Full text
Utech-S Photonic BioImaging RNA imaging group 1 of 6 smFISH: signal amplification with SABER Short name: smFISH_SABER Version: 2 Date: 1.7.2025 Abstract: SABER enables programmable amplification by generating longer oligos with repeated binding sites for secondary imaging oligos. More information can be found in the original paper (Kishi et al., 2019). We use these amplicons not on the primary oligos but attached to the barcode oligos from the ORCA approach (Bintu et al., 2018). We also employ this approach in sequential smFISH, as the amplified oligos can be stripped (see the separate protocol). To reduce background while maintaining protocol compatibility with the fluidics system, we employ a 3-stage hybridization strategy to optimize stringency for each step. • Primary probes: more stringent hybridization of (1X, 30% formamide, 10% dextran) instead of our usual (2X, 20% formamide. • SABER-Amplicons: buffer with (2xSSC, 20% Formamide, 10% dextran), dextran for reduced background and lower probe concentration. • Imager: A low-stringency buffer (2X SSC, 10% formamide, 10% dextran) was used to preserve oligo binding, likely due to the low Tm of the G-free imager; dextran enables reduced fluorophore concentration. 1 General points ...................................................................................................................................................... 3 2 Materials .............................................................................................................................................................. 3 2.1 Reagents ................................................................................................................................................................ 3 2.2 Oligos ..................................................................................................................................................................... 3 2.2.1 Nomenclature ................................................................................................................................................ 3 2.3 Equipment .............................................................................................................................................................. 3 2.4 Buffers .................................................................................................................................................................... 3 2.4.1 Wash buffers .................................................................................................................................................. 4 2.4.2 Hybridization buffers ..................................................................................................................................... 4 2.4.2.1 Hybridization buffer for primary oligos ................................................................................................. 4 2.4.2.2 Hybridization buffer for SABER probes .................................................................................................. 4 2.4.2.3 Hybridization buffer for imaging probes ................................................................................................ 4
2 of 6 3 Methods ............................................................................................................................................................... 4 3.1 Important considerations ...................................................................................................................................... 4 3.2 Saber amplification ................................................................................................................................................ 4 3.2.1 Prepare amplification mix .............................................................................................................................. 5 3.2.2 Amplification .................................................................................................................................................. 5 3.3 Day 1-2: fixation, permeabilization, primary probe hybridization ......................................................................... 5 3.4 Day 3: SABER amplification on the bench .............................................................................................................. 5 3.5 Day 3: SABER amplification for autoFISH ............................................................................................................... 6 4 References ............................................................................................................................................................ 6 5 Version history and archiving ................................................................................................................................ 6
3 of 6 1 General points • We found that the imagers can carry two fluorophores (3’ and 5’). This leads to a signal increase. • For moderate amplification (3X sites), oligos up to 84 nts can be directly purchased (IDT). These oligos are inexpensive and enable rapid experimentation. 2 Materials 2.1 Reagents Isothermal Buffer 10X M0537 NEB MgSO4 100mM M0537 NEB dATP 10mM U1330 Promega dCTP 10mM U1330 Promega dTTP 10mM U1330 Promega Clean.G 10µM 10mM CCCCGAAAGTGGCCTCGGGCCTTTTGGCCCGAGGCCACTTTCG Hairpin 100µM 40-45bp Bst LF Pol 8U/µL M0537 NEB OLIGOS 40bp MiniElute columns 28004 Qiagen 2.2 Oligos We order all oligos from IDT unless specified otherwise. Indicated prices are only indicative. 2.2.1 Nomenclature • All oligos targeting a specific gene carries an additional sequence termed “readout X”. • The amplified SABER oligos carry the complementary sequence to this readout sequence. We refer to these oligos as readouts ROX , where the X indicates against which readout they are designed. • SABER proposed different hairpin sequence (HP) that can be amplified, these are referred to as HPY where Y is and index from the original paper, e.g. we often use HP27. • Readout oligos also carry a toehold sequence that allows stripping them to remove the signal. • Imager oligos are specific against the amplicons obtained from the used HP. 2.3 Equipment • PCR machine • Electrophoresis system with camera 2.4 Buffers For one 12 mm coverslip washed in a 24-well plate, we usually use Buffer Day 1 Day 2 2X SSC 2 mL 2 mL Wash buffer I 1 mL 2 mL Wash buffer II - 3 mL Wash buffer III - 3 mL
4 of 6 2.4.1 Wash buffers For 10mL, adjust accordingly for your experiment. Reagent 2X SSC Wash I 1X SSC 30% F Wash II 1X SSC 20% F Wash III 2X SSC 10% F 20XSSC 1 mL 0.5 mL 0.5 mL 1 mL Formamide 3 mL 2 mL 1 mL H2O DEPC 9 mL 6.5 mL 7.5 mL 8 mL 2.4.2 Hybridization buffers Buffers with different stringency are used to hybridize primary probes, SABER probes, and imager oligos. When using SABER on a fluidic system, we only use 5% Dextran. Otherwise, the buffers become too viscous. When using SABER on the fluidics system, we use EC to hybridize SABER and imager oligos. Reagent Primary Probe SABER Probe Imager-HPy 20XSSC 50 µL 50 µL 100 µL Formamide or EC (bench/fluidics) 300 µL (F/F) 200 µL (F / EC) 100 µL (F / EC) Dextran 40% 10% bench 250 µL 250 µL 250 µL 5% fluidic system 125 µL 125 µL 125 µL Triton 10% 10 µL 10 µL 10 µL H2O DEPC: adjust to 1mL 400 / 525 µL 500 / 625 µL 550/ 575 µL 2.4.2.1 Hybridization buffer for primary oligos See the base protocol; for example, when using oPools, we use 1 µL for 50 µL of hybridization buffer. 2.4.2.2 Hybridization buffer for SABER probes • The goal is to adjust to a final concentration of the amplicon. • Prepare SABER-stock solution (below): 1 µL for 50µL hybridization buffer Reagent Amount Comment SABER-ROX-HPY … µL (adjust) Depends on the amplification, target is 40 pmol. 10X NEB3 1 µL H2O DEPC … µL Adjust water accordingly for total volume of 10 µL. Total 10 µL 2.4.2.3 Hybridization buffer for imaging probes • Prepare imager stock solution (see below): 1 µL per 50 µL hybridization Buffer Reagent Amount Imager HPY-CyZ (100 µM) 5 µL 10X NEB3 1 µL H2O DEPC 4 µL 3 Methods 3.1 Important considerations Due to the (strong) signal amplification, individual dots that stem from either non-specific primary probes or amplicons can be seen in the image. To reduce this non-specific signal, hybridization and washing conditions were established that are also compatible with fluidics system. 3.2 Saber amplification Amplicons can be prepared before and stored, or as mentioned above shorter amplicons can be bought directly.
