Integrative Descriptions of Two New Macrobiotidae Species (Tardigrada: Eutardigrada: Macrobiotoidea) from French Guiana and Malaysian Borneo
Abstract
Stec, Daniel, Dudziak, Magdalena, Michalczyk, Łukasz (2020): Integrative Descriptions of Two New Macrobiotidae Species (Tardigrada: Eutardigrada: Macrobiotoidea) from French Guiana and Malaysian Borneo. Zoological Studies (Zool. Stud.) 59 (23): 1-25, DOI: 10.6620/ZS.2020.59-23, URL: http://dx.doi.org/10.5281/zenodo.12822655
Full text
© 2020 Academia Sinica, Taiwan Open Access Integrative Descriptions of Two New Macrobiotidae Species (Tardigrada: Eutardigrada: Macrobiotoidea) from French Guiana and Malaysian Borneo Daniel Stec1,*, Magdalena Dudziak1, and Łukasz Michalczyk1 1Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387 Kraków, Poland. *Correspondence: E-mail: [email protected] (Stec) E-mail: [email protected] (Dudziak); [email protected] (Michalczyk) Received 27 March 2020 / Accepted 12 May 2020 / Published 2 July 2020 Communicated by Benny K.K. Chan In this paper we describe two new tardigrade species, one representing the Macrobiotus hufelandi complex and the other from the Paramacrobiotus richtersi complex. The descriptions are based on a detailed morphological examination under light and scanning electron microscopy and analysis of four genetic markers (18S rRNA, 28S rRNA, ITS-2 and COI). Macrobiotus crustulus sp. nov. from French Guiana is the most similar to Macrobiotus martini Bartels, Pilato, Lisi and Nelson, 2009, Macrobiotus santoroi Pilato and D'Urso, 1976, but differs from them mainly by having the lissostomus type of the oral cavity armature (teeth not visible under light microscopy) and well-developed, convex terminal discs of egg processes covered with evident granulation. Paramacrobiotus filipi sp. nov. from the Malaysian part of Borneo is the most similar to Paramacrobiotus alekseevi (Tumanov, 2005), but differs from it primarily by the presence of body granulation visible under light microscopy as well as sculptured and porous areoles around egg processes. Key words: Biodiversity, DNA barcodes, New species, Species complex, Taxonomy. Citation: Stec D, Dudziak M, Michalczyk Ł. 2020. Integrative descriptions of two new Macrobiotidae species (Tardigrada: Eutardigrada: Macrobiotoidea) from French Guiana and Malaysian Borneo. Zool Stud 59:23. doi:10.6620/ZS.2020.59-23. BACKGROUND Tardigrades are a phylum of ubiquitous microinvertebrates that inhabit marine and limnoterrestrial environments throughout the world (Nelson et al. 2015). Currently, there are nearly 1300 formally recognised tardigrade species (Guidetti and Bertolani 2005; Degma and Guidetti 2007; Degma et al. 2009– 2019). Although the great majority of species have been described classically, the number of taxa described under the integrative taxonomy framework is constantly increasing (e.g., Surmacz et al. 2019; Bochnak et al. 2020; Kayastha et al. 2020). Although studies on tardigrades have been conducted for more than two centuries, and have been particularly prevalent during the last few decades, there are still regions of the world where these animals have never been studied. One such places is French Guiana, an overseas department of the French Republic located in the northern Atlantic coast of South America. Another part of the globe with weakly investigated tardigrade fauna is Malaysia where the only records come from its eastern part, Malaysian, Borneo, but with no reports from the peninsular part of the country. However, the Bornean tardigrade fauna is also very poorly known, as only four species from the island have been recorded so far: Famelobiotus scalicii Pilato, Binda and Lisi, 2004, Bryodelphax arenosus Gąsiorek, 2018, Echiniscus masculinus Gąsiorek, Vončina and Michalczyk, 2020 and Insulobius orientalis Gąsiorek and Michalczyk, 2020. Zoological Studies 59:23 (2020) doi:10.6620/ZS.2020.59-23 1
© 2020 Academia Sinica, Taiwan In this paper, we provide integrative descriptions of two new Macrobiotidae species, Macrobiotus crustulus sp. nov. from French Guiana and Paramacrobiotus filipi sp. nov. from the Malaysian part of Borneo. In addition, we also present new photomicrographs of the types of Paramacrobiotus alekseevi (Tumanov, 2005) and amend its description. The detailed morphological and morphometric data were obtained using light contrast and scanning electron microscopy. These data were further associated with DNA sequences of four genetic markers that are standard in modern tardigrade taxonomy (the nuclear 18S rRNA, 28S rRNA, and ITS2, and the mitochondrial COI). MATERIALS AND METHODS The moss sample containing Macrobiotus crustulus sp. nov. was collected by Witold Morek and Bartłomiej Surmacz on 2 April 2019 from a tree trunk in the primeval tropical rainforest in the vicinity of Patawa, French Guiana, South America (4°33'58.2"N, 52°9'12.36"W; 268 m asl). The epiphyllous moss sample containing Paramacrobiotus filipi sp. nov. was collected by Piotr Gąsiorek on 27 July 2016 from the leaf of a tree in the primary tropical forest, Gunung Mulu, Sarawak, Borneo, Malaysia, Asia (4°02'N; 114°49'E; 100 m asl). Both samples were examined for tardigrades using the protocol by Dastych (1980) with modifications described in detail in Stec et al. (2015). A total of 55 and 28 animals as well as 45 and 15 eggs of the two new species were extracted from the South American and Asian samples, respectively. In order to perform integrative taxonomic descriptions, the isolated animals and eggs were split into three groups for specific analyses: morphological analysis with phase contrast light microscopy (PCM), morphological analysis with scanning electron microscopy (SEM), and DNA sequencing (for details please see sections “Material examined” provided below for each description). Microscopy and imaging Specimens for light microscopy were mounted on microscope slides in a small drop of Hoyer’s medium and secured with a cover slip, following the protocol by Morek et al. (2016). Slides were examined under an Olympus BX53 light microscopy, associated with an Olympus DP74 digital camera. Immediately after mounting the specimens in the medium, slides where also checked under PCM for the presence of males and females in the studied population as the spermatozoa in testis and spermathecae are visible for several hours after mounting (Coughlan et al. 2019). In order to obtain clean and extended specimens for SEM, tardigrades were processed according to the protocol by Stec et al. (2015). Specimens were examined under high vacuum in a Versa 3D DualBeam Scanning Electron Microscope (SEM) at the ATOMIN facility of the Jagiellonian University, Kraków, Poland. All figures were assembled in Corel Photo-Paint X6, ver. 16.4.1.1281. For structures that could not be satisfactorily focused in a single PCM photograph, a stack of 2–6 images were taken with an equidistance of ca. 0.2 μm and assembled manually into a single deep-focus image in Corel Photo-Paint. Morphometrics and morphological nomenclature All measurements are given in micrometres (μm). Sample size was adjusted following recommendations by Stec et al. (2016). Structures were measured only if their orientation was suitable. Body length was measured from the anterior extremity to the end of the body, excluding the hind legs. The terminology used to describe oral cavity armature and egg shell morphology follows Michalczyk and Kaczmarek (2003) and