A new species of Melinnopsis (Annelida, Melinnidae) from the Porcupine Abyssal Plain, northeast Atlantic

1 A new species of Melinnopsis (Annelida, Melinnidae) from the Porcupine Abyssal Plain, northeast Atlantic Laetitia M. Gunton1, Amanda Serpell-Stevens2, Kashaf Riaz3, Tammy Horton2 1 School of Ocean and Earth Science, University of Southampton, Southampton, SO14 3ZH, UK 2 National Oceanography Centre Southampton, Southampton SO14 3ZH, UK 3 School of the Environment and Life Sciences, University of Portsmouth, King Henry Building, Portsmouth PO1 2DY, UK Corresponding author: Laetitia M. Gunton ([email protected]) Copyright: © Laetitia M. Gunton et al. This is an open access article distributed under terms of the Creative Commons Attribution License (Attribution 4.0 International – CC BY 4.0). Research Article Abstract A new species of polychaete worm, Melinnopsis nathanieli sp. nov. (Annelida, Melinnidae), is described from the Porcupine Abyssal Plain in the northeast Atlantic at ~4850 m depth. Forty-two specimens were collected during RRS James Cook cruises JC247 and JC263 in 2023 and 2024 respectively. The new species is morphologically similar to Melinnopsis gardelli and Melinnopsis chadwicki, described from deep Australian waters, but differs from these species in having fewer (~ 16) abdominal uncini in a row compared with 30 in both M. gardelli and M. chadwicki. Phylogenetic relationships among the new species and other species in the family Melinnidae were assessed using the nuclear 18S, and the mitochondrial 16S and cytochrome oxidase subunit I (COI) gene fragments. The new species is genetically distinct from all other species of Melinnopsis, where molecular data is available, and genetically most similar to M. gardelli (pairwise distance 3.5%). Tubes of M. nathanieli sp. nov. were observed to act as a biogenic substrate for Actiniaria and Ascidiacea. Seafloor images of Melinnopsis nathanieli sp. inc. at the Porcupine Abyssal Plain show the worm’s tube positioned perpendicular to the sediment surface, and the long buccal tentacle protruding from the tube. A table containing key characters of all known Melinnopsis species is presented. This is the first species of Melinnopsis to be described from the northeast Atlantic. Key words: Atlantic Ocean, deep sea, molecular, phylogenetics, polychaete, taxonomy Introduction Melinnidae Chamberlin, 1919 is a family of tubicolous worms, commonly known as ‘grapple worms’ due to the presence of stout recurved hooks, resembling grappling hooks, which are present in some species. Species of the family Melinnidae are generally restricted to deeper waters. The family currently contains 52 accepted species (Rouse et al. 2022; Read and Fauchald 2025a). Traditionally, Melinninae Chamberlin, 1919 and Ampharetinae Malmgren, 1866 were considered subfamilies, within the family Ampharetidae Malmgren, 1866. Recently, Stiller et al. (2020) used molecular and morphological data to show that Melinninae, was more closely affiliated to the Terebellidae Johnston, 1846, rather than being a sister group to Ampharetinae, and thus assigned family status to Melinnidae. Currently, the Academic editor: Christopher Glasby Received: 5 September 2025 Accepted: 11 November 2025 Published: 23 December 2025 ZooBank: https://zoobank. org/8E086E9A-4BB5-4D7A-A2D12EBD336E9FB7 Citation: Gunton LM, Serpell-Stevens A, Riaz K, Horton T (2025) A new species of Melinnopsis (Annelida, Melinnidae) from the Porcupine Abyssal Plain, northeast Atlantic. ZooKeys 1265: 1–23. https://doi. org/10.3897/zookeys.1265.171206 ZooKeys 1265: 1–23 (2025) DOI: 10.3897/zookeys.1265.171206 2 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic family Melinnidae contains four genera, Isolda Müller, 1858, Melinna Malmgren, 1866, Melinnopsides Day, 1964 and Melinnopsis McIntosh, 1885. Within the genus Melinnopsis, there are 20 recognised species (Read and Fauchald 2025b). The genus was erected for Melinnopsis atlantica McIntosh, 1885 collected off Chesapeake Bay, Maryland in the northwest Atlantic Ocean at ~ 3100 m (1700 fathoms) during the HMS Challenger expedition. Due to the brevity of the original description and lack of justification for the new genus, the ensuing taxonomic history has been complicated, as outlined by Gunton et al. (2020). The most recently described species is Melinnopsis shinkaiae Jimi, Hookabe, Woo & Fujiwara, 2025 from the Daiichi-Kashima Seamount off Japan in the northwest Pacific Ocean at 3623 m depth. Melinnopsis shinkaiae was described based on two specimens using only morphological characters, as attempts to extract and amplify DNA were unsuccessful (Jimi et al. 2025). The most recent descriptions employing genetic data are those of Gunton et al. (2020) which included specimens from Australian waters in the southwest Pacific Ocean at 1006–2821 m depth. Gunton et al. (2020) used molecular (COI, 16S and 18S gene fragments) and morphological data to describe the genetically distinct but morphologically similar species, Melinnopsis chadwicki Gunton, Kupriyanova & Alvestad, 2020 and Melinnopsis gardelli Gunton, Kupriyanova & Alvestad, 2020. To date, only two species of Melinnopsis have been described from the Atlantic Ocean, M. atlantica, the aforementioned type species of the genus, and Melinnopsis angolensis Hilbig, 2005 described from the Angola Basin, southeast Atlantic at 5385–5439 m depth. The Porcupine Abyssal Sustained Observatory (PAP-SO) is a multidisciplinary open-ocean time-series study site in the northeast Atlantic (48°50'N, 16°30'W). PAP-SO has been studied since 1985 and is now the longest running abyssal time-series site in the world (Hartman et al. 2021). Material collected from the site is deposited in The Discovery Collections, National Oceanography Centre, Southampton, an internationally important repository of deep-sea marine benthic and pelagic invertebrate and fish specimens obtained since 1925. Despite this substantial collection of material, the annelid fauna is poorly characterised at the PAPSO. There have been five ecological studies of macrofauna (including annelids at family level) (Paterson et al. 1994; Glover et al. 2001; Galeron et al. 2001; Soto et al. 2010; Laguionie-Marchais et al. 2013), one study on annelid recruitment (Vanreusel et al. 2001), and four species-level studies on annelids from the PAP-SO (Dauvin et al. 1994; Paterson et al. 1998; Soto-Oyarsun 2008; Laguionie-Marchais 2015). To date, only four annelid species from two families have been described or had distributions recorded from the site including the spionids Aurospio abranchiata Neal, Paterson & Soto in Paterson et al., 2016 (type locality Portuguese margin, distribution including PAP at 4800 m), Aurospio tribranchiata Paterson & Soto in Paterson et al., 2016 (type locality PAP at 4800 m), Aurospio dibranchia Maciolek, 1981 (type locality Argentine Basin southwest Atlantic, distribution including near PAP off Ireland, northeast Atlantic at 1500-3350 m), and a pilargid, Sigambra magnuncus Paterson & Glover, 2000 (type locality PAP ca 4850 m). Thus, there is a clear lack of detailed knowledge on the polychaete fauna from the PAP-SO. The present study describes a new species of Melinnopsis, from depths of 4850 m at the Porcupine Abyssal Plain (PAP), northeast Atlantic Ocean. The phylogenetic position of the new species is assessed within the genus Melinnopsis. Furthermore, in-situ seafloor images of Melinnopsis at PAP-SO are presented. 3 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Materials and methods Sample collection Samples were collected during two RRS James Cook cruises to the PAP-SO; JC247 and JC263, in 2023 and 2024 respectively (Table 1, Fig. 1). Onboard, the OTSB14 (semi-balloon otter trawl) was utilised. The resulting trawl samples were washed in filtered sea water, and the annelids picked out. Annelid tubes were sorted either separately or with associated taxa, various Actiniaria and ascidians. All specimens were fixed in 100% ethanol. Table 1. RRS James Cook cruise and trawl station locations for Melinnopsis nathanieli sp. nov. specimens collected. Cruise Station No. Date Depth (m) Latitude N start, Longitude W start Latitude N finish, Longitude W finish JC247 51 16/05/23–17/05/23 4844–4846 49°02.63’N, 016°56.95’W 48°58.10’N, 016°57.81’W JC247 56 17/05/23–18/05/23 4843–4848 49°05.43’N, 016°53.02’W 49°01.12’N, 016°57.87’W JC263 69 06/06/24–07/06/24 4835–4836 48°54.03’N, 016°49.26’W 49°00.70’N, 016°50.22’W JC263 71 07/06/24–08/06/24 4831–4838 48°51.21’N, 016°51.45’W 48°57.45’N, 016°51.85’W Figure 1. A. Map of station locations at Porcupine Abyssal Plain Sustained Observatory in Northeast Atlantic. Red dots indicate sampling sites; B. Global distribution of Melinnopsis nathanieli sp. nov. (red dots) and sister species M. gardelli (green dots). 4 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Morphological investigations Identification was performed in the laboratory at the National Oceanography Centre, Southampton, where specimens were transferred to 80% ethanol. Worms were carefully extracted from the tubes using forceps, length and width measurements were taken. Identification was made using a stereo microscope, Leica M165C. Light photographs of specimens were taken using a Leica Flexacam C5 camera attached to the stereo microscope. Paratypes of Melinnopsis nathanieli sp. nov. were dehydrated in ethanol, critical point dried, coated in 80:20 gold: palladium mix 15–20 nm, and examined under the Scanning Electron Microscope Tescan Mira 3 FEG-SEM at the University of Portsmouth Electron Microscopy and Microanalysis Unit. Type material is lodged at the Natural History Museum in London, with NHMUK registration numbers, all other specimens are retained at The Discovery Collections, National Oceanography Centre, Southampton (DISCOLL). Other material included in this study includes the holotype of Melinnopsis atlantica (BMNH 1885.12.1.330) from the Natural History Museum, London. DNA extraction, amplification, and sequencing Molecular analysis was performed at Portsmouth University. Tissue samples were collected from seven specimens. DNA extraction was performed using a QIAGEN DNeasy® Blood & Tissue Kit following the manufacture’s protocols. PCR amplification of the COI, 16S and 18S genes was conducted using ten sets of primers (Table 2). Polymerase chain reaction (PCR) mixtures consisted of 12.5 µl of Thermo Scientific™ DreamTaq PCR Master Mix, 2 µl of each primer (forward and reverse), 7.5 µl of nuclease-free water and 1 µl of template DNA, making a total mixture of 25 µl. PCRs were conducted in a Thermal Cycler with the following conditions; COI: 94 °C/1 min, 5 cycles 94°/40 s, 45°/40 s, 72°/60 s, followed by 35 cycles 94°/40 s, 51°/40 s, 72°/60 s, and finally 72°/5 min. 16S: 94°/4 min, 35 cycles of 94°/30 s, 48°/30 s, 72°/60 s, and finally 72°/8 min. 18S (TimA/1100R2): 94 °C/3 min, 40 cycles 94 °C/ 30 s, 52 °C/ 30 s, 72 °C/ 30 s and finally 72°/5 min. 18S (18E/18L and 18F509/18R): 94 °C/3 min, 35 cycles 94 °C/ 60 s, 42 °C/ 90 s, 72 °C/ 120 s and finally 72°/7 min. The quantity of PCR products was detected using gel electrophoresis and visualised using a Gel Documentation System. Successful PCR products were sent to GENEWIZ (https://www.genewiz.com/en-gb/) where they were purified, and standard Sanger sequencing was performed. Sequence analysis Overlapping fragments were assembled into consensus sequences and edited in Geneious Prime 2019.0.4 (https://www.geneious.com). A BLAST analysis (Altschul et al. 1990) was performed to confirm the correct region had been amplified, to compare with other sequences on GenBank, and to check for contamination. New sequences were submitted to GenBank (Table 3). Additional sequences from the genus Melinnopsis (4 species and 24 sequences), and one species of Melinna, selected as an outgroup, were downloaded from GenBank (Table 3). 