Generation of a human iPS cell line from a patient with retinitis pigmentosa due to EYS mutation

Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr Lab resource: Stem Cell Line Generation of a human iPS cell line from a patient with retinitis pigmentosa due to EYS mutation Sofia M. Calado a,1 , Ana B. Garcia-Delgado a,1 , Berta De la Cerda a , Beatriz Ponte-Zuñiga b , Shom S. Bhattacharya a , Francisco J. Díaz-Corrales a,⁎ a Department of Regeneration and Cell Therapy, Andalusian Molecular Biology and Regenerative Medicine Centre-CABIMER (Junta de Andalucía, CSIC, Universidad de Sevilla, Universidad Pablo de Olavide), Seville, Spain b Macarena University Hospital, Department of Ophthalmology, Seville, Spain ABSTRACT Retinitis pigmentosa (RP) is an inherited retinal degenerative disease. Mutations in EYS have been associated with autosomal recessive RP. The human iPS cell line, CABi002-A, derived from peripheral blood mononuclear cells from a patient carrying a heterozygous double mutation in EYS gene was generated by non-integrative reprogramming technology, using hOCT3/4, hSOX2, hc-MYC and hKLF4 reprogramming factors. Pluripotency and differentiation capacity were assessed by immunocytochemistry and RT-PCR. This iPSC line can be further differentiated towards the affected cells to understand the pathophysiology of the disease and test new therapeutic strategies. Resource table Unique stem cell line identifier CABi002-A Alternative name(s) of stem cell line OF0176-EYS02-C7 Institution Andalusian Molecular Biology and Regenerative Medicine Centre (CABIMER) Contact information of distributor Francisco Diaz-Corrales, [email protected] Type of cell line iPSC Origin Human Additional origin info Age:38 Sex: Male Ethnicity if known: Caucasian Cell source Peripheral blood mononucleated cells Clonality Clonal Method of reprogramming Sendai viral reprogramming Genetic modification No Type of modification N/A Associated disease Autosomal Recessive Retinitis Pigmentosa Gene/locus EYS/6q12 c.3567delA c.4829-4832delCATT Method of modification N/A Name of transgene or resistance N/A Inducible/constitutive system N/A Date archived/stock date N/A Cell line repository/bank N/A Ethical approval Patient informed consent obtained/Ethics Review Boardcompetent authority approval obtained (Ethical Approval number: PR-01-2015) Resource utility The generation of this cellular model will allow us to better understand the pathophysiology of the disease and to test new therapeutic strategies for RP due to EYS mutations. Resource details Mononucleated cells were collected from 4 ml of peripheral blood sample from 38 year-old patient diagnosed with inherited con-rod dystrophy, due to an heterozygous double mutation in EYS gene caused by a deletion of an A in the position 3567 of the exon 23 of the paternal allele (c.3567delA p.Gly1190Aspfs*39), originating a frame reading change and premature STOP codon and a deletion of a CATT in the position 4829–4832 of the exon 26 of the maternal allele (c.4829- https://doi.org/10.1016/j.scr.2018.11.002 Received 17 September 2018; Received in revised form 29 October 2018; Accepted 9 November 2018 ⁎ Corresponding author at: Andalusian Molecular Biology and Regenerative Medicine Centre, Avda. Americo Vespucio n°24 Edif. CABIMER, Parque Científico y Tecnológico Cartuja, 41092 Sevilla, Spain. E-mail address: [email protected] (F.J. Díaz-Corrales). 1 Equally contributing authors. Stem Cell Research 33 (2018) 251–254 Available online 16 November 2018 1873-5061/ © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/BY/4.0/). T 4832delCATT p.Ser1610Phefs*7) (McGuigan et al., 2017). DNA sequencing of CABi002-A confirmed the presence of the aforementioned mutations (Fig. 1A). The human induced pluripotent stem (hiPS) cell line was generated by using Sendai virus, encoding the reprogramming factors hOCT3/4, hc-MYC, hKLF4, and hSOX2 (Takahashi et al., 2007), according to manufacturer's instructions. The obtained colonies presented stem-like morphology and pluripotency markers Nanog, Oct4, and TRA-1-81 staining (Fig. 1C). The clearance of viral and endogenous reprogramming markers (Fig. 1B), as well as the presence of pluripotency genes (Fig. 1D), was confirmed by RT-PCR after eight cell culture passages. Our results on the karyotype analysis showed that CABi002-A cell line exhibited a normal, diploid (46, XY) chromosomal content (Fig. 1E) and the genetic fingerprinting proved the genetic identity to parental mononucleated blood cells (archived with journal). Pluripotency was tested by the ability of CABi002- A to generate the three germ layers in vitro: endoderm, mesoderm and ectoderm, as confirmed by immunofluorescent staining of α-fetoprotein (AFP), vimentin and III beta-tubulin (Tuj1), respectively (Fig. 1F) and RT-PCR (Fig. 1G). Materials and methods Mutation sequencing Genomic DNA from peripheral blood mononuclear cells (PBMCs) and hiPSCs was isolated using the QIAamp DNA Blood mini kit (Qiagen). Primers used for amplification and directed sequencing of EYS flanking the mutation sites are described in Table 1. Reprogramming of PBMCs PBMCs were isolated using the Vacutainer®CPT™tubes (BD Biosciences). PBMCs were cultured (1.0 × 10 6 cells) in Expansion Medium (EM; QBSF-60 medium; 50 μg/ml ascorbic acid, 1% Pen/Strep, 50 ng/ml SCF, 10 ng/ml IL-3, 2 U/ml EPO, 40 ng/ml IGF-1 and 1 μM Dexamethasone), for one week before transduction with CytoTune®-iPS 2.0 Sendai Reprogramming Kit (Thermo Fisher Scientific). Briefly, 0.25 × 10 5 cells were transduced using MOI of 5–5-3 (hKOS, hc-MYC, hKLF4, respectively). After 24 h of incubation cells were collected, centrifuged and seeded in a 24 well plate containing EM. Two days later Fig. 1. Characterization of CABi002-A line. A. DNA electropherograms showing the heterozygous double mutation c.3567delA and c.4829-4832delCATT of EYS gene in CABi002-A hiPS cell line of a RP patient. B. RT-PCR analysis of SeV genome and transgenes in hiPSCs, PBMC's (monocytes) and positive control (+ Control). C. Immunocytochemistry for pluripotency markers NANOG, OCT4 and TRA-1-81. Nuclei were counterstained with DAPI. Lower panel (left) is a brightfield image of a CABi002-A hiPS colony, showing its normal morphology and (right) quantification by qPCR of pluripotency markers NANOG and OCT3/4 of CABi002-A hiPS cells compared, compared to PBMC's (monocytes). D. RT-PCR analysis of pluripotency markers. E. Representative metaphase of normal human karyotype (46, XY). F. Immunocytochemistry for ectodermal (Tuj1), mesodermal (ASM) and endodermal (AFP) germ layer markers with nuclei counterstained with DAPI. G. RT-PCR analysis of the three germ layer markers. S.M. Calado et al. Stem Cell Research 33 (2018) 251–254 252 0.1 × 10 6 cells were transferred onto a 6 well plate covered with 0.25 × 10 6 irradiated human foetal fibroblasts (irHFF) in QBSF-60 medium, supplemented with 50 μg/ml ascorbic acid and 1% Pen/Strep. Seven days post-transduction, culture medium was replaced by iPS medium (KO DMEM, 20% KO serum, 1% GlutaMAX; 1% MEM NEAA, 0.23 mM β-mercaptoethanol, 1% Pen/Strep, 10 ng/ml bFGF). Individual colonies with stem-like morphology were manually isolated and expanded 21 to 27 days post-transduction. hiPS cell cultures were cultured on 6 well plate coated 0.25 × 10 6 irHFF, maintained at 37 °C in humidified atmosphere containing 5% CO 2 , and passed every week. RT-PCR for detection of viral clearance and pluripotency markers Total RNA was isolated from cultured hiPS cells with RNeasy Mini Kit (Qiagen) and treated with DNase1 to remove genomic DNA contamination. 1 μg of total RNA was used as template to obtain cDNA, using QuantiTect Reverse Transcription Kit (Qiagen). Viral clearance and pluripotency markers detection were analyzed using the primers described in Table 1. RT-PCR reaction was performed using MyTaq DNA Polymerase (Bioline GmbH). PCR products were analyzed on 2% agarose gels. Three linage differentiation In vitro differentiation was performed by embryoid body (EB) formation to generate the three germ layers (endoderm, mesoderm and ectoderm). The hiPS cells were separated manually from the feeder cells and cultured in non-adherent conditions in iPS medium without bFGF (KO DMEM, 20% KO serum, 1% GlutaMAX; 1% MEM NEAA, 0.23 mM β-mercaptoethanol, 1% Pen/Strep) for the following 7 days. Then, the EBs were seeded on glass coverslips treated with 