the Springendemic Ostracoda (Cypricercinae, Cyprididae) and its Genetic Population Structure among Rheocrenic Springs in Japan Mizuho Munakata1,* , Hayato Tanaka2, and Keiichi Kakui3 1Department of Natural History Sciences, Graduate School of Science, Hokkaido University, Sapporo, Hokkaido 060-0810, Japan. *Correspondence: E-mail: [email protected]; [email protected] (Munakata) 2Tokyo Sea and Life Park, Edogawa-ku, Tokyo 134-8587, Japan. E-mail: [email protected] (Tanaka) 3Department of Biological Sciences, Faculty of Science, Hokkaido University, Sapporo, Hokkaido 060-0810, Japan. E-mail: [email protected] (Kakui) urn:lsid:zoobank.org:pub:54F5E692-51E8-47E6-ACEC-3DBE3FE9C8AC Received 22 December 2023 / Accepted 26 September 2024 / Published 31 December 2024 Communicated by Benny K.K. Chan We describe the ostracod Lissostrandesia fonticola gen. et sp. nov. in the subfamily Cypricercinae McKenzie, 1971, collected from six rheocrenic springs in Japan. The populations sampled were separated by up to 1000 km, and some of them by one or two marine straits, which comprise significant barriers for freshwater animals. Lissostrandesia differs from the other 13 cypricercine genera in (1) lacking a groove and inner list on the anterior inner margin of the left valve; (2) having b and d setae on the fifth limb; (3) having d1 and d2 setae on the sixth limb; (4) having a stout attachment of the caudal ramus; (5) having a Triebel’s loop on the dorsal branch of the attachment; and (6) having a long free ventral branch, its length more than twice its width, and (7) having a free dorsal branch contributing to a tip on Triebel’s loop. These differences were enough to warrant establishment of a new tribe, Lissostrandesiini, to accommodate the new genus. We present a key to the genera in Cypricercinae. The maximum p-distance for the mitochondrial cytochrome c oxidase subunit I (COI) gene among six local populations was 0.662%, a low value indicative of conspecificity. In addition, four populations with sample sizes of 13–21 individuals shared two main COI haplotypes, indicating high apparent connectivity. A trend of decreasing genetic diversity from south to north suggests L. fonticola has had a longer history on Honshu Island and dispersed northward from there. Using the 16S rRNA gene as a marker, we detected the endosymbiotic bacterium Cardinium, a group of “reproduction-manipulating” bacteria, in five populations, suggesting that L. fonticola is parthenogenetic. Passive dispersal is the most likely explanation for the broad distribution of this species across strong geographic barriers. Key words: Cox1, Cypridoidea, Genetic distance, Taxonomy, 18S Citation: Munakata M, Tanaka H, Kakui K. 2024. A new genus and species of the spring-endemic Ostracoda (Cypricercinae, Cyprididae) and its genetic population structure among rheocrenic springs in Japan. Zool Stud 63:51. doi:10.6620/ZS.2024.63-51. BACKGROUND Cypricercinae McKenzie, 1971, one of 23 subfamilies in the ostracod family Cyprididae Baird, 1845, is characterized morphologically by having a Triebel’s loop on the distal part of the caudal ramus attachment (hereafter “CR attachment”). This subfamily contains more than 170 species in 13 genera (Ferreira et al. 2019; Meisch et al. 2019; Martens et al. 2023). Savatenalinton and Martens (2009b) revised this subfamily and proposed three tribes based mainly on characters on the inside of the valve margins and the Zoological Studies 63:51 (2024) doi:10.6620/ZS.2024.63-51 1 © 2024 Academia Sinica, Taiwan CR attachment, including Triebel’s loop on the distal part of the attachment. Martens et al. (2023) proposed a fourth tribe. The four tribes are Bradleystrandesiini Savatenalinton and Martens, 2009b, with three genera; Cypricercini McKenzie, 1971, with five genera; Lithocypridini Martens, de Almeida and Higuti, 2023 in Martens et al. (2023), with one genus; and