Abrupt Photoperiod Changes Differentially Modulate Hepatic Antioxidant Response in Healthy and Obese Rats: Effects of Grape Seed Proanthocyanidin Extract (GSPE)

Citation: Cortés-Espinar, A.J.; Ibarz-Blanch, N.; Soliz-Rueda, J.R.; Calvo, E.; Bravo, F.I.; Mulero, M.; Ávila-Román, J. Abrupt Photoperiod Changes Differentially Modulate Hepatic Antioxidant Response in Healthy and Obese Rats: Effects of Grape Seed Proanthocyanidin Extract (GSPE). Int. J. Mol. Sci. 2023,24, 17057. https://doi.org/10.3390/ ijms242317057 Academic Editors: Juei-Tang Cheng and Jane C.-J. Chao Received: 2 November 2023 Revised: 28 November 2023 Accepted: 29 November 2023 Published: 2 December 2023 Copyright: © 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). International Journal of Molecular Sciences Article Abrupt Photoperiod Changes Differentially Modulate Hepatic Antioxidant Response in Healthy and Obese Rats: Effects of Grape Seed Proanthocyanidin Extract (GSPE) Antonio J. Cortés-Espinar 1,2 , Néstor Ibarz-Blanch 1,2 , Jorge R. Soliz-Rueda 1,2 , Enrique Calvo 1,2 , Francisca Isabel Bravo 1,2 , Miquel Mulero 1,2,* and Javier Ávila-Román3,* 1 Nutrigenomics Research Group, Department of Biochemistry and Biotechnology, Universitat Rovira i Virgili, 43007 Tarragona, Spain; [email protected].cat (A.J.C.-E.); [email protected] (N.I.-B.); [email protected] (J.R.S.-R.); [email protected] (E.C.); [email protected] (F.I.B.) 2Nutrigenomics Research Group, Institut d’InvestigacióSanitària Pere Virgili, 43007 Tarragona, Spain 3Molecular and Applied Pharmacology Group (FARMOLAP), Department of Pharmacology, Universidad de Sevilla, 41012 Sevilla, Spain *Correspondence: [email protected] (M.M.); [email protected] (J.Á.-R.) Abstract: Disruptions of the light/dark cycle and unhealthy diets can promote misalignment of biological rhythms and metabolic alterations, ultimately leading to an oxidative stress condition. Grape seed proanthocyanidin extract (GSPE), which possesses antioxidant properties, has demonstrated its beneficial effects in metabolic-associated diseases and its potential role in modulating circadian disruptions. Therefore, this study aimed to assess the impact of GSPE administration on the liver oxidant system of healthy and diet-induced obese rats undergoing a sudden photoperiod shift. To this end, forty-eight photoperiod-sensitive Fischer 344/IcoCrl rats were fed either a standard (STD) or a cafeteria diet (CAF) for 6 weeks. A week before euthanizing, rats were abruptly transferred from a standard photoperiod of 12 h of light/day (L12) to either a short (6 h light/day, L6) or a long photoperiod (18 h light/day, L18) while receiving a daily oral dose of vehicle (VH) or GSPE (25 mg/kg). Alterations in body weight gain, serum and liver biochemical parameters, antioxidant gene and protein expression, and antioxidant metabolites were observed. Interestingly, GSPE partially ameliorated these effects by reducing the oxidative stress status in L6 through an increase in GPx1 expression and in hepatic antioxidant metabolites and in L18 by increasing the NRF2/KEAP1/ARE pathway, thereby showing potential in the treatment of circadian-related disorders by increasing the hepatic antioxidant response in a photoperiod-dependent manner. Keywords: oxidative stress; phenolic compounds; obesity; GSPE; chronodisruption; liver; zeitgeber; chronotherapy 1. Introduction Organisms have developed biological rhythms to adapt to their environment, resulting in increased energy efficiency as physiological, metabolic, and behavioral processes coordinate with external cues known as zeitgebers (ZTs) [ 1 ]. These rhythms appeared as a response to the Earth’s rotational movement (i.e., circadian rhythms) and the translational movement (i.e., circannual rhythms) that determine days and seasons, respectively [ 2 ]. As a result, processes such as blood pressure, sleep/wake cycles, or liver metabolism are modulated by circadian rhythms, with a rhythmicity of approximately 24 h [ 3 ]. The main external cue that entrains biological rhythms is the light, which in mammals reaches the suprachiasmatic nucleus (SCN) of the hypothalamus. This central pacemaker recognizes both the light and the hours of daylight during this 24 h period (i.e., photoperiod) allowing the organism to adapt to the time of day and year by sending signals to entrain the peripheral oscillators present in virtually all tissues, including skeletal muscle, liver, or adipose Int. J. Mol. Sci. 2023,24, 17057. https://doi.org/10.3390/ijms242317057 https://www.mdpi.com/journal/ijms Int. J. Mol. Sci. 2023,24, 17057 2 of 23 tissue [4,5]. Subsequently, these oscillators regulate the expression of tissue-specific genes and affect cellular functions. Several harmful effects of altering the light/dark cycle have been described in this context, including increased body weight gain, alterations in lipid metabolism, impacts on bone health, colon physiology, and even mental disorders [6–10]. Furthermore, exercise, temperature, or food intake can also entrain biological clocks. In fact, the main ZT that entrains the peripheral oscillator is the feeding pattern, including not only the feeding schedule but also the diet composition [ 11 ]. In this context, the effects of a high-fat diet on circadian clock machinery consist of altering the expression of clock genes in peripheral tissues but not in the SCN [ 12 ]. In fact, Pendergast and colleagues described a 5 h phase advance in the liver clock of mice compared to the SCN after a week of a high-fat diet, promoting the misalignment between the central and the peripheral clocks [ 13 ]. Therefore, current lifestyles, including irregular eating schedules or high calorie intake, exposure to artificial light, shift work, and jet lag, can lead to chronodisruption and disrupt circadian rhythms [ 14 ]. In this context, these misalignments have been found to contribute to metabolic diseases such as obesity and metabolic syndrome (MetS) [ 15 ]. MetS is a heterogeneous disorder characterized by a cluster of different pathologies, such as abdominal obesity, hypertension, dyslipidemia, or insulin resistance, which can increase the risk of suffering type II diabetes, cardiovascular diseases, or nonalcoholic fatty liver disease (NAFLD), among others [ 16 ]. In addition, obesity can cause the enlargement (i.e., hypertrophy) and multiplication of adipocytes (i.e., hyperplasia), resulting in harmful changes in the adipose tissue phenotype. All of this, in turn, leads to a chronic, low-grade inflammatory state which can increase the production of reactive oxygen species (ROS), which accumulate and generate oxidative stress that damages cells and tissues [ 17 ]. In this regard, it has been recently described that there is a bidirectional relationship between oxidative stress and circadian dysregulation, wherein misaligned cues disrupting circadian rhythms can induce oxidative stress and vice versa [18,19]. For these reasons, mammals have developed antioxidant systems to protect themselves against the harmful effects of free radicals. Thus, the first line of defense against oxidative stress are the enzymatic antioxidant defenses. In this scenario, the NRF2-KEAP1-ARE pathway is of special relevance, since it plays a central role in inducing the antioxidant response at a genomic level. Under normal conditions, NRF2 is repressed by its natural inhibitor, KEAP1. However, NRF2 translocates to the nucleus in response to oxidative stress, where it binds to the antioxidant response element (ARE) sequences, increasing the expression of several antioxidant genes [ 20 , 21 ]. Among its targets, the most notable are the superoxide dismutases (SODs), including SOD1 (cytoplasmic) and SOD2 (mitochondrial), which detoxify the superoxide anion; glutathione peroxidase (GPx1) and glutathione-disulfide reductase (GSR), related to glutathione (GSH) homeostasis; and NAD(P)H quinone oxidoreductase 1 (NQO1), sestrin-2 (SESN2), and heme-oxygenase 1 (HO-1), which play a key role in the enzymatic detoxification of free radicals [ 22 – 25 ]. Furthermore, our bodies possess an enzyme-independent antioxidant system constituted of compounds such as GSH, vitamins C and E, and metabolites such as taurine or α -ketoglutaric acid [ 26 – 28 ]. Interestingly, biological rhythms have also been closely related to oxidative stress responses in organisms [ 29 ]. In fact, it has been described that the expression of the nuclear factor erythroid-derived 2-like 2 (Nfe2l2), the gene that encodes NRF2, occurs under the transcriptional regulation of the clock system proteins BMAL1 and CLOCK [ 30 ]. Additionally, diurnal oscillations of GSH levels or Sod1 or Ho-1 gene expressions have been described in the liver of healthy mice [ 31 ]. Consequently, misaligned cues could also have an impact on the antioxidant response. Natural antioxidants in food have gained attention for their ability to counteract the effects of free radicals in the body. As many of the chemical compounds serving as antioxidants cannot be synthesized by mammals, they must be obtained from the diet. In this sense, phenolic compounds, mainly found in vegetables, fruits, nuts, cereals, or beverages such as tea or red wine, have become particularly important [ 32 , 33 ]. In this regard, the supplementation with a grape seed proanthocyanidin extract (GSPE), primarily Int. J. Mol. Sci. 2023,24, 17057 3 of 23 composed of flavonoids, such as catechin or epicatechin and obtained from grape seeds, has demonstrated their antioxidant properties by modulating the gene expression of antioxidant enzymes in vitro and increasing the activity of antioxidant enzymes such as SOD in vivo [34,35] . However, GSPE supplementation not only affects the antioxidant system but also has beneficial effects at the metabolic level. In line with this, the oral administration of GSPE to rats fed a cafeteria diet (CAF), a model of MetS, showed a reduction in body weight gain, improved lipid metabolism, and lowered blood pressure [36,37] . Interestingly, it has been described that the effects of GSPE could also be mediated by their influence on circadian machinery. In this context, our research group has been working on elucidating these mechanisms, and we have shown the modulation of Bmal1 and Nampt gene expression in both central and liver peripheral clocks promoted by GSPE supplementation [ 38 , 39 ]. Furthermore, GSPE was reported to improve the metabolic status after light/dark cycle disruption [ 40 ]. More recently, we have also shown that GSPE administration restored the diurnal rhythms of antioxidant enzyme gene expression lost by the CAF in the liver [19]. Taking into account the above mentioned, this study aimed to investigate how a sudden shift in the photoperiod impacts on the modulation of the liver antioxidant metabolism in healthy and diet-induced obese rats and the effect of GSPE oral administration during this sudden change. To this end, photoperiod-sensitive strain Fischer 344/IcoCrl rats were long-term fed a standard diet (STD) or a CAF. One week before euthanasia, rats were transferred from a standard photoperiod (12 h light/12 h darkness) to a short photoperiod (6 h light/18 h darkness, L6) or to a long photoperiod (18 h light/6 h darkness, L18). During this time, they were also administered either a vehicle (VH) or GSPE diluted in VH. Body weight was measured weekly, and the moment before euthanasia, serum and liver were collected and kept at − 80 ◦ C before further processing for biochemical parameters, hepatic antioxidant-related gene transcription, protein expression, and metabolomics analysis. 