0,1% gelatin for 2 h/ RT and cultured during one week in EBs medium (DMEM/F12, 10% FBS, 1% GlutaMAX, 1% MEM NEAA, 1% Pen/Strep). The coverslips were fixed in 4% PFA for 15 min and analyzed by immunofluorescence. Immunocytochemistry Cells were allowed to grow in glass coverslips coated with irHFF and washed in ice-cold PBS before fixation in 4% PFA, for 15 min. Fixed cells were washed twice in PBS and placed in blocking solution (2% donkey serum in 0.2% Triton-X100/PBS) for 1 h at room temperature. Cells were incubated for 1 h at room temperature with the primary antibody (Table 1). After incubation, samples were washed 3 times in 0.2% Triton X100/PBS, and incubated with the secondary antibodies at room temperature for 1 h (Table 1). After 3 washes, coverslips were mounted with Vectashield mounting medium (Vector H-1200) containing 4,6-diamidino-2-phenylindole (DAPI). Karyotype analyses Genome integrity of the hiPS cells was analyzed by G-banding at 400–550 band resolution (Biobanco de Sistema Sanitario Público, Granada, Spain). Fingerprinting gDNA form PBMC's and hiPS cells was extracted using QIAamp DNA Blood mini kit (Qiagen) in the presence of RNAse (Roche). Fingerprinting analyses was performed by Biobanco de Sistema Sanitario Público, Granada, Spain. Table 1 Reagents details. Antibodies used for immunocytochemistry/flow-citometry Antibody Dilution Company Cat # and RRID Pluripotency markers Rabbit anti-OCT4 1:400 Cell Signaling Technology Cat# 2840, RRID:AB_2167691 Rabbit anti-NANOG 1:400 Cell Signaling Technology Cat# 4903, RRID:AB_10559205 Rabbit anti-SOX2 1:400 Cell Signaling Technology Cat# 3579, RRID:AB_2195767 Mouse anti-SSEA-4 1:100 BD Biosciences Cat# 560073, RRID:AB_1645601 Mouse anti-TRA-1-81 1:100 Stemgent Cat# 09-0069, RRID:AB_2119069 Differentiation markers Rabbit anti- Tuj1 1:2000 Covance Research Products Inc. Cat# MRB-435P-100, RRID:AB_663339 Mouse anti-ASM 1:300 Sigma-Aldrich Cat# A5228, RRID:AB_262054 Mouse anti-AFP 1:20 Sigma-Aldrich Cat# A5228, RRID:AB_262054 Secondary antibodies Donkey anti-Mouse 488 1:500 Molecular Probes Cat# A-21202, RRID:AB_141607 Donkey anti-Rabbit 594 1:500 Molecular Probes Cat# A-21207, RRID:AB_141637 Primers Target Forward/Reverse primer (5′-3′) Plasmids (RT-PCR) SeV plasmid GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC KOS plasmid ATGCACCGCTACGACGTGAGCGC/ACCTTGACAATCCTGATGTGG KLF4 plasmid TTCCTGCATGCCAGAGGAGCCC/AATGTATCGAAGGTGCTCAA c-MYC plasmid TAACTGACTAGCAGGCTTGTCG/TCCACATACAGTCCTGGATGATGATG Pluripotency markers (RT-PCR) NANOG CCAAATTCTCCTGCCAGTGAC/CACGTGGTTTCCAAACAAGAAA OCT4 AAGCCCTCATTTCACCAGG/CTTGGAAGCTTAGCCAGGTC SOX2 TCACATGTCCCAGCACTACC/CCCATTTCCCTCGTTTTTCT TERT GCGTTTGGTGGATGATTTCT/GGCATAGCTGGAGTAGTCGC Differentiation Potential (RT-PCR) PAX6 GTCCATCTTTGCTTGGGAAA/TAGCCAGGTTGCGAAGAACT MAP2 GCACGCCTGCAGCTTGCATC/TCTCCACCACCCCGTACGCA BRACHYURY TCAGCAAAGTCAAGCTCACCA/CCCCAACTCTCACTATGTGGATT MSX1 CGAGAGGACCCCGTGGATGCAGAG/GGCGGCCATCTTCAGCTTCTCCAG α-FETOPROTEIN CTTTGGGCTGCTCGCTATGA/ATGGCTTGGAAAGTTCGGGTC SOX17 CGCTTTCATGGTGTGGGCTAAGGACG/TAGTTGGGGTGGTCCTGCATGTGCTG House-Keeping genes (RT-PCR) GAPDH TGCACCACCAACTGCTTAGC/GGCATGGACTGTGGTCATGAG Genotyping EYS exon 23 TCCCAGCTACATGTTGTTG/CATTAAGATTTCCTGATGAAAGC EYS exon 26 CAAGCAACCAGAGACTCA/TGTGAAGGGACAATGGATAAAC S.M. Calado et al. Stem Cell Research 33 (2018) 251–254 253 Mycoplasma detection The presence of mycoplasma was tested regularly by luminescence using the MycoAlert™PLUS Mycoplasma Detection Kit (Lonza). Funding This work was supported by Cellex Foundation (Barcelona, Spain) and Fundación Progreso y Salud (Seville, Spain). References McGuigan, D.B., Heon, E., Cideciyan, A.V., Ratnapriya, R., Lu, M., Sumaroka, A., Roman, A.J., Batmanabane, V., Garafalo, A.V., Stone, E.M., Swaroop, A., Jacobson, S.G., 2017. EYS mutations causing autosomal recessive retinitis pigmentosa: changes of retinal structure and function with disease progression. Genes (Basel) 8, 1–19. https://doi.org/10.3390/genes8070178. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., Yamanaka, S., 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872. https://doi.org/10.1016/j.cell.2007.11.019. S.M. Calado et al. Stem Cell Research 33 (2018) 251–254 254