Kaczmarek and Michalczyk (2017). The type of buccal apparatus and claws are given according to Pilato and Binda (2010). Macroplacoid length sequence is given according to Kaczmarek et al. (2014). Buccal tube length and the level of the stylet support insertion point were measured according to Pilato (1981). The pt index is the ratio of the length of a given structure to the length of the buccal tube, expressed as a percentage (Pilato 1981). All other measurements and nomenclature follow Kaczmarek and Michalczyk (2017). Morphometric data were handled using the “Parachela” ver. 1.7 template available from the Tardigrada Register (Michalczyk and Kaczmarek 2013). Raw morphometric data for each analysed species are provided as supplementary materials (Table S1 and Table S2) and are deposited in the Tardigrada Register under www.tardigrada.net/ register/0068.htm (M. crustulus sp. nov.) and www. tardigrada.net/register/0069.htm (P. filipi sp. nov.). Tardigrade taxonomy follows Bertolani et al. (2014a). Comparative material First, to test whether our species had previously been described, we used dichotomous keys for the Macrobiotus hufelandi complex (Kaczmarek and Michalczyk 2017) and for the genus Paramacrobiotus (Kaczmarek et al. 2017). As they did not key to a recognised species, the specimens were compared with the original descriptions of the species most similar to them: Macrobiotus martini Bartels, Pilato, Lisi and page 2 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan Nelson, 2009, Macrobiotus santoroi Pilato and D'Urso, 1976 and Paramacrobiotus alekseevi (Tumanov, 2005). Additionally, we used two slides containing a paratype and six eggs of P. alekseevi and new microphotographs of paratypes, which were kindly sent to us by Denis Tumanov (Saint-Petersburg State University, Russia). Genotyping Individual DNA extractions were made from eight specimens (four specimens per each new species) following protocol by Casquet et al. (2012) with modification presented by Stec et al. (2020c). Before the extraction, specimens were mounted in water, on temporary slides and checked under the microscope to confirm their identification. We sequenced four DNA fragments: the small ribosome subunit (18S rRNA, nDNA), large ribosome subunit (28S rRNA, nDNA), internal transcribed spacer (ITS-2, nDNA), and cytochrome oxidase subunit I (COI, mtDNA). All fragments were amplified and sequenced according to the protocols described in Stec et al. (2020c); primers used in this study are listed in table 1. Sequencing products were read with the ABI 3130xl sequencer at the Molecular Ecology Lab, Institute of Environmental Sciences of the Jagiellonian University, Kraków, Poland. Sequences were processed in BioEdit ver. 7.2.5 (Hall 1999) and submitted to GenBank. Comparative genetic analysis For molecular comparisons, all published sequences of the four abovementioned markers for species of the Macrobiotus hufelandi complex and Table 1. PCR primers for amplification of the four DNA fragments sequenced in the study DNA fragment Primer name Primer direction Primer sequence (5'-3') Primer source 18S rRNA 18S_Tar_1Ff forward AGGCGAAACCGCGAATGGCTC Stec et al. (2017a) 18S_Tar_1Rr reverse GCCGCAGGCTCCACTCCTGG 28S rRNA 28S_Eutar_F forward ACCCGCTGAACTTAAGCATAT Gąsiorek et al. (2018) 28SR0990 reverse CCTTGGTCCGTGTTTCAAGAC Mironov et al. (2012) ITS-2 Eutar_Ff forward CGTAACGTGAATTGCAGGAC Stec et al. (2018a) Eutar_Rr reverse TCCTCCGCTTATTGATATGC COI LCO1490 forward GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO2198 reverse TAAACTTCAGGGTGACCAAAAAATCA Table 2. GenBank accession numbers for sequences of species of the Macrobiotus hufelandi complex analysed in this study. Underlined numbers indicate type and neotype sequences DNA marker Species Accession number Source 18S rRNA M. canaricus Stec et al., 2018 MH063925 Stec et al. (2018b) M. engbergi Stec et al., 2020 MN443039 Stec et al. (2020a) M. noongaris Coughlan and Stec, 2019 MK737069 Coughlan and Stec (2019) M. kamilae Coughlan and Stec, 2019 MK737070 Coughlan and Stec (2019) M. caelestis Coughlan et al., 2019 MK737073 Coughlan et al. (2019) “M. hufelandi” Schultze, 1834 GQ849024 Giribet et al. (1996) M. hufelandi group species HQ604971 FJ435738–40 Bertolani et al. (2014a) Guil and Giribet (2012) M. hannae Nowak and Stec, 2018 MH063922 Nowak and Stec (2018) “M. joannae” Pilato and Binda, 1983 [= M. hannae Nowak and Stec, 2018] HQ604974–5 Bertolani et al. (2014a) M. kristenseni Guidetti et al., 2013 KC193577 Guidetti et al. (2013) M. macrocalix Bertolani and Rebecchi, 1993 HQ604976 MH063926 Bertolani et al. (2014a) Stec et al. (2018b) M. papei Stec et al., 2018 MH063881 Stec et al. (2018c) M. paulinae Stec et al., 2015 KT935502 Stec et al. (2015) M. polypiformis Roszkowska et al., 2017 KX810008 Roszkowska et al. (2017) M. polonicus Pilato et al., 2003 HM187580 Wełnicz et al. (2011) M. cf. recens MH063927 Stec et al. (2018b) page 3 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan DNA marker Species Accession number Source M. sapiens Binda and Pilato, 1984 DQ839601 Bertolani et al. (2014a) M. scoticus Stec et al., 2017 KY797265 Stec et al. (2017b) M. shonaicus Stec et al., 2018 MG757132 Stec et al. (2018d) 28S rRNA M. canaricus Stec et al., 2018 MH063934 Stec et al. (2018b) M. engbergi Stec et al., 2020 MN443034 Stec et al. (2020a) M. noongaris Coughlan and Stec, 2019 MK737063 Coughlan and Stec (2019) M. kamilae Coughlan and Stec, 2019 MK737064 Coughlan and Stec (2019) M. caelestis Coughlan et al., 2019 MK737071 Coughlan et al. (2019) M. hannae Nowak and Stec, 2018 MH063924 Nowak and Stec (2018) M. hufelandi group species FJ435751, FJ435754–5 Guil and Giribet (2012) M. macrocalix Bertolani and Rebecchi, 1993 MH063935 Stec et al. (2018b) M. papei Stec et al., 2018 MH063880 Stec et al. (2018c) M. paulinae Stec et al., 2015 KT935501 Stec et al. (2015) M. polypiformis Roszkowska et al., 2017 KX810009 Roszkowska et al. (2017) M. cf. recens MH063936 Stec et al. (2018b) M. scoticus Stec et al., 2017 KY797266 Stec et al. (2017b) M. shonaicus Stec et al., 2018 MG757133 Stec et al. (2018d) ITS-2 M. canaricus Stec et al., 2018 MH063928–30 Stec et al. (2018b) M. engbergi Stec et al., 2020 MN443036–7 Stec et al. (2020a) M. noongaris Coughlan and Stec, 2019 MK737065–6 Coughlan and Stec (2019) M. kamilae Coughlan and Stec, 2019 MK737067 Coughlan and Stec (2019) M. caelestis Coughlan et al., 2019 MK737072 Coughlan et al. (2019) M. hannae Nowak and Stec, 2018 MH063923 Nowak and Stec (2018) M. macrocalix Bertolani and Rebecchi, 1993 MH063931 Stec et al. (2018b) M. papei Stec et al., 2018 MH063921 Stec et al. (2018c) M. paulinae Stec et al., 2015 KT935500 Stec et al. (2015) M. polonicus Pilato et al., 2003 HM150647 Wełnicz et al. (2011) M. polypiformis Roszkowska et al., 2017 KX810010 Roszkowska et al. (2017) M. cf. recens MH063932–3 Stec et al. (2018b) M. sapiens Binda and Pilato, 1984 GQ403680 Schill et al. (2010) M. scoticus Stec et al., 2017 KY797268 Stec et al. (2017b) M. shonaicus Stec et al., 2018 MG757134–5 Stec et al. (2018d) COI M. canaricus Stec et al., 2018 MH057765–6 Stec et al. (2018b) M. engbergi Stec et al., 2020 MN444824–6 Stec et al. (2020a) M. noongaris Coughlan and Stec, 2019 MK737919 Coughlan and Stec (2019) M. kamilae Coughlan and Stec, 2019 MK737920–1 Coughlan and Stec (2019) M. caelestis Coughlan et al., 2019 MK737922 Coughlan et al. (2019) M. hannae Nowak and Stec, 2018 MH057764 Nowak and Stec (2018) M. cf. hufelandi, Schultze, 1834 HQ876589–94, HQ876596 Bertolani et al. (2011a) M. hufelandi s.s., Schultze, 1834 HQ876584, HQ876586–8 Bertolani et al. (2011a) M. kristenseni Guidetti et al., 2013 KC193575–6 Guidetti et al. (2013) M. macrocalix Bertolani and Rebecchi, 1993 FJ176203–7, FJ176208–17 HQ876571 MH057767 Cesari et al. (2009) Bertolani et al. (2011a) Stec et al. (2018b) M. papei Stec et al., 2018 MH057763 Stec et al. (2018c) M. paulinae Stec et al., 2015 KT951668 Stec et al. (2015) M. polypiformis Roszkowska et al., 2017 KX810011–2 Roszkowska et al. (2017) M. cf. recens MH057768–9 Stec et al. (2018b) M. sandrae Bertolani and Rebecchi, 1993 HQ876566–67, HQ876569–70, HQ876572–83 Bertolani et al. (2011a) M. scoticus Stec et al., 2017 KY797267 Stec et al. (2017b) M. shonaicus Stec et al., 2018 MG757136–7 Stec et al. (2018d) M. terminalis Bertolani and Rebecchi, 1993 JN673960 AY598775 Cesari et al. (2011) Guidetti et al. (2005) M. vladimiri Bertolani et al., 2011 HM136931–2, HM136933–4, HQ876568 Bertolani et al. (2011a, b) Table 2. (Continued) page 4 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan the genus Paramacrobiotus were downloaded from GenBank (Tables 2 and 3). The sequences were aligned using the default settings (in the case of the ITS-2 and COI) and the Q-INS-I method (in the case of the ribosomal markers: 18S rRNA, 28S rRNA) of MAFFT version 7 (Katoh et al. 2002; Katoh and Toh 2008) and manually checked against non-conservative alignments in BioEdit. Then, the aligned sequences were trimmed to: 763 (18S rRNA), 715 (28S rRNA), 426 (ITS-2), and 624 (COI) bp for Macrobiotus hufelandi complex and 766 (18S rRNA), 727 (28S rRNA), and 588 (COI) bp for the genus Paramacrobiotus. All COI sequences were translated into protein sequences in MEGA7 version 7.0 (Kumar et al. 2016) to check against pseudogenes. Uncorrected pairwise distances were calculated using MEGA7 and are provided as supplementary materials (Table S3). RESULTS TAXONOMY Phylum Tardigrada Doyère, 1840 Class Eutardigrada Richters, 1926 Order Parachela Schuster, Nelson, Grigarick Table 3. GenBank accession numbers for sequences of Paramacrobiotus species analysed in this study. Underlined numbers indicate type or neotype sequences DNA marker Species Accession number Source 18S rRNA P. areolatus s.s. (Murray, 1907) MH664931 Stec et al. (2020b) P. lachowskae Stec et al., 2018 MF568532 Stec et al. (2018e) P. fairbanksi Schill et al., 2010 MH664941–42, MK041027–9 Stec et al. (2020b), Guidetti et al. 2019 P. tonollii (Ramazzotti, 1956) MH664946, DQ839605 Stec et al. (2020b), Guidetti et al. 2009 P. richtersi s.s. (Murray, 1911) MK041023 Guidetti et al. (2019) P. spatialis Guidetti et al., 2019 MK041024–6 Guidetti et al. (2019) P. depressus Guidetti et al., 2019 MK041030 Guidetti et al. (2019) P. celsus Guidetti et al., 2019 MK041031 Guidetti et al. (2019) P. arduus Guidetti et al., 2019 MK041032 Guidetti et al. (2019) P. experimentalis Kaczmarek et al., 2020 MN073467–8 Kaczmarek et al. (2020) P. areolatus group species MH664937, MH664943, DQ839602 Stec et al. (2020b), Guidetti et al. (2009) P. richtersi group species MH664932–6, MH664938–40, MH664944–5, HQ604985–6, EU038078, EU038080–1, DQ839603 Stec et al. (2020b) Bertolani et al. (2014a) Guidetti et al. (2009) 28S rRNA P. areolatus s.s. (Murray, 1907) MH664948 Stec et al. (2020b) P. lachowskae Stec et al., 2018 MF568533 Stec et al. (2018e) P. fairbanksi Schill et al., 2010 MH664950, MH664959 Stec et al. (2020b) P. tonollii (Ramazzotti, 1956) MH664963 Stec et al. (2020b) P. experimentalis Kaczmarek et al., 2020 MN073465–6 Kaczmarek et al. (2020) P. areolatus group species MH664955, MH664960 Stec et al. (2020b) P. richtersi group species MH664949, MH664951–4, MH664956–8, MH664961–2, FJ435757 Stec et al. (2020b), Guil and Giribet (2012) COI P. areolatus (Murray, 1907) MH675998 Stec et al. (2020b) P. lachowskae Stec et al., 2018 MF568534 Stec et al. (2018e) P. fairbanksi Schill et al., 2010 MH676011–2, EU244597, FJ435808–9, MK041003–11, AY598778–9 Stec et al. (2020b), Guidetti et al. (2005), Guidetti et al. (2019), Guil and Giribet (2012) P. tonollii (Ramazzotti, 1956) MH676018 Stec et al. (2020b) P. richtersi (Murray, 1911) MK040992–4 Guidetti et al. (2019) P. spatialis Guidetti et al., 2019 MK040995–9, MK041000–2 Guidetti et al. (2019) P. depressus Guidetti et al., 2019 MK041012–6 Guidetti et al. (2019) P. celsus Guidetti et al., 2019 MK041017–9 Guidetti et al. (2019) P. arduus Guidetti et al., 2019 MK041020–22 Guidetti et al. (2019) P. experimentalis Kaczmarek et al., 2020 MN097836–37 Kaczmarek et al. (2020) P. areolatus group species MH676007, MH676013 Stec et al. (2020b) P. richtersi group species MH675999, MH676000–6, MH676008–10, MH676014–7, EU244598–9, KF788251–7 Stec et al. (2020b), Guidetti et al. (2009), Caicedo et al. (2017) page 5 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan and Christenberry, 1980 Superfamily Macrobiotoidea Thulin, 1928 (in Marley et al. 2011) Family Macrobiotidae Thulin, 1928 Genus Macrobiotus C.A.S. Schultze, 1834 Macrobiotus crustulus sp. nov. Stec, Dudziak & Michalczyk (Figs. 1–8, Tables 2–3) urn:lsid:zoobank.org:act:F6723AE7-2F15-4FEA-A6BC76C3B48AE1C1 Material examined: 55 animals and 45 eggs. Specimens mounted on microscope slides in Hoyer’s medium (50 animals + 44 eggs), fixed on SEM stubs (1 + 1), and processed for DNA sequencing (4 + 0). Type locality: 4°33'58.2"N, 52°9'12.36"W; 268 m asl: French Guiana: the vicinity of Patawa; moss on the tree trunk in primeval tropical rainforest; coll. 2 April 2018 by Witold Morek and Bartłomiej Surmacz. Type depositories: Holotype (slide GF.271.06 with 4 paratypes) and 46 paratypes (slides: GF.271.*, where the asterisk can be substituted by any of the following numbers 01–05, 07–09; SEM stub: 19.16) and 45 eggs (slides: GF.271.*: 10–16; SEM stub: 19.16) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30387, Kraków, Poland. Etymology: The name refers to morphology of terminal discs of processes on the egg shell that resemble oat cookies. From Latin “cookie” = “crustulum”. Description: Animals (measurements and statistics in Table 4). Body transparent in juveniles and whitish in adults, after fixation in Hoyer’s medium – transparent (Fig. 1A). Eyes present, visible also in specimens mounted in Hoyer’s medium. Cuticle porous with circular and elliptical pores (diameter range: 0.8–2.4 μm) clearly visible on the entire body (Fig. 1B– C). Patches of granulation on all legs present and visible under PCM as singular dots/granules whereas under SEM these dots are revealed as aggregations of smaller microgranules (Fig. 2A–F). A patch of clearly visible granulation is present on the external surface of legs I– III (Fig. 2A–B). A pulvinus is present on the internal surface of legs I–III, together with faint granulation situated below the pulvinus (Fig. 2C–D). Granulation on legs IV is always visible and consists of a single large granulation patch on each leg covering dorsal and lateral leg surfaces (Fig. 2E–F). Claws stout, of the hufelandi type (Fig. 3A– D). Primary branches with distinct accessory points, a common tract, and with an evident stalk connecting the claw to the lunula (Fig. 3A–D). Lunulae on all legs smooth (Fig. 3A–D). Cuticular bars under claws are absent. Double muscle attachments are faintly marked in PCM (Fig. 3A). Mouth antero-ventral followed by ten short peribuccal lamellae (Fig. 