Decoding the interplay between TAZ and metabolism in early lung development
Abstract
Lung branching morphogenesis results from the crosstalk between epithelial and mesenchymal compartments and it is mainly regulated by multiple signaling pathways, namely Hippo signaling pathway. Hippo signaling pathway is a highly conserved kinase cascade that plays important roles in organ size control, repair and homeostasis. YAP and TAZ are the major transducers of Hippo pathway. The phosphorylation status of YAP/TAZ complex determines its subcellular localization and, consequently, the activation of the pathway. For instance, the non-phosphorylated YAP/TAZ is present in the nucleus where it associates with transcription factors like the TEAD family or RUNX2 promoting the transcription of target genes linked to cell proliferation and apoptosis. Several studies have described, over the years, the impact of metabolic pathways on Hippo regulation and activity. However, lung metabolic profile and the impact of Hippo modulation on the embryonic lung metabolic signature are still largely unknown. Therefore, this project aimed to study the impact of TAZ modulation on the chick lung metabolic profile. For this purpose, in vitro lung explants were treated with an inducer of TAZ nuclear localization (TM- 25659). Cultured lungs were morphometrically analyzed and processed for Western blot analysis, in situ hybridization and qRT-PCR. Moreover, culture medium was collected and analyzed by 1H-NMR spectroscopy. Lung explants stimulated with the TAZ inducer displayed an increase of 12% in branching, in a dose-dependent manner, when compared to controls. As expected, TAZ manipulation did not affect total YAP and TAZ protein expression levels but it promoted a mild increase in runx2 expression levels. qRT-PCR analysis revealed an increase of glut8, mct8, pdh and ldh expression levels when compared to controls. 1H-NMR spectroscopy revealed an increase in the secretion of succinate and acetate to the extracellular medium after explant stimulation with a TAZ inducer. Finally, embryonic lung metabolite profile was determined, and high lactate tissue levels were detected. TAZ manipulation had a mild impact in lung branching nonetheless it induced alterations in the expression levels of different enzymes and transporters of glucose catabolism. Furthermore, alterations in the amount of certain key metabolites was also noticed in TAZ-induced explants. Taken together, these results highlight a potential role for TAZ in the regulation of embryonic lung metabolic profile. This is the first study showing the contribution of Hippo signaling to metabolic reprograming of early lung development through the modulation of glucose catabolism-related genes. These findings may contribute to uncover new therapeutic targets to treat lung developmental disorders.
Full text
Julho de 2019 UMinho | 2019 Universidade do MinhoEscola de Medicina Henrique Emanuel Araújo Silva Decoding the interplay between TAZ and metabolism in early lung development Henrique Emanuel Araújo Silva Decoding the interplay between TAZ andmetabolism in early lung development
Dissertação de Mestrado Mestrado em Ciências da Saúde Trabalho Efetuado sob a orientação daDoutora Rute Carina Silva Moura Doutor Marco Aurélio Gouveia Alves Universidade do MinhoEscola de MedicinaJulho de 2019Henrique Emanuel Araújo Silva Decoding the interplay between TAZ andmetabolism in early lung development Estudo da interação entre TAZ e o metabolismono desenvolvimento pulmonar precoce
ii DIREITOS DE AUTOR E CONDIÇÕES DE UTILIZAÇÃO DO TRABALHO POR TERCEIROS Este é um trabalho académico que pode ser utilizado por terceiros desde que respeitadas as regras e boas práticas internacionalmente aceites, no que concerne aos direitos de autor e direitos conexos. Assim, o presente trabalho pode ser utilizado nos termos previstos na licença abaixo indicada. Caso o utilizador necessite de permissão para poder fazer um uso do trabalho em condições não previstas no licenciamento indicado, deverá contactar o autor, através do RepositóriUM da Universidade do Minho. Licença concedida aos utilizadores deste trabalho
iii Acknowledgments I would like to acknowledge the School of Medicine, the School of Sciences and all the professors that accompanied me during my bachelor and master’s degree. Particularly, to Doctor Rute Moura, that has been my supervisor for the last 3 years in several projects, I would like to express my profound recognition/gratitude. Thank you for believing in me and in my capability to do science, and for giving me all the support and conditions to grow as a scientist. To my supervisor Doctor Marco Alves and to Doctor Pedro Oliveira, for devoting their time and valuable experience to training me. Furthermore, I would like to acknowledge both ICVS and ICBAS teams, particularly, Hugo Silva, Pedro Silva and Ana Martins. Finally, I would like to acknowledge Professor Jorge Correia-Pinto as SSRD coordinator, my colleagues from I1.03 lab and SSRD. To all my friends that accompanied supported me thru my still short career during both bachelor and master’s degrees namely, Mário, António, Bruna, Ana, Marlene, Bruna, Tiago, Miguel, Eduarda, Gonçalo, Diogo, Joana, Sara, Helena, Micaela, Andreia, Catarina, Margarida and Carlos. To my oldest friends, César, João, Carlos, Paulo, Filipa and Tiago for always believing in me and in my skills. To my family for supporting me all these years and for looking at me with proud. Finally, and probably the most important acknowledgments, to my mother Deolinda, to my father Carlos and to my brother Carlos. Without them, my achievements would simply be impossible to accomplish. For all the sacrifices that they have done for me so that I can have a better future I can only be grateful. My success will always reflect the hard efforts that they made for me and my career. I am forever grateful and although a thank you seems very little considering all that you have done for me, for now is the only thing I can give you. The work presented in this dissertation was performed at the Surgical Sciences Research Domain of the Life and Health Sciences Research Institute (ICVS), School of Medicine, University of Minho, Braga, Portugal (ICVS/3B’s – PT Government Associate Laboratory, Braga/Guimarães, Portugal). The work was supported by FEDER funds, through the Competitiveness Factors Operational Programme (COMPETE), and by National funds, through the Foundation for Science and Technology (FCT), under the scope of the Project UID/Multi/50026/2019; and by the Project NORTE-01-0145-FEDER-000013, supported by the Northern Portugal Regional Operational Programme (NORTE 2020), under the Portugal 2020 Partnership Agreement, through the European Regional Development Fund (FEDER).
iv Statement of integrity I hereby declare having conducted this academic work with integrity. I confirm that I have not used plagiarism or any form of undue use of information or falsification of results along the process leading to its elaboration. I further declare that I have fully acknowledged the Code of Ethical Conduct of the University of Minho.
v Estudo da interação entre TAZ e o metabolismo no desenvolvimento pulmonar precoce Resumo A ramificação pulmonar resulta da interação entre os compartimentos epitelial e mesenquimal sendo regulada por diferentes vias de sinalização, nomeadamente, a via Hippo. A via de sinalização Hippo consiste numa cascata de cinases importante na regulação do crescimento dos órgãos, reparação e homeostasia celular. A ativação dessa via depende da fosforilação do complexo efetor YAP/TAZ. Assim, quando o complexo não está fosforilado está presente no núcleo onde se associa com fatores de transcrição, como o TEAD ou RUNX2, promovendo a transcrição de genes ligados à proliferação celular e apoptose. O impacto das vias metabólicas na regulação e atividade da via Hippo já foi descrita em alguns tecidos. No entanto, desconhece-se o impacto da modulação da via Hippo, mais concretamente da TAZ, no perfil metabólico do pulmão em desenvolvimento. Assim, este projeto teve como objetivo estudar o impacto da modulação da TAZ no perfil metabólico do pulmão embrionário de galinha. Para tal, explantes pulmonares foram tratados, in vitro , com TM-25659 que promove a translocação de TAZ para o núcleo. Os pulmões tratados foram analisados morfometricamente e processados para análise por Western blot, hibridização in situ e qRT-PCR. Para além disso, o meio de cultura foi analisado por espectroscopia de 1H-RMN. Os explantes de pulmão tratados com TM-25659 apresentaram um aumento de 12% na ramificação, quando comparados com o controlo. Como esperado, o tratamento não afetou os níveis de expressão das proteínas YAP e TAZ, mas levou a um aumento dos níveis de expressão de runx2 . Os resultados demonstram que a translocação de TAZ promove um aumento dos níveis de expressão de glut8 , mct8 , pdh e ldh quando comparados com o controlo. A análise metabolómica dos meios revelou um aumento da secreção de succinato e acetato após a estimulação da translocação de TAZ para o núcleo. Por fim caracterizou-se o perfil de metabólico do pulmão embrionário, por 1H-RMN, tendo-se detetado níveis elevados de lactato no tecido. A manipulação do efetor TAZ nos explantes pulmonares teve um impacto discreto na ramificação pulmonar, no entanto, induziu alterações significativas nos níveis de expressão de diferentes enzimas e transportadores envolvidos no catabolismo da glicose. Além disso, alterou o perfil metabólico basal de glicolítico para oxidativo. Em conjunto, estes resultados apontam para um papel da TAZ na regulação do perfil metabólico do pulmão durante o desenvolvimento. Este estudo demonstra, pela primeira vez, a contribuição da via Hippo para a reprogramação metabólica do pulmão em desenvolvimento através da modulação da expressão de genes do catabolismo da glucose. Estes resultados podem contribuir para distinguir novos alvos terapêuticos para tratar distúrbios do desenvolvimento/doença pulmonar. Palavras Chave: Desenvolvimento; Hippo; Metabolismo; Pulmão; TAZ
vi Decoding the interplay between TAZ and metabolism in early lung development Abstract Lung branching morphogenesis results from the crosstalk between epithelial and mesenchymal compartments and it is mainly regulated by multiple signaling pathways, namely Hippo signaling pathway. Hippo signaling pathway is a highly conserved kinase cascade that plays important roles in organ size control, repair and homeostasis. YAP and TAZ are the major transducers of Hippo pathway. The phosphorylation status of YAP/TAZ complex determines its subcellular localization and, consequently, the activation of the pathway. For instance, the non-phosphorylated YAP/TAZ is present in the nucleus where it associates with transcription factors like the TEAD family or RUNX2 promoting the transcription of target genes linked to cell proliferation and apoptosis. Several studies have described, over the years, the impact of metabolic pathways on Hippo regulation and activity. However, lung metabolic profile and the impact of Hippo modulation on the embryonic lung metabolic signature are still largely unknown. Therefore, this project aimed to study the impact of TAZ modulation on the chick lung metabolic profile. For this purpose, in vitro lung explants were treated with an inducer of TAZ nuclear localization (TM25659). Cultured lungs were morphometrically analyzed and processed for Western blot analysis, in situ hybridization and qRT-PCR. Moreover, culture medium was collected and analyzed by 1H-NMR spectroscopy. Lung explants stimulated with the TAZ inducer displayed an increase of 12% in branching, in a dose-dependent manner, when compared to controls. As expected, TAZ manipulation did not affect total YAP and TAZ protein expression levels but it promoted a mild increase in runx2 expression levels. qRT-PCR analysis revealed an increase of glut8 , mct8 , pdh and ldh expression levels when compared to controls. 1H-NMR spectroscopy revealed an increase in the secretion of succinate and acetate to the extracellular medium after explant stimulation with a TAZ inducer. Finally, embryonic lung metabolite profile was determined, and high lactate tissue levels were detected. TAZ manipulation had a mild impact in lung branching nonetheless it induced alterations in the expression levels of different enzymes and transporters of glucose catabolism. Furthermore, alterations in the amount of certain key metabolites was also noticed in TAZ-induced explants. Taken together, these results highlight a potential role for TAZ in the regulation of embryonic lung metabolic profile. This is the first study showing the contribution of Hippo signaling to metabolic reprograming of early lung development through the modulation of glucose catabolism-related genes. These findings may contribute to uncover new therapeutic targets to treat lung developmental disorders. Keywords: Development; Hippo; Lung; Metabolism; TAZ
vii Table of contents Acknowledgments ............................................................................................................................... iii Statement of integrity .......................................................................................................................... iv Resumo............................................................................................................................................... v Abstract.............................................................................................................................................. vi List of abbreviations ............................................................................................................................ ix Figure List ......................................................................................................................................... xiii Table List .......................................................................................................................................... xiv 1. Introduction ........................................................................................................................ 1 1.1. Lung development ........................................................................................................... 1 1.1.1. Mammalian lung development ..................................................................................... 1 1.1.2. Avian lung development ............................................................................................... 2 1.2. Hippo signaling pathway .................................................................................................. 3 1.2.1. Hippo modulators ........................................................................................................ 4 1.2.2. Hippo targets and effectors .......................................................................................... 6 1.2.3. Hippo functions ........................................................................................................... 7 1.2.4. Hippo and crosstalk with other signaling pathways ....................................................... 8 1.2.5. Hippo signaling and metabolism .................................................................................. 9 1.3. Hippo signaling during lung development ....................................................................... 11 1.4. Metabolism during development .................................................................................... 12 2. Aims ................................................................................................................................. 14 3. Materials and Methods ...................................................................................................... 15 3.1. Ethical statement........................................................................................................... 15 3.2. Tissue harvesting........................................................................................................... 15 3.3. Lung explant culture ...................................................................................................... 15 3.4. Morphometric analysis .................................................................................................. 16 3.5. Protein extraction and quantification .............................................................................. 17 3.5.1. Total protein extraction .............................................................................................. 17 3.5.2. Protein quantification ................................................................................................. 17 3.6. Western blot .................................................................................................................. 17 3.6.1. SDS-PAGE ................................................................................................................. 18 3.7. Whole-mount in situ hybridization................................................................................... 19
xiv Table List Table 1 List of primers and qRT-PCR conditions.