Nealecypridini Savatenalinton and Martens, 2009b, with four genera. Species in Cypricercinae inhabit freshwater environments, and representatives have been found in all zoogeographical regions except Antarctica. Five cypricercine species have been reported from Japan to date: Bradleycypris vittata (Sars, 1903); Bradleytriebella lineata (Victor and Fernando, 1981); Bradleytriebella tuberculata (Hartmann, 1964); Pseudostrandesia tenebrarum Smith and Ozawa, 2021 in Smith et al. 2021; and Tanycypris alfonsi Nagler, Geist, and Matzke-Karasz, 2014 (Okubo 1972 1990 2004; Okubo and Ida 1989; Ishii et al. 2017; Smith et al. 2011 2021). All except P. tenebrarum, which is known only from aquaria in pet shops, have been reported from lentic habitats such as rice fields and ponds. Springs are isolated, disjunct freshwater ecosystems having a characteristic, well-differentiated biological community (Cantonati et al. 2012). High endemism is expected for spring-dwelling organisms with limited dispersal ability (e.g., benthic animals lacking planktonic stages), because each spring is geographically isolated, physically and chemically distinct, and often minimally affected by human disturbance. The ostracod species diversity in springs has been well studied in Europe (e.g., Roca and Baltanás 1993; Mezquita et al. 1999; Rosati et al. 2014) but not in Japan (e.g., Broodbakker 1988; Smith and Kamiya 2006; Smith 2011). Within the past decade, the population-genetic structures of ostracods have been investigated with genetic markers, mostly the mitochondrial cytochrome c oxidase subunit I (COI) gene but also several nuclear genes, including elongation factor I alpha (EF-1α), internal transcribed spacer (ITS), and 28S rRNA (e.g., Koenders et al. 2012 2017; Martens et al. 2013 2015; Shearn et al. 2017; Schön et al. 2018a). One molecular study of the cypridid Callistocypris sp. from neotropical forests in Mexico revealed a single species inhabiting phytotelmata separated by more than 200 km, suggesting that this species can disperse between isolated bodies of water (Mercado-Salas et al. 2021). Another study, on cypridids in the genus Bennelongia, which is endemic to Western Australia, detected five species with restricted distributions (collected from only one site or several sites near one another), and two more broadly distributed species, detected at sites over 800 km apart (Martens et al. 2015). During field surveys of ostracods in freshwater springs in Japan, we collected morphologically identical cypricercine individuals from six disjunct rheocrenic springs, in three regions separated by straits, a significant geographical barrier for freshwater animals: one locality on Rishiri Island, three on Hokkaido Island, and two on Honshu Island. We could not assign this morphospecies to any known cypricercine genus, so herein we erect a new species, genus, and tribe for it; describe the species; and present a sequence for its 18S rRNA gene. Because benthic ostracods are typically lacking planktonic stages, and the groups of springs where we collected specimens are separated by marine barriers, we expected to detect several lineages within the morphospecies. We thus also investigated its population structure based on COI sequences from individuals from four disjunct sampling areas. Additionally, for information relevant to the reproductive mode of the species, we used a molecular marker to check for the presence of the endosymbiont bacterium Cardinium, a group of “reproduction-manipulating” bacteria (cf. Ma and Schwander 2017; Schön et al. 2018b; Schön and Martens 2020). Finally, we constructed a key to the genera of Cypricercinae. MATERIALS AND METHODS Sampling We obtained ostracods from six rheocrenic springs around volcanoes (Fig. 1; Table 1): Kanro-sensui (KS) on Rishiri Island; springs near the Mikuni-bashi Bridge (MB), Daisetsu Asahidake Spring (AS), and Genshino-izumi (GI) on Hokkaido; and Gudari-numa (GN) and Metori Spring (MS) on Honshu. Bottom sediment was stirred in ambient water in a bucket, and all but the sediment was filtered through a 63-μm-mesh plankton net. This process was repeated several times at each locality. Ostracods were picked from the residue under an SZX9 stereomicroscope (Olympus, Japan). Geographical coordinates and elevations were obtained from GSI Maps (Geospatial Information Authority of Japan 2023). Water temperature was measured by using an O-274 thermometer (DRETEC, Japan). Morphological observations Ostracods were fixed and preserved in 80% or 100% ethanol. The methods used for dissection, preparation of slides, light microscopy, scanning electron microscopy (SEM), and drawing were as described by Munakata et al. (2021). The material page 2 of 16Zoological Studies 63:51 (2024) © 2024 Academia Sinica, Taiwan studied has been deposited in the Invertebrate Collection of the Hokkaido University Museum (ICHUM), Sapporo, or in the Rishiri Town Museum, under catalog numbers ICHUM-8603 to 8615, 8625, and 8626, and RTMCRU216 (for details, see Table S1). The following abbreviations are used in the text: Ca, carapace; LV, left valve; RV, right valve; H, height; L, length; W, width; An1, antennula; An2, antenna; Md, mandible; Mx, maxillula; L5–7, fifth to seventh limbs; CR, caudal ramus; db, dorsal branch; vb, ventral Fig. 1. Sampling localities for Lissostrandesia fonticola gen. et sp. nov. in Japan. (A) Map of eastern Asia and the western Pacific. (B) Map showing northern to central Japan, with letters C–H indicating sampling localities (circles); red circles indicate populations included in population-genetic analyses. (C–H) Photographs of sampling sites. (C) Kanro-sensui (KS). (D) Springs near Mikuni-bashi Bridge (MB). (E) Daisetsu Asahidake Spring (AS). (F) Genshi-no-izumi (GI). (G) Gudari-numa (GN). (H) Metori Spring (MS). Maps were generated with GMT6 (Wessel et al. 2019). 135° 140° 145° 150° 35° 40° 45° 60° 90° 120° 150° 180° −150° 0° 30° 60° C Honshu Island H E B A Pacific Ocean Pacific Ocean Eurasia Japan Hokkaido Island D F G C G H F E D Kanro-sensui (KS) Asahi-dake Spring(AS) Springs near Mikuni-bashi Bridge (MB) Genshi-no-izumi (GI) Gudari-numa (GN) Metori Spring (MS) Rishiri Is. Sea of Okhotsk Table 1. Sampling localities for Lissostrandesia fonticola gen. et sp. nov. Locality name (abbriviation) Environment Latitude Longitude Altitude (m) Water temperature (℃) Sampling date Kanro-sensui (KS) Springhead and springbrook 45°13.11'N 141°13.03'E 267 6.7 05.x.2020, 29.v.2023 Springs near to Mikuni-bashi Bridge (MB) Springbrook 43°37.19'N 143°03.26'E 905 No data 14.vi.2022 Daisetsu Asahidake Spring (AS) Springbrook 43°37.59'N 142°41.31'E 445 7.0 26.viii.2020 Genshi-no-izumi (GI) Springhead 43°21.22'N 142°32.31'E 419 7.2 27.viii.2020 Gudari-numa (GN) Springhead 40°40.11'N 140°57.08'E 586 8.2 24.x.2021, 13.x.2022 Metori Spring (MS) Springhead and springbrook 35°53.32'N 138°20.39'E 1175 8.0 27.iii.2019, 02.xi.2021 page 3 of 16Zoological Studies 63:51 (2024) © 2024 Academia Sinica, Taiwan branch; TL, Triebel’s loop. The appendage chaetotaxy follows Broodbakker and Danielopol (1982) for An1, Md, and Mx; Martens (1987) for An2; Meisch (2000) for L5–7; and Meisch (2007) for CR. In addition to vb, db, and main branch used in Savatenalinton and Martens (2009b), we proposed the following terms: shared vb, the region of the vb shared with TL; free vb, the remaining portion of the vb; shared dv, the region of the db shared with TL; free db, the remaining portion of the db; and bridge, the connection between vb and db that makes the loop in TL (for details, see Fig. 7B). The following measurements were made from digital images by using ImageJ (Schneider et al. 2012): L and H of the LV and RV (LV-L, LV-H, RV-L, and RV-H) and W of the carapace (Ca-W). Measurements in the text are in millimeters, followed