2. Results 2.1. Abrupt Photoperiod Changes Altered Body Weight Gain, While Treatment with GSPE Partially Improved Serum Biochemical Parameters Affected by the CAF In order to check the obesogenic effect of the CAF, rats were weekly weighted, and their body weight gain was calculated. As expected, the CAF significantly increased the body weight gain during the first 6 weeks of the experiment when compared to rats fed an STD (Figure 1A,B). In the last week of the experiment, rats were abruptly transferred from the L12 to either the L6 or L18 photoperiods and administered VH or GSPE treatment daily. The changes in the photoperiods induced homeostatic disruption in the rats that was reflected in body weight gain during the last week (Figure 1C). Regarding the L6 photoperiod, the animals showed a similar decrease in body weight gain in all groups; however, no significant differences were found due to either the diet or GSPE treatment. Regarding the L18 photoperiod, the L18-STD-VH group was severely affected, but the GSPE treatment seemed to decrease the alteration. Interestingly, the L18-CAF-VH group was less affected by the change in photoperiod, showing differences with its control diet group (p= 0.085). However, the GSPE treatment in the L18-CAF-GSPE group decreased the body weight gain when compared to their control diet and treatment groups (p= 0.018 for GSPE-treated rats, and p= 0.008 for CAF-fed groups). Food intake was also measured during the last week of the experiment. As shown in Figure S1, the CAF-fed rats showed an increase in food consumption regardless of the photoperiod. Interestingly, a photoperiod effect was detected when comparing between both of the CAF-VH groups, with the L18CAF-VH group showing a lower food intake (p= 0.028). However, the GSPE did not reduce food intake in either of the CAF-fed groups. Int. J. Mol. Sci. 2023,24, 17057 4 of 23 Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 4 of 25 an increase in food consumption regardless of the photoperiod. Interestingly, a photoperiod effect was detected when comparing between both of the CAF-VH groups, with the L18-CAF-VH group showing a lower food intake (p = 0.028). However, the GSPE did not reduce food intake in either of the CAF-fed groups. Figure 1. Body weight gain (% to week 0): (A) body weight gain in the L6 condition; (B) body weight gain in the L18 condition; (C) percentage of body weight gain during the last week and the moment before euthanasia in the experiment. Values are expressed as the mean ± S.D. (A,B) or as the mean ± S.E.M. (C); n = 5–6 for the L6 and L18 conditions. The statistical analyses for the figures in (A,B) were performed using 2and 3-way repeated measures ANOVAs, and for the figure in (C) using 2and 3-way ANOVAs. The letters t, D, T, and P refer to time, diet (STD vs. CAF), treatment (VH vs. GSPE), and photoperiod (L6 vs. L18) effect, respectively. An LSD post hoc test was used to compare between groups: $ (0.1 < p < 0.05), + (p < 0.05), , and +++ (p < 0.001) indicate differences by diet effect; ** (p < 0.01) indicate differences by treatment effect. ns, indicates no significance; STD, indicates standard diet-fed rats; CAF, indicates cafeteria diet-fed rats; VH, indicates rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day; L18, indicates long photoperiod with 18 h light per day. The serum biochemical parameters were also altered, especially by the CAF, as represented in Table S1. Concerning the total cholesterol (TC), diet, treatment, and photoperiod have an effect on its levels. The CAF increased the TC levels in the L18 condition, but the GSPE was able to ameliorate this significantly, reducing them in the L18-CAF-GSPE (p = 0.001). The triglyceride (TAG) levels were mainly affected by the diet, as shown by the CAF-fed rats’ increased levels when compared to the STD-fed rats; likewise, the GSPE treatment was able to decrease TAG levels in the L18-CAF-GSPE group when compared to the L18-CAF-VH group (p = 0.004). The nonesterified fatty acids (NEFAs) levels were also highly altered by the CAF, especially in the L18 condition; however, the GSPE treatment showed no effects on this parameter. As expected, glucose levels were also affected by the diet, with increased levels in the CAF-fed rats when compared to the STD-fed rats; but the GSPE showed no effects. Finally, insulin levels were mainly affected by diet and treatment in the L6 condition. The L6-CAF-VH group showed increased levels for this parameter, but the GSPE treatment significantly decreased its levels (p = 0.005) in the L6-CAF-GSPE group, showing similar values to those of the STDfed rats. 2.2. CAF Highly Impacted Hepatic Biochemical Parameters, with GSPE Reducing Liver Weight and Total Lipid Content in the L6 Condition To assess the biochemical status of the liver in the different experimental groups, we carried out the measurement of the liver weight, total lipid content, TC, TAG, and phospholipids (Table 1). Regarding the liver weight, in the L6 condition, the CAF-fed rats Figure 1. Body weight gain (% to week 0): ( A ) body weight gain in the L6 condition; ( B ) body weight gain in the L18 condition; ( C ) percentage of body weight gain during the last week and the moment before euthanasia in the experiment. Values are expressed as the mean ± S.D. ( A , B ) or as the mean ± S.E.M. ( C ); n= 5–6 for the L6 and L18 conditions. The statistical analyses for the figures in ( A , B ) were performed using 2and 3-way repeated measures ANOVAs, and for the figure in ( C ) using 2and 3-way ANOVAs. The letters t, D, T, and P refer to time, diet (STD vs. CAF), treatment (VH vs. GSPE), and photoperiod (L6 vs. L18) effect, respectively. An LSD post hoc test was used to compare between groups: $ (0.1 < p< 0.05), + (p< 0.05), and +++ (p< 0.001) indicate differences by diet effect; ** (p< 0.01) indicate differences by treatment effect. ns, indicates no significance; STD, indicates standard diet-fed rats; CAF, indicates cafeteria diet-fed rats; VH, indicates rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day; L18, indicates long photoperiod with 18 h light per day. The serum biochemical parameters were also altered, especially by the CAF, as represented in Table S1. Concerning the total cholesterol (TC), diet, treatment, and photoperiod have an effect on its levels. The CAF increased the TC levels in the L18 condition, but the GSPE was able to ameliorate this significantly, reducing them in the L18-CAF-GSPE (p= 0.001). The triglyceride (TAG) levels were mainly affected by the diet, as shown by the CAF-fed rats’ increased levels when compared to the STD-fed rats; likewise, the GSPE treatment was able to decrease TAG levels in the L18-CAF-GSPE group when compared to the L18-CAF-VH group (p= 0.004). The nonesterified fatty acids (NEFAs) levels were also highly altered by the CAF, especially in the L18 condition; however, the GSPE treatment showed no effects on this parameter. As expected, glucose levels were also affected by the diet, with increased levels in the CAF-fed rats when compared to the STD-fed rats; but the GSPE showed no effects. Finally, insulin levels were mainly affected by diet and treatment in the L6 condition. The L6-CAF-VH group showed increased levels for this parameter, but the GSPE treatment significantly decreased its levels (p= 0.005) in the L6-CAF-GSPE group, showing similar values to those of the STD-fed rats. 2.2. CAF Highly Impacted Hepatic Biochemical Parameters, with GSPE Reducing Liver Weight and Total Lipid Content in the L6 Condition To assess the biochemical status of the liver in the different experimental groups, we carried out the measurement of the liver weight, total lipid content, TC, TAG, and phospholipids (Table 1). Regarding the liver weight, in the L6 condition, the CAF-fed rats groups showed a significantly increased liver weight when compared to their diet controls (p= 0.003 between the VH groups and p= 0.029 between the GSPE-treated rats). A similar effect was also observed in the L18 condition, in which the CAF increased the liver weight when compared to the STD-fed groups (p= 0.044 between the VH groups and p= 0.050 between the GSPE-treated rats). This observation agreed with the effects observed in the hepatic total lipid content. Thus, the CAF highly increased the total lipid content. Int. J. Mol. Sci. 2023,24, 17057 5 of 23 In more detail, in the L6 condition, the L6-CAF-VH group showed more than two-fold the lipid content when compared to the L6-STD-VH group (p< 0.001); interestingly, the GSPE treatment was able to decrease the lipid content despite the CAF (p= 0.002). In the L18 condition, the total lipid content also increased in both of the CAF-fed groups when compared to their diet controls, with those differences being statistically significant