1 1. Introduction 1.1. Lung development 1.1.1. Mammalian lung development The lung is a complex organ that consists of two related and highly branched tubular systems, the respiratory system and the vascular system1. Both systems are important for the intimate contact between air and blood over a large surface area, allowing effective gas exchange2,3. Functionally, the respiratory system is divided into the conducting and the respiratory zone. The conducting zone consists of the proximal tubular branched system, including the trachea, and the bronchial airways. Distal bronchial airways become gradually thinner and branched, originating the respiratory bronchioles that end at the alveolar region (respiratory zone). Regarding the vascular system, this is an exceptionally branched system, completely lined by endothelial cells, thus allowing proper fulfillment of the tissue’s requirements for oxygen and nutrients4–6. Pulmonary morphogenesis is a highly complex process that comprises several anatomical, mechanical and biochemical events commencing on the third week after conception and continuing across gestation and post-natal life until approximately 22 years of age7. Lung development can be divided into five different stages namely, embryonic, pseudoglandular, canalicular, saccular and alveolar, that overlap temporally and spatially8. The specification of the respiratory system initiates with the outward budding of the endoderm, in the anterior foregut of the respiratory diverticulum, with the expression of the transcription factor Nkx2.1, also known as thyroid transcription factor-1 (TTF-1). Evagination of the endoderm layer will generate the trachea and two lung buds emerging from the ventral side. The epithelium in the primitive buds differentiates into respiratory epithelium which underlines both proximal and distal airways8–12. The conducting airways are generated by an intensive and highly regulated branching process that occurs during the pseudoglandular stage. The bud tips bifurcate uninterruptedly leading to a tree-like tubular network where thin epithelial tubules are surrounded by mesenchyme derived from the mesodermal germ layer8. The mesenchyme at the bud tip is particularly important since cells migrate and differentiate into smooth muscle, stabilizing the cleft between the buds and facilitating branching9–11 The crosstalk between the epithelial and mesenchymal compartments is crucial for proper lung formation and it is conveyed by several diffusible signals from multiple signaling pathways including Sonic Hedgehog
2 (SHH)13, Wingless-related Integration Site (WNT)14, Transforming Growth Factor-β (TGF-β), Bone Morphogenic Protein (BMP)15, Fibroblast Growth Factor (FGF)16, Retinoic Acid (RA)17 and Hippo18; moreover, it involves an intense participation of extracellular matrix components such as laminin, fibronectin, syndecan, and tenascin. Altogether, they orchestrate lineage specification and expansion10. For instance, proximal-distal specification is governed by transcription factors such as sox2 (proximal) vs sox9 (distal) expression19. During this stage, cartilage, smooth muscle, vasculature, and mucous glands start to appear. The alveolar differentiation that begins at the canalicular stage leads to the formation of the elementary gas exchange surface coated with cuboidal epithelium. Furthermore, at this stage, vascularization begins, the existing airways increase in size continuously, and the mesenchyme surrounding the distalmost epithelial conduits (future alveoli) becomes progressively thinner8,9. Afterwards, bronchial epithelial cells differentiate in alveolar epithelial cells type 1 (AEC1) and 2 (AEC2) also known as pneumocytes type 1 and 2: AEC1 are mainly involved in gas exchange whereas AEC2 are specialized in the surfactant production and can act as progenitor cells for AEC1. The decrease in interstitial tissue and reduction of airway walls, together with tissue projection into the distal airspaces, creates sac-like structures characteristic of the saccular stage8,9. The sacs undergo several subdivisions due to the formation of crests (septation) and cluster at the end of the branched tips. The sacs are composed by lipofibroblasts, endothelial cells, pericytes, and myofibroblasts ultimately leading to alveoli formation. Progressively, the terminal saccules increase in size and become enveloped by a bilayer of capillaries. Further epithelial differentiation and maturation of AEC2 and lamellar bodies prime the synthesis, secretion, and recycling of pulmonary surfactant8,10. The alveolar stage consists in the formation of alveoli by septation of the distal saccules, therefore, increasing the surface area available for gas exchange. Simultaneously, the capillary bilayer fuses into a monolayer and the microvasculature matures8. The air-blood barrier between alveoli and capillaries is formed and it is ultimately composed of a basement membrane and two thin layers, one of epithelium and the other of endothelium. This process continues towards the post-natal period: the organ grows, microvasculature is remodeled, and new alveoli are formed20. During the first years of life, alveolar size remains mostly the same, yet, during adolescence, it increases9. 1.1.2. Avian lung development The adult avian respiratory system has evident differences when compared with the mammalian adult lung: it is composed by the parabronchial lung, involved in gas exchange events, and the air sacs that are important for air movement control21. The primordial avian lung arises as paired evaginations
3 from the laryngotracheal groove after 3-4 days of development. The proximal portion of each bud will generate the extrapulmonary primary bronchus and the distal portion will give rise to the lung. Following these events, the mesobronchus, or primary bronchus, enlarges and grows towards the neighboring mesenchyme originating the secondary bronchus by lateral sprouting. This monopodial branching is morphologically comparable to the domain branching that occurs during mammalian lung morphogenesis21,22. At the molecular level, the avian lung also displays similarities with the mammalian lung. The signaling pathways underlying early lung organogenesis are conserved between both phyla23–27. Hence, despite the structural differences between mammalian and avian adult lung, the embryonic lung at early developmental stages presents molecular and morphological similarities. Moreover, the chick model ( Gallus gallus ) presents some advantages when compared to mammalian models, namely: easy surgical manipulation and a low-cost model with no need for special housing facilities that eludes progenitor death. 1.2. Hippo signaling pathway Hippo signaling pathway, also known as Salvador/Warts/Hippo pathway, is an evolutionarily conserved kinase cascade, firstly discovered in Drosophila . Hippo core components, although conserved between species, in different contexts, tissues and even model systems present distinct functions. This pathway plays an imperative role in organ size, controlling cell number by the modulation of apoptosis and cell proliferation, as well as in cell differentiation, stem cell fate, renewal, and expansion. Furthermore, Hippo is also involved in mechanotransduction, tumorigenesis and drug resistance in mammals12,18,28–31. Developing organs seem to possess intrinsic signals that regulate their final dimensions32; for instance, Hippo regulates several aspects of lung homeostasis, repair, and development33–36. Hippo components comprise a series of adaptors and a core kinase cascade composed by two serine/threonine kinases, the mammalian Ste20-like kinases 1 and 2 (MST1/2) and large tumor suppressors 1 and 2 (LATS1/2); adaptor/scaffold proteins such as protein Salvador homolog 1 (SAV1) or WW5 in mammals and Mps one binder 1 (MOB1); downstream effectors, the Yes-associated protein (YAP) and its analog, the transcriptional coactivator with PDZ binding motif (TAZ) which in human present an amino acid sequence homology of approximately 45%; and finally, transcription factors like the TEAD family12,18,37,38. Both YAP and TAZ are emerging as key players for organ self-organization and act as the major transducers of Hippo pathway12,30. When Hippo signaling pathway is activated by upstream signals MST1/2 is phosphorylated and, subsequently, promotes the phosphorylation of MOB1, WW5, and LATS1/2. On its turn, LATS1/2
4 phosphorylates YAP/TAZ (Ser127-YAP and Ser89-TAZ, in humans) to create docking sites for the 14-3-3 proteins. Consequently, 14-3-3 proteins will bind and sequester YAP/TAZ in the cytoplasm thus inhibiting its translocation to the nucleus and promoting its proteasomal degradation. When inactivated, nonphosphorylated YAP/TAZ complex translocates into the nucleus where it associates with transcription factors, such as the TEAD family (TEAD1-4), SMADs or RUNX2, and the transcription of target genes is initiated18,29,31,37 (Fig 1). 1.2.1. Hippo modulators There are different levels of regulation for Hippo signaling cascade. Signals like increased cell-cell contact, changes on the extracellular matrix (ECM) or serum factors, repress cell proliferation and stimulate apoptosis by phosphorylating MST1/2 and, consequently, activate LATS1/2. In addition to MST1/2, mitogen-activated protein kinase kinase kinase kinase (MAP4K) and Serine/Threonine-protein kinase TAO families can also phosphorylate and, therefore, activate LATS1/2. MST1/2-promoted phosphorylation of LATS can induce LATS autophosphorylation leading to the activation of the pathway. One requirement for LATS1/2 phosphorylation, and consequently its activation, is its plasma membrane translocation assisted by NF2 protein (Merlin)39. Moreover, Rho GTPase transduces upstream stimuli, including GPCR signaling, mechanotransduction or the mevalonate pathway amongst others, leading to the restriction of LATS 1/2 activation37. Figure 1. Hippo signaling pathway core components. When Hippo is active (ON), MST1/2 phosphorylates LATS1/2 that then phosphorylate YAP and TAZ; phosphorylated YAP/TAZ are targeted for degradation in the cytoplasm. When Hippo is inactive (OFF), non-phosphorylated YAP/TAZ migrate into the nucleus where compete with the VGLL4 to TEAD transcription factors binding thus, activating the transcription of specific target genes. Proliferation Apoptosis
5 On the other hand, many different stimuli can lead to YAP/TAZ cytoplasmatic retention, including regulators such as Merlin and Angiomotins (the AMOT family: tight junctions) that not only phosphorylate YAP but also promote its physical exclusion from the nucleus. The AMOT family includes AMOTL1 (angiomotin-like protein 1), AMOTL2 (angiomotin-like protein 2), and the p130 isoform of AMOT. AMOT can increase or decrease Hippo signaling depending on the family member involved39,40. Additionally, several other kinases have been identified and shown to phosphorylate YAP increasing its activity, including Nuclear Dbf2-related kinases 1 and 2 (NDR1 and NDR2)41 and SRC kinases42 (Hippo-independent YAP regulation). The AMP-activated protein kinase (AMPK), that is important in cellular energetic homeostasis, can phosphorylate YAP/TAZ leading to its inhibition by a Hippo-independent mechanism, and linking YAP/TAZ activity to cellular nutritional state43. Although most of the transcriptional regulation occurs via YAP/TAZ phosphorylation, recent studies unveiled the fact that phosphorylation of TEAD via p38 Mitogen-Activated Protein Kinase (MAPK) promotes cytoplasmatic localization and consequently reduces the transcriptional activity of the YAP–TEAD complex4. Phosphorylation of Ser311-TAZ and Ser381-YAP mediated by LATS1/2, primes the subsequent phosphorylation by Casein kinase 1 isoform delta/epsilon; afterwards, the recruitment of E3 ubiquitin ligase leads to ubiquitination and proteasomal degradation of YAP/TAZ12. Additionally, YAP/TAZ nuclear translocation is under the control of cellular polarity and shape, which is regulated by the cytoskeleton. The cytoskeleton is responsible for physical inputs that guide YAP/TAZ into specific gene expression patterns that mostly depend on the context of biological responses44. Furthermore, cellular structural characteristics must be linked to cellular metabolism and other environmental inputs like, for instance, morphogens or nutrient accessibility. The synchronization between cell behavior and surrounding mechanical cues which is translated into signaling paths and affects gene expression is called mechanotransduction. YAP/TAZ promotes the transcription of genes that promote F-actin remodeling and mechanical signaling that will regulate YAP/TAZ activity45,46. Several other mechanisms of regulation direct the activity of Hippo including: protocadherins Dachsous and Fat (Dachsous-Fat system), expressed in opposing gradients in response to morphogens, that regulate Hippo and planar cell polarity; cell polarity with the participation of mammalian components of tight or adherens junctions complexes; cell density; integrin signaling and ECM attachment; and mechanical stress (mechanical force) at adherens junctions, focal adhesions, and cytoskeletal tension12,29. In figure 2 are summarized all the factors that influence the activity of Hippo.