by the mean value and sample size in parentheses. Molecular analysis Total DNA was extracted from the soft parts of 24, 32, 22, and 27 specimens from the GN, KS, MB, and MS populations, respectively, and one specimen from each of the local populations AS and GI, by using a NucleoSpin Tissue XS Kit (Macherey-Nagel, Germany) following the manufacturer’s protocol. The primers used for PCR amplification and sequencing for COI, 18S, and Cardinium 16S are listed in Munakata et al. (2021). We designed the specific primer Cypricer_ LCO_inner (AGCCATGCTAGGAACAGCTT) and used it instead of primer LCO1490 in cases where PCR amplification with the LCO1490/HCO2198 primer pair failed. The amplicon from primer LCO1490 was 658 bp long, whereas that from Cypricer_LCO_inner was 608 bp long. PCR amplification conditions for COI and Cardinium 16S with TaKaRa Ex Taq DNA polymerase (TaKaRa Bio, Japan) and for 18S with KOD FX Neo (Toyobo Life Science, Japan) were as described by Munakata et al. (2021). All nucleotide sequences were determined by direct sequencing in the forward and reverse directions with a BigDye Terminator Kit ver. 3.1 and a 3730 DNA Analyzer (Life Technologies, USA). Fragments were concatenated by using MEGA 11 (Tamura et al. 2021). Ambiguous positions due to double peaks in sequencing chromatograms were assigned a letter in the IUPAC nucleotide ambiguity code (Johnson 2010). BLAST (Altschul et al. 1990) was used to search the International Nucleotide Sequence Database (INSD; International Nucleotide Sequence Database Collaboration 2023) for sequences most similar to ours. The 18S dataset for phylogenetic analysis included one sequence we determined from a specimen collected from MS, the type locality (ICHUM-8610; accession number LC789200), and 32 sequences from 31 cypridoidean species and one outgroup taxon (Pontocypris mytiloides, Pontocypridoidea) taken from the INSD (Table S2). Detailed methods for 18S sequence alignment and the phylogenetic analysis, and the results from the analysis are provided as files S1–3. Population genetics COI sequences were determined for 13 individuals from the GN, 21 from KS, 20 from MB, and 19 from MS population. After alignment by means of Clustal W (Thompson et al. 1994), these sequences were trimmed to the shortest length among them (608 bp), and three sites containing ambiguous bases (as indicated by IUPAC codes; see above) were removed with MEGA 11. An integer neighbor-joining (IntNJ) network was constructed with PopART v.1.7 (Leigh and Bryant 2015) at 0.50 reticulation tolerance. Haplotype diversity (h), nucleotide diversity (π), and Tajima’s D (Tajima 1989) were calculated with DnaSP v.6.12.03 (Rozas et al. 2017). Fu’s FS (Fu 1997) was calculated with Arlequin v. 3.5.2.2 (Excoffier and Lischer 2010). RESULTS TAXONOMY Superfamily Cypridoidea Baird, 1845 Family Cyprididae Baird, 1845 Subfamily Cypricercinae McKenzie, 1971 Tribe Lissostrandesiini trib. nov. urn:lsid:zoobank.org:act:77659c20-0d1a-4b8e-832c8f35d462023a Type genus: Lissostrandesia gen. nov. Diagnosis: Inner lamella on LV without groove or inner list (Type A, see Savatenalinton and Martens 2009b); L5 with b, d setae; L6 with d1, d2 setae; CR attachment stout, with TL on db; vb with long, free part (free vb; length more than twice width); dorsal branch of TL with free part contributing to tip of TL (free db). Genus Lissostrandesia gen. nov. urn:lsid:zoobank.org:act:3ae75bca-c259-40c5-a3254b717128d779 Type species: Lissostrandesia fonticola gen. et. sp. nov. Etymology: Derived from the ancient-Greek adjective lissos (smooth), referring to the smooth inner margin of the valves, lacking any grooves or lists, page 4 of 16Zoological Studies 63:51 (2024) © 2024 Academia Sinica, Taiwan combined with the generic name Strandesia, a common group in this subfamily. Gender feminine. New Japanese name: Hira-maruwa-kaimijinko combines the Japanese word