only among the GSPE-treated groups (p= 0.014). Interestingly, a photoperiod effect was also observed in the CAF-VH groups, being statistically lower in L18 when compared to L6 (p= 0.003). Regarding the biochemical parameters, the CAF increased the TC levels in both the L6 and L18 conditions when compared to the STD-VH groups (p= 0.044 for L6 and p= 0.012 for L18 condition), showing similar levels in both of the photoperiod conditions; however, the GSPE was unable to reduce the TC levels. Regarding the TAG levels, no differences were found due to the diet or treatment in the L6 condition. However, in the L18 condition, the L18-CAF-GSPE group showed increased TAG levels when compared to its diet control (p= 0.008). Interestingly, there were an increase in the TAG levels in the CAF-GSPE group in the L18 condition when compared with the same group in the L6 condition (p= 0.037). Regarding the phospholipid levels, they were notably altered in both of the CAF-fed groups in both photoperiod conditions in comparison with their dietary controls, showing significance in the L6 condition (p= 0.002 for the VH-treated rats and p> 0.001 for the GSPE-treated rats in the L6 condition; p= 0.088 for GSPE-treated groups in the L18 condition). Interestingly, the STD-GSPE group in L18 had notably increased phospholipid levels when compared to the same group in the L6 condition (p= 0.016 for GSPE-treated groups). Altogether, the measured parameters were notably modified by the diet in both photoperiods. However, the treatment with GSPE could alleviate the increase in the total lipid content in the L6 condition promoted by the CAF. 2.3. GSPE Treatment Increased Antioxidant Response Gene Expression in CAF-Fed Rats in a Photoperiod-Dependent Manner To investigate how the abrupt change in the light/dark cycle affects the antioxidant response in the liver in a healthy and obese context, we assessed the gene expression of various antioxidant genes. First, we examined the expression of Nfe2l2, which encodes for NRF2, a key transcription factor involved in the antioxidant response in the organism (Figure 2A). Regarding the L18 condition, the expression in the L18-CAF-GSPE was upregulated due to the diet and treatment, as shown by the comparisons of this group with the L18-STD-GSPE group (p= 0.070) and with the L18-CAF-VH group (p= 0.063). Furthermore, we assessed the gene expression of the natural inhibitor of NRF2, Keap1. Its expression was affected by diet, photoperiod, and treatment (Figure 2B). Concerning the L6 condition, Keap1 expression was downregulated by the CAF, showing differences when comparing the L6-CAF-VH with L6-STD-VH groups (p= 0.016) and L6-CAF-GSPE vs. L6-STD-GSPE (p= 0.048). In addition, only the group L18-CAF-GSPE led to a downregulation of the Keap1 gene expression in comparison to the L18-CAF-VH group (p= 0.023) in this photoperiod condition. Moreover, the L18-CAF-GSPE group also showed differences with its diet control (p= 0.008). Additionally, we also detected a photoperiod effect in the STD-VH groups that downregulated Keap1 expression in the L18 condition (p= 0.037). To investigate additional antioxidant pathways targeted by NRF2, we examined the gene expression of two proteins involved in the detoxification of the superoxide anion, Sod1 and Sod2, mainly located in cytoplasm and in mitochondria, respectively. Regarding the Sod1 expression, we found no relevant effects in the L6 condition (Figure 2C). Interestingly, the L18-CAF-GSPE group showed an increased Sod1 expression when compared to the L18-STD-GSPE group (p= 0.087) and to the L18-CAF-VH group (p= 0.033), as well as when compared to the same group in the L6 condition (p= 0.041). Regarding the Sod2 expression, it showed no significant differences by diet, treatment, or photoperiod, (Figure 2D). Int. J. Mol. Sci. 2023,24, 17057 6 of 23 Table 1. Liver biochemical parameters. Parameter L6 L6 ANOVA L18 L18 ANOVA 3-Way ANOVA STD-VH STD-GSPE CAF-VH CAF-GSPE STD-VH STD-GSPE CAF-VH CAF-GSPE Liver weight (g) 12.36 ±0.61 12.49 ±0.59 15.29 ±0.35 ++ 14.5 ±0.54 +D 13.08 ±0.59 13.22 ±0.95 14.92 ±0.68 +15.1 ±0.68 $D D Total lipid content (mg lipids/g liver) 33.71 ±1.47 29.07 ±4.28 74.15 ± 13.15 +++ 42.15 ±5.65 ** D, T, Tendency in D×T32.87 ±3.23 31.87 ±4.9 44.41 ± 5.23 && 55.83 ±7.57 +DD, T×P, D×T×P Cholesterol (µM) 22.00 ±3.00 23.00 ±2.00 31.00 ±1.00 +33.00 ±3.00 +D 24.00 ±2.00 24.00 ±2.00 34.00 ±4.00 +32.00 ±4.00 $D D Triglycerides (µM) 70.00 ±9.00 57.00 ±8.00 65.00 ±5.00 62.00 ±6.00 ns 61.00 ±6.00 55.00 ±7.00 82.00 ±11.00 $ 86.00 ± 8.00 ++& D D, D×P Phospholipids (µM) 29.00 ±1.00 25.00 ±3.00 50.00 ±2.00 ++ 50.00 ±5.00 +++ D41.00 ±7.00 %41.00 ±6.00 &52.00 ±5.00 $52.00 ±2.00 $Tendencyin D D, P, Tendency in D×P Values are expressed as the mean ± S.E.M.; n= 5–6 for the L6 and L18 conditions. The statistical analyses were performed using 2and 3-way ANOVAs. The letters D, T, and P refer to diet (STD vs. CAF), treatment (VH vs. GSPE), and photoperiod (L6 vs. L18) effect, respectively. An LSD post hoc test was used to compare between groups: $ (0.1 < p< 0.05), + (p< 0.05), ++ (p< 0.01), and +++ (p< 0.001) indicate differences by diet effect; ** (p< 0.01) indicate differences by treatment effect; % (0.1 < p< 0.05), & (p< 0.05), and && (p< 0.01) indicate differences by photoperiod effect. ns, indicates no significance; STD, indicates standard diet-fed rats; CAF, indicates cafeteria diet-fed rats; VH, indicates rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day; L18, indicates long photoperiod with 18 h light per day. Int. J. Mol. Sci. 2023,24, 17057 7 of 23 Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 7 of 25 2.3. GSPE Treatment Increased Antioxidant Response Gene Expression in CAF-Fed Rats in a Photoperiod-Dependent Manner To investigate how the abrupt change in the light/dark cycle affects the antioxidant response in the liver in a healthy and obese context, we assessed the gene expression of various antioxidant genes. First, we examined the expression of Nfe2l2, which encodes for NRF2, a key transcription factor involved in the antioxidant response in the organism (Figure 2A). Regarding the L18 condition, the expression in the L18-CAF-GSPE was upregulated due to the diet and treatment, as shown by the comparisons of this group with the L18-STD-GSPE group (p = 0.070) and with the L18-CAF-VH group (p = 0.063). Furthermore, we assessed the gene expression of the natural inhibitor of NRF2, Keap1. Its expression was affected by diet, photoperiod, and treatment (Figure 2B). Concerning the L6 condition, Keap1 expression was downregulated by the CAF, showing differences when comparing the L6-CAF-VH with L6-STD-VH groups (p = 0.016) and L6-CAF-GSPE vs. L6-STD-GSPE (p = 0.048). In addition, only the group L18-CAF-GSPE led to a downregulation of the Keap1 gene expression in comparison to the L18-CAF-VH group (p = 0.023) in this photoperiod condition. Moreover, the L18-CAF-GSPE group also showed differences with its diet control (p = 0.008). Additionally, we also detected a photoperiod effect in the STD-VH groups that downregulated Keap1 expression in the L18 condition (p = 0.037). Figure 2. Antioxidant-related relative gene expression in the liver. All data were relativized to the L6-STD-VH group: (A) nuclear factor erythroid-derived 2-like 2 (Nfe2l2); (B) Kelch-like ECHassociated protein 1 (Keap1); (C) superoxide dismutase 1 (Sod1); (D) superoxide dismutase 2 (Sod2); (E) glutathione peroxidase 1 (GPx1); (F) glutathione-disulfide reductase (GSR); (G) NAD(P)H dehydrogenase (quinone 1) (Nqo1); (H) Sestrin-2 (Sesn2). Values are expressed as the mean ± S.E.M.; n = 4–6 for the L6 and L18 conditions. The statistical analyses were performed using 2and 3-way ANOVAs. The letters D, T, and P refer to diet (STD vs. CAF), treatment (VH vs. GSPE), and photoperiod (L6 vs. L18) effect, respectively. An LSD post hoc test was used to compare between groups: $ (0.1 < p < 0.05), + (p < 0.05), and ++ (p < 0.01) indicate differences by diet effect; # (0.1 < p < 0.05) and * (p < 0.05) indicate differences by treatment effect; % (0.1 < p < 0.05) and & (p < 0.05) indicate differences by photoperiod effect. ns, indicates no significance; STD, indicates standard diet-fed rats; CAF, indicates cafeteria diet-fed rats; VH, indicates rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day; L18, indicates long photoperiod with 18 h light per day. To investigate additional antioxidant pathways targeted by NRF2, we examined the gene expression of two proteins involved in the detoxification of the superoxide anion, Figure 2. Antioxidant-related relative gene expression in the liver. All data were relativized to the L6STD-VH group: ( A ) nuclear factor erythroid-derived 2-like 2 (Nfe2l2); ( B ) Kelch-like ECH-associated protein 1 (Keap1); ( C ) superoxide dismutase 1 (Sod1); ( D ) superoxide dismutase 2 (Sod2); ( E ) glutathione peroxidase 1 (GPx1); ( F ) glutathione-disulfide reductase (GSR); ( G )NAD(P)H dehydrogenase (quinone 1) (Nqo1); ( H )Sestrin-2 (Sesn2). Values are expressed as the mean ± S.E.M.; n= 4–6 for the L6 and L18 conditions. The statistical analyses were performed using 2and 3-way ANOVAs. The letters D, T, and P refer to diet (STD vs. CAF), treatment (VH vs. GSPE), and photoperiod (L6 vs. L18) effect, respectively. An LSD post hoc test was used to compare between groups: $ (0.1 < p< 0.05), + (p< 0.05), and ++ (p< 0.01) indicate differences by diet effect; # (0.1 < p< 0.05) and * (p< 0.05) indicate differences by treatment effect; % (0.1 < p< 0.05) and & (p< 0.05) indicate differences by photoperiod effect. ns, indicates no significance; STD, indicates standard diet-fed rats; CAF, indicates cafeteria diet-fed rats; VH, indicates rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day; L18, indicates long photoperiod with 18 h light per day. Additionally, we further evaluated the status of the enzymes also targeted by NRF2 and related to the glutathione (GSH) homeostasis, such as GPx1, which is in charge of detoxifying hydrogen peroxide using GSH, and GSR, which reduces the oxidized GSH. Regarding the GPx1 expression, it showed significant differences by diet and treatment (Figure 2E). Interestingly, both of the