6 1.2.2. Hippo targets and effectors Hippo response is conveyed by YAP and TAZ proteins, however, the association with transcription factors is imperative since YAP and TAZ do not possess DNA binding domains. The TEAD family and SMADs family of transcription factors associate with YAP/TAZ; moreover, other transcriptional factors such as β-catenin47 or the runt-related transcription factor 2 (RUNX2)48 may be also recruited depending on the context. Concerning TEAD proteins, in vertebrates, they can be associated with the vestigial like family member 4 (VGLL4), a cofactor of TEAD, which competes with YAP/TAZ for TEADs binding, thus repressing its action (Fig 1)49. The most studied biological function dependent on YAP/TAZ is cell proliferation. The expression of cell cycle regulators induced by YAP/TAZ controls this process, amongst them: cell cycle genes including DNA repair and replication machinery, cyclins and mitotic-related proteins. Particularly, cyce and e2f1, growth-promoting genes like myc and inhibitors of apoptosis such as birc3 and diap1 stand out as Hippo target genes50. Additionally, genes like ctgf , cyr61 , axl , birc5 , areg , and ankrd1 can also be targets of Hippo effectors. Moreover, the expression of anti-apoptotic genes such as the inhibitor of apoptosis protein (IAP) and bcl2 families is also controlled by YAP/TAZ and results in cell resistance against apoptosis12,29,45. On a metabolic point of view, mTOR signaling is activated by YAP/TAZ. The transcription of several regulators of this pathway is on the basis of this transcriptional program51. Additionally, the transcriptional regulation of enzymes involved in glycolysis, glutamine metabolism, nucleotide synthesis, and Hexosamine Biosynthetic Pathway (HBP) can also regulate YAP/TAZ activity45. Figure 2. Hippo signaling pathway activity regulation. Factors that influence the activation of Hippo pathway kinases and YAP/TAZ. Upstream cues include Ds–Fat signaling; crosstalk from other major signaling pathways including EGFR, WNT, BMP, SHH, and GPCR; integrin signaling; cellular metabolism; metabolic pathways; F-actin levels, tension in the cytoskeleton, and mechanical stress at cell junctions and focal adhesions. Adapted from29. YAP/TAZ MST MST
7 1.2.3. Hippo functions Hippo was initially recognized as a regulator of organ size due to its control over cell proliferation and, later, as a sensor of cell density52,53. Nonetheless, organ size regulation does not occur in the same way in different types of vertebrate organs. It has already been described that YAP promotes overgrowth in organs like the liver54 but not, for instance, in the kidney55. In addition, YAP/TAZ activation (Hippo off) promotes cell proliferation at low cell density whereas strong Hippo signaling (Hippo on) suppresses cell proliferation at high cell density leading to contact inhibition (cell junctions and polarity appearance). Moreover, ligands from other signaling pathways like Epidermal Growth Factor Receptor (EGFR) or WNT also promote growth and are linked to YAP since these ligands are transcriptional targets of YAP and/or TAZ29,53. YAP/TAZ are deeply linked with cell fate decisions in many aspects of development. In early mouse embryogenesis, YAP/TAZ complex is involved in the division of the blastocyst into the inner cell mass (ICM) and trophoectoderm (TE)56. Hippo signaling is activated on the inner cells that will generate the ICM; on the other hand, in blastocyst cells, Hippo is downregulated leading to YAP/TAZ activation thus promoting the formation of TE. This regulation seems to be due to AMOT that promote LATS activation, and to cell stretching that activates YAP/TAZ in TE cells57,58. In recent years, many studies point to the fact that YAP/TAZ complex is essential for progenitor or stem cell fates in many mammalian tissues including muscle, skin, liver, nervous system, teeth, pancreas, mammary gland and in the lung59. YAP/TAZ promotes survival of human embryonic stem cells, suppresses differentiation and can convert differentiated cells into stem cells. Furthermore, YAP/TAZ are involved in mesenchymal stem cell differentiation in culture conditions60,61. Regarding cell behavior, YAP/TAZ have very important roles on vasculature since they act as downstream effectors of Vascular Endothelial Growth Factor (VEGF) and Vascular Endothelial Growth Factor Receptor 2 (VEGFR2) signaling62. VEGF activates YAP/TAZ thus promoting the transcription of genes involved on angiogenesis62,63; consequently, when dysregulated it can cause several diseases like pulmonary hypertension or atherosclerosis64. Hippo is important for the proper functioning of the immune system mostly due to the control of LATS activity in tumors65. Considering the role of YAP/TAZ in regulating progenitor cell fate and organ growth, it is not surprising that it is involved in tissue repair and regeneration, and wound healing. In fact, alterations in cell density, cell-cell contact, and cell stretching after tissue damage, wound, inflammation or infection,
8 and corresponding signaling pathways can activate YAP/TAZ. YAP/TAZ have key roles in the regeneration of several mammalian tissues like skin, mammary gland, intestine, and lungs66. Hippo dysregulation is associated with many diseases. For instance, in pulmonary fibrosis, the activation of YAP/TAZ can promote abnormal and excessive ECM deposition by activated fibroblasts leading to cellular dysfunction and tissue stiffening67,68. Moreover, many types of cancers including colon, breast, ovarian, pancreatic, liver, skin, brain and lung show high levels and increased nuclear localization of YAP/TAZ. Besides, high levels of YAP/TAZ are generally associated with poor prognosis in many human cancers. Not only YAP/TAZ overactivation is associated with cancer but also mutations in the upstream Hippo signaling modulators like EGFR-RAS, c-Jun N-terminal kinases (JNK), SRC, G protein-coupled receptors (GPCR), WNT or phosphoinositide 3-kinase (PI3K) signaling pathways. In addition to the impact in cell proliferation, there are other effects associated with YAP/TAZ-related oncogenesis like cancer stem cell behavior support, alterations on metabolism and metastasis promotion, particularly TAZ69. 1.2.4. Hippo and crosstalk with other signaling pathways Hippo signaling is a major regulator of cell fate and tissue growth, however, it does not act alone, and it depends on the crosstalk with other signaling pathways. For instance, signaling pathways with GPCRs can influence the activity of Rho which, by its turn, can regulate YAP and TAZ70. Many hormones, growth factors or metabolic regulators can act through different classes of GPCRs that can either induce or repress YAP/TAZ activity71,72. For instance, lysophosphatidic acid (LPA) and sphingosine-1-phosphate (S1P) inhibit LATS1/2 and activate YAP/TAZ70. In addition to LPA and S1P, estrogens, thrombin, and acetylcholine can activate YAP/TAZ. On the other hand, GPCR signaling caused by epinephrine or glucagon can repress YAP/TAZ activity70,71,73,74. YAP/TAZ complex is a transcriptional mediator of WNT signaling. The destruction complex that controls the intracellular amount of β-catenin also regulates YAP/TAZ activity. Cytoplasmatic YAP/TAZ facilitates the formation of the destruction complex thus promoting β-catenin degradation. Likewise, YAP/TAZ translocation into the nucleus can lead to β-catenin nuclear localization. Taken together, it appears that activation of Hippo antagonizes the WNT-β-catenin signaling. Additionally, YAP/TAZ can inhibit Dishevelled, a downstream signaling mediator, and, therefore, inhibit WNT signaling47 Some reports have shown a crosstalk between TGF-β and YAP/TAZ. The Hippo effectors are important in determining the action of the SMAD2/3-SMAD4 complex that participates in pluripotency maintenance as well as in mesodermal differentiation during the onset of gastrulation and mesodermal specification. The crosstalk between these two signaling pathways has been observed during lung
9 development12,75. Hippo is also related to the BMP pathway since YAP/TAZ can interact with the SMADs. Furthermore, EGFR, JNK, and SHH can interact with YAP/TAZ and regulate its activity50. Additionally, Hippo effectors YAP/TAZ interact with Notch signaling. The regulation of Notch ligands promoted by YAP/TAZ in a single cell causes the activation of Notch signaling in the surrounding cells. In fact, many Notch ligands are translated in a YAP/TAZ-induced manner and regulate many processes during development including differentiation of neural crest progenitors during arterial wall development or the somatic segmentation clock76,77. During vascular development, the effect on endothelial cells promoted by VEGF signaling promotes YAP/TAZ activation that, due to its translational program, leads to a proper VEGF receptor trafficking62,78. 1.2.5. Hippo signaling and metabolism Signaling pathways and metabolism cooperate to allow proper tissue growth and homeostasis. Insulin/Insulin-like growth factor signaling can activate YAP/TAZ and promote tissue growth, through the action of phosphoinositide-dependent kinase 1 (PDK1) and Protein kinase B, also known as AKT80. The decrease in glucose levels leads to AMPK activation and, by its turn, this cellular energy sensor decrease YAP/TAZ activity both directly phosphorylating YAP and phosphorylating AMOTL1 to promote LATS activation43,79,81. Recently, it was described that glucose availability can sustain YAP activity through the hexosamine biosynthesis pathway and its impact on the O -GlcNAc transferases that attach a GlcNAc group to Thr or Ser residues. High glucose levels promote the formation of uridine diphosphate N - acetylglucosamine (UDP-GlcNAc) which increases YAP O -GlcNAcylation, stabilizing YAP protein and decreasing its phosphorylation by LATS72,74,82. Furthermore, the glycolysis rate-limiting enzyme phosphofructokinase 1 (PFK1) can bind directly to TEAD stabilizing the interaction with YAP/TAZ and, consequently, enhancing YAP/TAZ activity by the formation of the nuclear complex PFK1-YAP/TAZ-TEAD. On the other hand, YAP induces the transcription of genes involved in the hexosamine biosynthesis pathways which promote O -GlcNAcylation and increase the glucose uptake83. Cell size and proliferation are deeply responsive to nutrients and growth factors availability, as well as cellular energy levels, mainly via TOR signaling. The mTORC1 kinase complex supports YAP/TAZ activity by the inhibition of the autophagosome-dependent lysosomal degradation in a model of perivascular epithelioid tumors51. mTORC2 kinase complex can activate YAP/TAZ through the inhibitory phosphorylation of AMOT proteins or MST184,85. On the other hand, the tuberous sclerosis protein (TSC)- Tor pathway can influence both levels and activity of YAP and TAZ51. Moreover, aerobic glycolysis regulates
16 organ growth over time. Moreover, with this methodology, it is possible to evaluate the components of the culture medium and assess, for instance, which metabolites are being consumed or secreted112. Firstly, Nucleopore polycarbonate membranes with an 8 µm pore size (Whatman, USA) were presoaked in 400 µL of Medium 199 (Sigma, USA) for one hour, at room temperature, in a 24-well culture plate (SPL Life Sciences, Korea). Next, Medium 199 was substituted by 200 µL of Medium 199 supplemented with 5% heat-inactivated fetal calf serum (Invitrogen, USA), 10% chicken serum (Invitrogen), 1% L-glutamine (Invitrogen), 1% penicillin 5000 IU/mL, streptomycin 5000 IU/mL (Invitrogen) and 0.25 mg/mL ascorbic acid (Sigma). Subsequently, stage b2 lungs were placed on top of the membranes and incubated in a 5% CO2 incubator at 37°C, for 30 minutes. After that period, floating cultures were photographed, and the stage confirmed. Next, explants were randomly assigned to one of five experimental groups: DMSO (0.1%) or TM-25659 (5 µM, 10 µM, 15 µM, and 20 µM). TM-25659 was selected because it enhances the translocation of TAZ to the nucleus. Since TM-25659 must be dissolved in DMSO, control explants were supplemented with this solvent. Explants were incubated for 48h and the culture medium, supplemented accordingly, replaced after 24h. Branching morphogenesis was monitored, by photographing the explants, every 24h: at D0 (0h), D1 (24h) and D2 (48h) of culture24. At D2, lung explants were washed three times with filtered PBS 1x, snap-frozen and stored at -80˚C for further processing for protein, RNA or metabolite extraction; for in situ hybridization, explants were fixed and processed as previously described (section 3.2). Culture medium was collected at D0, D1, and D2, and kept at -20˚C for metabolite analysis (section 3.9.1)23. 3.4. Morphometric analysis To determine the impact of TM-25659 on lung organogenesis, D0 and D2 lung explants were morphometrically analyzed. The total number of peripheral airway buds was determined at both time points (n≥15/condition). Additionally, the internal perimeter of the lung (epithelium) and the outer perimeter of the lung (mesenchyme) were assessed at D0 and D2 (n≥15/condition) using Axion-Vision Rel. 4.3 (Carl Zeiss GmbH, Germany). With these measurements, the area and perimeter of both compartments can be calculated. The results of branching and morphometric analysis were expressed as D2/D0 ratio27. All quantitative morphometric data are presented as mean ± SEM with a statistically significant level of 5% (p<0.05). Statistical analysis was performed using GraphPad Prism 6 (USA). Normality of distribution and homogeneity of group variances were tested, and One-Way ANOVA was performed.
17 3.5. Protein extraction and quantification 3.5.1. Total protein extraction Pooled samples of lung explants (3 pools/condition: 10 lungs/pool) were homogenized in a small volume of a specific lysis buffer containing: HEPES, pH 7.5, 20 mM; Glycerophosphate, 50 mM; EGTA, 2 mM; Sodium Vanadate, 1 mM; 10% Glycerol; 1% Triton X-100; 1% complete protease inhibitor cocktail (Sigma). Tissues were mechanically homogenized on ice using a pellet pestle cordless motor (Kontes Glass, USA), during 3 cycles of 10 seconds at maximum speed, followed by 2 minutes on ice. The homogenate was centrifuged at 13000 rpm for 30 minutes, at 4°C, the supernatant was collected and stored at -80°C. 3.5.2. Protein quantification Protein quantification was performed by the Bradford assay. The Bradford method is a rapid, sensitive, reproducible and low interference protein quantification method that uses Coomassie Brilliant Blue G-250. This dye reacts with basic amino acid residues in the proteins changing the absorption maximum from 465 to 595 nm113,114. Coomassie Brilliant Blue G-250 changes from red to blue form when binding between protein and dye occurs113. The Bradford calibration curve was generated using standard solutions with different Bovine Serum Albumin concentrations ranging from 0.1 to 0.7 µg/µl. The spectrophotometric readings were made in duplicate and linear regression applied to obtain the standard curve. The different samples were read in duplicate, and the concentration of total protein determined by the linear regression equation. 3.6. Western blot Western blot is a widely used technique that allows the identification of specific proteins from a complex mixture (homogenate) extracted from cells or tissues. Briefly, proteins are separated by size thru gel electrophoresis, in denaturing conditions, and then transferred to a membrane. Subsequently, the membrane is incubated with a primary antibody against the protein of interest that is then recognized by a secondary antibody coupled to an enzyme. Finally, in the presence of proper substrates, the enzymatic reaction occurs, and the product is detected by an imaging system115. This immunodetection technique enables the quantification of proteins with different expression levels in the same blot. Additionally, a normalization method based on housekeeping proteins, such as β-tubulin, is required and essential as a loading control116.