hira (smooth) with maruwa-kaimijinko, the name for the subfamily Cypricercinae (Okubo 2004). Diagnosis: Same as the diagnosis for the tribe. Lissostrandesia fonticola gen. et sp. nov. (Figs. 2–4) urn:lsid:zoobank.org:act: 5ab1df55-6ebf-46a9-9428dff0ba4391af Cypricercinae sp.: Munakata et al. (2023), 9–10, figs. 2A, 3A, B, 4. Type locality: Springhead of Metori Spring, Nagasaka Town, Hokuto City, Yamanashi Prefecture, Japan (35°53.32'N, 138°20.39'E); in sediment. Material examined: Holotype: female, ICHUM-8615, two slides. Paratypes (14 females): ICHUM-8603–8610, two slides for each; ICHUM8611, 8612, one SEM stub and one slide for each; ICHUM-8613, 8614, one SEM stub for each; ICHUM-8625, 8626, undissected, one vial for each. All individuals except ICHUM-8626 were collected by MM at the type locality; ICHUM-8626 was collected by Fuga Matsui from a spring near Mikuni-bashi Bridge (Table S1). Etymology: The specific name is from the Latin fontis, genitive singular of fons (fountain or spring), and -cola, nominative singular of the adjective-forming suffix “cola” (inhabit). New Japanese name: Shimizu-hira-maruwakaimijinko. Because this species was collected only in springs, the Japanese word shimizu (cold, clear freshwater) was prefixed to the generic name. Diagnosis: Same as the generic diagnosis. Description of Lissostrandesia fonticola: Measurements (in millimeters, except for ratios) of carapace and valves: LV-L 0.99–1.05 (1.02, n = 3), LV-H 0.51–0.56 (0.53, n = 3), LV-H/LV-L 0.52–0.53 (0.53, n = 3); RV-L 1.00–1.03 (1.02, n = 3), RV-H 0.50–0.53 (0.52, n = 3), RV-H/RV-L 0.50–0.51 (0.51, n = 3); Ca-W 0.41–0.42 (0.42, n = 3), Ca-W/LV-L 0.40–0.42 (0.41, n = 3). Carapace (Figs. 2, 3) translucent, with violetcolored area dorsally; eyes black (Fig. 2A). Carapace outer surface smooth, with sparse tiny setae; widest point at about mid-length (Fig. 3A, B); anterior and posterior ends rounded in dorsal view (Fig. 3A), outer list present on ventral and posterior margins of both valves (Fig. 3B). RV slightly overlapping LV along entire margin, with slight ventral expansion (Fig. 3A, B); greatest height at mid-length of RV; anterodorsal and posterodorsal margins smooth; posterior margin slightly more sharply rounded than anterior; ventral margin slightly concave; apex of anterior margin below mid-height of RV and higher than apex of posterior margin (Fig. 3C, E); in inner view, inner list and groove absent along entire margin; calcified inner lamella well developed on anterior, posterior, and ventral margins (Fig. 3C). LV similar to RV in shape; ventral margin nearly straight (Fig. 3D, F). Two oblong mandibular muscle scars and five oblong adductor muscle scars on LV and RV (Fig. 3C, D). Hinge adont. An1 (Fig. 4A) with seven podomeres. Podomere length ratio from second to seventh podomeres 5: 7: 3: 3: 3: 3. First podomere with one dorsal and two ventrodistal plumed setae; without Wouters organ. Second podomere with dorsodistal plumed seta not reaching middle of third podomere; without Rome organ. Third podomere with dorsodistal plumed seta reaching beyond end of seventh podomere and ventrodistal plumed seta reaching end of fourth podomere. Fourth podomere with two dorsodistal setae reaching tips of long setae on sixth podomere and two ventrodistal plumed setae reaching end of fifth podomere. Fifth podomere with two long dorsodistral setae reaching tips of long setae on seventh podomere and two shorter ventrodistal plumed setae extending Fig. 2. Left views of fixed specimens of Lissostrandesia fonticola gen. et sp. nov. (A) Form with translucent carapace and dorsal violet area; female from Metori Spring (paratype ICHUM-8625). (B) Pale yellowish form; female from springs near Mikuni-bashi Bridge (paratype ICHUM-8626). Arrows indicate anterior. Scale bar = 0.5 mm. page 5 of 16 Zoological Studies 63:51 (2024) © 2024 Academia Sinica, Taiwan to end of seventh