5 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Table 3. Melinnidae taxa used in molecular phylogenetic analysis with museum voucher number, sampling location, depth, GenBank accession numbers. Institutional abbreviations: RUB - Ruhr-Universitat Bochum, SIO-BIC - Scripps Institution of Oceanography Benthic Invertebrate Collection, ZMBN - Department of Natural History, University Museum of Bergen, AM - Australian Museum, NHMUKNatural History Museum, London. Dashes (—) indicate no data available. Taxon Voucher Collection location Depth (m) GenBank or BOLD accession number Publication COI 16S 18S Melinnopsis Melinnopsis cf. armipotens (Moore, 1923) SIO:BIC:A12604 Costa Rica: Pacific Ocean, Subduction Plume 3502 PQ449274 — — Seid et al. 2025 Melinnopsis sp. RUB Msp_01 Antarctica 2057 RUMS096-09 — — Unpublished Melinnopsis sp. RUB Msp_09 Antarctica 2057 RUMS104-09 — — Unpublished Melinnopsis sp. RUB Msp_27 Antarctica 2057 RUMS122-09 — — Unpublished Melinnopsis sp. RUB Msp_28 Antarctica 2057 RUMS123-09 — — Unpublished Melinnopsis sp. RUB Msp_29 Antarctica 2057 RUMS124-09 — — Unpublished Melinnopsis chadwicki Gunton et al. 2020 AM W.50414 off Moreton Bay, Australia 1071-1138 MT556172 MT556641 MT561568 Gunton et al. 2020 Melinnopsis chadwicki Gunton et al. 2020 AM W.52949 Coral Sea Marine Park, Australia 1013-1093 MT556174 MT556643 MT561570 Gunton et al. 2020 Melinnopsis chadwicki Gunton et al. 2020 AM W.52948 Coral Sea Marine Park, Australia 1013-1093 MT556173 MT556642 MT561569 Gunton et al. 2020 Melinnopsis gardelli Gunton et al. 2020 AM W.52539 Jervis Marine Park, Australia 2650-2636 MT556177 MT556646 MT561573 Gunton et al. 2020 Melinnopsis gardelli Gunton et al. 2020 AM W.50735 Jervis Marine Park, Australia 2650-2636 MT556175 MT556644 MT561571 Gunton et al. 2020 Melinnopsis gardelli Gunton et al. 2020 AM W.51476 Freycinet Marine Park, Australia 2820-2751 MT556176 MT556645 MT561572 Gunton et al. 2020 Melinnopsis nathanieli sp. nov. (holotype) NHMUK ANEA 2025.3262 PAP NE Atlantic 4843-4848 PX149846 PX169426 — This study Melinnopsis nathanieli sp. nov. DISCOLL-JC247056-POLY-006 PAP NE Atlantic 4843-4848 PX149845 PX169425 PX169420 This study Melinnopsis nathanieli sp. nov. DISCOLL-JC247056-POLY-009 PAP NE Atlantic 4843-4848 PX149844 PX169424 PX169419 This study Melinnopsis nathanieli sp. nov. DISCOLL-JC247056-POLY-011 PAP NE Atlantic 4843-4848 PX149843 PX169423 PX169418 This study Melinnopsis nathanieli sp. nov. DISCOLL-JC247056-POLY-013 PAP NE Atlantic 4843-4848 PX149842 —PX169417 This study Melinnopsis nathanieli sp. nov. DISCOLL-JC247056-POLY-015 PAP NE Atlantic 4843-4848 PX149841 PX169422 PX169416 This study Melinnopsis nathanieli sp. nov. DISCOLL-JC263071-POLY-024 PAP NE Atlantic ~4850 — PX169421 — This study Outgroup Melinna Melinna cristata (M. Sars, 1851) ZMBN 95306 Skagerrak, Norway 212 MG270118 MG253102 MG253147 Eilertsen et al. 2017 Table 2. Primers used for PCR and Sanger sequencing. Gene Primer Sequence 5’-3’ Direction Reference 16S Ann16SF GCGGTATCCTGACCGTRCWAAGGTA Forward Sjölin et al. (2005) 16SbrH CCGGTCTGAACTCAGATCACGT Reverse Palumbi (1991) 18S 18e CTGGTTGATCCTGCCAGT Forward Hillis and Dixon (1991) 18L GAATTACCGCGGCTGCTGGCACC Reverse Halanych et al. (1995) 18F509 CCCCGTAATTGGAATGAGTACA Forward Struck et al. (2002) 18R GTCCCCTTCCGCAATTYCTTTAAG Reverse Passamaneck et al. (2004) TimA AMC TGG TTG ATC CTG CCA G Forward Norén and Jondelius (1999) 1100R2modified CGG TAT CTG ATC GTC TTC GA Reverse Kupriyanova et al. (2006) COI polyLCO GAYTATWTTCAACAAATCATAAAGATATTGG Forward Carr et al. (2011) polyHCO TAMACTTCWGGGTGACCAAARAATCA Reverse Carr et al. (2011) 6 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Sequences were aligned using the Geneious plugins with the default settings: MAFFT (Katoh et al. 2002) for 16S and 18S and MUSCLE (Edgar 2004) for COI. Pairwise genetic distances for COI and 16S were calculated in Mega v. 11.0.13 (Tamura et al. 2021). Concatenated sequences for all three genes were made in Geneious. JModelTest (Darriba et al. 2012) was used to find the best model using the Akaike Information Criterion (AIC). The model GTR+I+G was selected for COI, TIM2+I for 16S and TrN for 18S. Phylogenetic trees were constructed using IQ-TREE version 2 (Minh et al. 2020) and run for 10000 bootstrap replicates. Trees were visualised in FigTree v. 1.4.4 (Rambaut 2018) and edited in Adobe Illustrator. Results Molecular results The maximum likelihood analysis of Melinnopsis for three concatenated gene fragments (COI, 16S and 18S) recovered a tree with two well-supported (SH-aLRT: 100%, UFBoot: 100%) clades within Melinnopsis (Fig. 2). The first well-supported clade (SH-aLRT: 98.7%, UFBoot: 100%) contained specimens identified as Melinnopsis sp. from Antarctica. The second clade (SH-aLRT: 99.3%, UFBoot: 100%), contained Melinnopsis cf. armipotens, M. chadwicki, M. gardelli and M. nathanieli sp. nov. Specimens attributed to M. nathanieli sp. nov. formed a well-supported monophyletic group (SH-aLRT: 99.8%, UFBoot: 97%), these were sister to a clade containing two specimens of M. gardelli (AM W.20735 Figure 2. Maximum likelihood tree of Melinnopsis from IQTREE based on COI, 16S, and 18S gene fragments. Scale bar represents 0.02 substitutions per site. 7 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic and AM W.51476) recovered with poor support (SH-aLRT: 77.8%, UFBoot: 75%). Sister to the clade containing M. nathanieli sp. nov. and M. gardelli, one specimen of M. gardelli (AM W.52539) was recovered. The COI intraspecific pairwise genetic distances within M. nathanieli sp. nov. ranged 0.006–0.015. The single closest COI sequence of M. nathanieli sp. nov. was M. gardelli AM W.50735 sequence (0.035 difference). Taxonomy Order Terebellida Suborder Terebelliformia Family Melinnidae Chamberlin, 1919 Melinnopsis McIntosh, 1885 Melinnopsis McIntosh, 1885 (including Amelinna Hartman, 1969; Melinnexis Annenkova, 1931; and Melinnides Wesenberg-Lund, 1950) sensu Reuscher et al. (2015). Type species. Melinnopsis atlantica McIntosh, 1885 (type lodged at the Natural History Museum in London U.K., catalogue number 1885.12.1.330). Type locality off Chesapeake Bay, NW Atlantic, 3109 m. Generic diagnosis. Large buccal tentacles occurring with smaller ones. Four pairs of branchiae. Post-branchial hooks absent. Brittle acicular neurochaetae in segments II–IV