18 3.6.1. SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) constitutes the most common way of separating a complex mixture of proteins. SDS is a denaturing anionic detergent that disturbs native protein conformation by breaking non-covalent bonds and gives a uniform net negative charge to the protein molecules. When exposed to an electrical field, proteins migrate to the positive electrode and separate only according to their molecular weight117,118. Samples were prepared with a commercial Laemmli buffer (Bio-Rad, USA) mixed with β-mercaptoethanol (Sigma) to guarantee the reduction of disulfide bridges. Ten μg of total protein were loaded onto 10% acrylamide minigels and electrophoresed at 100 V, for approximately 2 hours, in the vertical Mini-PROTEAN Tetra Cell (Bio-Rad). 10% resolving gels were prepared with: 10% Acrylamide/Bis-acrylamide (Bio-Rad); 0.375 M Tris-HCl, pH 8.8; 0.1% Sodium Dodecyl Sulfate (SDS). Finally, 0.05% Ammonium Persulfate (APS) and 0.014% Tetramethylethylenediamine (TEMED) were added to accelerate polymerization. The 4% stacking gel was prepared with: 4% Acrylamide/Bis-acrylamide; 0.126 M Tris-HCl, pH 6.8; 0.1% SDS. Finally, 0.05% of APS and 0.008% TEMED were added. Afterwards, the polyacrylamide gel was transferred to 0.2 μm nitrocellulose membrane (TransBlot Turbo RTA Mini Nitrocellulose Transfer Kit, Bio-Rad) in the Trans-Blot Turbo Transfer System (BioRad) for 7 minutes, at 2 amperes and 25 volts. After transfer, membranes were incubated with Ponceau S [(0.1% Ponceau S (w/v) in 5% acetic acid)] to confirm protein transfer. Membranes were then blocked, for 2 hours at room temperature, with a blocking buffer [5% BSA in TBST (20 mM Tris, 0.137 M NaCl, 0.1% Tween, pH 7.6)]; after washing with TBST, blots were incubated with primary antibodies diluted in 5% BSA in TBST, overnight at 4ºC. The antibody dilution was settled to 1:2000 for YAP/TAZ (#ab8418, Rabbit mAb, Cell Signaling Technology, USA). For loading control, blots were probed with β-tubulin (1:200000; #ab6046, Abcam Inc., UK). Membranes were then washed in TBST, and next incubated with anti-rabbit secondary horseradish peroxidase-conjugated antibody (1:2000; #7074, Cell Signaling Technology Inc.) in 2% skimmed milk in TBST, according to the manufacturer’s instructions. Finally, and after washing with TBST, membranes were developed with Clarity Western ECL substrate (Bio-Rad) and the chemiluminescent signal was captured using the Chemidoc XRS (Bio-Rad). Quantitative analysis was performed with ImageLab software (Bio-Rad). Three independent experiments were performed, and each sample was run in triplicate. For loading control, β-tubulin was used. Semi-quantitative expression analysis of total YAP and total TAZ was
19 performed using an Image Analysis Software (Bio-Rad, USA). All quantitative data are presented as mean ± SEM with a statistically significant level of 5% (p<0.05). Statistical analysis was performed using GraphPad Prism 6 (USA). Normality of distribution and homogeneity of group variances were tested, and One-Way ANOVA was performed. 3.7. Whole-mount in situ hybridization In situ hybridization is a semi-quantitative technique that allows the detection of specific mRNA in the tissue thus revealing its spatial localization in the different cellular compartments. It requires the use of single-strand antisense RNA probes that are reverse and complementary to the mRNA to be detected. In the appropriate conditions, the labeled RNA probe recognizes and binds to the target mRNA, producing a stable hybrid. This hybrid is then detected through the use of an antibody that recognizes the specific labeling followed by an enzymatic reaction that produces a chromogenic precipitate. The presence of this precipitate reveals to the expression site of the mRNA119,120. The antisense probe used in this work, runx2 , was already described in the literature and the plasmid was kindly provided, in filter paper, by the authors121. 3.7.1. Probe preparation The runx2 plasmid was eluted using ultrapure water and left at room temperature, for 2 hours. Next, the plasmid was transformed by heat shock protocol using competent of Escherichia coli (XL1-blue) cells122. Cells were plated in Luria broth (LB) agar plates (0.5% yeast extract, 1% NaCl, 1% tryptone, 2% agar) supplemented 1 µg/mL ampicillin (NZYTech, Portugal), and kept overnight at 37°C. Subsequently, selected isolated colonies were inoculated in LB liquid medium, overnight, and plasmid DNA was extracted using GeneJET Plasmid Miniprep Kit (Thermo Fisher Scientific, USA), according to the manufacturer’s instructions. Finally, plasmid DNA concentration was determined by NanoDrop spectrophotometer (NanoDrop ND-1000, USA) and sample purity was estimated based on the 260/280 ratio. 3.7.2. Probe synthesis The fragment of interest, containing runx2 sequence, was obtained by PCR amplification (NZYTaq 2x Green Master Mix; NZYTech) using M13 universal primers and a standard protocol. To confirm the presence of the expected band, a 0.8% agarose gel was used. The PCR reaction was cleaned using GRS PCR & Gel Band Purification Kit (Grisp, Portugal). RNA antisense probes were obtained through an in vitro transcription reaction using approximately 750 ng of the purified fragment as a template. For the in vitro
20 transcription reaction, SP6 RNA polymerase and a nucleotide mix containing uracil bound to Digoxigenin (DIG) were used (Roche Applied Sciences, USA). DIG is the key for the detection procedure since it is recognized by an anti-DIG antibody coupled to an enzyme (alkaline phosphatase) that, in the presence of specific substrates, produces a blue precipitate. 3.7.3. In situ hybridization In situ hybridization procedure was performed according to Henrique et al. protocol with minor modifications123. Whole lungs (6 lungs/stage) or lung explants (5 lungs/condition) and 2 control embryos stage HH25 were rehydrated through a series of methanol into PBT at room temperature. After rehydration, both lungs and embryos were washed twice with PBT and treated with proteinase K, 20 mg/mL, in PBT, for 2 and 35 minutes respectively, at room temperature. This serine protease permeabilizes tissues to facilitate the entry of the RNA probes. Subsequently, tissues were washed twice in PBT to remove completely the proteinase K and treated with a fixing solution (formaldehyde 3.7%; glutaraldehyde 0.1M in PBT) for 20 minutes. Then, tissues were washed with PBT and hybridization solution [formamide 50%; saline-sodium citrate (SSC), 1.3x, pH 5; EDTA, 0.005M, pH 8; t-RNA, 50 mg/mL; Tween 20, 0.2%; 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate (CHAPS), 0.00813M, 5%; Heparin, 100 µg/mL; and ultrapure H2O]. Afterwards, lungs were incubated for at least one hour with the hybridization solution at 70˚C. Finally, the lungs were incubated with DIGRNA labeled probe mixed in the hybridization solution at a final concentration of 0.5%, at 70˚C overnight. On the following day, the probe was retrieved, and tissues were washed twice with pre-heated hybridization solution at room temperature and once at 70˚C (30 minutes). Next, tissues were washed with hybridization solution plus MABT [MAB 5x (Maleic Acid, 0.5M; NaCl, 0.74M; NaOH, pH 7.5) diluted 5 times; Tween 20, 10%; ultrapure water]. Then, tissues were incubated with a blocking solution [blocking reagent (Roche Applied Sciences) 2% and goat serum (Invitrogen) 20% in MABT], to decrease the background. Finally, tissues were incubated overnight, at room temperature and with gentle agitation, with anti-digoxigenin antibody solution (1:2000 in blocking solution; Roche Applied Sciences). On the third day, several washes with MABT were carried out and after tissues were washed twice with NTMT (NaCl, 0.1M; Tris-HCl, 0.1M; MgCl2, 50mM; and Tween 20, 1%). Then, tissues were incubated with developing solution containing blue 4-nitro tetrazolium chloride (NBT) and 5-bromo-4-chloro-3-indoylphosphate (BCIP) in NTMT. In the presence of NBT, the alkaline phosphatase (bound to the antidigoxigenin antibody) cleaves BCIP thus promoting the formation of a blue precipitated in the sites where the enzyme is present. The developing reaction was stopped, at the same time, for the same group of
21 tissues, by washing 3 times in PBT. Tissues were photographed with a camera Olympus U-LH100HG coupled to a stereomicroscope Olympus SZX16 and stored at 4ºC. 3.8. Quantitative real-time polymerase chain reaction (qRT-PCR) qRT-PCR is a highly sensitive and reproducible technique used to detect and quantify mRNA levels. The procedure is based on the fluorescence labeling of the amplified PCR product. During each cycle, the fluorescence is measured and the signal increases proportionally to the amount of PCR product amplified and, hence, it is quantified in “real-time”. The fluorescent signal is generated by the presence of DNA-binding dyes that allow identifying the exponential phase of the reaction124. 3.8.1. RNA extraction and quantification Lung explant tissue was retrieved from -80˚C and placed on ice. Total RNA was extracted from D0 and D2 lung explants, from three culture conditions, using TripleXtractor direct RNA kit (GRiSP) according to the manufacturer’s instructions. Next, total RNA was quantified using Nanodrop. Finally, RNA was analyzed through an Experion automated electrophoresis system (Bio-Rad) to assess RNA integrity and purity, using the Experion RNA StdSens kit (Bio-Rad). 3.8.2. DNase treatment Total RNA was treated with DNase to remove genomic DNA from the sample. Total RNA was incubated with DNase-RNase free (Thermo Fisher Scientific) following the manufacturer’s guidelines. Briefly, after 30 minutes, at 37˚C, the reaction was stopped with EDTA and the enzyme inactivated for 10 minutes, at 65˚C. 3.8.3. cDNA synthesis and quantification cDNA was obtained from treated RNA (<5 µg) using GRS cDNA Synthesis kit (GRiSP) respecting manufacturer’s protocol for oligo(dT)20 primers. Samples were quantified using the Nanodrop and stored at -20˚C. To validate cDNA quality, GAPDH was amplified by conventional PCR using KAPA2G Fast ReadyMix PCR Kit (KAPA Biosystems, USA) and forward and reverse GAPDH primers (Forward: 5’- ATATGACAAGTCCCTGAAAATTGTCAG-3’; Reverse: 5’-GCATCAAAGGTGGAGGAATGG-3’). 3.8.4. qRT-PCR The primers used in this study (Table 1) had already been previously optimized for annealing temperature, cycles and cDNA dilution (to ensure similar efficiency range). qRT-PCR was performed using 1 µL of cDNA sample (70 ng/µL), and NZY qPCR Green Master Mix (2x) (NZYTech, Portugal), according
22 to manufacturer’s instructions. mRNA expression levels were normalized for two housekeeping genes: 18S and β -actin . Each sample was run in duplicate (n=8/condition). Relative gene expression was calculated following the mathematical model 2^(∆Ct), being ∆Ct=Ctreference-Ctsample. Additionally, fold variation of gene expression levels was calculated following the mathematical model 2^(-∆∆Ct)125, being ∆∆Ct=∆Ctsample-∆Ctcontrol. All quantitative data are presented as mean ± SEM with a statistically significant level of 5% (p<0.05). Statistical analysis was performed using GraphPad Prism 6 (USA). Normality of distribution and homogeneity of group variances were tested, and One-Way ANOVA was performed. Gene Primers (5’-3’) Number of cycles Annealing temperature 18S TCTTTCTCGATTCCGTGGGT AACGCCACTTGTCCCTCTAC 35 58˚C β -actin CTTCTAAACCGGACTGTTACCA AAACAAATAAAGCCATGCCAATCT 35 58˚C ldha AAGACGCCGGCAGTACAC GAGTGTGCAGTCACGCTGTA 35 58˚C ldhb ACTTGGTATCCACCCAACCAG CTCAGCAACGCTAAGACCAAT 35 54˚C pdha TCACGGCTTTACCTATGCCC ACCTGAGCACCGACAATACC 35 58˚C pdhb GCTCAGAAGATGCTAAAGGGC GCTTCTAAACAGTGCCCAACAG 35 58˚C hk1 CTGGCCTACTACTTCACCGAG TCACTGTCGCTGTTGGGTTA 40 58˚C hk2 GCGCAGAAGGTGGACAAATAC TGCCAAGAAGTCTCCGTCCT 45 58˚C glut1 GCAGTTCGGCTACAACACCG ATCAGCATGGAGTTACGCCG 40 58˚C glut3 GTACCGTTCGGGTTCCGTTAG AATGGCAGCAACAGAAACAGC 40 62˚C glut8 AGCTTTGGCTTCGTGCTAGG GTAGCCTCCCAGTATTCCTCC 40 58˚C mct1 TCGGAGCCTTCATCTCCATTG CAATCAAACCACACCCCGAG 40 58˚C mct4 GGATCTGCACTCAGGGAACC GGAAAGGCGTAGGAGAACCC 45 62˚C mct8 TTCTTCTGCTCTCCCATCGT CGACGCTTGAAGTAGTGACC 40 58˚C Table1. List of primers and qRT-PCR conditions. Forward and reverse primer sequences, number of qRT-PCR cycles and annealing temperature.
23 3.9. Metabolite analysis Metabolomics is defined as the analysis of small molecules involved in the metabolism of living organisms, the metabolites. Metabolites present a molecular weight below 1800-1500 Dalton and can act as substrates or products on different metabolic pathways. This class of compounds includes sugars, amino acids, and lipids amongst others and are related not only with the cellular energetic machinery but also with intercellular communication126. The metabolome provides insights about specific metabolic, biochemical and molecular alterations since it is the reflex of all the reactions occurring in cells and tissues. Currently, the two major approaches used are targeted and untargeted metabolomics. The targeted method focuses on specific metabolites, metabolic pathways or compound classes based on the specific chemical properties of the targeted metabolites. On the other hand, the untargeted approach aims the coverage of all metabolites existing in the sample without previous biological knowledge127. Proton NMR (1H-NMR) spectroscopy allows absolute quantification, metabolite identification, and reduced interference and it is widely used for these studies. 3.9.1. Extracellular medium analysis Samples of culture medium (≈ 200 µL) from D0, D1, and D2 (section 3.3) were analyzed by 1HNMR spectroscopy (n=6/condition/stage) and injected directly. In order to quantify the extracellular metabolites in the media, sodium fumarate (singlet, at 6.50 ppm, parts per million), was used as an internal reference. Spectral acquisition was performed at 14.1T and 25˚C using a Bruker Avance 600 MHz spectrometer equipped with a 5-mm QXI probe and a z-gradient, with solvent-suppression and a sweep width of 6 kHz, using a delay of 14 seconds, a water presaturation of 3 seconds, a pulse angle of 45˚, an acquisition time of 3.5 seconds and at least 128 scans128 The following metabolites were quantified: histidine (doublet, 7.9 ppm), phenylalanine (double doublet, 7.4 ppm), tyrosine (multiplet, 6.9 ppm), glycine (singlet, 3.54 ppm), choline (singlet, 3.18 ppm), H1-α glucose (doublet, 5.22 ppm), glutamine (multiplet, 2.44 ppm), succinate (singlet, 2.39 ppm), acetate (singlet, 1.9 ppm), alanine (doublet, 1.46 ppm), lactate (doublet, 1.33 ppm) and valine (doublet, 1.02 ppm). The relative areas of 1H-NMR resonances were quantified using the curve-fitting routine supplied with the NUTSproTM NMR spectral analysis program (Acorn NMR, USA). The concentration of the different compounds was obtained according to the following formula (Acompound corresponds to the peak(s) area in the 1H-NMR spectra).