GSPE-treated groups showed upregulated GPx1 expression when compared to their control treatment, with the differences found between the L6-CAF-GSPE and the L6-STD-GSPE groups (p= 0.040) being statistically significant. Similarly, in the L18 photoperiod, there was a significant decrease in the GPx1 gene expression in the L18-CAF-VH group compared to the L18-STD-VH group (p= 0.046). Concerning the GSR expression, it was mainly affected by diet and treatment (Figure 2F). In the L6 condition, the L6-STD-GSPE group showed a decreased expression when compared with the L6-STD-VH group (p= 0.008). In the L18 condition, the L18-CAF-VH group exhibited increased expression when compared to the L18-STD-VH (p= 0.003). However, the GSPE treatment in the CAF-fed rats seemed to downregulate its expression, as shown when comparing the L18-CAF-GSPE group to the L18-CAF-VH group (p= 0.054). The expressions of Nqo1 and Sesn2, additional NRF2 targets, were also assessed because of their cytoprotective role in cells against ROS. In the first case, its gene expression was mainly altered by diet (Figure 2G); however, no differences were found among the groups. Notably, we found a photoperiod effect among the STD-GSPE groups, with an increase in its expression in the L18 condition when compared to the L6 condition (p= 0.035). Regarding Sesn2, the CAF downregulated its expression in both groups in the L6 condition (p= 0.009 for the VH-treated groups, and p= 0.041 for the GSPE-treated groups), but no more significant differences were found when comparing among the groups (Figure 2H). Int. J. Mol. Sci. 2023,24, 17057 8 of 23 2.4. CAF Significantly Altered Both HO-1 and SOD1 Expressions after an Abrupt Change in Photoperiod, and GSPE could Modulate HO-1 Expression in a Photoperiod-Dependent Manner To further explore the antioxidant response in the present experimental model, we evaluated the expression of SOD1 and HO-1, target genes of NRF2 that are involved in reducing oxidative stress and inflammation, using Western blotting. As shown in Figure 3A, CAF strongly altered the expression of HO-1, showing higher levels in the CAF-fed rats when compared to the STD-fed rats in both photoperiods. The densitometric analysis (Figure 3B) confirmed these alterations caused by the diet. In the L6 condition, the expression of HO-1 significantly increased because of the diet when comparing both the CAF-fed groups with their STD-fed control groups (p= 0.036 for the VH-treated groups, and p= 0.022 for the GSPE-treated rats). Similarly, in the L18 condition, both CAF-fed groups showed higher levels of HO-1 expression than the STD-fed groups (p= 0.004 for the VH-treated rats, and p= 0.004 for the GSPE-treated rats). Interestingly, the animals treated with the GSPE seemed to have increased HO-1 expression when compared to their treatment control groups in the L18 condition. Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 9 of 25 Figure 3. Effects of diet and the sudden light/dark cycle disruption in hepatic HO-1 and SOD1: (A) representative Western blot analysis of HO-1; (B) representative densitometric analysis of HO-1 normalized to β-actin (housekeeping protein) in liver; (C) representative Western blot analysis of SOD1; (D) representative densitometric analysis of SOD1 normalized to β-actin (housekeeping protein) in liver. Values are expressed as the mean ± S.E.M.; n = 4 for the L6 and L18 conditions. The statistical analyses were performed using 2and 3-way ANOVAs. The letter D refer to diet (STD vs. CAF) effect. An LSD post hoc test was used to compare between groups: $ (0.1 < p < 0.05), + (p < 0.05), and ++ (p < 0.01) indicate differences by diet effect. ns, indicates no significance; STD, indicates standard diet-fed rats; CAF, indicates cafeteria diet-fed rats; VH, indicates rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day; L18, indicates long photoperiod with 18 h light per day. In a similar way, SOD1 expression was also highly altered because of the CAF, as shown in Figure 3C. Indeed, the densitometric analysis (Figure 3D) confirmed this alteration. Concerning the L18 condition, both of the CAF-fed groups also showed increased levels of SOD1, especially in the L18-CAF-VH group (p = 0.032) and, interestingly, the GSPE treatment seemed to decrease its expression in rats fed the CAF in the L6 photoperiod. 2.5. GSPE Improved Liver Antioxidant Metabolic Profile of CAF-Fed Rats after an Abrupt Change in Photoperiod To better understand the antioxidant response of the animals, we analyzed 27 metabolites related to liver oxidative stress. Figures 4 and 5 represent the metabolomic profile in both the L6 and L18 conditions, using principal component analysis (PCA), sparse partial least squares discriminant analysis sparse least (sPLS-DA), and heatmap analysis, while the antioxidant metabolites annotated are shown in Table S1. Regarding the L6 condition, the PCA did not show any clustering among groups (Figure 4A). However, the sPLS-DA showed clustering by diet with a clear separation between the STD and the CAF-fed groups (Figure 4B). The antioxidant-related metabolomic profile (Figure 4C) showed differences depending on both factors: diet and treatment. Regarding the differences between diets, the STD-fed rats showed increased levels of metabolites, such as malic acid, sarcosine, or hydroxyphenyl lactic acid, while the CAF-fed groups showed increased levels of nicotinamide, glycine, or serine, with both glycine and serine being involved in glutathione (GSH) synthesis. Regarding the differences between treatment, it seemed that the GSPE treatment increased the hepatic antioxidant-related metabolites in both groups but especially in the L6-CAF-GSPE group. In this case, the GSPE-treated rats showed increased metabolite concentration of fumaric acid or threonine, while the VHtreated rats showed reduced levels of these metabolites (Table S2). Additionally, these Figure 3. Effects of diet and the sudden light/dark cycle disruption in hepatic HO-1 and SOD1: ( A ) representative Western blot analysis of HO-1; ( B ) representative densitometric analysis of HO1 normalized to β -actin (housekeeping protein) in liver; ( C ) representative Western blot analysis of SOD1; ( D ) representative densitometric analysis of SOD1 normalized to β -actin (housekeeping protein) in liver. Values are expressed as the mean ± S.E.M.; n= 4 for the L6 and L18 conditions. The statistical analyses were performed using 2and 3-way ANOVAs. The letter D refer to diet (STD vs. CAF) effect. An LSD post hoc test was used to compare between groups: $ (0.1 < p< 0.05), + (p< 0.05), and ++ (p< 0.01) indicate differences by diet effect. ns, indicates no significance; STD, indicates standard diet-fed rats; CAF, indicates cafeteria diet-fed rats; VH, indicates rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day; L18, indicates long photoperiod with 18 h light per day. In a similar way, SOD1 expression was also highly altered because of the CAF, as shown in Figure 3C. Indeed, the densitometric analysis (Figure 3D) confirmed this alteration. Concerning the L18 condition, both of the CAF-fed groups also showed increased levels of SOD1, especially in the L18-CAF-VH group (p= 0.032) and, interestingly, the GSPE treatment seemed to decrease its expression in rats fed the CAF in the L6 photoperiod. 2.5. GSPE Improved Liver Antioxidant Metabolic Profile of CAF-Fed Rats after an Abrupt Change in Photoperiod To better understand the antioxidant response of the animals, we analyzed 27 metabolites related to liver oxidative stress. Figures 4and 5represent the metabolomic profile in Int. J. Mol. Sci. 2023,24, 17057 9 of 23 both the L6 and L18 conditions, using principal component analysis (PCA), sparse partial least squares discriminant analysis sparse least (sPLS-DA), and heatmap analysis, while the antioxidant metabolites annotated are shown in Table S1. Regarding the L6 condition, the PCA did not show any clustering among groups (Figure 4A). However, the sPLS-DA showed clustering by diet with a clear separation between the STD and the CAF-fed groups (Figure 4B). The antioxidant-related metabolomic profile (Figure 4C) showed differences depending on both factors: diet and treatment. Regarding the differences between diets, the STD-fed rats showed increased levels of metabolites, such as malic acid, sarcosine, or hydroxyphenyl lactic acid, while the CAF-fed groups showed increased levels of nicotinamide, glycine, or serine, with both glycine and serine being involved in glutathione (GSH) synthesis. Regarding the differences between treatment, it seemed that the GSPE treatment increased the hepatic antioxidant-related metabolites in both groups but especially in the L6-CAF-GSPE group. In this case, the GSPE-treated rats showed increased metabolite concentration of fumaric acid or threonine, while the VH-treated rats showed reduced levels of these metabolites (Table S2). Additionally, these differences were higher when comparing between the CAF-fed rats, with increased levels of almost all metabolites analyzed in the GSPE-treated group. On the other hand, in the L18 condition, the PCA did not show any clustering among groups (Figure 5A). In addition, as before, the sPLS-DA did show a marked clustering by diet (Figure 5B). Interestingly, the L18-CAF-GSPE group seemed to get closer to the STD-fed groups while moving farther away from the L18-CAF-VH group. The heatmap analysis (Figure 5C) shows the antioxidant-related metabolomic profile, which also clustered by diet. In the STD-fed rats, higher levels of taurine and sarcosine were observed, whereas citric acid, inosine-5-monophosphate, or glutamic acid, also involved in GSH synthesis, were the main metabolites in the CAF-fed rats (Table S2). In this case, the treatment with GSPE did not increase the concentration of metabolites when compared to the VH-treated groups. Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 10 of 25 differences were higher when comparing between the CAF-fed rats, with increased levels of almost all metabolites analyzed in the GSPE-treated group. Figure 4. Metabolomic analysis of liver antioxidant-related metabolites in the L6 condition: (A) principal component analysis (PCA), (B) sparse partial least squares discriminant analysis (sPLSDA), and (C) heatmap analysis of antioxidant-related detected metabolites in the liver metabolomics of rats transferred to the L6 photoperiod. STD, rats fed a standard diet; CAF, rats fed a cafeteria diet; VH, rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day. inosine 5-monophosphate Nicotinamide Glycine Serine Adenosine Inosine Phosphoric acid Pyruvic acid Stearic acid Glutamic acid Citric acid Methionine Proline myo-Inositol Fumaric acid Threonine Aspartic acid a-ketoglutaric acid Sarcosine Taurine Phenylalanine Leucine Malic acid Glucose 6-phosphate adenosine-5-monophosphate Ribose-5-phosphate Hydroxyphenyllactic acid Figure 4. Metabolomic analysis of liver antioxidant-related metabolites in the L6 condition: ( A ) principal component analysis (PCA), ( B ) sparse partial least squares discriminant analysis (sPLS-DA), and ( C ) heatmap analysis of antioxidant-related detected metabolites in the liver metabolomics of rats transferred to the L6 photoperiod. STD, rats fed a standard diet; CAF, rats fed a cafeteria diet; VH, rats administered vehicle; GSPE, indicates rats were administered with grape seed proanthocyanidin extract at 25 mg/kg b.w.; L6, indicates short photoperiod with 6 h light per day. Int. J. Mol. Sci. 2023,24, 17057 16 of 23 a 6-week pretreatment period (n= 24). The CAF consisted of food commonly consumed by humans with high palatability and high caloric content but poor nutritional value, including biscuits with cheese and pâté, bacon, ensaimada (pastry), standard chow, carrot, and milk containing 22% sucrose (w/v). In the last week, the rats were transferred from the standard photoperiod (L12) to the short (L6) or long (L18) photoperiod, and treatment was orally administered, consisting of vehicle (VH, milk containing 22% sucrose, w/v) or GSPE diluted in VH (25 mg/kg b.w.), resulting in 8 groups (n= 6 animals per group). Throughout the course of the experiment, the weights and food intake of the rats were monitored on a weekly basis. Before euthanizing, the rats underwent a 3-h fasting period, and then they were euthanized with 3% isoflurane and decapitation. Figure 7provides a detailed overview of the study’s design. Whole blood was collected for serum extraction following centrifugation (2000 × gand 4 ◦ C, 15 min). Both serum and liver samples were collected and preserved at − 80 ◦ C for subsequent analysis. All animal care and experimental procedures were approved by the Ethics Review Committee for Animal Experimentation of the Universitat Rovira I Virgili (reference number 9495). The procedures adhered to the guidelines outlined in Directive 86/609EEC of the Council of the European Union and were conducted in accordance with the protocols established by the Departament d’Agricultura, Ramaderia i Pesca of the Generalitat de Catalunya. Int. J. Mol. Sci. 2023, 24, x FOR PEER REVIEW 17 of 25 included catechin, epicatechin, dimers, trimers, and tetramers of procyanidins, and epicatechin gallate, among others. 4.2. Experimental Procedure in Rats Forty-eight 13-week-old male Fischer 344/IcoCrl rats (Charles River Laboratories, Barcelona, Spain) were housed in pairs under standard conditions (23 °C, 55% humidity, and photoperiod, 12 h light/12 h dark; light density: 350 lux) with ad libitum access to food and drink water. We have selected F344/IcoCrl rats because they are sensitive to photoperiod cues [62,88–90]. After the acclimatization period, the animals underwent weighing and were subsequently assigned randomly to two groups based on their diet. Half of the animals were given an STD (kcal/100 g: 72% carbohydrates, 8% fat, and 20% protein; Safe-A04c, Scientific Animal Food and Engineering, Barcelona, Spain), while the remaining half were given a CAF (Kcal/100 g: 58% carbohydrates, 31% fat, and 11% protein) during a 6-week pretreatment period (n = 24). The CAF consisted of food commonly consumed by humans with high palatability and high caloric content but poor nutritional value, including biscuits with cheese and pâté, bacon, ensaimada (pastry), standard chow, carrot, and milk containing 22% sucrose (w/v). In the last week, the rats were transferred from the standard photoperiod (L12) to the short (L6) or long (L18) photoperiod, and treatment was orally administered, consisting of vehicle (VH, milk containing 22% sucrose, w/v) or GSPE diluted in VH (25 mg/kg b.w.), resulting in 8 groups (n = 6 animals per group). Throughout the course of the experiment, the weights and food intake of the rats were monitored on a weekly basis. Before euthanizing, the rats underwent a 3-h fasting period, and then they were euthanized with 3% isoflurane and decapitation. Figure 7 provides a detailed overview of the study’s design. Whole blood was collected for serum extraction following centrifugation (2000× g and 4 °C, 15 min). Both serum and liver samples were collected and preserved at −80 °C for subsequent analysis. All animal care and experimental procedures were approved by the Ethics Review Committee for Animal Experimentation of the Universitat Rovira I Virgili (reference number 9495). The procedures adhered to the guidelines outlined in Directive 86/609EEC of the Council of the European Union and were conducted in accordance with the protocols established by the Departament d’Agricultura, Ramaderia i Pesca of the Generalitat de Catalunya. Figure 7. Experimental design. Forty-eight male Fischer 344 rats were randomly divided into two groups based on their diet: 24 were fed an STD and the other half were fed a CAF for 6 weeks. Then, the animals were abruptly transferred from L12 to L6 or L18 photoperiods, and treatment with VH or GSPE diluted in VH at a dose of 25 mg/kg b.w. was administered. After a week, the rats were euthanized, and serum and liver were collected for further analysis. Figure 7. Experimental design. Forty-eight male Fischer 344 rats were randomly divided into two groups based on their diet: 24 were fed an STD and the other half were fed a CAF for 6 weeks. Then, the animals were abruptly transferred from L12 to L6 or L18 photoperiods, and treatment with VH or GSPE diluted in VH at a dose of 25 mg/kg b.w. was administered. After a week, the rats were euthanized, and serum and liver were collected for further analysis. 4.3. Dosage Information/Dosage Regimen The rats were administered either a dose of VH (condensed milk diluted in water at a ratio of 1:5, v/v) or 25 mg GSPE/kg b.w. diluted in VH after the sudden photoperiod change. This particular dose of GSPE, regularly employed by our group, has been demonstrated to be the lowest but the most efficient to induce changes in key metabolic pathways in healthy rats [ 91 ]. Moreover, this dose corresponds to an intake of approximately 370 mg of phenols per day when considering the conversion from animal (rat) to human [ 92 ]. This quantity of phenols is easily attainable through (poly)phenol-rich diets such as the Mediterranean [ 91 , 92 ]. Both VH and GSPE were orally administered at 8 a.m. The euthanize of the rats was carried out 3 h after the last dose. 4.4. Hepatic RNA Extraction For hepatic RNA extraction, 1 mL of Trizol ® reagent (Thermo Fisher, Madrid, Spain) was used to homogenize 20–30 mg of liver tissue in a Tissue Lyser LT (Qiagen, Madrid, Spain). Homogenate was centrifuged (12,000 × g, 4 ◦ C, 10 min) and supernatant was mixed with 250 µ L of chloroform. Following centrifugation (12,000 × g, 4 ◦ C, 15 min), the aqueous phase was transferred to a new microtube. Then, 500 µ L of isopropanol was added, and Int. J. Mol. Sci. 2023,24, 17057 17 of 23 a centrifugation step was performed (12,000 × g, 4 ◦ C, 10 min). The resulting pellet was washed with 70% ethanol and centrifuged (8000 × g, 4 ◦ C, 5 min), repeating both steps twice. Then, 60 µ L of nuclease-free water was used to resuspend the dried washed pellet and a NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) was used to assess the RNA yield and purity. 4.5. cDNA Synthesis and Gene-Expression Analysis RNA was used to synthetize cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Barcelona, Spain). The reaction was performed in a Galaxy XP ClearLine Thermal Cycler (ClearLine, Dominique Dutscher, Brumath, France) according to the instructions from the manufacturer. The cDNA obtained was used to conduct a quantitative polymerase chain reaction amplification using the iTaq Universal SYBR Green Supermix (Bio-Rad, Madrid, Spain) in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Madrid, Spain). The sequences of the oligonucleotides used in the reaction are listed in Table 2and were synthetized by Biomers.net (Ulm, Germany). The relative expression of mRNA was depicted as a fold change and determined as a percentage of the L6-STD-VH group. The calculation was performed using the 2- ∆∆ Ct method, with the peptidylprolyl isomerase A (Ppia) gene serving as the housekeeping control, in accordance with the approach outlined by Schmittgen and Livak [93]. Table 2. Nucleotide sequences of the primers used for the RT-qPCR. Gene Accession Number (NCBI) Forward Primer (50to 30) Reverse Primer (50to 30) Nrf2 NM_001399173.1 ACATTTCAGTCGCTTGCCCT TCCTGCCAAACTTGCTCCAT Keap1 NM_057152.2 TGGGCGTGGCAGTGCTCAAC GCCCATCGTAGCCTCCTGCG Sod1 NM_017050.1 GGTGGTCCACGAGAAACAAG CAATCACACCACAAGCCAAG Sod2 NM_017051.2 AAGGAGCAAGGTCGCTTACA ACACATCAATCCCCAGCAGT GPx1 NM_030826.4 TGCAATCAGTTCGGACATC CACCTCGCACTTCTCAAACA GSR NM_053906.2 ATCAAGGAGAAGCGGGATG GCGTAGCCGTGGATGACT Nqo1 NM_017000.3 GGGGACATGAACGTCATTCTCT AGTGGTGACTCCTCCCAGACAG Sesn2 Ppia NM_001109358.2 NM_017101.1 TACCTTAGCAGCTTCTGGCG TCAAACACAAATGGTTCCCAGT AGGTAAGAACACTGGTGGCG ATTCCTGGACCCAAAACGCT 4.6. Serum Biochemical Analysis The serum biochemical parameters glucose, nonesterified free fatty acids (NEFAs), total cholesterol (TC), and triglycerides (TAGs) were analyzed using enzymatic colorimetric assays according to the manufacturers’ instructions. The specific assays for glucose, TC, and TAG were obtained from QCA (Amposta, Tarragona, Spain), while the assay for the NEFAs was obtained from WAKO (Neuss, Germany). 