or II–V. Twelve to 14 thoracic uncinigers. Uncini with subrostral process. Remarks. The new species described here conforms to the generic diagnosis of Reuscher et al. (2015), in possessing one long buccal tentacle, four pairs of branchiae, acicular chaetae on segments II-V, 12 or 13 thoracic uncinigers, uncini with subrostral process and lacking post-branchial hooks (dorsal hooks). Melinnopsis nathanieli sp. nov. https://zoobank.org/A0D97042-8E76-4DEC-8103-5602CCDB688B Type material. Holotype: • One specimen; NHMUK ANEA 2025.3262, incomplete, end of abdomen missing; Atlantic, Porcupine Abyssal Plain Sustained Observatory; OTSB14; Start 49°05.43'N, 016°53.02'W, End 49°01.12'N, 016°57.87'W; depth 4843–4848 m; 17/05/23–18/05/23; RRS James Cook Cruise 247, Station 056; COI PX149846, 16S PX169426. Paratypes: Total six specimens. • NHMUK ANEA 2025.3263; NHMUK ANEA 2025.3264, complete specimen; Atlantic, Porcupine Abyssal Sustained Observatory; OTSB14; Start 48°51.21'N, 016°51.45'W, End 48°57.45'N, 016°51.85'W; depth 4831–4838 m; 07/06/24–08/06/24; RRS James Cook Cruise 263, Station 071. • NHMUK ANEA 2025.3265, buccal tentacle extended 10 mm; NHMUK ANEA 2025.3266; NHMUK ANEA 2025.3267 (SEM specimen); NHMUK ANEA 2025.3268 (SEM specimen), complete specimen broken in two fragments; Atlantic, Porcupine Abyssal Plain Sustained Observatory; OTSB14; Start 48°54.03'N, 016°49.26'W, End 49°00.70'N, 016°50.22'W; depth 4835–4836 m; 06/06/24–07/06/24; RRS James Cook Cruise 263, Station 069. 8 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Other material examined. Total 35 specimens. • DISCOLL-JC247-056-POLY-003; DISCOLL-JC247-056-POLY-004; DISCOLL-JC247-056-POLY-005; DISCOLL-JC247-056-POLY-006 (COI PX149845; 16S PX169425; 18S PX169420); DISCOLL-JC247-056-POLY-007; DISCOLL-JC247-056-POLY-008; DISCOLLJC247-056-POLY-009 (COI PX149844; 16S PX169424; 18S PX169419); DISCOLL-JC247-056-POLY-010; DISCOLL-JC247-056-POLY-011 (COI PX149843; 16S PX169423; 18S PX169418); DISCOLL-JC247-056-POLY-012; DISCOLL-JC247056-POLY-013 (COI PX149842; 18S PX169417); DISCOLL-JC247-056-POLY-014; DISCOLL-JC247-056-POLY-015 (COI PX149841; 16S PX169422; 18S PX169416); DISCOLL-JC247-056-POLY-016; DISCOLL-JC247-056-POLY-018; DISCOLLJC247-056-POLY-019; DISCOLL-JC247-056-POLY-020; DISCOLL-JC247-056POLY-021; DISCOLL-JC247-056-POLY-022; DISCOLL-JC247-056-POLY-023; DISCOLL-JC247-056-POLY-024; DISCOLL-JC247-056-POLY-025; all same collection data as for holotype. • DISCOLL-JC247-051-POLY-039; Atlantic, Porcupine Abyssal Plain Sustained Observatory; OTSB14; Start 49°02.63'N, 016°56.95'W, End 48°58.10'N, 016°57.81'W; depth 4844–4846 m; 16/05/23-15/05/23; RRS James Cook Cruise 247, Station 051. • DISCOLL-JC263-069-POLY-033; DISCOLL-JC263069-POLY-034; DISCOLL-JC263-069-POLY-035; DISCOLL-JC263-069-POLY-036; DISCOLL-JC263-069-POLY-037; Atlantic, Porcupine Abyssal Plain Sustained Observatory; OTSB14; Start 48°54.03'N, 016°49.26'W, End 49°00.70'N, 016°50.22'W; depth 4835–4836 m; 06/06/24–07/06/24; RRS James Cook Cruise 263, Station 069. • DISCOLL-JC263-071-POLY-023, complete specimen (5 branchiae); DISCOLL-JC263-071-POLY-024 (16S PX16942); DISCOLL-JC263-071-POLY-025, 2 fragments; DISCOLL-JC263-071-POLY-027; DISCOLL-JC263-071-POLY-028; DISCOLL-JC263-071-POLY-029; DISCOLL-JC263-071-POLY-030; Atlantic, Porcupine Abyssal Plain Sustained Observatory; OTSB14; Start 48°51.21'N, 016°51.45'W, End 48°57.45'N, 016°51.85'W; depth 4831–4838 m; 07/06/24– 08/06/24; RRS James Cook Cruise 263, Station 071. Additional comparative material. BMNH 1885.12.1.330, holotype of Melinnopsis atlantica McIntosh, 1885, off Chesapeake Bay, North America, 37°25.002'N, 71°40.002'W, HMS Challenger, Stn. 44, 1700 fathoms (3109 m), 02/05/1873, 2 short anterior fragments, 1 posterior fragment and ~ 9 tube fragments. Description. (based on holotype NHMUK ANEA 2025.3262) Holotype 35 mm length for more than 25 chaetigers, widest at post-branchial region 2 mm, thereafter gradually tapering to abdomen (1 mm width) (Fig. 3A). Thorax with 16 or 17 chaetigers (lower thorax damaged so exact number of chaetigers uncertain). Neurochaetae as small acicular spines on segments II–V and uncini on remaining > 21 chaetigers. Prostomium with well-defined anterior and posterior sections separated by a pair of deep transverse nuchal slits meeting mid-dorsally (Fig. 3D). Anterior part of prostomium whole, without any distinct lobes, and with a slightly raised lip. No eyespots or pigmented glandular bands present. No speckled pigment on anterior part of prostomium. Segment I continued ventrally forming lower margin of mouth with no crenulations on the ventral side (Fig. 3B). Buccal tentacles in holotype missing, only one large stump remaining. Lateral wings of anterior body between prostomium and segment V slightly arched, peak approx. segment IV (Figs 3E, 4B). Segment I collar-like, laterally and ventrally encompassing head region. Branchiae emerging together on dorsal branchial ridge at level of segment II, 9 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Figure 3. Light images of Melinnopsis nathanieli sp. nov. A. Holotype NHMUK ANEA 2025.3262 entire body dorsal view; B. NHMUK ANEA 2025.3262 anterior section ventral view; C. NHMUK ANEA 2025.3265 prostomium and long buccal tentacle; D. NHMUK ANEA 2025.3265 prostomium; E. NHMUK ANEA 2025.3262 anterior body lateral view, arrows indicate acicular neurochaetae; F. NHMUK ANEA 2025.3262 thoracic chaetigers; G. NHMUK ANEA 2025.3262 abdominal uncini. Abbreviations: n.s. = nuchal slits. Scale bars: 2 mm (A); 1 mm (B, D, E); 3 mm (C); 0.5 mm (F); 20 µm (G). 