24 Absolute quantification (pmol) was normalized over lung growth ratio (epithelial perimeter) (section 3.8.1). 3.9.2. Tissue metabolite analysis Three pools of 50 mg of whole lung tissue (roughly 70 stage b2 lungs/pool) were collected on ice and kept at -80ºC. Next, tissues were lyophilized, weighted, and kept at -80ºC for further metabolite extraction. Briefly, 1 mL of methanol:chloroform mixture (2:1) was added to the lyophilized samples and tissues sonicated at 4˚C for 15 minutes. Afterwards, 500 µL of chloroform and an equal volume of water were added and mixed thoroughly by vortexing. Finally, the samples were centrifuged, 10000g, for 20 minutes at 4˚C. The aqueous phase, containing the water-soluble metabolites was collected and stored at -80˚C. Lastly, samples were lyophilized and weighted. Before loading the sample in the equipment, sodium fumarate was added as an internal reference as described in the previous section (3.9.1). With the standard parameters, a database was created, and the samples were loaded into the machine. Spectral analysis was performed with the NUTS NMR Data Processing Software (Acorn NMR Inc.). The following metabolites were quantified: adenosine monophosphate (singlet, 8.57 ppm), inosine monophosphate (singlet, 8.54 ppm), formate (singlet, 8.44 ppm), adenosine (singlet, 8.33 ppm), adenosine triphosphate (singlet, 8.25 ppm), glutamate (double doublet, 3.74 ppm), glycine (singlet, 3.54 ppm), taurine (triplet, 3.40 ppm), O-phosphocholine (singlet, 3.2 ppm), creatine (singlet, 3.02 ppm), succinate (singlet, 2.39 ppm), pyruvate (singlet, 2.36 ppm), acetate (singlet, 1.9 ppm), alanine (doublet, 1.46 ppm) and lactate (doublet, 1.33 ppm). The concentration of the different compounds was obtained according to the previously described formula (section 3.9.1), and the absolute quantification (pmol) was normalized by the weight of lyophilized tissue.
25 4. Results Lung development is a highly complex process that depends on the crosstalk between several signaling pathways that ultimately contribute to proper branching morphogenesis. Hippo signaling has recently emerged as a key player in lung organogenesis and it is known to be involved in organ size control, tissue regeneration, and homeostasis. Contrasting with the extensive knowledge about the molecular mechanisms underlying lung branching is the almost absence of data regarding the interaction between signaling and metabolism in the early stages of lung development. In this work, we aimed to clarify the role of Hippo signaling in regulating lung growth and metabolism, specifically through its effector TAZ (a transcriptional co-activator with PDZ-binding domain). For this purpose, in vitro lung explants were cultured with a TAZ nuclear translocational enhancer (TM25659) that promotes TAZ nuclear localization and, consequently, its association with transcription factors like the TEAD or RUNX2. Explants were morphometrically analyzed to determine the impact on lung growth. Lung tissue was collected for determining the expression levels of selected glucose catabolism genes, by qRT-PCR. Culture medium was collected and extracellular metabolites analyzed and quantified, by 1H-NMR spectroscopy. 4.1. In vitro TAZ modulation in the embryonic chick lung To clarify the role of TAZ during early stages of chick lung branching morphogenesis, in vitro lung explants were treated with TM-25659, and doses selected according to the literature (5 µM, 10 µM, 15 µM, 20 µM). DMSO served as a control since the drug was dissolved in this solvent. TAZ impact on pulmonary growth was assessed by morphological analysis, and TAZ modulation confirmed by in situ hybridization, for runx2 . 4.1.1. Impact of TAZ modulation in lung branching and growth Stage b2 lungs were cultured for 48 hours with increasing doses of TAZ and with DMSO (Fig 3). In figure 3 it is possible to observe that treated lung explants (Fig 3D, 3F, 3H and 3J) display normal growth when compared to control explants (Fig 3B).
32 glut3 (Fig 10B) expression levels remained virtually unaffected by TM-25659 treatment, with no statistical differences between the three groups. Regarding MCT’s, mct1 and mct4 (Fig 11A and 11B) expression levels did not vary between conditions. Nevertheless, mct8 expression levels (Fig 11C) presented a noteworthy, statistically significant and dose-dependent increase in the higher dose when compared to the control with a fold variation of 12.6. hk1 and hk2 expression levels (Fig 12A and B) were moderately maintained in the three conditions, without statistical differences. Nonetheless, hk2 (Fig 12B) expression levels displayed a clear increasing tendency in a dose-dependent manner. pdha and pdhb transcripts (Fig 13A and B) presented a similar tendency with a substantial increase in the highest dose when compared to the control with a fold variation of 2 in both cases. Figure 10. mRNA expression levels of key glucose catabolism transporter genes after TAZ stimulation with TM-25659 for 48 hours. Relative expression levels of glut1 (A), glut3 (B) and glut8 (C). Results are expressed in arbitrary units, as mean ± SEM (n≥5/condition). p≤0.05: *; p≤ 0.01: **.
33 Regarding ldha (Fig 14A) and ldhb (Fig 14B), an increase in the expression levels was detected for the highest dose when compared to the control. In terms of fold variation, a 6.2 and 2.6 increase were detected for ldha and ldhb respectively. Additionally, for ldha , there was also an evident increase between 10 µM and 15 µM dose of about 2.93 in fold variation. Figure 11. mRNA expression levels of key glucose catabolism transporter genes after TAZ stimulation with TM-25659 for 48 hours. Relative expression levels of mct1 (A), mct3 (B), and mct8 (C). Results are expressed in arbitrary units, as mean ± SEM (n≥5/condition). p≤0.05: *. Figure 12. mRNA expression levels of key glucose catabolism enzyme genes after TAZ stimulation with TM-25659 for 48 hours. Relative expression levels of hk1 (A) and hk2 (B). Results are expressed in arbitrary units, as mean ± SEM (n≥5/condition).
34 4.3. Impact of TAZ manipulation in the extracellular metabolite profile of the developing lung To characterize the metabolic alterations associated with TAZ manipulation, the medium from in vitro lung explant cultures treated with DMSO, 10 and 15 µM TM-25659 was collected, and extracellular metabolite fluctuations assessed by 1H-NMR spectroscopy. With this approach, we were able to detect, in the extracellular medium: acetate, alanine, choline, glucose, glycine, histidine, lactate, phenylalanine, succinate, tyrosine and valine. Metabolite production/consumption was expressed in pmol per growth ratio (Fig 15 and 19-Appendix 1). As a reference, normal supplemented medium (without DMSO or TM25659) was used. The 1H-NMR results revealed that glucose consumption (Fig 15A) and lactate production (Fig 15B) remained unaltered, regardless of the treatment. Alanine (Fig 15C) was produced although there are no statistically significant differences between treatments. Glutamine consumption (Fig 15D) increases Figure 13. mRNA expression levels of key glucose catabolism enzyme genes after TAZ stimulation with TM-25659 for 48 hours. Relative expression levels of pdha (A) and pdhb (B). Results are expressed in arbitrary units, as mean ± SEM (n≥7/condition). p≤0.05: *. Figure 14. mRNA expression levels of key glucose catabolism enzyme genes after TAZ stimulation with TM-25659 for 48 hours. Relative expression levels (A and B) of ldha and ldhb . Results are expressed in arbitrary units, as mean ± SEM (n≥7/condition). p≤0.05: *; p≤ 0.01: **; p≤ 0.0001: ****.
35 mildly, in a dose-dependent manner but without statically significance. Conversely, a progressive and dose-dependent increase in acetate (Fig 15E) and succinate (Fig 15F) production is observed, that reaches its maximum in the 15 µM condition when compared to the control. Regarding other metabolites including, histidine, phenylalanine, tyrosine, glycine, choline and valine, no differences were observed between treatments (please see Fig 19-Appendix 1). 4.4. Embryonic lung tissue metabolomic profile Lung embryonic metabolic signature has not been described in the literature before. In this sense, we characterized the normal metabolomic profile of stage b2 lungs by 1H-NMR spectroscopy. From the 1H-NMR spectra, we were able to detect metabolites that belong to different families of biomolecules, Figure 15. Metabolite concentration after TAZ stimulation with TM-25659 for 48 hours. Representation of glucose consumption (A), lactate production (B), glutamine consumption (C), alanine production (D), acetate production (E) and succinate production (F). Results are expressed as mean ± SEM (n≥6/condition). p≤0.05: *
36 namely, amino acids, nucleotides, and intermediaries of glycolysis and Krebs cycle. However, glucose was not detected. Results are presented in figure 16. Considering amino acids (Fig 16A), we were able to identify and quantify alanine, glutamate, and glycine. Among them, glutamate is present in a considerably higher amount than its counterparts. Regarding nucleotides (Fig 16B), we detected the presence of inosine monophosphate (IMP), adenosine, adenosine monophosphate (AMP) and adenosine triphosphate (ATP). From glycolysis and Krebs cycle (Fig 16C) we detected lactate, pyruvate, and succinate. The amount of lactate present in the tissue was significantly higher than pyruvate and succinate levels. Furthermore, other metabolites (Fig 16D) like acetate, formate, taurine, O-phosphocholine, and creatine were also identified and quantified. Figure 16. Metabolomic analysis of the embryonic chicken lung. Metabolite quantification of embryonic chicken lung stage b2. Metabolites were grouped in families: amino acids (A), nucleotides (B), glycolysis/Krebs cycle intermediaries (C) and other metabolites present in high amounts (D) Results are expressed as mean ± SEM (n=3/condition).
37 5. Discussion Hippo signaling is a highly conserved signaling pathway that influences many important biological processes during the development of tissues and organs, among them the lung. This pathway is responsible for controlling several cellular events like the regulation of cell growth, proliferation, survival, and organ-size control; more recently, it has been also implicated in metabolic regulation. The molecular mechanisms underlying lung branching morphogenesis have been well described during lung development, however, the interplay between Hippo effectors and metabolism in early lung development has not been addressed so far. The work presented in this Master thesis aimed to dissect the role of Hippo effector TAZ in the regulation of the metabolic program of the embryonic lung. 5.1. TAZ nuclear localization and influence in lung branching and growth Ex vivo explant culture is one of the best techniques to study organogenesis-related events since it maintains native interactions between cells within tissues. In this study, we selected TM-25659 that enhances TAZ nuclear translocation in a dose-dependent manner, without changing the total TAZ protein level in the cells129. Stimulation of TAZ nuclear translocation in lung explants did not promote morphological alterations when compared to control explants (Fig 3). Considering lung branching, a mild increase in the number of secondary buds formed, after 48 hours, for the 10 µM and 15 µM doses was detected. No significant differences were observed for the 5 µM and 20 µM treatments when compared with the control. Despite this mild increase in branching, the overall size of the lung is maintained (Fig 4B). Moreover, no major differences were observed in the perimeter and area of lung compartments (epithelium/mesenchyme) individually. Altogether, these results suggest that secondary buds formed are smaller when TAZ is translocated to the nucleus. Branching morphogenesis relies on the crosstalk between epithelial and mesenchymal compartments mediated by signaling pathways. Among them, FGF plays a crucial role in this event. In fact, perturbations in this signaling pathway causes abrogation of branching3. Additionally it has been demonstrated that during processes of homeostasis or injury, basal stem cells have the ability to downregulate their Hippo signaling, (increasing YAP/TAZ nuclear localization) to generate their own localized Fgf10-expressing niche69,133,134. In our experimental setting, an interaction between Hippo and FGF signaling may account for the observed increase in branching.