4.7. Protein Extraction and Western Blot Analysis RIPA buffer (50 mM Tris-HCl, 150 mM NaCl; pH 7.4, 1% Tween 20, 0.25% Nadeoxycholate) supplemented with phenylmethylsulfonyl fluoride (PMSF), protease inhibitor cocktail (PIC), and phosphatase cocktails 2 and 3 were used to homogenate the liver tissue in a Tissue Lyser LT (Qiagen, Madrid, Spain). The samples were then subjected to a 30 min shaking step, and the lysates were centrifuged (16,300 × g, 4 ◦ C, 15 min). The protein concentration was determined from the supernatant using the Pierce bicinchoninic acid (BCA) protein assay kit (Thermo Fisher Scientific, Madrid, Spain). A total quantity of 50 µ g protein per sample underwent electrophoretic separation on 10% SDS-polyacrylamide gels (TGX FastCast Acrylamide Kit, Bio-Rad, Madrid, Spain). After electrophoretic separation, proteins were transferred to PVDF membranes in the Trans-Blot Turbo system (Bio-Rad, Madrid, Spain). The Pounceau-S staining was used to assess the efficacy of the protein transference. Membranes were then blocked with 5% nonfat milk diluted in 0.2% TBS-Tween for one hour at room temperature. Then, the following polyclonal primary antibodies in a Int. J. Mol. Sci. 2023,24, 17057 18 of 23 1:1000 dilution were used to blot the membranes overnight a 4 ◦ C: rabbit-anti-superoxide dismutase 1 (SOD1), rabbit-anti-heme-oxygenase 1 (HO-1), and mouseβ -actin. After washing the membranes three times with 0.2% TBS-Tween, the secondary antibodies conjugated with horseradish peroxidase goat anti-mouse IgG and donkey anti-rabbit IgG (Amersham, Cytiva, Barcelona, Spain) in a 1:2000 dilution were employed to hybridized the membranes for one hour at room temperature. After three more washes, immunoreactive proteins were detected using a chemiluminescence substrate kit (Amersham ECL Select, Cytiva, Barcelona, Spain) according to the manufacturer’s instructions. Digital images were captured using a G:BOX Chemi XL1.4 (Syngene, Cambridge, UK), while the densitometry analysis was performed using ImageJ Software 1.54g (NIH, Bethesda, MD, USA). 4.8. Extraction and Measurement of the Concentration of Lipids in the Liver To extract lipids from the liver, the Bligh and Dyer method was carried out [ 94 ]. In these lipid extracts, cholesterol, triglycerides (QCA, Amposta, Tarragona, Spain), and phospholipids (Spinreact, St. Esteve de Bas, Girona, Spain) were measured using enzymatic colorimetric assays. 4.9. Metabolomics Analysis Rat liver samples were subjected to metabolomic analysis at the Centre for Omics Sciences (COS, Tarragona, Spain) using gas chromatography coupled with quadrupole time-of-flight mass spectrometry (GC-qTOF model 7200, Agilent, Santa Clara, CA, USA). 10–20 mg liver tissue was used for the sample extraction by adding methanol:water in a 8:2 proportion containing an internal standard mixture. Later, samples were homogenized in a bullet blender with a stainless-steel ball and incubated for 10 min at 4 ◦ C. Following centrifugation at 19,000 × g, supernatants underwent compound derivatization through methoximation and silylation and then evaporated to dryness. To analyze the derivatized compounds, GC-qTOF was employed. The chromatographic separation procedure was carried out according to the Fiehn method [ 95 ]. For this purpose, a HP5-MS film capillary column (30 m × 0.25 mm × 0.25 µ m) was employed (J&W Scientific, Agilent, Santa Clara, CA, USA) using helium as the carrier gas in an oven program ranging from 60 to 325 ◦ C. The ionization process was carried out by electronic impact (EI) in the full-scan mode, with 70 eV being the electron energy employed. The metabolite identification consisted in matching the EI mass spectrum and retention time to a metabolomic Fiehn library, which contained almost 1400 metabolites (Agilent, Santa Clara, CA, USA). Following putative identification of metabolites, they were semi-quantified based on an internal standard response ratio. 4.10. Statistical Analysis The data expressed in both the tables and graphics are represented as the mean ± standard deviation or median and interquartile range. The normal distribution of data was probed using the Shapiro–Wilk test. The statistical tests used for the individual analyses are expressed in the figure legends. The graphics were made using Prism v. 8 software (GraphPad Software, San Diego, CA, USA), and the statistical analyses were performed using SPSS version 26 (IBM Inc., Armonk, NY, USA). A probability value of p< 0.005 was considered statistically significant. The metabolomic analyses, which included principal component analysis (PCA), sparse partial least squares discriminant analysis (sPLS-DA), and heatmaps, were assessed using MetaboAnalyst v.5.0 (McGill University, Montreal, QC, Canada) [96]. 5. Conclusions The results obtained in our study suggest that the abrupt photoperiod changes (L6 vs. L18) are differentially modulating the beneficial effects of GSPE on the hepatic antioxidant response, particularly in diet-induced obese rats. More specifically, the effect of GSPE on the L6 condition could be less mediated by an antioxidant enzymatic response (only GPx1) Int. J. Mol. Sci. 2023,24, 17057 19 of 23 and might be more induced by modulation of the liver antioxidant-related metabolome. However, in the L18 condition, the effects of GSPE could be associated with the ability of GSPE to reduce free radicals by increasing, at least in part, the NRF2/KEAP1/ARE pathway but not by increasing the antioxidant-related metabolites in the liver. Nevertheless, further studies are needed to elucidate the underlying mechanisms by which GSPE may alleviate circadian disturbances resulting from a sudden change in the light/dark cycle at both the genomic (e.g., miRNAs) and metabolic levels. Supplementary Materials: The supporting information can be downloaded at: https://www.mdpi. com/article/10.3390/ijms242317057/s1. Author Contributions: Conceptualization, M.M. and J.Á.-R.; methodology, A.J.C.-E., N.I.-B., J.R.S.-R., E.C. and F.I.B.; software, A.J.C.-E. and J.R.S.-R.; validation, M.M. and J.Á.-R.; formal analysis, A.J.C.-E., N.I.-B. and J.R.S.-R.; resources, M.M., J.Á.-R., E.C. and F.I.B.; data curation, A.J.C.-E. and J.R.S.-R.; writing—original draft preparation, A.J.C.-E., M.M. and J.Á.-R.; writing—review and editing, A.J.C.- E., E.C., M.M. and J.Á.-R.; visualization, M.M. and J.Á.-R.; supervision, M.M. and J.Á.-R.; project administration, M.M. and J.Á.-R.; funding acquisition, M.M., J.Á.-R. and F.I.B. All authors have read and agreed to the published version of the manuscript. Funding: This project was funded by the Spanish Ministry of Science and Innovation MCIN/AEI/ 10.13039/501100011033/; ERDF “A way of making Europe” (grant number: PID2021-128813OB-I00). A.J.C.-E. was the recipient of a grant for the hiring of predoctoral research staff from Universitat Rovira i Virgili-Martíi Franquès (2019PMF-PIPF-74). F.I.B. and M.M. are Serra Húnter Fellows. Institutional Review Board Statement: All animal care and experimental protocols involving animals were approved by the Ethics Review Committee for Animal Experimentation of the Universitat Rovira i Virgili (reference number: 9495, 18 September 2019) and were carried out in accordance with Directive 86/609EEC of the Council of the European Union and the procedure established by the Departament d’Agricultura, Ramaderia i Pesca of the Generalitat de Catalunya. Informed Consent Statement: Not applicable. Data Availability Statement: The data presented in this study are available upon request from the corresponding author. The data are not publicly available because of a lack of a platform to publish them. Acknowledgments: The authors would like to thank Niurka Llópiz and Rosa Pastor (Tarragona) for their help and technical assistance. We thank Pol Herrero and Antonio del Pino from the Centre for Omic Sciences (COS), Joint Unit of the Universitat Rovira i Virgili-Eurecat, for their contribution to the metabolomics analyses. The graphical abstract was designed with resources from Flaticon.com (accessed on 27 October 2023). Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results. Abbreviations ARE: antioxidant response elements; b.w.: body weight; BCA: Pierce bicinchoninic acid; CAF: cafeteria diet; EGCG: ( − )-epigallocatechin-3-gallate; GPx1: glutathione peroxidase; GSH: glutathione; GSPE: grape seed proanthocyanidin extract; GSR: glutathione-disulfide reductase; HO-1: hemeoxygenase 1; L12: standard photoperiod (12 h light/day); L18: long photoperiod (18 h light/day); L6: short photoperiod (6 h light/day); MetS: metabolic syndrome; NAFLD: nonalcoholic fatty liver disease; NEFAs: nonesterified fatty acids; Nfe2l2: nuclear factor erythroid-derived 2-like 2; NQO1: NAD(P)H quinone oxidoreductase 1; PCA: principal component analysis; PMSF: phenylmethylsulfonyl fluoride; ROS: reactive oxygen species; SCN: suprachiasmatic nucleus; SESN2: sestrin-2; SOD: superoxide dismutase; sPLS-DA: sparse partial least squares discriminant analysis; STD: standard diet; TAGs: triglycerides; TC: total cholesterol; VH: vehicle; ZT: Zeitgeber. Int. J. Mol. Sci. 2023,24, 17057 20 of 23 References 1. Golombek, D.A.; Rosenstein, R.E. Physiology of Circadian Entrainment. Physiol. Rev. 2010 ,90, 1063–1102. [CrossRef] [PubMed] 2. Kuhlman, S.J.; Craig, L.M.; Duffy, J.F. Introduction to Chronobiology. Cold Spring Harb. Perspect. Biol. 2018 ,10, a033613. [CrossRef] [PubMed] 3. Ayyar, V.S.; Sukumaran, S. Circadian Rhythms: Influence on Physiology, Pharmacology, and Therapeutic Interventions. J. Pharmacokinet. Pharmacodyn. 2021,48, 321–338. [CrossRef] 4. Welsh, D.K.; Takahashi, J.S.; Kay, S.A. Suprachiasmatic Nucleus: Cell Autonomy and Network Properties. Annu. Rev. Physiol. 2009,72, 551–577. [CrossRef] 5. Korf, H.W. Signaling Pathways to and from the Hypophysial Pars Tuberalis, an Important Center for the Control of Seasonal Rhythms. Gen. Comp. Endocrinol. 2018,258, 236–243. [CrossRef] 6. Tsai, L.-L.; Tsai, Y.-C.; Hwang, K.; Huang, Y.-W.; Tzeng, J.-E. Repeated Light-Dark Shifts Speed up Body Weight Gain in Male F344 Rats. Am. J. Physiol. Endocrinol. Metab. 