5A–B), bucco-pharyngeal apparatus of the Macrobiotus type with thickened walls of the buccal tube posterior to the stylets support insertion point (Figs. 4A, 5A–B). Under PCM, the oral cavity armature is of the lissostomus type, i.e., teeth in the oral cavity not visible (Fig. 4B–C). However, in SEM, two bands of teeth are clearly visible with the first band being situated at the base of peribuccal lamellae and composed of a 4–6 rows of small cone-shaped/ granular teeth arranged around the oral cavity (Fig. 5A–B). The second band of teeth is situated behind the ring fold and comprises 4–6 rows of small coneshaped/granular teeth which are larger than those of the first band (Fig. 5A–B). The teeth of the third band are reduced to irregular wrinkled cuticular thickenings posterior to the second band of teeth (Fig. 5A–B). Pharyngeal bulb spherical, with triangular apophyses, two rod-shaped macroplacoids and a triangular small microplacoid (Fig. 4A, D–E). The macroplacoid length sequence 2 < 1. The first macroplacoid has a central constriction whereas the second macroplacoid is constricted subterminally (Fig. 4D–E). Eggs (measurements and statistics in Table 5): Laid freely, whitish, spherical (Figs. 6A, 7A). The surface between the processes is of the hufelandi type, i.e., covered with a reticulum with very thin walls (Figs. 6F–G, 7A–F). Peribasal meshes of similar size compared to interbasal meshes, usually with three to four rows of meshes between the neighbouring processes (Figs. 6F–G, 7A–F). Mesh diameter is always larger than mesh walls and nodes (Figs. 6F–G, 7A–F). The meshes are 0.7–1.6 μm in diameter, polygonal but with rounded edges. In SEM, meshes deep and empty inside and the whole reticulum is gently attached to the chorion surface by faint connectors what makes the impression that the reticulum is hanging over the egg surface (Fig. 7B–F). Processes are of the inverted goblet shape with slightly concave trunks but convex terminal discs (Figs. 6A–C, 7A–D). The central portion of each processes trunk is covered by small granulation that is visible only under SEM (Fig. 7B–E) Terminal discs are round with serrated/jagged edges and with a convex central area covered by a uniformly distributed granulation visible clearly both in PCM and SEM (Figs. 6B–E, 7A–D). Reproduction: The new species is dioecious. Spermathecae in females as well as testis in males have been found to be filled with spermatozoa, clearly visible under PCM up to 24 hours after mounting in Hoyer’s medium (Fig. 8A–D). The new species does not exhibit page 6 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan secondary sexual dimorphism (e.g., males do not have gibbosities on hind legs). DNA sequences: We obtained sequences for all four of the above mentioned DNA markers, each of which was represented by a single haplotype: 18S rRNA sequence (GenBank: MT261912), 1014 bp long; 28S rRNA sequence (GenBank: MT261903), 720 bp long; ITS-2 sequence (GenBank: MT261907), 439 bp long; COI sequence (GenBank: MT260371), 658 bp long. Remarks: Macrobiotus crustulus sp. nov. is the first ever tardigrade species reported from French Guiana. Genus: Paramacrobiotus Guidetti, Schill, Bertolani, Dandekar and Wolf, 2009. Paramacrobiotus filipi sp. nov. Dudziak, Stec & Michalczyk (Figs. 9–13, Tables 4–5) urn:lsid:zoobank.org:act:EED1679C-D91B-4D9A-B4CB21E6B50180C9 Material examined: 28 animals and 15 eggs. Specimens mounted on microscope slides in Hoyer’s medium (24 animals + 10 eggs), fixed on SEM stubs (0+5), and processed for DNA sequencing (4+0). Type locality: 44°02'N, 114°49'E; 100 m asl: Malaysia: Sarawak, Borneo, Gunung Mulu; epiphyllous moss on the tree leaf in the primary tropical forest; coll. 27 July 2016 by Piotr Gąsiorek. Table 4. Measurements [in µm] of selected morphological structures of Macrobiotus crustulus sp. nov. individuals mounted in Hoyer’s medium Character N Range Mean SD Holotype µm pt µm pt µm pt µm pt Body length 22 238–567 767–1242 379 1000 82 126 490 1029 Buccal tube Buccal tube length 22 29.1–47.6 – 37.5 –4.5 –47.6 – Stylet support insertion point 22 20.7–33.2 69.3–72.7 26.7 71.2 3.2 1.2 33.0 69.3 Buccal tube external width 22 2.7–5.3 9.3–12.7 4.1 10.8 0.6 0.9 4.8 10.1 Buccal tube internal width 22 1.6–2.7 5.1–6.5 2.1 5.7 0.3 0.4 2.5 5.3 Ventral lamina length 22 14.0–22.4 46.9–55.8 18.9 50.6 2.0 2.9 22.4 47.1 Placoid lengths Macroplacoid 1 22 6.9–14.5 23.6–31.7 10.4 27.7 1.8 2.3 13.0 27.3 Macroplacoid 2 22 4.6–11.0 15.8–23.1 7.4 19.5 1.5 2.0 11.0 23.1 Microplacoid 22 2.0–3.6 4.8–9.0 2.6 6.8 0.4 1.0 3.6 7.6 Macroplacoid row 22 13.4–25.0 46.0–57.0 19.4 51.4 3.1 2.8 25.0 52.5 Placoid row 22 16.2–28.9 55.7–61.2 22.1 58.7 3.1 1.7 28.9 60.7 Claw 1 heights External primary branch 21 7.6–12.6 22.4–31.2 9.8 26.5 1.3 2.1 12.6 26.5 External secondary branch 20 5.7–10.1 16.9–24.7 7.8 20.9 1.2 2.1 10.1 21.2 Internal primary branch 21 7.1–12.8 22.3–28.2 9.6 25.4 1.4 1.6 12.8 26.9 Internal secondary branch 19 4.9–10.7 16.8–23.4 7.5 19.8 1.4 1.5 10.3 21.6 Claw 2 heights External primary branch 22 7.3–12.6 22.6–29.5 9.9 26.4 1.3 1.7 12.6 26.5 External secondary branch 22 5.1–10.1 17.5–23.5 7.8 20.6 1.2 1.6 10.1 21.2 Internal primary branch 22 7.1–12.8 23.9–29.7 9.8 26.0 1.5 1.5 12.8 26.9 Internal secondary branch 21 5.6–10.4 17.9–23.5 7.9 20.7 1.2 1.6 10.4 21.8 Claw 3 heights External primary branch 19 7.2–12.5 21.9–28.5 10.0 26.2 1.4 1.5 12.5 26.3 External secondary branch 20 5.2–10.3 16.3–23.7 7.8 20.5 1.2 1.7 10.3 21.6 Internal primary branch 20 7.1–12.8 21.8–28.2 9.6 25.4 1.4 1.6 12.8 26.9 Internal secondary branch 18 5.4–10.7 16.1–23.3 7.7 20.1 1.2 1.7 10.7 22.5 Claw 4 heights Anterior primary branch 20 7.2–15.5 24.7–33.3 11.3 30.1 2.0 2.5 15.5 32.6 Anterior secondary branch 18 6.7–13.3 20.1–30.5 9.0 23.7 1.7 2.4 12.1 25.4 Posterior primary branch 18 8.3–15.3 25.7–33.8 11.8 31.0 1.8 2.3 15.3 32.1 Posterior secondary branch 12 6.8–10.2 19.1–27.0 8.9 24.4 1.1 2.3 ?? N, number of specimens/structures measured; Range, refers to the smallest and the largest structure among all measured specimens; SD, standard deviation. page 7 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan Type depositories: Holotype (slide MY.098.01 with 4 paratypes) and 19 paratypes (slides: MY.098.*, where the asterisk can be substituted by any of the following numbers 02, 04–05) and 15 eggs (slides: MY.098.