16 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic interspecific genetic difference suggested by Gunton et al. (2025) for the family Melinnidae (5.8–33.6%). Unfortunately, the Phylum Annelida lacks a universal barcoding gap, the separation between intraspecific and interspecific genetic distances. Indeed, the interspecific gap appears to differ between genera and families, for example, Syllidae (Anguillosyllis) (pairwise difference 6.6–15.1%) (Drennan et al. 2025), Goniadidae (pairwise difference 12.0–28.1%), Spiophanes (pairwise difference 4.0–14.4%) (Meißner et al. 2023), Onuphidae (p-distance 9.6–18.1%) (Budaeva et al. 2024) and the average for multiple families (K2P 16.5%) (Carr et al. 2011). Despite this high genetic similarity, given the difference in bathymetric range (M. gardelli: 2520–2821 m, M. nathanieli sp. nov. 4843–4850 m), widely separated type locality (ca 19,000 km from the northeast Atlantic to the southwest Pacific Fig. 1B) and morphological differences, we here describe M. nathanieli sp. nov. as a new species, distinct from M. gardelli. We further propose that M. gardelli may not be a single species, but a complex of multiple species. In our phylogenetic analysis, M. nathanieli sp. nov. fell within a clade containing species attributed to M. gardelli, with a single M. gardelli specimen AM W.52539 recovered as sister to a clade containing the remaining M. gardelli (AM W.50735, AM W.51476) and M. nathanieli sp. nov. specimens. A recent study investigating the genetic connectivity using the COI barcoding gene fragment of three annelid species, including M. gardelli, along the eastern Australian margin, revealed that M. gardelli displayed strong genetic structuring (Gunton et al. 2025). Gunton et al. (2025) concluded that the intraspecific genetic differences were low enough to support M. gardelli as a single species; however, the differences suggesting strong genetic structuring may indicate incipient speciation. Following our molecular analysis using three genetic markers, we suggest that the records associated with the specimen AM W.52539 should be relabeled with the updated identification of Melinnopsis sp. Further detailed genetic analysis including additional markers for the specimens along the Australian margin are needed to resolve the M. gardelli species complex, which is beyond the scope of this study. Melinnopsis nathanieli sp. nov. has an interesting association with some species of Actiniaria and Ascidiacea, in which the tube of the melinnid acts as a biogenic attachment substrate. One of the Actinaria species, Actinauge abyssorum, observed attached to melinnid tubes in this study has also been reported attached to the top of a dead sponge stalk, Hyalonema sp. in the abyssal northeast Pacific (Beaulieu 2001). It is likely both the sponge stalk and melinnid tube act as a vertical living space extending the associated ascidians into the benthic boundary layer flow thus improving the ascidians’ ability to suspension feed. It is unclear whether the host (sponge or worm) derives any benefit or harm from the relationship. This association between Melinnopsis and actinarians and ascidians has been noted since the start of the PAP-SO time series in the mid1980s (AS-S unpublished data). Indeed, images of tubeworms with ascidians attached have been observed from Autosub5 Mission 42, Stn. JC237-053 to the Porcupine Abyssal plain (Fig. 6D) suggesting the association is not uncommon. Melinnopsis tube worms are among the most frequently imaged polychaetes at PAP-SO (BJ Bett pers. comm. 13 October 2025). Images from a Bathysnap time-lapse camera at PAP-SO station JC263-072 deployed on 8 June 2024 and recovered 5 June 2025 included a tube worm in the camera frame (Fig. 6G–I). These images showed the worm tube positioned at an acute angle to the sediment, the tube moved position to become more upright (Fig. 6G) or bent 17 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic towards the sediment surface (Fig. 6H, I). The buccal tentacle of the worm generally protruded out of the tube and was seen ‘midwater fishing’. There were also examples where the tentacle appeared to be in contact with the seabed (Fig. 6H, I) (A. Gates pers. comm. 15 October 2025). It is highly likely the Bathysnap and Autosub5 images (Fig. 6D–I) are of M. nathanieli sp. nov., given the distinctive tube which protrudes perpendicular to the sediment surface (also seen in seafloor images of the closely related M. shinkaiae, Jimi et al. 2025), and long buccal tentacle. Furthermore, M. nathanieli sp. nov. is the only Melinnopsis species retrieved in trawls from the PAP during JC237 and JC263. Since it is not possible to conclusively determine if the seafloor images are of M. nathanieli sp. nov. or another species, the image-based identifications are referred to as Melinnopsis nathanieli sp. inc. according to recommendations of Horton et al. (2021), to indicate ‘uncertain identification’. Precision sampling using a suction arm attached to an ROV would be needed to confirm the identification of suspected Melinnopsis specimens, followed by further morphological and molecular examination such as in the study of Jimi et al. (2025). Although our new species agrees well with the current generic diagnosis of Melinnopsis, the generic diagnosis must be revised. The most recent diagnosis by Reuscher et al. (2015) included ‘large buccal tentacles occurring along with smaller ones’. However, a large buccal tentacle was not observed in our examination of the type species, M. atlantica, neither was this character mentioned in McIntosh’s original description (McIntosh 1885). Unfortunately, the holotype of M. atlantica is in poor condition, consisting of two short anterior fragments and one posterior fragment, thus preventing a redescription of the type species here. Presently, we cannot confirm the presence or absence of the large buccal tentacle in M. atlantica. Specimens from the type locality off Chesapeake Bay should be collected, a neotype designated, examined, and sequenced to redescribe the type species, revise the generic definition, and allow a subsequent revision of the entire genus. Conclusion The present study describes a new species of abyssal tubicolous polychaete from the family Melinnidae, M. nathanieli sp. nov. This description will assist with species-level identification from seafloor imagery and act as a springboard for future publications on annelids from the Porcupine Abyssal Plain. Acknowledgements The PAP-SO time series would not be possible without the ongoing support of the National Marine Facilities group, the Ocean Technology and Engineering group, and the Marine Autonomous Robotic Systems group. We thank the dedicated captains and crews of the ships involved in the data collection, equipment deployment, and servicing at the PAP-SO site, principally the RRS James Cook and the RRS Discovery. The authors thank Joseph Dunlop at the Electron Microscopy and Microanalysis Unit, Portsmouth University who helped with SEM imaging. Thanks are also due to Brian Bett and Andrew Gates for thoughtful discussions and providing the images from Autosub and Bathysnap for use in this paper. Thanks to Emma Sherlock Senior Curator of Annelid worms, Natural History Museum London for help with loan material and museum registration numbers. 