5 of 6 3.2.1 Prepare amplification mix 1. Prepare mix for 100 µL (see below) 2. Heat the mix @ 37°C for 15 min. 3. Add 10 µL Primer Oligo ROX-HP-Y (10 µM). Buffer Amount Final concentration Isothermal Buffer 10X 10 µL 1X MgSO4 100mM 10 µL 10 mM dATP 10mM 5 µL 500 µM dCTP 10mM 5 µL 500 µM dTTP 10mM 5 µL 500 µM Clean.G 10µM 10mM 1 µL 100nM Hairpin 100µM 1 µL 1 µM Bst LF Pol 8U/µL 5 µL 30 U H2O 48 µL 3.2.2 Amplification CRITICAL STEP: length of oligo is proportional to amplification time 1. Incubate at 37°C. 2. Elongation is proportional to the amplification time. For an elongation of 30 min, we obtain oligos of around 200 bases (8-10 repeats). 3. Stop the reaction with 10 min @ 80°C 4. Purify amplified oligos on MiniElute columns. 5. Elution volume: 10 µL (Elution buffer from the kit). 6. Check amplicons on a 2% agarose gel in TAE (Volume = 1 µL). 7. Estimate the concentration of the probe obtained by comparison with a RO at 20 µm . Gel on the right shows ladder (first and last column), and oligos from IDT with different number of repeats (X1, X3) and different amplification times (30 min and 2h). 3.3 Day 1-2: fixation, permeabilization, primary probe hybridization • Follow the base protocol for sample processing up to the step to hybridize primary probes. • CRITICAL STEP: use more stringent hybridization conditions for primary probes (1X SSC, 30% formamide) instead of our usual (2X SSC, 20% formamide). 3.4 Day 3: SABER amplification on the bench 1. Wash after primary probe hybridization a. Wash twice with wash buffer I, incubate @ 37C for 30 min. b. Wash once with wash buffer II, incubate @ RT for 10 min. 2. Hybridization of SABER probes
6 of 6 3. Incubate at 37°C for 30 min in Hybridization buffer (Saber-Probe), protected from light. a. Wash twice with wash buffer II, incubate at 37°C for 30 min. b. Wash once with wash buffer III, incubate at RT for 5 min. 4. Hybridization of imager oligos. 5. Incubate at 37°C for 30 min in Hybridization buffer (Imager). 6. Wash twice with wash buffer III, incubate at 37°C for 30 min. 7. Final washes, DAPI staining, and mounting. a. Wash once with 2X SSC, incubate at RT for 5 min. 8. Wash once with DAPI buffer, incubate at RT for 10 min. a. Wash once with 2X SSC, incubate at RT for 10 min. b. Mount with Prolongold. 3.5 Day 3: SABER amplification for autoFISH • The main differences are in the composition and volumes of the buffers. • Formamide is replaced by Ethylene Carbonate (at the same percentage), and the Dextran concentration is reduced to 5%. • The volumes are to be adjusted. A probe volume of 2 mL in hybridization buffer is required to hybridize a run of fluidic. 4 References Bintu, B. et al. (2018) ‘Super-resolution chromatin tracing reveals domains and cooperative interactions in single cells’, Science (New York, N.Y.), 362(6413). Available at: https://doi.org/10.1126/science.aau1783. Kishi, J.Y. et al. (2019) ‘SABER amplifies FISH: enhanced multiplexed imaging of RNA and DNA in cells and tissues’, Nature Methods, 16(6), pp. 533–544. Available at: https://doi.org/10.1038/s41592-019-0404-0. 5 Version history and archiving Version Date Modfied by Changes v1 31.10.2024 Mueller F, Weber C Initial version. v2 1.7.2025 Mueller F, Weber C Resubmission of autoFISH paper. Improved for clarity.