38 5.2. Molecular validation of TAZ manipulation It has been described that TM-25659 enhances TAZ nuclear translocation without altering the total TAZ protein levels in the cells129. To confirm TAZ manipulation, the expression levels of total TAZ protein were assessed, by Western blot, in lung explants treated with TM-25659 (Fig 7). Moreover, total YAP expression levels were also evaluated to discard a possible interference of the treatment with this effector. The Western blot analysis revealed that, regardless of the dose, total TAZ protein levels remain unchanged. This result is in accordance with the existing literature that claims similar results for the pluripotent embryonic C3H10T1/2 cell line. The authors found that TM-25659 significantly increased the nuclear localization of TAZ without changing its total amount probably due to reduced tyrosine phosphorylation; moreover, a direct interaction between the drug and TAZ protein has been suggested to induce conformational changes on TAZ however, the underlying mechanism is not clear. Moreover, TM-25659 treatment aided the DNA-binding activity of RUNX2 in the presence of TAZ129. Our results showed that total YAP protein levels remained unaltered, independently of TAZ stimulation, implying that there were no compensation events due to YAP and TAZ homology and shared transcription factors. This led us to conclude that the observed morphological effect is not related to an increase of protein expression levels but with the TAZ translocation into the nucleus and, consequently, activation of its gene expression program. Taking into consideration branching and protein expression data, from this point onwards, only two doses of TM-25659 were used: 10 and 15 µM. TAZ nuclear localization was confirmed by in situ hybridization for runx2, one of the many transcription factors that interact with YAP and TAZ. However, nuclear localization of either YAP or TAZ differently impacts on runx2 expression. YAP nuclear translocation promotes runx2 suppression whereas TAZ nuclear localization promotes its activation132. RUNX2 belongs to the RUNX family of transcription factors, characterized by its DNA-binding domain runt and consists of three members, RUNX1, RUNX2, and RUNX3. RUNX2 is mainly expressed in osteoblasts134 and chondrocytes135, but also in uncommitted mesenchymal cells136. In humans, runx2 encodes two isoforms RUNX2-type I and RUNX2-type II137. These two isoforms are differentially distributed in both space and time but also amongst different tissues and species. Both isoforms have already been described in adult bone and lung, whereas type I isoform is broadly expressed in heart, brain, skeletal muscles and spleen138,139. We characterized for the first time runx2 expression pattern on embryonic chicken lung, by in situ hybridization (Fig 8). Our results showed that runx2 mRNA is present in early stages of lung development namely, in b1, b2, and b3 stages; moreover, the expression levels were relatively low and there were no
39 major differences between stages. runx2 is expressed more evidently in the proximal epithelium, similarly to taz expression pattern, and close to bud sprouting sites. Regarding in vitro explants, 10 and 15 µM of TM-25659 treated lungs display a mild increase in runx2 expression when compared with the control. Altogether these results highlight that TAZ is being translocated into the nucleus, interacting with transcription factors and, consequently, promoting the expression of its target genes. 5.3. TAZ-induced alterations in glucose catabolism-related gene expression Glucose catabolism is thought to be the main energy source for the developing embryo and therefore for the developing lung. To verify if TAZ nuclear translocation promoted alterations in the metabolism-related gene expression, qRT-PCR was performed for certain key transporters and enzymes involved in glucose catabolism. The facilitated diffusion of sugars into cells is mediated by membrane proteins of the GLUT family (GLUT1–12 and GLUT14)140. We evaluated the expression levels of glut1 , glut3 and glut8 . glut1 ; and glut3 expression levels did not change with TM-treatment. Conversely, glut8 expression increased in a dosedependent manner, when compared to the control, and displayed a statistically significant difference for the 15 µM dose. GLUT8 is mainly an intracellular hexose transporter, however, there is conflicting evidence regarding GLUT8 localization in lysosomes (more plausible)141, endoplasmic reticulum and microsomal membranes142. Notwithstanding, a study performed in blastocysts shown its localization in the plasma membrane after insulin stimulation143. Moreover, it can move between intracellular vesicles and the plasma membrane. Altogether, data presented on the literature points to the fact that GLUT8 is a constitutively intracellular hexose transporter that may be responsible for promoting transport of sugars or sugar derivatives into or out of intracellular organelles144. GLUT8 has a ubiquitous distribution and can partially substitute GLUT4 whose expression is less widely distributed145. It is conserved in chicken and its expression is ubiquitous as well. Although glut8 expression is higher in kidneys and adipose tissue it has also been detected in the brain, adrenal, spleen, lung, testis, and pancreas. This transporter was shown to be insulin-responsive in the mammalian blastocyst, however, in rat adipose cells GLUT8 does not primarily function as an insulin-responsive transporter. In chicken, it is known to be an insulin-responsive glucose transporter146–148. 15 µM-treated explants display an increase in the expression levels of this transporter suggesting an increase in the intracellular glucose transport (since insulin is not present in the explant culture). Taking into consideration GLUT8 possible localizations, we may hypothesize that hexoses are being redistributed inside the cell to be used for biosynthetic purposes. Furthermore, developmental tissues require an intense synthesis of proteins; in this sense, intracellular glucose can be
40 used for protein glycosylation in the rough endoplasmic reticulum (RER). Concluding, intracellular hexose exchange may be supporting cellular biosynthesis, however, further studies focusing on this hypothesis are necessary. MCTs are encoded by the family of genes SLC16A, with 14 members. MCT1-4 can perform proton-linked monocarboxylate transport whereas MCT8 is known to transport thyroid hormones149. We analyzed the expression levels of mct1 , mct4 and mct8 (Fig 11). mct1 and mct4 expression levels remained constant in the lungs exposed to TAZ stimulation, without statistically significant differences compared to controls. On the other hand, mct8 expression levels are significantly higher in 15 µM-treated explants when compared to control explants. MCT8 is a specific thyroid hormone cell-membrane transporter highly expressed in adult human tissues namely, in the liver, heart, brain, placenta, kidney and lung. The widespread distribution of this transporter is crucial since thyroid hormone is essential for the regulation of developmental and metabolic processes in many tissues. MCT8 is capable of transporting both 3,3’,5-triiodothyronine (T3 or triiodothyronine) and 3’,5’,3,5 tetraiodo-L-thyronine (T4 or thyroxine)150–153. T4 is the main product of thyroid gland secretion and has low affinity for nuclear thyroid hormone receptors (TRs); contrarily, T3 has a high affinity for nuclear TRs and can be produced by the thyroid gland or in the neighboring area from T4 by target tissues and cells153. Thyroid hormones are known to stimulate the energetic metabolism especially on the muscle and liver promoting the expression of key catabolic enzymes107. MCT8 and MCT10 present a high degree of homology between them and have far less homology with the other members of the MCT family. This is mainly because MCT8 and MCT10 can transport amino acid derivatives whereas the other MCTs transport monocarboxylates. However, it has been proposed that other MCTs can also transport amino acids, and MCT8 and MCT10 can transport monocarboxylates as well151. Taking into consideration that thyroid hormones were absent from the culture medium, mct8 increase may be due to the tissue necessity of transporting other monocarboxylates and/or amino acid derivatives (since it does not transport lactate) from and to the extracellular medium. This hypothesis corroborates the high biosynthetic and energetic activities which are characteristics of growing tissues such as the developing lung. Besides glucose catabolism-related transporters, the expression levels of important enzymes were also assessed. We analyzed the expression levels of hk1 and hk2 ; pdha and pdhb ; and ldha and ldhb . The hexokinase family is composed of enzymes that irreversibly phosphorylate glucose into glucose-6phosphate, at the expenses of one molecule of ATP. The phosphorylated form of glucose is trapped within the cells and enters its glycolytic fate107. hk1 and hk2 expression levels were not affected by the TM-25659
41 treatment and, so, it is likely that the total amount of glucose for catabolic metabolism entering the cells remains constant. Pyruvate Dehydrogenase (PDH) is part of the mitochondrial pyruvate dehydrogenase complex (PDC) and uses pyruvate as its main substrate. PDC is a complex of three enzymes, pyruvate dehydrogenase (E1), dihydrolipoyl transacetylase (E2) and dihydrolipoyl dehydrogenase (E3). Pyruvate serves many destinations including the citric acid cycle after glycolysis but can be also converted into other molecules like glucose, glycerol, fatty acids, and non-essential amino acids154. PDH catalyzes the rate-limiting conversion of pyruvate into acetyl-CoA which can fuel different metabolic pathways155. Our results have shown an increase in both pdha and pdhb expression levels in a dose-dependent manner, statistically significant for the 15 µM treatment when compared with the control (Fig 13). The increase in gene expression of both pdh isoforms suggests a potential increase in the conversion of pyruvate into acetyl-CoA. Moreover, due to the irreversibility of the reaction, acetyl-CoA levels should increase and fuel other metabolic paths such as the Krebs cycle. Lactate dehydrogenase (LDH) is a tetrameric glycolytic enzyme that catalyzes the reversible conversion of pyruvate to lactate, coupled with the oxidation of NADH to NAD+. It comprises two major subunits, LDHA and LDHB which can form five different isoenzymes (LDH1, LDH2, LDH3, LDH4, and LDH5) by the different tetrameric associations between the two subunits. LDHA is the major form in skeletal muscle and presents higher affinity for pyruvate, thus converting pyruvate into lactate and producing NAD+. LDHB is found mostly in heart muscle and converts lactate into pyruvate which then can be used for mitochondria oxidation. In the adult lung, LDH3 seems to be the most abundant isoenzyme156; this isoform is composed by two LDHA subunits and two LDHB subunits and presents intermediary enzymatic affinity meaning that it converts pyruvate into lactate or lactate into pyruvate157–159. ldha and ldhb expression levels exhibit a dose-dependent statistically significant increase when compared to control; this upsurge is more evident in the 15 µM dose (Fig 14). Furthermore, ldh expression results show that ldhb expression levels are 2 orders of magnitude higher than ldha (10-1 vs 10-3), which points to LDHB as the main contributor in the embryonic lung. Taken together, these results point towards a potential metabolic shift from a glycolytic-lactate metabolic axis to the production of high amounts of pyruvate that can enter the Krebs cycle and, consequently, oxidative phosphorylation. This hypothesis is supported by the increased expression of both PDH isoforms and the fact that LDH catalyzes the interconversion between pyruvate and lactate, implying a potential pyruvate accumulation.
48 6. Conclusions and Future Perspectives Hippo signaling pathway is known to be involved in the regulation of cell growth, proliferation, survival, and organ-size control. Over the years, Hippo and other signaling pathways were deeply dissected in several morphogenesis-related processes in many organs, including the lung. However, the interplay between Hippo and developmental lung metabolism has not been described so far. In this study, we described the role of TAZ in lung branching morphogenesis metabolism. TAZ manipulation elicited extensive metabolic alterations and promoted a shift from glucose-lactate based metabolism towards a more oxidative metabolism (TCA-dependent). The alterations in the lung metabolic signature were accompanied by changes in the expression levels of key glucose catabolism-related transporters and enzymes. Briefly, glut8 may be facilitating the transport of sugars or sugar-derivatives in or out of intracellular organelles, thus contributing to biosynthetic events; moreover, it may be exporting, for instance, acetate or succinate. pdh and ldh may be contributing to pyruvate accumulation and, consequently, to a metabolic shift from glycolysis into the Krebs cycle and oxidative phosphorylation represented by acetate and succinate accumulation. Finally, the embryonic chick lung metabolome analysis revealed that lung tissue displays high levels of lactate when compared with succinate and acetate. The basal metabolite profile validates the changes observed due to TAZ manipulation that point to a metabolic rewiring towards the Krebs cycle and oxidative phosphorylation. Further studies are needed to confirm some of the proposed hypothesis, namely, metabolome analysis of TAZ-stimulated explants to complete tissue metabolic profile and characterization of LDH and PDH protein expression levels. On the other hand, it would be interesting to unravel the underlying mechanism leading to TAZ-induced branching by characterizing its specific gene expression program and determine if it has impact in both proliferation and differentiation. By fully dissecting the mechanisms controlling lung growth through metabolic pathways, we hope to unravel new therapeutic strategies that might improve the treatment of lung growth disorders characterized by a reduction in lung size, as for instance, fetal pulmonary hypoplasia.
49 7. References 1. Morrisey, E. E. & Hogan, B. L. M. Preparing for the First Breath: Genetic and Cellular Mechanisms in Lung Development. Dev. Cell 18, 8–23 (2010). 2. Mullassery, D. & Smith, N. P. Lung development. Semin. Pediatr. Surg. 24, 152–155 (2015). 3. Herriges, M. & Morrisey, E. E. Lung development: orchestrating the generation and regeneration of a complex organ. Development 141, 502–513 (2014). 4. Lin, K. C. et al. Regulation of Hippo pathway transcription factor TEAD by p38 MAPK-induced cytoplasmic translocation. Nat. Cell Biol. 19, 996–1002 (2017). 5. Potente, M. & Carmeliet, P. The Link Between Angiogenesis and Endothelial Metabolism. Annu. Rev. Physiol. 79, 43–66 (2016). 6. Kleinstreuer, C., Zhang, Z. & Donohue, J. F. Targeted Drug-Aerosol Delivery in the Human Respiratory System. Annu. Rev. Biomed. Eng. 10, 195–220 (2008). 7. Arigliani, M., Spinelli, A. M., Liguoro, I. & Cogo, P. Nutrition and lung growth. Nutrients 10, 919 (2018). 8. Nikolić, M. Z., Sun, D. & Rawlins, E. L. Human lung development: recent progress and new challenges. Development 145, dev163485 (2018). 9. Chanda, D. et al. Developmental pathways in the pathogenesis of lung fibrosis. Mol. Aspects Med. 65, 56–69 (2019). 10. Gkatzis, K., Taghizadeh, S., Huh, D., Stainier, D. Y. R. & Bellusci, S. Use of three-dimensional organoids and lung-on-a-chip methods to study lung development, regeneration and disease. Eur. Respir. J. 52, 1800876 (2018). 11. Zhou, Y. et al. Extracellular matrix in lung development, homeostasis and disease. Matrix Biol. 73, 77– 104 (2018). 12. Saito, A. & Nagase, T. Hippo and TGF-β interplay in the lung field. Am. J. Physiol. - Lung Cell. Mol. Physiol. L756–L767 (2015). 13. Fernandes-Silva, H., Correia-Pinto, J. & Moura, R. S. Canonical Sonic Hedgehog Signaling in Early Lung Development. J. Dev. Biol. 5, 3 (2017). 14. Hussain, M. et al. Wnt/β-catenin signaling links embryonic lung development and asthmatic airway remodeling. Biochim. Biophys. Acta - Mol. Basis Dis. 1863, 3226–3242 (2017). 15. Ning, J., Zhao, Y., Ye, Y. & Yu, J. Opposing roles and potential antagonistic mechanism between TGF-β and BMP pathways: Implications for cancer progression. EBioMedicine 41, 702–710 (2019). 16. Danopoulos, S., Shiosaki, J. & Al Alam, D. FGF Signaling in Lung Development and Disease: Human Versus Mouse. Front. Genet. 10, 170 (2019). 17. Nolte, C., De Kumar, B. & Krumlauf, R. Hox genes: Downstream “effectors” of retinoic acid signaling in vertebrate embryogenesis . Genesis e23306 (2019). 18. Yeung, B., Yu, J. & Yang, X. Roles of the Hippo pathway in lung development and tumorigenesis. Int. J. Cancer 138, 533–539 (2016). 19. Yang, J. & Chen, J. Developmental programs of lung epithelial progenitors: A balanced progenitor model. Wiley Interdiscip. Rev. Dev. Biol. 3, 331–347 (2014). 20. Schittny, J. C. Development of the lung. Cell Tissue Res. 367, 427–444 (2017). 21. Maina, J. N. Development, structure, and function of a novel respiratory organ, the lung-air sac system of birds: To go where no other vertebrate has gone. Biol. Rev. Camb. Philos. Soc. 81, 545–579 (2006).