18 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Additional information Conflict of interest The authors have declared that no competing interests exist. Ethical statement No ethical statement was reported. Use of AI No use of AI was reported. Funding The Porcupine Abyssal Plain – Sustained Observatory of the Natural Environment Research Council (NERC, UK) is previously funded through the Climate Linked Atlantic Sector Science (CLASS) project supported by NERC National Capability funding (NE/ R015953/1) and now through the AtlantiS program (NE/Y005589/1). The authors acknowledge The Nippon Foundation-Nekton Ocean Census Programme (https://oceancensus.org/) for supporting the discovery and description of this species. This is Ocean Census Species Number 76. Author contributions Conceptualization: LMG. Data curation: AS-S, LMG, KR. Formal analysis: LMG, KR. Funding acquisition: LMG, TH, AS-S. Methodology: KR. Writing – original draft: LMG, AS-S. Writing – review and editing: LMG, TH, AS-S. Author ORCIDs Laetitia M. Gunton https://orcid.org/0000-0003-4758-4974 Amanda Serpell-Stevens https://orcid.org/0009-0009-1153-3033 Tammy Horton https://orcid.org/0000-0003-4250-1068 Data availability All of the data that support the findings of this study are available in the main text. References Altschul SF, Gish W, Miller WE, Myers W, Lipman DJ (1990) Basic local alignment search tool. Journal of Molecular Biology 215(3): 403–410. https://doi.org/10.1016/S00222836(05)80360-2 Annenkova NP (1931) Zur Polychaetenfauna von Franz-Joseph-Land (Melinnexis gen. nov. arctica sp. nov.). Zoologischer Anzeiger 95(9/10): 269–272. Augener H (1906) Reports on the results of dredging, under the supervision of Alexander Agassiz, in the Gulf of Mexico and the Caribbean Sea, and on the east coast of the United States, 1877 to 1880, by the U.S. Coast Survey Steamer Blake, Lieut. Commander C.D. Sigsbee, U.S.N., and Commander J.R. Bartlett, U.S.N. commanding. 42. Westindische Polychaeten. Bulletin of the Museum of Comparative Zoology 43(4): 91–196. Beaulieu S (2001) Life on glass houses: Sponge stalk communities in the deep sea. Marine Biology 138(4): 803–817. https://doi.org/10.1007/s002270000500 Budaeva N, Agne S, Ribeiro PA, Straube N, Preick M, Hofreiter M (2024) Wide-spread dispersal in a deep-sea brooding polychaete: The role of natural history collections in 19 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic assessing the distribution in quill worms (Onuphidae, Annelida). Frontiers in Zoology 21(1): 1. https://doi.org/10.1186/s12983-023-00520-0 Carlgren O (1934) Ceriantharia, Zoantharia and Actiniaria from the “Michael Sars” North Atlantic Deep-sea Expedition 1910. Report on the Scientific Results of the “Michael Sars” North Atlantic Deep-Sea Expedition 1910 5(6): 1–27. Carr CM, Hardy SM, Brown TM, Macdonald TA, Hebert PDN (2011) A tri-oceanic perspective: DNA barcoding reveals geographic structure and cryptic diversity in Canadian Polychaetes. PLOS ONE 6(7): 1–12. https://doi.org/10.1371/journal.pone.0022232 Chamberlin RV (1919) The Annelida Polychaeta. Memoirs of the Museum of Comparative Zoology at Harvard College. 48: 1–514. [Albatross Expeditions] Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9(8): 772–772. https://doi. org/10.1038/nmeth.2109 Dauvin J-C, Kendall M, Paterson G, Gentil F, Jirkov I, Sheader M, de Lange M (1994) An initial assessment of polychaete diversity in the northeastern Atlantic. Biodiversity Letters 2(6): 171–181. https://doi.org/10.2307/2999658 Day JH (1964) A review of the family Ampharetidae (Polychaeta). Annals of the South African Museum 48(4): 97–120. Drennan R, Neal L, Wiklund H, Stewart ECD, Rabone M, Boolukos C, Clatworthy I, Jungmanova Z, Dahlgren TG, Glover AG (2025) On Anguillosyllis cf. hessleri Maciolek, 2020 – A species complex from the Clarion-Clipperton zone, abyssal central Pacific. Deep-sea Research. Part I, Oceanographic Research Papers 220: 104453. https://doi. org/10.1016/j.dsr.2025.104453 Edgar RC (2004) MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research 32(5): 1792–1797. https://doi.org/10.1093/nar/ gkh340 Eilertsen MH, Kongsrud JA, Alvestad T, Stiller J, Rouse GW, Rapp HT (2017) Do ampharetids take sedimented steps between vents and seeps? Phylogeny and habitat-use of Ampharetidae (Annelida, Terebelliformia) in chemosynthesis based-ecosystems. BMC Evolutionary Biology 17(1): 222. https://doi.org/10.1186/s12862-017-1065-1 Galeron J, Sibuet M, Vanreusel A, MacKenzie K, Gooday AJ, Dinet A, Wolff GA (2001) Temporal patterns among meiofauna and macrofauna taxa related to changes in sediment geochemistry at an abyssal NE Atlantic site. Progress in Oceanography 50(1/4): 303–324. https://doi.org/10.1016/S0079-6611(01)00059-3 Glover A, Paterson G, Bett B, Gage J, Sibuet M, Sheader M, Hawkins L (2001) Patterns in polychaete abundance and diversity from the Madeira Abyssal Plain, northeast Atlantic. Deep-sea Research, Part I, Oceanographic Research Papers 48(1): 217–236. https://doi.org/10.1016/S0967-0637(00)00053-4 Gunton LM, Kupriyanova E, Alvestad T (2020) Two new deep-water species of Ampharetidae (Annelida: Polychaeta) from the eastern Australian continental margin. Records of the Australian Museum 72(4): 101–121. https://doi.org/10.385 3/j.2201-4349.72.2020.1763 Gunton LM, Kupriyanova EK, Roterman CN (2025) Well-connected worms: Genetic connectivity of annelids (Melinnidae and Ampharetidae) across a biogeographical break in Australia’s eastern abyss. Records of the Australian Museum 77(2): 121– 135. https://doi.org/10.3853/j.2201-4349.77.2025.1910 Halanych KM, Bacheller JD, Aguinaldo AM, Liva SM, Hillis DM, Lake JA (1995) Evidence from 18S ribosomal DNA that the lophophorates are protostome animals. Science 267(5204): 1641–1643. https://doi.org/10.1126/science.7886451 20 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Hartman O (1960) Systematic account of some marine invertebrate animals from the deep basins off southern California. Allan Hancock Pacific Expeditions 22(2): 69– 216. Hartman O (1969) Atlas of the sedentariate polychaetous annelids from California. 