podomere. Sixth podomere with four outer distal long setae (as long as podomeres 1–7) and shorter inner distal seta. Seventh podomere with three distal setae (two long, reaching tips of long setae on sixth podomere; one short, ca. one-fifth length of long setae) and aesthetasc ya (two-fifths length of long setae). An2 (Fig. 4B, C) with five podomeres. First podomere (coxa; not illustrated) with three ventral plumed setae. Second podomere (basis) with ventrosubdistal seta reaching middle of third podomere. Exopodite with one plumed long and two unequal short setae. Third (first endopodal) podomere with six inner subdistal natatory setae (one long seta not extending beyond half of fourth podomere and five short setae just reaching end of third podomere), ventrodistal plumed seta reaching tip of fourth podomere, and mid-ventral aesthetasc Y not reaching beyond end of third podomere. Fourth podomere undivided, with two mid-dorsal setae, dorso-subdistal setae z1–3 of unequal length, midventral plumed setae t1–4 reaching middle of claws G1 and G3, mid-ventral short aesthetasc y1, ventrodistal short aesthetasc y2, and distal claws G1–3; claw G2 ca. 90% length of claws G1, G3. Fifth podomere (Fig. 4C) with plumed seta g reaching to ca. three-fourths length of claw GM and bifurcate aesthetasc y3 (longer than half length of claw GM); Gm ca. three-fifths length of GM; GM reaching tips of claws G1, G3. Md (Fig. 5A) with coxa, palp comprising four podomeres (one basal, three endopodal), and vibratory plate. Coxa with distal teeth and two subdistal plumed setae. First podomere (basis) with one ventrodistal seta, ventrodistal setae S1 and S2, and ventrodistal short seta α (ca. one-third length of seta S2); seta S1, S2 unequal in length, bearing row of long setules. Vibratory plate (exopodite; not illustrated) with four rays. Second (first endopodal) podomere with four dorsodistal setae of unequal length (longer two setae reaching end of fourth podomere); one mid-ventral, one long plumed, and three smooth setae not extending beyond tips of claws on fourth podomere; and mid-ventral plumed short seta ß (ca. one-fourth length of mid-ventral smooth setae). Third podomere with four dorso-subdistal and two ventro-subdistal setae; inner region with distal plumed Fig. 3. SEM images of carapaces and valves of female Lissostrandesia fonticola gen. et sp. nov. (A) Paratype ICHUM-8613; (B) Paratype ICHUM-8614; (C, D) Paratype ICHUM-8611; (E, F) Holotype, ICHUM-8612. (A, B) Dorsal and ventral views of whole carapace. (C, D) Inner views of left and right valves. (E, F) Outer views of left and right valves. Arrows indicate anterior. Scale bar = 0.5 mm. page 6 of 16Zoological Studies 63:51 (2024) © 2024 Academia Sinica, Taiwan seta γ and three distal plumed setae. Fourth podomere with distal seta and four distal claws. Mx (Fig. 5B) with palp comprising two podomeres, three endites, and vibratory plate. First palpal podomere with one subdorsodistal and six dorsodistal plumed setae reaching tips of claws on second palpal podomere. Second palpal podomere rectangular, L/W ca. 2, with three distal setae and three distal claws. First endite with two ventroproximal plumed setae, and eight smooth and two plumed distal setae. Second endite with eight distal setae. Third endite with two distal serrated spines and seven distal setae (two of them plumed). Vibratory plate (not illustrated) with more than 10 rays. L5 (Fig. 6A) with protopod, palp, and vibratory plate. Protopod with two setae a, plumed seta b, plumed seta d, and 12 distal plumed setae of unequal lengths. Palp with distal plumed setae h1–3. Vibratory plate (not illustrated) with several rays. L6 (Fig. 6B) with six podomeres (border between first and second podomeres indistinct). Length ratio for third to sixth podomeres and terminal claw (h2) 14: 7: 10: 3: 24. First and second podomeres (protopod) with setae d1, d2. Third (first