50 22. Makanya, A. N. Membrane mediated development of the vertebrate blood-gas-barrier. Birth Defects Res. Part C - Embryo Today Rev. 108, 85–97 (2016). 23. Moura, R. S., Coutinho-Borges, J. P., Pacheco, A. P., daMota, P. O. & Correia-Pinto, J. FGF signaling pathway in the developing chick lung: Expression and inhibition studies. PLoS One 6, e17660 (2011). 24. Moura, R. S., Carvalho-Correia, E., DaMota, P. & Correia-Pinto, J. Canonical Wnt signaling activity in early stages of chick lung development. PLoS One 9, e112388 (2014). 25. Moura, R. S., Vaz-Cunha, P., Silva-Gonçalves, C. & Correia-Pinto, J. Characterization of miRNA processing machinery in the embryonic chick lung. Cell Tissue Res. 362, 569–575 (2015). 26. Moura, R. S., Silva-Gonçalves, C., Vaz-Cunha, P. & Correia-Pinto, J. Expression analysis of Shh signaling members in early stages of chick lung development. Histochem. Cell Biol. 146, 457–466 (2016). 27. Fernandes-Silva, H. et al. Retinoic acid regulates avian lung branching through a molecular network. Cell. Mol. Life Sci. 74, 4599–4619 (2017). 28. Deng, X. & Fang, L. VGLL4 is a transcriptional cofactor acting as a novel tumor suppressor via interacting with TEADs. Am J Cancer Res 8, 932–943 (2018). 29. Misra, J. R. & Irvine, K. D. The Hippo Signaling Network and Its Biological Functions. Annu. Rev. Genet. 52, 65–87 (2018). 30. Sharif, G. M. & Wellstein, A. Cell density regulates cancer metastasis via the Hippo pathway. Futur. Oncol. 11, 3253–3260 (2015). 31. Sun, Z. et al. FoxO6 regulates Hippo signaling and growth of the craniofacial complex. PLoS Genetics 14, e1007675 (2018). 32. Heallen, T. et al. Hippo pathway inhibits wnt signalling to restrain CM prolifeartion and hear size. Science 332, 458–461 (2011). 33. Lin, C., Yao, E., Chuang, P.T. A conserved MST1/2-YAP axis mediates Hippo signaling during lung growth HHS Public Access Author manuscript. Dev Biol 403, 101–113 (2015). 34. Mahoney, J. E., Mori, M., Szymaniak, A. D., Varelas, X. & Cardoso, W. V. The Hippo Pathway Effector Yap Controls Patterning and Differentiation of Airway Epithelial Progenitors. Dev. Cell 30, 137–150 (2014). 35. Zhao, R. et al. Yap Tunes Airway Epithelial Size and Architecture by Regulating the Identity, Maintenance, and Self-Renewal of Stem Cells. Dev. Cell 30, 151–165 (2014). 36. Lange, A. W. et al. Hippo/Yap signaling controls epithelial progenitor cell proliferation and differentiation in the embryonic and adult lung. J. Mol. Cell Biol. 7, 35–47 (2015). 37. Han, H. et al. Regulation of the Hippo Pathway by Phosphatidic Acid-Mediated Lipid-Protein Interaction. Mol. Cell 72, 328–340.e8 (2018). 38. Lin, C. et al. YAP is essential for mechanical force production and epithelial cell proliferation during lung branching morphogenesis. Elife 6, e21130 (2017). 39. Yin, F. et al. Spatial organization of hippo signaling at the plasma membrane mediated by the tumor suppressor merlin/NF2. Cell 154, 1342–1355 (2013). 40. Yi, C. et al. The p130 isoform of angiomotin is required for yap-mediated hepatic epithelial cell proliferation and tumorigenesis. Sci. Signal. 6, ra77 (2013). 41. Zhang, L. et al. NDR functions as a physiological YAP1 kinase in the intestinal epithelium. Curr. Biol. 25, 296–305 (2015). 42. Li, P. et al. αE-catenin inhibits a Src–YAP1 oncogenic module that couples tyrosine kinases and the effector of hippo signaling pathway. Genes Dev. 30, 798–811 (2016).
51 43. Mo, J. S. et al. Cellular energy stress induces AMPK-mediated regulation of YAP and the Hippo pathway. Nat. Cell Biol. 17, 500–510 (2015). 44. Panciera, T., Azzolin, L., Cordenonsi, M. & Piccolo, S. Mechanobiology of YAP and TAZ in physiology and disease. Nat. Rev. Mol. Cell Biol. 18, 758–770 (2017). 45. Totaro, A., Panciera, T. & Piccolo, S. YAP/TAZ upstream signals and downstream responses. Nat. Cell Biol. 20, 888–899 (2018). 46. Vogel, V. & Sheetz, M. Local force and geometry sensing regulate cell functions. Nat. Rev. Mol. Cell Biol. 7, 265–275 (2006). 47. Varelas, X. et al. The Hippo Pathway Regulates Wnt/β-Catenin Signaling. Dev. Cell 18, 579–591 (2010). 48. Hong, J. et al. TAZ, a Transcriptional Modulator of Mesenchymal Stem Cell Differentiation. Science 309, 1074–1078 (2005). 49. Zhang, W. et al. VGLL4 functions as a new tumor suppressor in lung cancer by negatively regulating the YAP-TEAD transcriptional complex. Cell Res. 24, 331–343 (2014). 50. Varelas, X. The Hippo pathway effectors TAZ and YAP in development, homeostasis and disease. Development 141, 1614–1626 (2014). 51. Liang, N. et al. Regulation of YAP by mTOR and autophagy reveals a therapeutic target of tuberous sclerosis complex. J. Exp. Med. 211, 2249–2263 (2014). 52. Huang, J., Wu, S., Barrera, J., Matthews, K. & Pan, D. The Hippo signaling pathway coordinately regulates cell proliferation and apoptosis by inactivating Yorkie, the Drosophila homolog of YAP. Cell 122, 421–434 (2005). 53. Zhao, B. et al. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes Dev. 21, 2747–2761 (2007). 54. Dong, J. et al. Elucidation of a Universal Size-Control Mechanism in Drosophila and Mammals. Cell 130, 1120–1133 (2007). 55. Reginensi, A. et al. Yap and Cdc42-Dependent Nephrogenesis and Morphogenesis during Mouse Kidney Development. PLoS Genet. 9, (2013). 56. Nishioka, N. et al. The Hippo Signaling Pathway Components Lats and Yap Pattern Tead4 Activity to Distinguish Mouse Trophectoderm from Inner Cell Mass. Dev. Cell 16, 398–410 (2009). 57. Hirate, Y. et al. Polarity-dependent distribution of angiomotin localizes hippo signaling in preimplantation embryos. Curr. Biol. 23, 1181–1194 (2013). 58. Maître, J. L. et al. Asymmetric division of contractile domains couples cell positioning and fate specification. Nature 536, 344–348 (2016). 59. Mo, J. S., Park, H. W. & Guan, K.L. The Hippo signaling pathway in stem cell biology and cancer. EMBO Rep. 1–15 (2014). doi:10.15252/embr.201438638 60. Lian, I. et al. The role of YAP transcription coactivator in regulating stem cell self-renewal and differentiation. Genes Dev. 24, 1106–1118 (2010). 61. Panciera, T. et al. Induction of Expandable Tissue-Specific Stem/Progenitor Cells through Transient Expression of YAP/TAZ. Cell Stem Cell 19, 725–737 (2016). 62. Wang, X. et al. YAP/TAZ Orchestrate VEGF Signaling during Developmental Angiogenesis. Dev. Cell 42, 462–478.e7 (2017). 63. Feng, X. et al. Thromboxane A2 activates YAP/TAZ protein to induce vascular smooth muscle cell proliferation and migration. J. Biol. Chem. 291, 18947–18958 (2016). 64. Wang, K. C. et al. Flow-dependent YAP/TAZ activities regulate endothelial phenotypes and atherosclerosis. Proc. Natl. Acad. Sci. 113, 11525–11530 (2016).
52 65. Moroishi, T. et al. The Hippo Pathway Kinases LATS1/2 Suppress Cancer Immunity. Cell 167, 1525– 1539.e17 (2016). 66. Yu, F. X., Zhao, B. & Guan, K. L. Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer. Cell 163, 811–828 (2015). 67. Lin, Z. & Pu, W. T. Harnessing Hippo in the heart: Hippo/Yap signaling and applications to heart regeneration and rejuvenation. Stem Cell Research 13, (2014). 68. Martin, K. et al. PAK proteins and YAP-1 signalling downstream of integrin beta-1 in myofibroblasts promote liver fibrosis. Nat. Commun. 7, 12502 (2016). 69. Zanconato, F., Cordenonsi, M. & Piccolo, S. YAP/TAZ at the Roots of Cancer. Cancer Cell 29, 783–803 (2016). 70. Yu, F. X. et al. Regulation of the Hippo-YAP pathway by G-protein-coupled receptor signaling. Cell 150, 780–791 (2012). 71. Meng, Z., Moroishi, T. & Guan, K. L. Mechanisms of Hippo pathway regulation. Genes Dev. 30, 1–17 (2016). 72. Santinon, G., Pocaterra, A. & Dupont, S. Control of YAP/TAZ Activity by Metabolic and Nutrient-Sensing Pathways. Trends Cell Biol. 26, 289–299 (2016). 73. Feng, X. et al. Hippo-independent activation of YAP by the GNAQ uveal melanoma oncogene through a Trio-regulated Rho GTPase Signaling Circuitry. Cancer Cell 25, 831–845 (2014). 74. Peng, C. et al. Regulation of the Hippo-YAP Pathway by Glucose Sensor O-GlcNAcylation. Mol. Cell 68, 591–604.e5 (2017). 75. Beyer, T. A. et al. Switch enhancers interpret TGF-β and hippo signaling to control cell fate in human embryonic stem cells. Cell Rep. 5, 1611–1624 (2013). 76. Manderfield, L. J. et al. Hippo signaling is required for Notch-dependent smooth muscle differentiation of neural crest. Development 142, 2962–2971 (2015). 77. Hubaud, A. & Pourquié, O. Signalling dynamics in vertebrate segmentation. Nat. Rev. Mol. Cell Biol. 15, 709–721 (2014). 78. Park, D. Y. et al. YAP/TAZ regulates sprouting angiogenesis and vascular barrier maturation. J. Clin. Invest. 127, 3441–3461 (2017). 79. Wang, W. et al. AMPK modulates Hippo pathway activity to regulate energy homeostasis. Nat. Cell Biol. 17, 490–499 (2015). 80. Straßburger, K., Tiebe, M., Pinna, F., Breuhahn, K. & Teleman, A. A. Insulin/IGF signaling drives cell proliferation in part via Yorkie/YAP. Dev. Biol. 367, 187–196 (2012). 81. deRan, M. et al. Energy stress regulates Hippo-YAP signaling involving AMPK-mediated regulation of angiomotin-like 1 protein. Cell Rep. 9, 495–503 (2014). 82. Zhang, X. et al. The essential role of YAP O-GlcNAcylation in high-glucose-stimulated liver tumorigenesis. Nat. Commun. 8, 15280 (2017). 83. Enzo, E. et al. Aerobic glycolysis tunes YAP/TAZ transcriptional activity. EMBO J. 34, 1349–1370 (2015). 84. Artinian, N. et al. Phosphorylation of the Hippo pathway component AMOTL2 by the mTORC2 kinase promotes YAP signaling, resulting in enhanced glioblastoma growth and invasiveness. J. Biol. Chem. 290, 19387– 19401 (2015). 85. Sciarretta, S. et al. MTORC2 regulates cardiac response to stress by inhibiting MST1. Cell Rep. 11, 125– 136 (2015).
53 86. Hu, J. K. H. et al. An FAK-YAP-mTOR Signaling Axis Regulates Stem Cell-Based Tissue Renewal in Mice. Cell Stem Cell 21, 91–106.e6 (2017). 87. Wang, L. et al. GCN5L1 modulates cross-talk between mitochondria and cell signaling to regulate FoxO1 stability and gluconeogenesis. Nat. Commun. 8, 523 (2017). 88. Singh, S., Simpson, R. L. & Bennett, R. G. Relaxin activates peroxisome proliferator-activated receptor γ (PPAR γ) through a pathway involving PPAR γ coactivator 1α (PGC1α). J. Biol. Chem. 290, 950–959 (2015). 89. Yu, F. X. et al. Protein kinase A activates the Hippo pathway to modulate cell proliferation and differentiation. Genes Dev. 27, 1223–1232 (2013). 90. Hu, Y. et al. YAP suppresses gluconeogenic gene expression through PGC1α. Hepatology 66, 2029–2041 (2017). 91. Sorrentino, G. et al. Metabolic control of YAP and TAZ by the mevalonate pathway. Nat. Cell Biol. 16, 357– 366 (2014). 92. Wang, Z. et al. Interplay of mevalonate and Hippo pathways regulates RHAMM transcription via YAP to modulate breast cancer cell motility. Proc. Natl. Acad. Sci. 111, E89–E98 (2014). 93. Deng, Y., Matsui, Y., Pan, W., Li, Q. & Lai, Z. C. Yap1 plays a protective role in suppressing free fatty acidinduced apoptosis and promoting beta-cell survival. Protein Cell 7, 362–372 (2016). 94. Chan, P. et al. Autopalmitoylation of TEAD proteins regulates transcriptional output of the Hippo pathway. Nat. Chem. Biol. 12, 282–289 (2016). 95. Li, T. & Le, A. Glutamine Metabolism in Cancer. in (ed. Anne Le) 1063, 13–32 (Springer International Publishing, 2018). 96. Cluntun, A. A., Lukey, M. J., Cerione, R. A. & Locasale, J. W. Glutamine Metabolism in Cancer: Understanding the Heterogeneity. Trends in Cancer 3, 169–180 (2017). 97. Cox, A. G. et al. Yap reprograms glutamine metabolism to increase nucleotide biosynthesis and enable liver growth. Nat. Cell Biol. 18, 886–896 (2016). 98. Bertero, T. et al. Vascular stiffness mechanoactivates YAP/ TAZ-dependent glutaminolysis to drive pulmonary hypertension. J. Clin. Invest. 126, 3313–3335 (2016). 99. Morin-Kensicki, E. M. et al. Defects in Yolk Sac Vasculogenesis, Chorioallantoic Fusion, and Embryonic Axis Elongation in Mice with Targeted Disruption of Yap65. Mol. Cell. Biol. 26, 77–87 (2005). 100. Makita, R. et al. Multiple renal cysts, urinary concentration defects, and pulmonary emphysematous changes in mice lacking TAZ. Am. J. Physiol. Physiol. 294, F542–F553 (2008). 101. Mitani, A. et al. Transcriptional coactivator with PDZ-binding motif is essential for normal alveolarization in mice. Am. J. Respir. Crit. Care Med. 180, 326–338 (2009). 102. Danopoulos, S. et al. Human lung branching morphogenesis is orchestrated by the spatiotemporal distribution of ACTA2, SOX2, and SOX9. Am. J. Physiol. Cell. Mol. Physiol. 314, L144–L149 (2017). 103. Mao, Y. et al. Characterization of a Dchs1 mutant mouse reveals requirements for Dchs1-Fat4 signaling during mammalian development. Development 138, 947–957 (2011). 104. Chung, C. et al. Hippo-Foxa2 signaling pathway plays a role in peripheral lung maturation and surfactant homeostasis. Proc. Natl. Acad. Sci. 110, 7732–7737 (2013). 105. Warburg, O. On the origin of cancer cells. Science 123, 309–314 (1956). 106. Akram, M. Mini-review on glycolysis and cancer. J. Cancer Educ. 28, 454–457 (2013). 107. Cox, M. M. & Nelson, D. L. Lehninger’s Principles of Biochemistry (2008).