2005,289, 212–217. [CrossRef] [PubMed] 7. Tran, L.; Jochum, S.B.; Shaikh, M.; Wilber, S.; Zhang, L.; Hayden, D.M.; Forsyth, C.B.; Voigt, R.M.; Bishehsari, F.; Keshavarzian, A.; et al. Circadian Misalignment by Environmental Light/Dark Shifting Causes Circadian Disruption in Colon. PLoS ONE 2021 , 16, e0251604. [CrossRef] 8. Walker, W.H.; Walton, J.C.; DeVries, A.C.; Nelson, R.J. Circadian Rhythm Disruption and Mental Health. Transl. Psychiatry 2020 , 10, 28. [CrossRef] 9. Schilperoort, M.; Bravenboer, N.; Lim, J.; Mletzko, K.; Busse, B.; van Ruijven, L.; Kroon, J.; Rensen, P.C.N.; Kooijman, S.; Winter, E.M. Circadian Disruption by Shifting the Light-Dark Cycle Negatively Affects Bone Health in Mice. FASEB J. 2020 ,34, 1052–1064. [CrossRef] 10. Xie, X.; Zhao, B.; Huang, L.; Shen, Q.; Ma, L.; Chen, Y.; Wu, T.; Fu, Z. Effects of Altered Photoperiod on Circadian Clock and Lipid Metabolism in Rats. Chronobiol. Int. 2017,34, 1094–1104. [CrossRef] 11. Lewis, P.; Oster, H.; Korf, H.W.; Foster, R.G.; Erren, T.C. Food as a Circadian Time Cue—Evidence from Human Studies. Nat. Rev. Endocrinol. 2020,16, 213–223. [CrossRef] 12. Kohsaka, A.; Laposky, A.D.; Ramsey, K.M.; Estrada, C.; Joshu, C.; Kobayashi, Y.; Turek, F.W.; Bass, J. High-Fat Diet Disrupts Behavioral and Molecular Circadian Rhythms in Mice. Cell Metab. 2007,6, 414–421. [CrossRef] [PubMed] 13. Pendergast, J.S.; Branecky, K.L.; Yang, W.; Ellacott, K.L.J.; Niswender, K.D.; Yamazaki, S. High-Fat Diet Acutely Affects Circadian Organisation and Eating Behavior. Eur. J. Neurosci. 2013,37, 1350–1356. [CrossRef] [PubMed] 14. Sato, T.; Sato, S. Circadian Regulation of Metabolism: Commitment to Health and Diseases. Endocrinology 2023 ,164, bqad086. [CrossRef] 15. Albrecht, U. The Circadian Clock, Metabolism and Obesity. Obes. Rev. 2017,18, 25–33. [CrossRef] 16. Fahed, G.; Aoun, L.; Bou Zerdan, M.; Allam, S.; Bou Zerdan, M.; Bouferraa, Y.; Assi, H.I. Metabolic Syndrome: Updates on Pathophysiology and Management in 2021. Int. J. Mol. Sci. 2022,23, 786. [CrossRef] [PubMed] 17. Manna, P.; Jain, S.K. Obesity, Oxidative Stress, Adipose Tissue Dysfunction, and the Associated Health Risks: Causes and Therapeutic Strategies. Metab. Syndr. Relat. Disord. 2015,13, 423–444. [CrossRef] 18. McClean, C.; Davison, G.W. Circadian Clocks, Redox Homeostasis, and Exercise: Time to Connect the Dots? Antioxidants 2022 , 11, 256. [CrossRef] 19. Cortés-Espinar, A.J.; Ibarz-Blanch, N.; Soliz-Rueda, J.R.; Bonafos, B.; Feillet-Coudray, C.; Casas, F.; Bravo, F.I.; Calvo, E.; ÁvilaRomán, J.; Mulero, M. Rhythm and ROS: Hepatic Chronotherapeutic Features of Grape Seed Proanthocyanidin Extract Treatment in Cafeteria Diet-Fed Rats. Antioxidants 2023,12, 1606. [CrossRef] 20. Lu, M.-C.; Ji, J.-A.; Jiang, Z.-Y.; You, Q.-D. The Keap1-Nrf2-ARE Pathway As a Potential Preventive and Therapeutic Target: An Update. Med. Res. Rev. 2016,36, 924–963. [CrossRef] 21. Pekovic-Vaughan, V.; Gibbs, J.; Yoshitane, H.; Yang, N.; Pathiranage, D.; Guo, B.; Sagami, A.; Taguchi, K.; Bechtold, D.; Loudon, A.; et al. The Circadian Clock Regulates Rhythmic Activation of the NRF2/Glutathione-Mediated Antioxidant Defense Pathway to Modulate Pulmonary Fibrosis. Genes. Dev. 2014,28, 548–560. [CrossRef] 22. Ma, Q. Role of Nrf2 in Oxidative Stress and Toxicity. Annu. Rev. Pharmacol. Toxicol. 2013,53, 401–426. [CrossRef] 23. Dinkova-Kostova, A.T.; Talalay, P. NAD(P)H:Quinone Acceptor Oxidoreductase 1 (NQO1), a Multifunctional Antioxidant Enzyme and Exceptionally Versatile Cytoprotector. Arch. Biochem. Biophys. 2010,501, 116–123. [CrossRef] [PubMed] 24. Shin, B.Y.; Jin, S.H.; Cho, I.J.; Ki, S.H. Nrf2-ARE Pathway Regulates Induction of Sestrin-2 Expression. Free Radic. Biol. Med. 2012 , 53, 834–841. [CrossRef] [PubMed] 25. Araujo, J.A.; Zhang, M.; Yin, F. Heme Oxygenase-1, Oxidation, Inflammation, and Atherosclerosis. Front. Pharmacol. 2012 ,3, 119. [CrossRef] [PubMed] 26. Liu, S.; He, L.; Yao, K. The Antioxidative Function of Alpha-Ketoglutarate and Its Applications. BioMed Res. Int. 2018 , 2018, 3408467. [CrossRef] [PubMed] 27. Ali, S.S.; Ahsan, H.; Zia, M.K.; Siddiqui, T.; Khan, F.H. Understanding Oxidants and Antioxidants: Classical Team with New Players. J. Food Biochem. 2020,44, e13145. [CrossRef] [PubMed] 28. Surai, P.F.; Earle-payne, K.; Kidd, M.T. Taurine as a Natural Antioxidant: From Direct Antioxidant Effects to Protective Action in Various Toxicological Models. Antioxidants 2021,10, 1876. [CrossRef] Int. J. Mol. Sci. 2023,24, 17057 21 of 23 29. Wilking, M.; Ndiaye, M.; Mukhtar, H.; Ahmad, N. Circadian Rhythm Connections to Oxidative Stress: Implications for Human Health. Antioxid. Redox Signal. 2013,19, 192–208. [CrossRef] 30. Wible, R.S.; Ramanathan, C.; Sutter, C.H.; Olesen, K.M.; Kensler, T.W.; Liu, A.C.; Sutter, T.R. NRF2 Regulates Core and Stabilizing Circadian Clock Loops, Coupling Redox and Timekeeping in Mus Musculus. eLife 2018,7, e31656. [CrossRef] 31. Xu, Y.Q.; Zhang, D.; Jin, T.; Cai, D.J.; Wu, Q.; Lu, Y.; Liu, J.; Klaassen, C.D. Diurnal Variation of Hepatic Antioxidant Gene Expression in Mice. PLoS ONE 2012,7, e44237. [CrossRef] 32. Demirci-Çekiç, S.; Özkan, G.; Avan, A.N.; Uzunboy, S.; Çapano˘glu, E.; Apak, R. Biomarkers of Oxidative Stress and Antioxidant Defense. J. Pharm. Biomed. Anal. 2022,209, 114477. [CrossRef] 33. Rahman, M.M.; Rahaman, M.S.; Islam, M.R.; Rahman, F.; Mithi, F.M.; Alqahtani, T.; Almikhlafi, M.A.; Alghamdi, S.Q.; Alruwaili, A.S.; Hossain, M.S.; et al. Role of Phenolic Compounds in Human Disease: Current Knowledge and Future Prospects. Molecules 2022,27, 233. [CrossRef] 34. Devi, A.; Jolitha, A.B.; Ishii, N. Grape Seed Proanthocyanidin Extract (GSPE) and Antioxidant Defense in the Brain of Adult Rats. Med. Sci. Monit. 2006,12, BR124-9. 35. Puiggròs, F.; Llópiz, N.; Ardévol, A.; Bladé, C.; Arola, L.; Salvadó, M.J. Grape Seed Procyanidins Prevent Oxidative Injury by Modulating the Expression of Antioxidant Enzyme Systems. J. Agric. Food Chem. 2005,53, 6080–6086. [CrossRef] [PubMed] 36. Pons, Z.; Margalef, M.; Bravo, F.I.; Arola-Arnal, A.; Muguerza, B. Chronic Administration of Grape-Seed Polyphenols Attenuates the Development of Hypertension and Improves Other Cardiometabolic Risk Factors Associated with the Metabolic Syndrome in Cafeteria Diet-Fed Rats. Br. J. Nutr. 2017,117, 200–208. [CrossRef] [PubMed] 37. Sampey, B.P.; Vanhoose, A.M.; Winfield, H.M.; Freemerman, A.J.; Muehlbauer, M.J.; Fueger, P.T.; Newgard, C.B.; Makowski, L. Cafeteria Diet Is a Robust Model of Human Metabolic Syndrome with Liver and Adipose Inflammation: Comparison to High-Fat Diet. Obesity 2011,19, 1109–1117. [CrossRef] [PubMed] 38. Ribas-Latre, A.; Baselga-Escudero, L.; Casanova, E.; Arola-Arnal, A.; Salvadó, M.-J.; Bladé, C.; Arola, L. Dietary Proanthocyanidins Modulate BMAL1 Acetylation, Nampt Expression and NAD Levels in Rat Liver. Sci. Rep. 2015,5, 10954. [CrossRef] 39. Ribas-Latre, A.; Del Bas, J.M.; Baselga-Escudero, L.; Casanova, E.; Arola-Arnal, A.; Salvadó, M.J.; Arola, L.; Bladé, C. Dietary Proanthocyanidins Modulate Melatonin Levels in Plasma and the Expression Pattern of Clock Genes in the Hypothalamus of Rats. Mol. Nutr. Food Res. 2015,59, 865–878. [CrossRef] [PubMed] 40. Soliz-Rueda, J.R.; López-Fernández-Sobrino, R.; Torres-Fuentes, C.; Bravo, F.I.; Suárez, M.; Mulero, M.; Muguerza, B. Metabolism Disturbance by Light/Dark Cycle Switching Depends on the Rat Health Status: The Role of Grape Seed Flavanols. Food Funct. 2023,14, 6443–6454. [CrossRef] 41. Kolbe, I.; Oster, H. Chronodisruption, Metabolic Homeostasis, and the Regulation of Inflammation in Adipose Tissues. Yale J. Biol. Med. 2019,92, 317–325. [PubMed] 42. Pérez-Torres, I.; Castrejón-Téllez, V.; Soto, M.E.; Rubio-Ruiz, M.E.; Manzano-Pech, L.; Guarner-Lans, V. Oxidative Stress, Plant Natural Antioxidants, and Obesity. Int. J. Mol. Sci. 2021,22, 1786. [CrossRef] [PubMed] 43. Fernández-Sánchez, A.; Madrigal-Santillán, E.; Bautista, M.; Esquivel-Soto, J.; Morales-González, Á.; Esquivel-Chirino, C.; Durante-Montiel, I.; Sánchez-Rivera, G.; Valadez-Vega, C.; Morales-González, J.A. Inflammation, Oxidative Stress, and Obesity. Int. J. Mol. Sci. 2011,12, 3117–3132. [CrossRef] [PubMed] 44. Lalanza, J.F.; Snoeren, E.M.S. The Cafeteria Diet: A Standardized Protocol and Its Effects on Behavior. Neurosci. Biobehav. Rev. 2021,122, 92–119. [CrossRef] 45. Buyukdere, Y.; Gulec, A.; Akyol, A. Cafeteria Diet Increased Adiposity in Comparison to High Fat Diet in Young Male Rats. PeerJ 2019,7, e6656. [CrossRef] 46. Carillon, J.; Romain, C.; Bardy, G.; Fouret, G.; Feillet-Coudray, C.; Gaillet, S.; Lacan, D.; Cristol, J.-P.; Rouanet, J.-M. Cafeteria Diet Induces Obesity and Insulin Resistance Associated with Oxidative Stress but Not with Inflammation: Improvement by Dietary Supplementation with a Melon Superoxide Dismutase. Free Radic. Biol. Med. 2013,65, 254–261. [CrossRef] 47. Fonken, L.K.; Workman, J.L.; Walton, J.C.; Weil, Z.M.; Morris, J.S.; Haim, A.; Nelson, R.J. Light at Night Increases Body Mass by Shifting the Time of Food Intake. Proc. Natl. Acad. Sci. USA 2010,107, 18664–18669. [CrossRef] 48. Espinoza Gallardo, A.C.; López-Espinoza, A.; Vázquez-Cisneros, L.C.; Zepeda-Salvador, A.P.; Santillano-Herrera, D. Light-Dark Cycle Inversion Effect on Food Intake and Body Weight in Rats. Nutr. Hosp. 2021,38, 495–501. [CrossRef] 49. Arble, D.M.; Ramsey, K.M.; Bass, J.; Turek, F.W. Circadian Disruption and Metabolic Disease: Findings from Animal Models. Best Pract. Res. Clin. Endocrinol. Metab. 2010,24, 785–800. [CrossRef] 50. Tavolaro, F.M.; Thomson, L.M.; Ross, A.W.; Morgan, P.J.; Helfer, G. Photoperiodic Effects on Seasonal Physiology, Reproductive Status and Hypothalamic Gene Expression in Young Male F344 Rats. J. Neuroendocrinol. 2015,27, 79–87. [CrossRef] 51. Ross, A.W.; Russell, L.; Helfer, G.; Thomson, L.M.; Dalby, M.J.; Morgan, P.J. Photoperiod Regulates Lean Mass Accretion, but Not Adiposity, in Growing F344 Rats Fed a High Fat Diet. PLoS ONE 2015,10, e0119763. [CrossRef] [PubMed] 52. Mariné-Casadó, R.; Domenech-Coca, C.; del Bas, J.M.; Bladé, C.; Caimari, A.; Arola, L. Cherry Consumption out of Season Alters Lipid and Glucose Homeostasis in Normoweight and Cafeteria-Fed Obese Fischer 344 Rats. J. Nutr. Biochem. 