*: 03, 06; SEM stub: 18.13) are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387, Kraków, Poland. Etymology: We take great pleasure in dedicating this new species to Filip Dudziak, son of the second Fig. 1. Macrobiotus crustulus sp. nov., habitus and cuticular pores (PCM). A, dorso-ventral projection (holotype, Hoyer’s medium); B–C, cuticular pores on the dorso-cephalic (B) and dorso-caudal (C) part of the body. Scale bars in μm. page 8 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan Fig. 2. Macrobiotus crustulus sp. nov., cuticular structures on legs (paratypes). A–B, external granulation on leg II seen in PCM (A) and SEM (B), respectively; C–D, a cuticular bulge (pulvinus) and a faint granulation, on the internal surface of legs I and II seen in PCM (C) and SEM (D), respectively; E–F, granulation on leg IV seen in PCM (E) and SEM (F). Filled flat arrowheads indicate the pulvinus. Scale bars in μm. page 9 of 25 Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan oral cavity armature where no teeth are visible under PCM, whereas M. martini and M. santoroi exhibit the maculatus and the patagonicus type of the oral cavity armature, respectively. Moreover, the new species differs specifically from: M. martini, reported only from the USA (Great Smoky Mountains National Park) (Bartels et al. 2009; Nelson and Bartels 2013; Bertolani et al. 2014b), by: smaller cuticular pores (up to 2.4 μm in the new species vs 3.5 μm in M. martini), smooth lunules IV (lunules IV slightly dentate in M. martini), the presence of a subterminal constriction in the second macroplacoid (the second macroplacoid without constrictions in M. martini), stylet supports inserted more anteriorly (pt = 69.3–72.7 in the new species vs pt = 72.9–74.9 in M. martini), a different morphology of the reticulation on the egg surface (peribasal meshes of similar size compared to interbasal meshes in the new species vs peribasal meshes distinctly larger compared to interbasal meshes in M. martini), a different morphology of terminal discs of egg processes (margins on the terminal discs slightly and densely indented with the disc surface covered by granulation vs. margins of terminal discs with poorly visible indentation and discs surface without granulation in M. martini), higher egg processes (7.0–11.6 μm in the new species vs 3.0–5.8 μm in M. Table 6. Measurements [in µm] of selected morphological structures of individuals of Paramacrobiotus filipi sp. nov. individuals mounted in Hoyer’s medium Character N Range Mean SD Holotype µm pt µm pt µm pt µm pt Body length 20 245–537 778–1144 372 943 80 100 295 792 Buccal tube Buccal tube length 20 29.9–47.5 – 39.1 –5.1 –37.3 – Stylet support insertion point 20 22.9–37.2 75.2–79.6 30.4 77.6 4.1 1.1 28.9 77.5 Buccal tube external width 20 5.2–10.4 16.7–22.4 7.7 19.4 1.6 1.8 8.0 21.4 Buccal tube internal width 20 3.9–7.9 12.9–17.5 6.0 15.1 1.2 1.4 5.9 15.8 Ventral lamina length 19 17.5–27.1 54.9–66.1 23.4 60.0 2.9 2.3 23.3 62.5 Placoid lengths Macroplacoid 1 20 4.0–9.4 11.9–20.0 6.3 16.0 1.4 2.0 6.1 16.4 Macroplacoid 2 20 2.4–6.2 8.0–13.8 4.3 10.9 1.1 1.6 3.7 9.9 Macroplacoid 3 20 4.5–10.2 14.6–21.5 7.0 17.8 1.7 2.0 6.6 17.7 Microplacoid 20 1.5–3.5 4.0–8.6 2.5 6.3 0.5 1.1 1.9 5.1 Macroplacoid row 20 13.6–27.5 44.4–58.6 19.8 50.1 4.1 4.3 18.9 50.7 Placoid row 20 17.4–34.5 52.9–73.6 25.4 64.3 5.2 5.5 24.3 65.1 Claw 1 heights External primary branch 16 8.7–12.1 23.6–31.6 10.6 26.3 1.0 2.1 11.8 31.6 External secondary branch 16 6.2–9.1 14.9–23.6 8.0 19.8 0.8 2.1 8.8 23.6 Internal primary branch 15 8.8–12.2 21.8–29.5 10.0 25.4 1.0 2.0 9.2 24.7 Internal secondary branch 15 6.0–10.0 15.0–22.5 7.4 18.7 1.0 2.1 7.4 19.8 Claw 2 heights External primary branch 19 8.2–13.4 22.2–30.6 10.7 27.4 1.3 1.9 10.8 29.0 External secondary branch 20 6.2–10.2 15.9–23.7 8.2 21.0 1.1 1.9 8.0 21.4 Internal primary branch 19 6.9–11.9 23.1–27.7 9.7 25.0 1.3 1.5 9.0 24.1 Internal secondary branch 18 5.1–9.3 17.1–22.2 7.5 19.2 1.1 1.4 ?? Claw 3 heights External primary branch 17 7.7–13.2 25.1–31.6 10.9 27.7 1.6 1.8 11.8 31.6 External secondary branch 18 5.7–10.4 17.3–23.7 8.3 21.1 1.3 1.6 8.6 23.1 Internal primary branch 17 7.4–12.3 22.8–28.5 10.0 25.8 1.5 1.6 ?? Internal secondary branch 17 5.2–10.4 15.2–24.0 7.7 19.6 1.5 2.1 ?? Claw 4 heights Anterior primary branch 11 8.1–13.9 27.1–36.2 11.2 30.4 1.9 3.1 13.3 35.7 Anterior secondary branch 13 4.9–13.5 16.4–29.2 8.8 21.7 2.1 3.5 10.4 27.9 Posterior primary branch 5 10.3–15.0 30.1–32.0 12.4 31.2 1.9 0.7 11.6 31.1 Posterior secondary branch 7 6.0–10.5 18.9–23.9 8.9 21.7 1.6 2.0 8.9 23.9 N, number of specimens/structures measured; Ranger, refers to the smallest and the largest structure among all measured specimens; SD, standard deviation). page 16 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan Fig. 9. Paramacrobiotus filipi sp. nov., habitus, body granulation and cuticular structures on legs (PCM). A, dorso-ventral projection (holotype, Hoyer’s medium); B, body granulation on the dorso-caudal part of the body (paratype); C, granulation on the external surface of leg II (paratype); D, pulvinus on the internal surface of leg II (paratype); E, granulation on leg IV (holotype). Empty flat arrowhead indicates granulation on the external leg surface, filled flat arrowhead indicates a pulvinus, filled and empty indented arrowheads indicate les and more denser granulation on leg IV, respectively. Scale bars in μm. page 17 of 25 Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan martini), and by wider terminal discs of egg processes (5.3–9.8 μm in the new species vs 2.5–5.0 μm in M. martini). M. santoroi, reported only from its type locality in Australia (Pilato and D'Urso 1976), by: the presence of a subterminal constriction in the second macroplacoid (the second macroplacoid without constriction in M. santoroi), typically developed terminal discs of egg processes (processes peg-shaped, with strongly reduced terminal discs in M. santoroi), the presence of evident reticulation on the egg surface between the processes, with large meshes with a diameter that is always larger than the mesh walls and nodes (very fine mesh with evident and wide walls and nodes, giving the false impression of a granulated surface in M. santoroi), larger eggs (egg full and bare diameter respectively 91.0–129.5 μm and 77.2–112.5 μm in the new species vs up to 84.0 μm and up to 76.0 μm in M. santoroi), higher egg processes (7.0–11.6 μm in the new species vs up to 4.0 μm in M. santoroi), and by a lower number of processes on the egg circumference (26–34 processes in the new species vs. 37–40 processes in M. santoroi). Genotypic differential diagnosis of Macrobiotus crustulus sp. nov. The ranges of uncorrected genetic p-distances between the new species and species of the Macrobiotus hufelandi complex, the sequences of which are available from GenBank, are as follows (from the most to the least conservative): 18S rRNA: 1.46–4.65% (2.82% on average), with the most similar being an undetermined M. hufelandi complex species from Spain (FJ435738–9), Macrobiotus canaricus Stec, Krzywański and Michalczyk, 2018 from Spain (MH063925), Macrobiotus macrocalix Bertolani and Rebecchi, 1993 from Poland (MH063926) and the least similar being Macrobiotus polypiformis Roszkowska, Ostrowska, Stec, Janko and Kaczmarek, 2017 from Ecuador (KX810008). Fig. 10. Paramacrobiotus filipi sp. nov., claws (PCM). A–B, claws II (A, paratype) and IV (B, holotype). Filled flat arrowheads arrowhead indicate the horseshoe structure connecting the anterior and the posterior claw. Scale bars in μm. Table 7. Measurements [in µm] of selected morphological structures of the eggs of Paramacrobiotus filipi sp. nov. mounted in Hoyer’s medium Character N Range Mean SD Egg bare diameter 5 61.4–65.4 63.9 1.7 Egg full diameter 5 99.0–104.5 102.4 2.4 Process height 29 17.8–25.2 20.7 1.8 Process base width 29 11.7–21.7 16.5 2.4 Process base/height ratio 29 55%–100% 80% 12% Inter-process distance 26 2.0–7.1 4.7 1.4 Number of processes on the egg circumference 4 10–11 10.3 0.5 N, number of eggs/structures measured; Range, refers to the smallest and the largest structure among all measured specimens; SD, standard deviation. page 18 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan Fig. 11. Paramacrobiotus filipi sp. nov., buccal apparatus and the oral cavity armature seen in PCM. A, dorso-ventral projection of the buccal apparatus (paratype); B–D, oral cavity armature, dorsal (B, D) and ventral (C, E) view (B and C holotype, D and E