endopodal) podomere with ventrodistal plumed seta e not reaching middle of fifth podomere. Fourth podomere not fused to fifth podomere, with ventrodistal plumed seta f reaching end of sixth podomere. Fifth podomere with short ventrodistal plumed seta g. Sixth podomere with dorsodistal plumed seta h3, ventrodistal plumed seta h1, and distal curved claw h2. Fig. 4. Lissostrandesia fonticola gen. et sp. nov., holotype female (ICHUM-8612). (A) Antennula. (B) Antenna, outer view; coxa, setae, and claws on fifth podomere omitted. (C) An2, fifth podomere. Scale bars = 0.1 mm. A B C ya Y t1–4 z1–3 G3 G2 G1 GM Gm y3 g page 7 of 16 Zoological Studies 63:51 (2024) © 2024 Academia Sinica, Taiwan L7 (Fig. 6C) with four podomeres, bearing pincer organ formed by third and fourth podomeres. First podomere (protopod) with plumed setae d1, d2, dp. Second (first endopodal) podomere with ventrodistal plumed seta e not extending beyond end of fused third and fourth podomeres. Third podomere with mid-ventral plumed seta f reaching tip of seta h1. Fourth podomere with long plumed seta h3, hook-like seta h2, and tiny seta h1. CR (Fig. 7A) with CR-L/CR-W ratio ca. 17. L ratio of ramus, plumed seta Sa, claw Ga, claw Gp, and plumed seta Sp 17: 3: 9: 7: 2. CR attachment (Fig. 7B) stout, with TL on db, and with free db contributing to acute tip; vb with welldeveloped free part, with L of free vb about 10 times W; vb with swollen end. Male unknown. Variation: We observed two types of carapace coloration, depending on the population. In individuals from MS, KS, AS, and GI, the carapace was translucent, with a violet area on the dorsal side (Fig. 2A); in individuals from GN and MB, the carapace was pale yellowish, with a dark green area on the dorsal side (Fig. 2B). These colors were retained in ethanol. Fig. 5. Lissostrandesia fonticola gen. et sp. nov., holotype female (ICHUM-8612). (A) Mandible, inner view, vibratory plate omitted. (B) Maxillula. Scale bars = 0.1 mm. A B α γβ S1 S2 endites 2-segmented palp sideways-directed bristles page 8 of 16Zoological Studies 63:51 (2024) © 2024 Academia Sinica, Taiwan Molecular information We determined COI sequences for 19 individuals from the MS population (608 or 658 bp, encoding 202 or 218 amino acids; INSD accession numbers LC789259–LC789277); these differed by 0–4 nucleotide substitutions in 608 bp. In BLAST searches, the most similar sequence to ours was from “Ostracoda sp.” (MF751183.1; identity score 84.33%, query cover 98%; deWaard et al. 2019). We also determined COI sequences (608 or 658 bp; INSD accession numbers LC789204– LC789258, LC726439) from ostracods from the other five populations: 21 from KS, 20 from MB, one from AS, one from GI, and 13 from GN. Mean p-distances (608 bp) within populations for which more than one individual was sequenced were 0.016–0.193% and those between them were 0.00–0.229%. Maximum p-distances within and between populations were 0.500% and 0.662%, respectively (Table 2). Fig. 6. Lissostrandesia fonticola gen. et sp. nov., holotype female (ICHUM-8612). (A–C) Fifth to seventh limbs; setules of distal setae on protopod, palp of fifth limb, and vibratory plate on fifth limb omitted. Scale bars = 0.1 mm. A B C h1 a b d h3 h2 d2 d1 e f h2 h3 g h1 h2 h3 h1 e f d1d2 dp page 9 of 16 Zoological Studies 63:51 (2024) © 2024 Academia Sinica, Taiwan phylogenetic analysis of the subfamily. Hydrobiologia 632:1–48. doi:10.1007/s10750-009-9826-5. Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9:671–675. doi:10.1038/nmeth.2089. Schön I, Higuti J, Patel T, Martens K. 2018a. Aquatic longdistance dispersal and vicariance shape the evolution of an ostracod species complex (Crustacea) in four major Brazilian floodplains. Mol Phylogenet Evol 121:86–97. doi:10.1016/ j.ympev.2017.12.019. Schön I, Kamiya T, Van Den Berghe T, Van Den Berghe L. 2018b. Novel Cardinium strains from non-marine ostracod (Crustacea) hosts from natural populations. Mol Phylogenet Evol 130:406– 415. doi:10.1016/j.ympev.2018.09.008. Schön I, Martens K. 2020. Are Cardinium infections causing asexuality in non-marine ostracods? Hydrobiologia 847:1651– 1661. doi:10.1007/s10750-019-04110-2. Sharpe RW. 1903. Report on the freshwater Ostracoda of the United States National Museum, including a revision of the subfamilies and genera of the family Cyprididae. Proc US Natl Mus 26:969– 1001. Shearn R, Schön I, Martens K, Halse S, Krawiec J, Koenders A. 2017. Patterns of genetic divergence in the Ilyodromus amplicolis lineage (Crustacea, Ostracoda), with descriptions of three new species. Zootaxa 4318:1–46. doi:10.11646/zootaxa.4318.1.1. Smith RJ. 2011. Groundwater, spring and interstitial Ostracoda (Crustacea) from Shiga Prefecture, Japan, including descriptions of three new species and one new genus. Zootaxa 3140:15–37. doi:10.11646/zootaxa.3140.1.2. Smith RJ, Janz H, Okubo I. 2011. Recent Cyprididae and Ilyocyprididae (Crustacea: Ostracoda) from Lake Biwa, Japan, including a summary of the lake’s ostracod fauna. Zootaxa 2874:1–37. doi:10.11646/zootaxa.2874.1.1. Smith RJ, Kamiya T. 2006. Six new species of fresh and brackish water ostracods (Crustacea) from Yakushima, Southern Japan. Hydrobiologia 559:331–355. doi:10.1007/s10750-005-0946-2. Smith RJ, Ozawa H, Kawashima K, Nakai S. 2021. A new species of Pseudostrandesia Savatenalinton and Martens, 2009 (Ostracoda, Crustacea) collected from two pet shops in central Japan: an alien species? Zool Sci 38:481–493. doi:10.2108/zs210027. Stuhlmann F. 1888. Vorläufiger Bericht über eine mit Unterstützung der Königlichen Akademie der Wissenschaften unternommence Reise nach Ost-Afrika, zur Untersuchung der Süsswasserfauna. Sitzungsberichte der Königlich-Preussischen Akademie der Wissenschaften 49:1255–1269. Tajima F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585–595. doi:10.1093/genetics/123.3.585. Tamura K, Stecher G, Kumar S. 2021. MEGA 11: Molecular evolutionary genetics analysis version 11. Mol Biol Evol 38:3022–3027. doi:10.1093/molbev/msab120. Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673– 4680. doi:10.1093/nar/22.22.4673. Triebel VE. 1959. Zur Kenntnis der Ostracoden-Gattungen Isocypris und Dolerocypris. Senck Biol 40:155–170. Vávra V. 1897. Die Süsswasser-Ostracoden Deutsch-Ost-Afrikas. In: Möbius K (ed) Die Tierwelt Ost-Afrikas und der Nachbargebiete 4:1–28. Victor R, Fernando CH. 1981. Freshwater ostracods (Crustacea: Ostracoda) of the genus Strandesia Vavra, 1895 from Malaysia, Indonesia and the Philippines. Arch Hydrobiol Suppl 58:469– 522. Wessel P, Luis JF, Uieda L, Scharroo R, Wobbe F, Smith WHF, Tian D. 2019. The generic mapping tools version 6. Geochem Geophy Geosy 20:5556–5564. doi:10.1029/2019GC008515. Würdig NL, Pinto ID. 1990. Diaphanocypris, a new ostracode genus occurring in South and Central America. Pesquisas 17:31–38. Supplementary materials Table S1. List of Lissostrandesia fonticola specimens used in morphological or genetic analyses, with their museum catalog and GenBank accession numbers. Abbreviations: AS, Daisetsu Asahidake Spring; GI, Genshi-no-izumi; GN, Gudari-numa; KS, Kanro-sensui; MB, springs near Mikuni-bashi Bridge; MS, Metori Spring. (download) Table S2. List of species included in the molecular phylogenetic analysis, with their GenBank accession numbers and source references. (download) File S1. Detailed methods for the phylogenetic analysis, and the results of the analysis. (download) File S2. Aligned 18S sequences used in the maximumlikelihood analysis, trimmed in MEGA 11 to the shortest length among them. (download) File S3. Aligned 18S sequences used in the maximumlikelihood analysis, reduced to 1583 positions after the removal of alignment-ambiguous sites with Gblocks ver. 0.91b in NGPhylogeny.fr under “relaxed” parameters. (download) page 16 of 16Zoological Studies 63:51 (2024)