2019 ,63, 72–86. [CrossRef] [PubMed] 53. Arreaza-Gil, V.; Escobar-Martínez, I.; Suárez, M.; Bravo, F.I.; Muguerza, B.; Arola-Arnal, A.; Torres-Fuentes, C. Gut Seasons: Photoperiod Effects on Fecal Microbiota in Healthy and Cafeteria-Induced Obese Fisher 344 Rats. Nutrients 2022 ,14, 722. [CrossRef] Int. J. Mol. Sci. 2023,24, 17057 22 of 23 54. Zhou, J.; Mao, L.; Xu, P.; Wang, Y. Effects of ( − )-Epigallocatechin Gallate (EGCG) on Energy Expenditure and Microglia-Mediated Hypothalamic Inflammation in Mice Fed a High-Fat Diet. Nutrients 2018,10, 1681. [CrossRef] [PubMed] 55. del Bas, J.M.; Guirro, M.; Boqué, N.; Cereto, A.; Ras, R.; Crescenti, A.; Caimari, A.; Canela, N.; Arola, L. Alterations in Gut Microbiota Associated with a Cafeteria Diet and the Physiological Consequences in the Host. Int. J. Obes. 2018 ,42, 746–754. [CrossRef] 56. Kumar, S.; Alagawadi, K.; Rao, M.R. Effect of Argyreia Speciosa Root Extract on Cafeteria Diet-Induced Obesity in Rats. Indian. J. Pharmacol. 2011,43, 163. [CrossRef] [PubMed] 57. Martín-González, M.Z.; Palacios, H.; Rodríguez, M.A.; Arola, L.; Aragonès, G.; Muguerza, B. Beneficial Effects of a Low-Dose of Conjugated Linoleic Acid on Body Weight Gain and Other Cardiometabolic Risk Factors in Cafeteria Diet-Fed Rats. Nutrients 2020,12, 408. [CrossRef] 58. de Melo, A.F.; Moreira, C.C.L.; Sales, C.F.; Rentz, T.; Raposo, H.F.; Garófalo, M.A.R.; Botion, L.M.; Kettelhut, I.d.C.; de Oliveira, H.C.F.; Chaves, V.E. Increase in Liver Cytosolic Lipases Activities and VLDL-TAG Secretion Rate Do Not Prevent the NonAlcoholic Fatty Liver Disease in Cafeteria Diet-Fed Rats. Biochimie 2018,150, 16–22. [CrossRef] 59. Chambel, S.S.; Santos-Gonçalves, A.; Duarte, T.L. The Dual Role of Nrf2 in Nonalcoholic Fatty Liver Disease: Regulation of Antioxidant Defenses and Hepatic Lipid Metabolism. BioMed Res. Int. 2015,2015, 597134. [CrossRef] 60. Saran, A.R.; Dave, S.; Zarrinpar, A. Circadian Rhythms in the Pathogenesis and Treatment of Fatty Liver Disease. Gastroenterology 2020,158, 1948–1966.e1. [CrossRef] 61. Li, Y.; Xu, S.; Mihaylova, M.M.; Zheng, B.; Hou, X.; Jiang, B.; Park, O.; Luo, Z.; Lefai, E.; Shyy, J.Y.-J.; et al. AMPK Phosphorylates and Inhibits SREBP Activity to Attenuate Hepatic Steatosis and Atherosclerosis in Diet-Induced Insulin-Resistant Mice. Cell Metab. 2011,13, 376–388. [CrossRef] [PubMed] 62. Rodríguez, R.M.; Colom-Pellicer, M.; Blanco, J.; Calvo, E.; Aragonès, G.; Mulero, M. Grape-Seed Procyanidin Extract (GSPE) Seasonal-Dependent Modulation of Glucose and Lipid Metabolism in the Liver of Healthy F344 Rats. Biomolecules 2022,12, 839. [CrossRef] [PubMed] 63. Palacios-Jordan, H.; Martín-González, M.Z.; Suárez, M.; Aragonès, G.; Muguerza, B.; Rodríguez, M.A.; Bladé, C. The Disruption of Liver Metabolic Circadian Rhythms by a Cafeteria Diet Is Sex-Dependent in Fischer 344 Rats. Nutrients 2020 ,12, 1085. [CrossRef] 64. Budkowska, M.; Cecerska-Hery´c, E.; Marcinowska, Z.; Siennicka, A.; Doł˛egowska, B. The Influence of Circadian Rhythm on the Activity of Oxidative Stress Enzymes. Int. J. Mol. Sci. 2022,23, 14275. [CrossRef] 65. Early, J.O.; Menon, D.; Wyse, C.A.; Cervantes-Silva, M.P.; Zaslona, Z.; Carroll, R.G.; Palsson-McDermott, E.M.; Angiari, S.; Ryan, D.G.; Corcoran, S.E.; et al. Circadian Clock Protein BMAL1 Regulates IL-1 β in Macrophages via NRF2. Proc. Natl. Acad. Sci. USA 2018,115, E8460–E8468. [CrossRef] [PubMed] 66. Hybertson, B.M.; Gao, B. Role of the Nrf2 Signaling System in Health and Disease. Clin. Genet. 2014,86, 447–452. [CrossRef] 67. Niu, L.; Shao, M.; Liu, Y.; Hu, J.; Li, R.; Xie, H.; Zhou, L.; Shi, L.; Zhang, R.; Niu, Y. Reduction of Oxidative Damages Induced by Titanium Dioxide Nanoparticles Correlates with Induction of the Nrf2 Pathway by GSPE Supplementation in Mice. Chem. Biol. Interact. 2017,275, 133–144. [CrossRef] 68. Liu, B.; Zhang, H.; Tan, X.; Yang, D.; Lv, Z.; Jiang, H.; Lu, J.; Baiyun, R.; Zhang, Z. GSPE Reduces Lead-Induced Oxidative Stress by Activating the Nrf2 Pathway and Suppressing MiR153 and GSK-3 β in Rat Kidney. Oncotarget 2017 ,8, 42226–42237. [CrossRef] 69. Feng, Y.; Chen, X.; Chen, D.; He, J.; Zheng, P.; Luo, Y.; Yu, B.; Huang, Z. Dietary Grape Seed Proanthocyanidin Extract Supplementation Improves Antioxidant Capacity and Lipid Metabolism in Finishing Pigs. Anim. Biotechnol. 2023 ,34, 1–11. [CrossRef] 70. Liu, K.; Luo, M.; Wei, S. The Bioprotective Effects of Polyphenols on Metabolic Syndrome against Oxidative Stress: Evidences and Perspectives. Oxid. Med. Cell. Longev. 2019,2019, 6713194. [CrossRef] 71. Truzzi, F.; Tibaldi, C.; Zhang, Y.; Dinelli, G.; D 0 Amen, E. An Overview on Dietary Polyphenols and Their Biopharmaceutical Classification System (Bcs). Int. J. Mol. Sci. 2021,22, 5514. [CrossRef] [PubMed] 72. Ribas-Latre, A.; Del Bas, J.M.; Baselga-Escudero, L.; Casanova, E.; Arola-Arnal, A.; Salvadó, M.J.; Bladé, C.; Arola, L. Dietary Proanthocyanidins Modulate the Rhythm of BMAL1 Expression and Induce ROR α Transactivation in HepG2 Cells. J. Funct. Foods 2015,13, 336–344. [CrossRef] 73. Rodríguez, R.M.; Cortés-Espinar, A.J.; Soliz-Rueda, J.R.; Feillet-Coudray, C.; Casas, F.; Colom-Pellicer, M.; Aragonès, G.; AvilaRomán, J.; Muguerza, B.; Mulero, M.; et al. Time-of-Day Circadian Modulation of Grape-Seed Procyanidin Extract (GSPE) in Hepatic Mitochondrial Dynamics in Cafeteria-Diet-Induced Obese Rats. Nutrients 2022,14, 774. [CrossRef] [PubMed] 74. Pei, J.; Pan, X.; Wei, G.; Hua, Y. Research Progress of Glutathione Peroxidase Family (GPX) in Redoxidation. Front. Pharmacol. 2023,14, 1147414. [CrossRef] [PubMed] 75. Campbell, N.K.; Fitzgerald, H.K.; Dunne, A. Regulation of Inflammation by the Antioxidant Haem Oxygenase 1. Nat. Rev. Immunol. 2021,21, 411–425. [CrossRef] 76. Costa Silva, R.C.M.; Correa, L.H.T. Heme Oxygenase 1 in Vertebrates: Friend and Foe. Cell Biochem. Biophys. 2022 ,80, 97–113. [CrossRef] [PubMed] 77. Milani, P.; Gagliardi, S.; Cova, E.; Cereda, C. SOD1 Transcriptional and Posttranscriptional Regulation and Its Potential Implications in ALS. Neurol. Res. Int. 2011,2011, 458427. [CrossRef] 78. Toivonen, J.M.; Manzano, R.; Oliván, S.; Zaragoza, P.; García-Redondo, A.; Osta, R. MicroRNA-206: A Potential Circulating Biomarker Candidate for Amyotrophic Lateral Sclerosis. PLoS ONE 2014,9, e89065. [CrossRef] Int. J. Mol. Sci. 2023,24, 17057 23 of 23 79. Baselga-Escudero, L.; Blade, C.; Ribas-Latre, A.; Casanova, E.; Suarez, M.; Torres, J.L.; Salvado, M.J.; Arola, L.; Arola-Arnal, A. Resveratrol and EGCG Bind Directly and Distinctively to MiR-33a and MiR-122 and Modulate Divergently Their Levels in Hepatic Cells. Nucleic Acids Res. 2014,42, 882–892. [CrossRef] 80. Baselga-Escudero, L.; Blade, C.; Ribas-Latre, A.; Casanova, E.; Salvadó, M.-J.; Arola, L.; Arola-Arnal, A. Chronic Supplementation of Proanthocyanidins Reduces Postprandial Lipemia and Liver MiR-33a and MiR-122 Levels in a Dose-Dependent Manner in Healthy Rats. J. Nutr. Biochem. 2014,25, 151–156. [CrossRef] 81. Arola-Arnal, A.; Bladé, C. Proanthocyanidins Modulate MicroRNA Expression in Human HepG2 Cells. PLoS ONE 2011 ,6, e25982. [CrossRef] 82. Manocchio, F.; Soliz-Rueda, J.R.; Ribas-Latre, A.; Bravo, F.I.; Arola-Arnal, A.; Suarez, M.; Muguerza, B. Grape Seed Proanthocyanidins Modulate the Hepatic Molecular Clock via MicroRNAs. Mol. Nutr. Food Res. 2022 ,66, e2200443. [CrossRef] [PubMed] 83. Egnatchik, R.A.; Leamy, A.K.; Jacobson, D.A.; Shiota, M.; Young, J.D. ER Calcium Release Promotes Mitochondrial Dysfunction and Hepatic Cell Lipotoxicity in Response to Palmitate Overload. Mol. Metab. 2014,3, 544–553. [CrossRef] 84. Listenberger, L.L.; Ory, D.S.; Schaffer, J.E. Palmitate-Induced Apoptosis Can Occur through a Ceramide-Independent Pathway. J. Biol. Chem. 2001,276, 14890–14895. [CrossRef] [PubMed] 85. Ma, Q.; Zhou, X.; Sun, Y.; Hu, L.; Zhu, J.; Shao, C.; Meng, Q.; Shan, A. Threonine, but Not Lysine and Methionine, Reduces Fat Accumulation by Regulating Lipid Metabolism in Obese Mice. J. Agric. Food Chem. 2020,68, 4876–4883. [CrossRef] [PubMed] 86. Chen, J.; Qian, D.; Wang, Z.; Sun, Y.; Sun, B.; Zhou, X.; Hu, L.; Shan, A.; Ma, Q. Threonine Supplementation Prevents the Development of Fat Deposition in Mice Fed a High-Fat Diet. Food Funct. 2022,13, 7772–7780. [CrossRef] [PubMed] 87. Arreaza-Gil, V.; Escobar-Martínez, I.; Mulero, M.; Muguerza, B.; Suárez, M.; Arola-Arnal, A.; Torres-Fuentes, C. Gut Microbiota Influences the Photoperiod Effects on Proanthocyanidins Bioavailability in Diet-Induced Obese Rats. Mol. Nutr. Food Res. 2023 , 67, 2200600. [CrossRef] 88. Mariné-Casadó, R.; Domenech-Coca, C.; del Bas, J.M.; Bladé, C.; Arola, L.; Caimari, A. Intake of an Obesogenic Cafeteria Diet Affects Body Weight, Feeding Behavior, and Glucose and Lipid Metabolism in a Photoperiod-Dependent Manner in F344 Rats. Front. Physiol. 2018,9, 1639. [CrossRef] 89. Gibert-Ramos, A.; Crescenti, A.; Salvadó, M. Consumption of Cherry out of Season Changes White Adipose Tissue Gene Expression and Morphology to a Phenotype Prone to Fat Accumulation. Nutrients 2018,10, 1102. [CrossRef] 90. Gibert-Ramos, A.; Ibars, M.; Salvadó, M.J.; Crescenti, A. Response to the Photoperiod in the White and Brown Adipose Tissues of Fischer 344 Rats Fed a Standard or Cafeteria Diet. J. Nutr. Biochem. 2019,70, 82–90. [CrossRef] 91. Aragonès, G.; Suárez, M.; Ardid-Ruiz, A.; Vinaixa, M.; Rodríguez, M.A.; Correig, X.; Arola, L.; Bladé, C. Dietary Proanthocyanidins Boost Hepatic NAD + Metabolism and SIRT1 Expression and Activity in a Dose-Dependent Manner in Healthy Rats. Sci. Rep. 2016,6, 24977. [CrossRef] [PubMed] 92. Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose Translation from Animal to Human Studies Revisited. FASEB J. 2008 ,22, 659–661. [CrossRef] [PubMed] 93. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2- ∆∆ CT Method. Methods 2001,25, 402–408. [CrossRef] [PubMed] 94. Smedes, F.; Thomasen, T.K. Evaluation of the Bligh & Dyer Lipid Determination Method. Mar. Pollut. Bull. 1996 ,32, 681–688. [CrossRef] 95. Cajka, T.; Fiehn, O. Toward Merging Untargeted and Targeted Methods in Mass Spectrometry-Based Metabolomics and Lipidomics. Anal. Chem. 2016,88, 524–545. [CrossRef] 96. Xia, J.; Wishart, D.S. Web-Based Inference of Biological Patterns, Functions and Pathways from Metabolomic Data Using MetaboAnalyst. Nat. Protoc. 2011,6, 743–760. [CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.