paratype); F–G, placoid morphology, dorsal (F, holotype) and ventral (E, paratype) view. Filled indented arrowheads indicate the subdivided medio-ventral tooth of the third band of teeth, flat empty arrowheads indicate the subterminal constriction in the third macroplacoid. Scale bars in μm. page 19 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan 28S rRNA: 6.22–12.89% (8.86% on average), with the most similar being M. macrocalix from Poland (MH063935) and the least similar being M. polypiformis from Ecuador (KX810009). ITS-2: 15.15–30.81% (21.04% on average), with the most similar being M. canaricus from Spain (MH063928) and the least similar M. scoticus Stec, Morek, Gąsiorek, Blagden and Michalczyk, 2017 from Scotland (KY797268). COI: 20.13–26.79% (22.23% on average), with the most similar being M. terminalis Bertolani and Rebecchi, 1993 from Italy (AY598775) and the least similar being M. papei Stec, Kristensen and Michalczyk, 2018 from Tanzania (MH057763). Phenotypic differential diagnosis of P. filipi sp. nov. By having three macroplacoids and a microplacoid, granulation on all legs, all lunules smooth and eggs with processes terminated with small terminal discs, the new species is very similar to P. alekseevi, reported only from its type locality in Thailand (Tumanov 2005) and from China (Beasley and Miller 2007), but differs from it specifically by: the presence of body granulation which is visible under PCM (granulation absent or not visible under PCM in P. alekseevi), the medio-ventral tooth subdivided into two smaller teeth (medio-ventral tooth always subdivided into three to five smaller teeth in P. alekseevi), and by porous areoles (areoles without pores or pores not visible under PCM in P. alekseevi). Genotypic differential diagnosis of P. filipi sp. nov. The ranges of uncorrected genetic p-distances between the new species and species of the genus Paramacrobiotus, for which sequences are available from GenBank, are as follows (from the most to the least conservative): 18S rRNA: 1.86–4.53% (2.18% on average), with the most similar being P. richtersi s.s. (Murray, 1911) from Ireland (MK041023), P. spatialis Guidetti, Cesari, Bertolani, Altiero and Rebecchi, 2019 from Italy (MK041024–6), P. fairbanksi Schill, Forster, Dandekar and Wolf, 2010 from Italy and Poland (MK041027–9, MH664941–2), P. depressus Guidetti, Cesari, Bertolani, Altiero and Rebecchi, 2019 from Italy (MK041030), P. celsus Guidetti, Cesari, Bertolani, Altiero and Rebecchi, 2019 from Italy (MK041031), P. arduus Guidetti, Cesari, Bertolani, Altiero and Rebecchi, 2019 from Italy (MK041032), an undetermined P. richtersi complex species from Italy, Portugal, New Zealand, Norway, France and Australia (HQ604985–6, MH664932, MH664934, MH664939–42, MH664944) and the least similar being P. areolatus (Murray, 1907) from Norway (MH664931). Fig. 12. Paramacrobiotus filipi sp. nov., egg chorion morphology seen in PCM. A–B, egg surface under 1000× magnification; C–F, midsections of egg processes under 1000× magnification. Filled flat arrowheads indicate sculptured and porous areole surface. Scale bars in μm. page 20 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan Fig. 13. Paramacrobiotus filipi sp. nov., egg chorion morphology seen in SEM. A, entire egg; B–D, magnification on the egg processes and areoles; E– F, details of the egg processes apices terminated small terminal discs. Scale bars in μm. page 21 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan 28S rRNA: 3.63–8.65% (5.06% on average), with the most similar being P. experimentalis Kaczmarek, Mioduchowska, Poprawa and Roszkowska, 2020 from Madagascar (MN073466–5) and the least similar being P. areolatus from Norway (MH664948). COI: 22.16–27.05% (24.51% on average), with the most similar being an undetermined P. richtersi complex species from Brazil (MH676002) and the least similar being P. arduus from Italy (MK041022). CONCLUSIONS We identified two new tardigrade species using an integrative approach based on morphological distinctions to congeners and a genetic comparison using four DNA fragments. Moreover, Macrobiotus crustulus sp. nov. is the first ever tardigrade species reported from French Guiana, whereas Paramacrobiotus filipi sp. nov. is only the fourth species reported from Malaysia. Fig. 14. Paramacrobiotus alekseevi (Tumanov, 2005), details of animals and egg chorion morphology (PCM). A–B, granulation and claws on legs III (A, holotype) and IV (B, holotype); C–D, egg surface under 1000× magnification; E–F, ventral view on the oral cavity armature (E – holotype, F – paratype). Empty flat and indented arrowheads indicate granulation on leg III and IV, respectively, filled flat arrowheads indicate sculptures areoles without pores, filled indented arrowheads indicate subdivided medio-ventral tooth of the third band of teeth. Scale bars in μm. page 22 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan Moreover, the re-examination of the type material of P. alekseevi enabled us to amend its description. Acknowledgment: This work and the new species name have been registered with ZooBank under urn:lsid:zoobank.org:pub:C81767B5-2BA3-402A93C1-1DFBAD256482. We would like to thank to our colleagues Bartłomiej Surmacz, Witold Morek and Piotr Gąsiorek for collecting the samples which allowed us to conduct this study. The sampling in Borneo was supported by the Polish Ministry of Science and Higher Education via the Diamond Grant (DI2015 014945 to Piotr Gąsiorek, supervised by Łukasz Michalczyk). We are also very grateful Denis Tumanov for sending us the type material and microphotographs of type specimens of P. alekseevi and to Witold Morek for his help with SEM imagining. Finally we are also indebted to two anonymous reviewers for their valuable comments and suggestion on our manuscript. The study was supported by the Sonata Bis programme of the Polish National Science Centre (grant no. 2016/22/E/NZ8/00417 to ŁM) and by the grant from the European Commission’s programme “Transnational Access to Major Research Infrastructures” to SYNTHESYS (grant no. DKTAF-2693 to DS). Authors’ contributions: DS and ŁM conceived the study. DM collected and analysed molecular data. DS and MD examined the sample, provided the measurements and photographs of the new species, prepared the figures and drafted the manuscript. ŁM supervised the entire process and drafted the manuscript. All the authors read and approved the final manuscript. Competing interests: The authors declare that they have no competing interests. Availability of data and materials: The slides and SEM stubs are deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa 9, 30-387 Kraków, Poland. Consent for publication: Not applicable. Ethics approval consent to participate: Not applicable. REFERENCES Bartels P, Pilato G, Lisi O, Nelson DR. 2009. Macrobiotus (Eutardigrada, Macrobiotidae) from the Great Smoky Mountains National Park, Tennessee/North Carolina, USA (North America): two new species and six new records. Zootaxa 2022:45–57. doi:10.11646/zootaxa.2022.1.4. Beasley CW, Miller WR. 2007. Tardigrada of Xinjiang Uygur Autonomous Region, China. J Limnol 66:49–55. doi:10.4081/ jlimnol.2007.s1.49. Bertolani R, Bartels PJ, Guidetti R, Cesari M, Nelson DR. 2014b. Aquatic tardigrades in the Great Smoky Mountains National Park, North Carolina and Tennessee, U.S.A., with the description of a new species of Thulinius (Tardigrada, Isohypsibiidae). Zootaxa 