1–812. Allan Hancock Foundation, University of Southern California. Los Angeles. Hartman SE, Bett BJ, Durden JM, Henson SA, Iveren M, Jeffreys RM, Horton T, Lampitt R, Gates AR (2021) Enduring science: Three decades of observing the Northeast Atlantic from the Porcupine Abyssal Plain Sustained Observatory (PAP-SO). Progress in Oceanography 191(201508): 102508. https://doi.org/10.1016/j.pocean.2020.102508 Herdman WA (1881) Preliminary report on the Tunicata of the Challenger expedition. Cynthiidae. Proceedings of the Royal Society of Edinburgh 11(3): 52–88. https:// www.biodiversitylibrary.org/page/48710941 Hertwig R (1882) Die Actinien der Challenger Expedition. Gustav Fischer. Jena, 119 pp. Hilbig B (2005) Melinnopsis angolensis (Annelida: Polychaeta: Ampharetidae), a new species from the Angola Basin. Organisms, Diversity & Evolution 5(Suppl.1): 215– 220. https://doi.org/10.1016/j.ode.2004.11.005 Hillis DM, Dixon MT (1991) Ribosomal DNA: Molecular evolution and phylogenetic inference. The Quarterly Review of Biology 66(4): 411–453. https://doi.org/10.1086/417338 Hoagland RA (1920) Polychaetous annelids collected by the United States fisheries steamer Albatross during the Philippine expedition of 1907–1909. Bulletin - United States National Museum 100(1): 603–635. Horton T, Marsh L, Bett BJ, Gates AR, Jones DOB, Benoist NMA, Pfeifer S, Simon-Lledó E, Durden JM, Vandepitte L, Appeltans W (2021) Recommendations for the standardisation of open taxonomic nomenclature for image-based identifications. Frontiers in Marine Science 8: 620702. https://doi.org/10.3389/fmars.2021.620702 Huvenne V (2024) RRS James Cook cruise 237, 06 AUG-04 SEP 2022. CLASS – Climate-linked Atlantic Sector Science Whittard Canyon and Porcupine Abyssal Plain Fixed-Point Observatories. Southampton, National Oceanography Centre. (National Oceanography Centre Research Expedition Report, 80). https://nora.nerc.ac.uk/id/eprint/536754 Imajima M (2001) Deep-sea benthic polychaetous annelids of Tosa Bay, southwestern Japan. National Science Museum Monographs 20: 31–100. Jimi N, Hookabe N, Woo SP, Fujiwara Y (2025) Taxonomy and ecological insights into Melinnopsis shinkaiae sp. nov., a polychaete with a vertical tube from the Daiichi-Kashima seamount (Northwest Pacific). Plankton & Benthos Research 20(1): 29–35. https://doi.org/10.3800/pbr.20.29 Johnston G (1846) An index to the British Annelides [sic]. Annals and Magazine of Natural History, series 1, 16(supplement to vol 16): 433–462. [Plate 2] https://doi. org/10.1080/037454809495980 Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research 30(14): 3059–3066. https://doi.org/10.1093/nar/gkf436 Kupriyanova EK, Macdonald TA, Rouse GW (2006) Phylogenetic relationships within Serpulidae (Sabellida, Annelida) inferred from molecular and morphological data. Zoologica Scripta 35(5): 421–439. https://doi.org/10.1111/j.1463-6409.2006.00244.x Laguionie-Marchais C (2015) Polychaete community structure and biodiversity change in space and time at the abyssal seafloor. PhD Thesis, University of Southampton, Southampton United Kingdom. Laguionie-Marchais C, Billett DSM, Paterson GLD, Ruhl HA, Soto EH, Smith Jr KL, Thatje S (2013) Inter-annual dynamics of abyssal polychaete communities in the North East 21 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Pacific and North East Atlantic—A family-level study. Deep-sea Research, Part I, Oceanographic Research Papers 75: 175–186. https://doi.org/10.1016/j.dsr.2012.12.007 Maciolek NJ (1981) A new genus and species of Spionidae (Annelida: Polychaeta) from the North and South Atlantic. Proceedings of the Biological Society of Washington 94(1): 228–239. Malmgren AJ (1866? vol for 1865) Nordiska Hafs-Annulater. [part three of three]. Öfversigt af Königlich Vetenskapsakademiens förhandlingar, Stockholm 22(5): 355– 410 [pls XVIII–XXIX]. McIntosh WC (1885) Report on the Annelida Polychaeta collected by H.M.S. Challenger during the years 1873–1876. Report on the Scientific Results of the Voyage of H.M.S. Challenger during the years 1873–76. Zoology 12(part 34): I–XXXVI, 1–554 [pls 1–55, 1A-39A, & Annelida stations map]. Meißner K, Schwentner M, Götting M, Knebelsberger T, Fiege D (2023) Polychaetes distributed across oceans—Examples of widely recorded species from abyssal depths of the Atlantic and Pacific Oceans. Zoological Journal of the Linnean Society 199(4): 906–944. https://doi.org/10.1093/zoolinnean/zlad069 Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, von Haeseler A, Lanfear L (2020) IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution 37(5): 1530–1534. https://doi.org/10.1093/molbev/msaa015 Moore JP (1923) The polychaetous annelids dredged by the U.S.S. “Albatross” off the coast of southern California in 1904. IV. Spionidae to Sabellariidae. Proceedings. Academy of Natural Sciences of Philadelphia 75: 179–259. Müller F (1858) Einiges über die Annelidenfauna der Insel Santa Catharina an der brasilianischen Küste. Archiv für Naturgeschichte 24(1): 211–220. Norén M, Jondelius U (1999) Phylogeny of Prolecithophora (Plathyhelminthes) inferred from 18S rDNA sequences. Cladistics: The International Journal of the Willi Hennig Society 15(2): 103–112. https://doi.org/10.1111/j.1096-0031.1999.tb00252.x OBIS (2025) Ocean Biodiversity In formation