3764(5):524–536. doi:10.11646/zootaxa.3764.5.2. Bertolani R, Biserov V, Rebecchi L, Cesari M. 2011b. Taxonomy and biogeography of tardigrades using an integrated approach: new results on species of the Macrobiotus hufelandi group. Invertebrate Zoology 8(1):23–36. doi:10.15298/ invertzool.08.1.05. Bertolani R, Guidetti R, Marchioro T, Altiero T, Rebecchi L, Cesari M. 2014a. Phylogeny of Eutardigrada: New molecular data and their morphological support lead to the identification of new evolutionary lineages. Mol Phylogenet Evol 76:110–126. doi:10.1016/j.ympev.2014.03.006. Bertolani R, Rebecchi L. 1993. A revision of the Macrobiotus hufelandi group (Tardigrada, Macrobiotidae), with some observations on the taxonomic characters of eutardigrades. Zool Scr 22:127–152. doi:10.1111/j.1463-6409.1993.tb00347.x. Bertolani R, Rebecchi L, Giovannini I, Cesari M. 2011a. DNA barcoding and integrative taxonomy of Macrobiotus hufelandi C.A.S. Schultze 1834, the first tardigrade species to be described, and some related species. Zootaxa 2997:19–36. doi:10.11646/ zootaxa.2997.1.2. Binda MG, Pilato G. 1984. Macrobiotus sapiens, nuova specie di Eutardigrado di Sicilia. Animalia 11:85–90. Bochnak M, Vončina K, Kristensen RM, Gąsiorek P. 2020. Continued exploration of Tanzanian rainforests reveals a new echiniscid species (Heterotardigrada). Zool Stud 59:18. doi:10.6620/ ZS.2020.59-18. Caicedo M, Arquez M, Castro LR, Quiroga S. 2017. Genetic barcoding in a Paramacrobiotus species (Tardigrada: Parachela) in Santa Mata, Colombia. Revista Intropica 12:1. doi:10.21676/23897864.2125. Casquet JT, Thebaud C, Gillespie RG. 2012. Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Mol Ecol Resour 12:136–141. doi:10.1111/j.1755-0998.2011.03073.x. Cesari M, Bertolani R, Rebecchi L, Guidetti R. 2009. DNA barcoding in Tardigrada: the first case study on Macrobiotus macrocalix Bertolani & Rebecchi 1993 (Eutardigrada, Macrobiotidae). Mol Ecol Resour 9(3):699–706. doi:10.1111/j.17550998.2009.02538.x. Cesari M, Giovanni I, Bertolani R, Rebecchi L. 2011. An example of problems associated with DNA barcoding in tardigrades: a novel method for obtaining voucher specimens. Zootaxa 3104:42–51. doi:10.11646/zootaxa.3104.1.3. Coughlan K, Michalczyk Ł, Stec D. 2019. Macrobiotus caelestis sp. nov., a new tardigrade species (Macrobiotidae: hufelandi group) from the Tien Shan Mountains (Kyrgyzstan). Annales Zoologici 69(3):499–513. doi:10.3161/00034541ANZ2019.69.3.002. Coughlan K, Stec D. 2019. Two new species of the Macrobiotus hufelandi complex (Tardigrada: Eutardigrada: Macrobiotidae) from Australia and India, with notes on their phylogenetic position. Eur J Taxon 573:1–38. doi:10.5852/ejt.2019.573. Dastych H. 1980. Niesporczaki (Tardigrada) Tatrzańskiego Parku Narodowego. Monografie Fauny Polski 9:1–232. Degma P, Bertolani R, Guidetti R. 2009–2019. Actual checklist of Tardigrada species. doi:10.25431/11380_1178608. Degma P, Guidetti R. 2007. Notes to the current checklist of Tardigrada. Zootaxa 1579:41–53. doi:10.11646/ zootaxa.1579.1.2. page 23 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan Doyère LMF. 1840. Memoire sur les Tardigrades. I. Ann Sci Nat Paris Series 2 14:269–362. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299. Gąsiorek P, Michalczyk Ł. 2020. Phylogeny of Itaquasconinae in light of the evolution of the flexible pharyngeal tube in Tardigrada. Zool Scr 49:499–151. doi:10.1111/zsc.12424. Gąsiorek P, Stec D, Zawierucha Z, Kristensen RM, Michalczyk Ł. 2018. Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa 4472(2):261–297. doi:10.11646/zootaxa.4472.2.3. Gąsiorek P, Vončina K, Michalczyk Ł. 2020. An overview of the sexual dimorphism in Echiniscus (Heterotardigrada, Echiniscoidea), with the description of Echiniscus masculinus sp. nov. (the virginicus complex) from Borneo. Zoosyst Evol 96(1):103–113. doi:10.3897/zse.96.49989. Gąsiorek P. 2018. New Bryodelphax species (Heterotardigrada: Echiniscidae) from Western Borneo (Sarawak), with new molecular data for the genus. Raffles B Zool 66:371–381. Guidetti R, Bertolani R. 2005. Tardigrade taxonomy: an updated check list of the taxa and a list of characters for their identification. Zootaxa 845:1–46. doi:10.11646/zootaxa.845.1.1. Giribet G, Carranza S, Baguña J, Riutort M, Ribera C. 1996. First molecular evidence for the existence of a Tardigrada + Arthropoda clade. Mol Biol Evol 13:76–84. doi:10.1093/ oxfordjournals.molbev.a025573. Guidetti R, Cesari M, Bertolani R, Altiero T, Rebecchi L. 2019. High diversity in species, reproductive modes and distribution within the Paramacrobiotus richtersi complex (Eutardigrada, Macrobiotidae). Zool Lett 5:1. doi:10.1186/s40851-018-0113-z. Guidetti R, Gandolfi A, Rossi V, Bertolani R. 2005. Phylogenetic analysis of Macrobiotidae (Eutardigrada, Parachela): a combined morphological and molecular approach. Zool Scr 34:235–244. doi:10.1111/j.1463-6409.2005.00193.x. Guidetti R, Peluffo JR, Rocha AM, Cesari M, Moly de Peluffo MC. 2013. The morphological and molecular analyses of a new South American urban tardigrade offer new insights on the biological meaning of the Macrobiotus hufelandi group of species (Tardigrada: Macrobiotidae). J Nat Hist 47(37–38):2409–2426. doi:10.1080/00222933.2013.800610. Guidetti R, Schill RO, Bertolani R, Dandekar T, Wolf M. 2009. New molecular data for tardigrade phylogeny, with the erection of Paramacrobiotus gen. nov. J Zool Syst Evol Res 47(4):315–321. doi:10.1111/j.1439-0469.2009.00526.x. Guil N, Giribet G. 2012. A comprehensive molecular phylogeny of tardigrades – adding genes and taxa to a poorly resolved phylumlevel phylogeny. Cladistics 28(1):21–49. doi:10.1111/j.10960031.2011.00364.x. Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98. Kaczmarek Ł, Cytan J, Zawierucha K, Diduszko D, Michalczyk Ł. 2014. Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa 3790:357–379. doi:10.11646/zootaxa.3790.2.5. Kaczmarek Ł, Gawlak M, Bartels PJ, Neslon DR, Roszkowska M. 2017. Revision of the genus Paramacrobiotus Guidetti et al., 2009 with the description of a new species, re-descriptions and a key. Annales Zoologici 67(4):627–656. doi:10.3161/00034541A NZ2017.67.4.001. Kaczmarek Ł, Michalczyk Ł. 2017. The Macrobiotus hufelandi (Tardigrada) group revisited. Zootaxa 4363:101–123. doi:10.11646/zootaxa.4363.1.4. Kaczmarek Ł, Roszkowska M, Poprawa I, Janelt K, Kmita H, Gawlak M, Fiałkowska E, Mioduchowska M. 2020. Integrative description of bisexual Paramacrobiotus experimentalis sp. nov. (Macrobiotidae) from republic of Madagascar (Africa) with microbiome analysis. Mol Phylogenet Evol 145:106730. doi:10.1016/j.ympev.2019.106730. Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059–66. doi:10.1093/ nar/gkf436. Katoh K, Toh H. 2008. Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinform 9:286–298. doi:10.1093/bib/bbn013. Kayastha P, Berdi D, Mioduchowska M, Gawlak M, Łukasiewicz A, Gołdyn B, Kaczmarek Ł. 2020. Some tardigrades from Nepal (Asia) with integrative description of Macrobiotus wandae sp. nov. (Macrobiotidae: hufelandi group). Annales Zoologici 70:121–142. doi:10.3161/00034541ANZ2020.70.1.007. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evol 33:1870–1874. doi:10.1093/molbev/msw054. Marley NJ, McInnes SJ, Sands CJ. 2011. Phylum Tardigrada: A re– evaluation of the Parachela. Zootaxa 2819:51–64. doi:10.11646/ zootaxa.2819.1.2. Michalczyk Ł, Kaczmarek Ł. 2003. A description of the new tardigrade Macrobiotus reinhardti (Eutardigrada, Macrobiotidae, harmsworthi group) with some remarks on the oral cavity armature within the genus Macrobiotus Schultze. Zootaxa 331:1–24. doi:10.11646/zootaxa.331.1.1. Michalczyk Ł, Kaczmarek Ł. 2013. The Tardigrada Register: a comprehensive online data repository for tardigrade taxonomy. J Limnol 72:175–181. doi:10.4081/jlimnol.2013.s1.e22. Mironov SV, Dabert J, Dabert M. 2012. A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa 3253:54–61. doi:10.11646/ zootaxa.3253.1.2. Morek W, Stec D, Gąsiorek P, Schill RO, Kaczmarek Ł, Michalczyk Ł. 2016. An experimental test of eutardigrade preparation methods for light microscopy. Zool J Linnean Soc 178:785–793. doi:10.1111/zoj.12457. Murray J. 1907. Arctic Tardigrada, collected by William S. Bruce. Earth Env Sci T R So 45:669–681. Murray J. 1911. Clare Island Survey Arctiscoida. Proc R Ir Acad C 31:1–16. Nelson DR, Bartels PJ. 2013. Species richness of soil and leaf litter tardigrades in the Great Smoky Mountains National Park (North Carolina/Tennessee, USA). J Limnol 72:144–151. doi:10.4081/ jlimnol.2013.s1.e18. Nelson DR, Guidetti R, Rebecchi L. 2015. Phylum Tardgrada. In: Thorp and Covich’s Freshwater Invertebrates. Academic Press, pp. 347–380. doi:10.1016/B978-0-12-385026-3.00017-6. Nowak B, Stec D. 2018. An integrative description of Macrobiotus hannae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Poland. Turk J Zool 42:269–286. doi:10.3906/zoo-1712-31. Pilato G, Binda MG. 2010. Definition of families, subfamilies, genera and subgenera of the Eutardigrada, and keys to their identification. Zootaxa 2404:1–52. doi:10.11646/ zootaxa.2404.1.1. Pilato G, Binda MG, Lisi O. 2004. Famelobiotus salici, n. gen. n. sp., page 24 of 25Zoological Studies 59:23 (2020)
© 2020 Academia Sinica, Taiwan a new eutardigrade from Borneo. New Zeal J Zool 31:57–60. doi:10.1080/03014223.2004.9518359. Pilato G, Binda MG. 1983. Descrizione du una nuova specie di Eutardigrado d’Australia Macrobiotus joannae n. sp. Animalia 10:262–272. Pilato G, D'Urso V. 1976. Contributo alla conoscenza dei Tardigradi d’Australia. Animalia 3:135–145. Pilato G, Kaczmarek Ł, Michalczyk Ł, Lisi O. 2003. Macrobiotus polonicus, a new species of Tardigrada from Poland (Eutardigrada, Macrobiotidae, 'hufelandi group'). Zootaxa 258:1–8. doi:10.11646/zootaxa.258.1.1. Pilato G. 1981. Analisi di nuovi caratteri nello studio degli Eutardigradi. Animalia 8:51–57. Ramazzotti G. 1956. Tre nouve specie di Tardigradi ed altre specie poco comuni. Atti Soc Nat Milano 95:284–291. Richters F. 1926. Tardigrada. In: Kükenthal, W. & Krumbach, T. (Eds.) Handbuch der Zoologie Vol. 3. Walter de Gruyter & Co., Berlin & Leipzig, pp. 58–61. Roszkowska M, Ostrowska M, Stec D, Janko K, Kaczmarek Ł. 2017. Macrobiotus polypiformis sp. nov., a new tardigrade (Macrobiotidae; hufelandi group) from the Ecuadorian Pacific coast, with remarks on the claw abnormalities in eutardigrades. Eur J Taxon 327:1–19. doi:10.5852/ejt.2017.327. Schill RO, Forster F, Dandekar T, Wolf N. 2010. Using compensatory base change analysis of internal transcribed spacer 2 secondary structures to identify three new species in Paramacrobiotus (Tardigrada). Org Divers Evol 10(4):287–296. doi:10.1007/ s13127-010-0025-z. Schultze CAS. 1834. Macrobiotus Hufelandii animal e crustaceorum classe novum, reviviscendi post diuturnam asphixiam et aridiatem potens, etc. 8, 1 tab. C. Curths, Berlin, 6 pp, I Table. Schuster RO, Nelson DR, Grigarick AA, Christenberry D. 1980. Systematic criteria of the Eutardigrada. T Am Microsc Soc 99:284–303. Stec D, Arakawa K, Michalczyk Ł. 2018d. An integrative description of Macrobiotus shonaicus sp. nov. (Tardigrada: Macrobiotidae) from Japan with notes on its phylogenetic position within the hufelandi group. PLoS ONE 13:e0192210. doi:10.1371/journal. pone.0192210. Stec D, Gąsiorek P, Morek W, Kosztyła P, Zawierucha K, Michno K, Kaczmarek Ł, Prokop ZM, Michalczyk Ł. 2016. Estimating optimal sample size for tardigrade morphometry. Zool J Linnean Soc 178:776–784. doi:10.1111/zoj.12404. Stec D, Kristensen RM, Michalczyk Ł. 2018c. Integrative taxonomy identifies Macrobiotus papei, a new tardigrade species of the Macrobiotus hufelandi complex (Eutardigrada: Macrobiotidae) from the Udzungwa Mountains National Park (Tanzania). Zootaxa 4446:273–291. doi:10.11646/zootaxa.4446.2.7. Stec D, Kristensen RM, Michalczyk Ł. 2020c. An integrative description of Minibiotus ioculator sp. nov. from the Republic of South Africa with notes on Minibiotus pentannulatus Londoño et al., 2017 (Tardigrada: Macrobiotidae). Zool Anz 286:117–134. doi:10.1016/j.jcz.2020.03.007. Stec D, Krzywański Ł, Michalczyk Ł. 2018b. Integrative description of Macrobiotus canaricus sp. nov. with notes on M. recens (Eutardigrada: Macrobiotidae). Eur J Taxon 452:1–36. doi:10.5852/ejt.2018.452. Stec D, Krzywański Ł, Zawierucha K, Michalczyk Ł. 2020b. Untangling systematics of the Paramacrobiotus areolatus species complex by an integrative redescription of the nominal species for the group, with multilocus phylogeny and species delineation within the genus Paramacrobiotus. Zool J Linnean Soc 188(3):694–716. doi:10.1093/zoolinnean/zlz163. Stec D, Morek W, Gąsiorek P, Blagden B, Michalczyk Ł. 2017b. Description of Macrobiotus scoticus sp. nov. (Tardigrada: Macrobiotidae: hufelandi group) from Scotland by means of integrative taxonomy. Annales Zoologici 67:181–197. doi:10.31 61/00034541ANZ2017.67.2.001. Stec D, Morek W, Gąsiorek P, Michalczyk Ł. 2018a. Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Syst Biodivers 16(4):357–376. doi:10.1080/1477200 0.2018.1424267. Stec D, Roszkowska M, Kaczmarek Ł, Michalczyk Ł. 2018e. Paramacrobiotus lachowskae, a new species of Tardigrada from Colombia (Eutardigrada: Parachela: Macrobiotidae). New Zeal J Zool 45(1):43–60. doi:10.1080/03014223.2017.1354896. Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł. 2015. An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052:501–526. doi:10.11646/zootaxa.4052.5.1. Stec D, Tumanov DT, Kristensen RM. 2020a. Integrative taxonomy identifies two new tardigrade species (Eutardigrada: Macrobiotidae) from Greenland. Eur J Taxon 614:1–40. doi:10.5852/ejt.2020.614. Stec D, Zawierucha K, Michalczyk Ł. 2017a. An integrative description of Ramazzottius subanomalus (Biserov, 1985) (Tardigrada) from Poland. Zootaxa 4300(3):403–420. doi:10.11646/zootaxa.4300.3.4. Surmacz B, Morek W, Michalczyk Ł. 2019. What if multiple claw configurations are present in a sample? A case study with the description of Milnesium pseudotardigradum sp. nov. (Tardigrada) with unique developmental variability. Zool Stud 58:32. doi:10.6620/ZS.2019.58-32. Thulin G. 1928. Über die Phylogenie und das System der Tardigraden. Hereditas 11:207–266. Tumanov DV. 2005. Notes on the Tardigrada of Thailand, with a description of Macrobiotus alekseevi sp. nov. (Eutardigrada, Macrobiotidae). Zootaxa 980:1–16. doi:10.11646/ zootaxa.999.1.1. Wełnicz W, Grohme MA, Kaczmarek Ł, Schill RO, Frohme M. 2011. ITS-2 and 18S rRNA data from Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada, Tardigrada). J Zool Syst Evol Res 49:34–39. doi:10.1111/j.1439-0469.2010.00595.x. Supplementary Materials Table S1. Raw morphometric data for Macrobiotus crustulus sp. nov. (download) Table S2. Raw morphometric data for Paramacrobiotus filipi sp. nov. (download) Table S3. Uncorrected pairwise distances. (download) page 25 of 25Zoological Studies 59:23 (2020)