System. Intergovernmental Oceanographic Commission of UNESCO. https://obis.org [accessed 15 October 2025] Olu K, Cannat M, Arnaud-Haond S, Rabouille C, Lallier F, Blandin J, Cambon-Bonavita M, Justiniano J, Sarradin P, Fouquet Y, Fabri M, Gillet H, Soubigou O, Menot L, Cotten C (2025) Biological samples from the French oceanographic fleet’s deep-sea cruises. Version 1.3. IFREMER - French Research Institute for Exploitation of the Sea. Sampling event dataset. https://doi.org/10.15468/dl.ey5ub5 Palumbi S, Martin A, Roman S, McMillan WO, Stice L, Grabowski G (1991) The Simple Fool’s Guide to PCR V.2.0. Special Publication University of Hawaii, Department of Zoology & Kewalo Marine Laboratory, Honolulu, Hawaii, 46 pp. Passamaneck YJ, Schander C, Halanych KM (2004) Investigation of molluscan phylogeny using large-subunit and small-subunit nuclear rRNA sequences. Molecular Phylogenetics and Evolution 32(1): 25–38. https://doi.org/10.1016/j.ympev.2003.12.016 Paterson GLJ, Glover AG (2000) A new species of Sigambra (Polychaeta, Pilargidae) from the abyssal plains of the NE Atlantic. Bulletin of the Natural History Museum. London (Zoology) 66(2): 167–170. Paterson GLJ, Gage JD, Lamont P, Bett BJ, Thurston MH (1994) Patterns of abundance and diversity from the abyss - polychaetes from northeastern Atlantic abyssal plains. Mémoires du Muséum d’Histoire Naturelle 162: 503–511. Paterson GLJ, Wilson GDF, Cosson N, Lamont PA (1998) Hessler and Jumars (1974) revisited: Abyssal polychaete assemblages from the Atlantic and Pacific. Deep-sea 22 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic Research, Part II, Topical Studies in Oceanography 45(1–3): 225–251. https://doi. org/10.1016/S0967-0645(97)00084-2 Paterson GLJ, Neal L, Altamira I, Soto EH, Smith CR, Menot L, Billett DSM, Cunha MR, Marchais-Laguionie C, Glover AG (2016) New Prionospio and Aurospio from the Deep Sea (Annelida: Polychaeta). Zootaxa 4092(1): 1–32. Rambaut A (2018) FigTree version 1.4.4. Molecular Evolution, Phylogenetics and Epidemiology. Institute of Evolutionary Biology,University of Edinburgh, Scotland http://tree.bio.ed.ac.uk/software/figtree/ [accessed 4 July 2025] Read G, Fauchald K [Eds] (2025a) World Polychaeta Database. Melinnidae Chamberlin, 1919. World Register of Marine Species. https://www.marinespecies.org/aphia. php?p=taxdetails&id=155483 [accessed 29 July 2025] Read G, Fauchald K [Eds] (2025b) World Polychaeta Database. Melinnopsis McIntosh, 1885. World Register of Marine Species. https://www.marinespecies.org/aphia. php?p=taxdetails&id=129170 [accessed 4 July 2025] Reuscher M, Fiege D, Imajima M (2015) Ampharetidae (Annelida: Polychaeta) from Japanese waters. Part IV. Miscellaneous genera. Journal of the Marine Biological Association of the United Kingdom 95(6): 1105–1125. https://doi.org/10.1017/S0025315415000545 Rouse G, Pleijel F, Tilic E (2022) Annelida. Oxford University Press, London, UK and New York, USA, 418 pp. https://doi.org/10.1093/oso/9780199692309.001.0001 Seid CA, Hiley AS, McCowin MF, Carvajal JI, Cha H, Ahyong ST, Ashford OS, Breedy O, Eernisse DJ, Goffredi SK, Hendrickx ME, Kocot KM, Mah CL, Miller AK, Mongiardino Koch N, Mooi R, O’Hara TD, Pleijel F, Stiller J, Tilic E, Valentich-Scott P, Warén A, Wicksten MK, Wilson NG, Cordes EE, Levin LA, Cortés J, Rouse GW (2025) A faunal inventory of methane seeps on the Pacific margin of Costa Rica. ZooKeys 1222: 1–250. https://doi.org/10.3897/zookeys.1222.134385 Sjölin E, Erséus C, Källersjö M (2005) Phylogeny of Tubificidae (Annelida, Clitellata) based on mitochondrial and nuclear sequence data. Molecular Phylogenetics and Evolution 35(2): 431–441. https://doi.org/10.1016/j.ympev.2004.12.018 Soto EH, Paterson GLJ, Billett DSM, Hawkins LE, Galéron J, Sibuet M (2010) Temporal variability in polychaete assemblages of the abyssal NE Atlantic Ocean. Deep-sea Research, Part II, Topical Studies in Oceanography 57(15): 1396–1405. https://doi. org/10.1016/j.dsr2.2009.02.003 Soto-Oyarzun EH (2008) Taxonomy and biology of deep-sea polychaetes: temporal variability in polychaete assemblages of the abyssal NE Atlantic Ocean. PhD Thesis, University of Southampton, United Kingdom. Stiller J, Tilic E, Rousset V, Pleijel F, Rouse GW (2020) Spaghetti to a Tree: A Robust Phylogeny for Terebelliformia (Annelida) Based on Transcriptomes, Molecular and Morphological Data. Biology (Basel) 9(4): 73. https://doi.org/10.3390/biology9040073 Struck T, Hessling R, Purschke G (2002) The phylogenetic position of the Aeolosomatidae and Parergodrilidae, two enigmatic oligochaete-like taxa of the Polychaeta, based on molecular data from 18S rDNA sequences. Journal of Zoological Systematics and Evolutionary Research 40(3): 155–163. https://doi.org/10.1046/j.1439-0469.2002.00200.x Tamura T, Stecher S, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis version 11. Molecular Biology and Evolution 38(7): 3022–3027. https://doi. org/10.1093/molbev/msab120 Treadwell AL (1906) Polychaetous annelids of the Hawaiian Islands collected by the steamer Albatross in 1902. Bulletin of the United States Fish Commission 23(3): 1145–1181. Uschakov PV (1952) Batipelagicheskie i glubokovrduye formy mnogoshchetinkrvykh chervei (Polychaeta) iz Rariteamchatskykh vod Tikhogo Okeana [Bathypelagic and 23 ZooKeys 1265: 1–23 (2025), DOI: 10.3897/zookeys.1265.171206 Laetitia M. Gunton et al.: A new species of Melinnidae from the Northeast Atlantic benthic forms of Polychaeta in far Eastern Seas]. Issledovaniya dal’nevostochnykh Morei SSSR 3: 103–112. Uschakov PV (1957) [On the polychaete worms fauna (Polychaeta) of the Arctic and Antarctic]. K faune mnogoshchetinkovikh chervei (Polychaeta) Arkitki i Antarktiki. Zoologicheskii jurnal [Journal of Zoology] 36(11): 1659–1672. Vanreusel A, Cosson-Sarradin N, Gooday AJ, Paterson GLJ, Galéron J, Sibuet M, Vincx M (2001) Evidence for episodic recruitment in a small opheliid polychaete species from the abyssal NE Atlantic. Progress in Oceanography 50: 285–301. https://doi. org/10.1016/S0079-6611(01)00058-1 Wesenberg-Lund E (1950) Polychaeta. Danish Ingolf-Expedition 4(14): 1–92.