54 108. Agathocleous, M. & Harris, W. A. Metabolism in physiological cell proliferation and differentiation. Trends Cell Biol. 23, 484–492 (2013). 109. Bulusu, V. et al. Spatiotemporal Analysis of a Glycolytic Activity Gradient Linked to Mouse Embryo Mesoderm Development. Dev. Cell 40, 331–341.e4 (2017). 110. Oginuma, M. et al. A Gradient of Glycolytic Activity Coordinates FGF and Wnt Signaling during Elongation of the Body Axis in Amniote Embryos. Dev. Cell 40, 342–353.e10 (2017). 111. Carraro, G., del Moral, P.M. & Warburton, D. Mouse Embryonic Lung Culture, A System to Evaluate the Molecular Mechanisms of Branching. J. Vis. Exp. 40, e2035 (2010). 112. Moral, P. & Warburton, D. Mouse Cell Culture. 633, 71–79 (2010). 113. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254 (1976). 114. Ku, H. K. et al. Interpretation of protein quantitation using the Bradford assay: Comparison with two calculation models. Anal. Biochem. 434, 178–180 (2013). 115. Yang, P.-C. & Mahmood, T. Western blot: Technique, theory, and trouble shooting. N. Am. J. Med. Sci. 4, 429 (2012). 116. Taylor, S. C. & Posch, A. The Design of a Quantitative Western Blot Experiment. Biomed Res. Int. 2014, 361590 (2014). 117. Nowakowski, A. B., Wobig, W. J. & Petering, D. H. Native SDS-PAGE: High resolution electrophoretic separation of proteins with retention of native properties including bound metal ions. Metallomics 6, 1068–1078 (2014). 118. Brunelle, J. L. & Green, R. One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE). Methods in Enzymology 541, (Elsevier Inc., 2014). 119. Luk, P. P. et al. Clinical Utility of In Situ Hybridization Assays in Head and Neck Neoplasms. Head Neck Pathol. 1-18 (2018). 120. Volpi, C. C. et al. Bright-field in situ hybridization detects gene alterations and viral infections useful for personalized management of cancer patients. Expert Rev. Mol. Diagn. 18, 259–277 (2018). 121. Holleville, N., Matéos, S., Bontoux, M., Bollerot, K. & Monsoro-Burq, A. H. Dlx5 drives Runx2 expression and osteogenic differentiation in developing cranial suture mesenchyme. Developmental Biology 304, 860–874 (2007). 122. Green, M. & Sambrook, J. Molecular Cloning, a laboratory manual. 1, (John Inglis, 2012). 123. Henrique, D. et al. Expression of a Delta homologue in prospective neurons in the chick. Nature 375, 787–790 (1995). 124. Klein, D. Quantification using real-time PCR technology: applications and limitations. Trends Mol. Med. 8, 257–60 (2002). 125. Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45 (2001). 126. Mussap, M., Zaffanello, M. & Fanos, V. Metabolomics: A challenge for detecting and monitoring inborn errors of metabolism. Biochim. Clin. 43, 14–23 (2019). 127. Gagnebin, Y., Boccard, J., Ponte, B. & Rudaz, S. Metabolomics in chronic kidney disease: Strategies for extended metabolome coverage. J. Pharm. Biomed. Anal. 161, 313–325 (2018). 128. Alves, M. G., Oliveira, P. F., Martins, F. O., Oliveira, P. J. & Carvalho, R. A. Gender-dependent metabolic remodeling during heart preservation in cardioplegic celsior and histidine buffer solution. J. Cardiovasc. Pharmacol. 59, 151–157 (2012).
55 129. Jang, E. J. et al. TM-25659 enhances osteogenic differentiation and suppresses adipogenic differentiation by modulating the transcriptional co-activator TAZ. Br. J. Pharmacol. 165, 1584–1594 (2012). 130. San Martin, I. A. et al. Impaired cell cycle regulation of the osteoblast-related heterodimeric transcription factor Runx2-Cbfβ in osteosarcoma cells. in Journal of Cellular Physiology 221, 560–571 (2009). 131. Zhu, Y. et al. Pharmacological activation of TAZ enhances osteogenic differentiation and bone formation of adipose-derived stem cells. Stem Cell Res. Ther. 9, 53 (2018). 132. Nishio, M. et al. The Hippo Signaling Pathway: A Candidate New Drug Target for Malignant Tumors. in Innovative Medicine (eds. Nakao, K., Minato, N. & Uemoto, S.) 79–94 (Springer, 2015). 133. Yuan, T., Volckaert, T., Chanda, D., Thannickal, V. J. & De Langhe, S. P. Fgf10 Signaling in Lung Development, Homeostasis, Disease, and Repair After Injury. Front. Genet. 9, 418 (2018). 134. Yin, Y. et al. An FGF-WNT gene regulatory network controls lung mesenchyme development. Dev. Biol. 319, 426–436 (2008). 135. Volckaert, T. et al. Fgf10-Hippo Epithelial-Mesenchymal Crosstalk Maintains and Recruits Lung Basal Stem Cells. Dev. Cell 43, 48–59.e5 (2017). 136. Maruyama, Z. et al. Runx2 determines bone maturity and turnover rate in postnatal bone development and is involved in bone loss in estrogen deficiency. Dev. Dyn. 236, 1876–1890 (2007). 137. Yoshida, C. A. et al. Runx2 and Runx3 are essential for chondrocyte maturation, and Runx2 regulates limb growth through induction of Indian hedgehog. Genes Dev. 18, 952–963 (2004). 138. Qin, X., Jiang, Q., Miyazaki, T. & Komori, T. Runx2 regulates cranial suture closure by inducing hedgehog, Fgf, Wnt and Pthlh signaling pathway gene expressions in suture mesenchymal cells. Hum. Mol. Genet. 28, 896– 911 (2018). 139. Li, Y. Lin & Xiao, Z. Sheng. Advances in Runx2 regulation and its isoforms. Med. Hypotheses 68, 169– 175 (2006). 140. Xiao, Z. S., Simpson, L. G. & Quarles, L. D. IRES-dependent translational control of Cbfa1/Runx2 expression. J. Cell. Biochem. 88, 493–505 (2003). 141. Herreño, A. M. et al. Role of RUNX2 transcription factor in epithelial mesenchymal transition in non-small cell lung cancer lung cancer: Epigenetic control of the RUNX2 P1 promoter. Tumor Biol. 41, 101042831985101 (2019). 142. Scheepers, A., Joost, H. G. & Schürmann, A. The glucose transporter families SGLT and GLUT: Molecular basis of normal and aberrant function. J. Parenter. Enter. Nutr. 28, 364–371 (2004). 143. Augustin, R., Riley, J. & Moley, K. H. GLUT8 contains [DE]XXXL[LI] sorting motif and localizes to a late endomosal/lysosomal compartment. Traffic 6, 1196–1212 (2005). 144. Piroli, G. G. et al. Peripheral glucose administration stimulates the translocation of GLUT8 glucose transporter to the endoplasmic reticulum in the rat hippocampus. J. Comp. Neurol. 452, 103–114 (2002). 145. Carayannopoulos, M. O. et al. GLUT8 is a glucose transporter responsible for insulin-stimulated glucose uptake in the blastocyst. Proc. Natl. Acad. Sci. 97, 7313–7318 (2002). 146. Schmidt, S., Joost, H.-G. & Schürmann, A. GLUT8, the enigmatic intracellular hexose transporter. Am. J. Physiol. Metab. 296, E614–E618 (2009). 147. Doege, H., Schürmann, A., Bahrenberg, G., Brauers, A. & Joost, H. G. GLUT8, a novel member of the sugar transport facilitator family with glucose transport activity. J. Biol. Chem. 275, 16275–16280 (2000). 148. Byers, M. S., Howard, C. & Wang, X. Avian and Mammalian Facilitative Glucose Transporters. Microarrays 6, 7 (2017).
56 149. Kono, T. et al. Characterisation of glucose transporter (GLUT) gene expression in broiler chickens. Br. Poult. Sci. 46, 510–515 (2005). 150. Seki, Y., Sato, K., Kono, T., Abe, H. & Akiba, Y. Broiler chickens (Ross strain) lack insulin-responsive glucose transporter GLUT4 and have GLUT8 cDNA. Gen. Comp. Endocrinol. 133, 80–87 (2003). 151. Halestrap, A. P. The monocarboxylate transporter family-Structure and functional characterization. IUBMB Life 64, 1–9 (2012). 152. Lafrenière, R. G., Carrel, L. & Willard, H. F. A novel transmembrane transporter encoded by the XPCT gene in xq13.2. Hum. Mol. Genet. 3, 1133–1139 (1994). 153. Friesema, E. C. H. et al. Identification of monocarboxylate transporter 8 as a specific thyroid hormone transporter. J. Biol. Chem. 278, 40128–40135 (2003). 154. Vancamp, P. & Darras, V. M. From zebrafish to human: A comparative approach to elucidate the role of the thyroid hormone transporter MCT8 during brain development. Gen. Comp. Endocrinol. 265, 219–229 (2018). 155. Stepien, B. K. & Huttner, W. B. Transport, Metabolism, and Function of Thyroid Hormones in the Developing Mammalian Brain. Front. Endocrinol. (Lausanne). 10, 209 (2019). 156. Park, S. et al. Role of the pyruvate dehydrogenase complex in metabolic remodeling: Differential pyruvate dehydrogenase complex functions in metabolism. Diabetes Metab. J. 42, 270–281 (2018). 157. Golias, T., Kery, M., Radenkovic, S. & Papandreou, I. Microenvironmental control of glucose metabolism in tumors by regulation of pyruvate dehydrogenase. Int. J. Cancer 144, 674–686 (2019). 158. Drent, M., Cobben, N. A. M., Henderson, R. F., Wouters, E. F. M. & Van Dieijen-Visser, M. Usefulness of lactate dehydrogenase and its isoenzymes as indicators of lung damage or inflammation. Eur. Respir. J. 9, 1736– 1742 (1996). 159. Ding, J., Karp, J. E. & Emadi, A. Elevated lactate dehydrogenase (LDH) can be a marker of immune suppression in cancer: Interplay between hematologic and solid neoplastic clones and their microenvironments. Cancer Biomarkers 19, 353–363 (2017). 160. Feng, Y. et al. Lactate dehydrogenase A: A key player in carcinogenesis and potential target in cancer therapy. Cancer Med. 7, 6124–6136 (2018). 161. Porporato, P. E., Dhup, S., Dadhich, R. K., Copetti, T. & Sonveaux, P. Anticancer targets in the glycolytic metabolism of tumors: A comprehensive review. Front. Pharmacol. 2, 49 (2011). 162. Tielens, A. G. M., van Grinsven, K. W. A., Henze, K., van Hellemond, J. J. & Martin, W. Acetate formation in the energy metabolism of parasitic helminths and protists. Int. J. Parasitol. 40, 387–397 (2010). 163. Cho, E. H. Succinate as a regulator of hepatic stellate cells in liver fibrosis. Front. Endocrinol. (Lausanne). 9, 455 (2018). 164. Murphy, M. P. & O’Neill, L. A. J. Krebs Cycle Reimagined: The Emerging Roles of Succinate and Itaconate as Signal Transducers. Cell 174, 780–784 (2018). 165. Brosnan, J. T. & Brosnan, M. E. Glutamate: A truly functional amino acid. Amino Acids 45, 413–418 (2013). 166. Adeva-Andany, M. et al. Insulin resistance and glycine metabolism in humans. Amino Acids 50, 11–27 (2018). 167. Gorzalczany, Y. & Sagi-eisenberg, R. Role of Mast Cell-Derived Adenosine in Cancer. 20, 2603 (2019). 168. Tierney, D. F. Lung Metabolism and Biochemistry. Annu. Rev. Physiol. 36, 209–231 (2003). 169. Orang, A. V., Petersen, J., McKinnon, R. A. & Michael, M. Z. Micromanaging aerobic respiration and glycolysis in cancer cells. Mol. Metab. 23, 98–126 (2019).
57 170. Pietzke, M. et al. Stratification of cancer and diabetes based on circulating levels of formate and glucose. Cancer Metab. 7, 3 (2019). 171. Lambert, I. H., Kristensen, D. M., Holm, J. B. & Mortensen, O. H. Physiological role of taurine--from organism to organelle. Acta Physiol. (Oxf). 213, 191–212 (2015). 172. Jansen, S. M. et al. Biosynthesis of Phosphatidylcholine from a Phosphocholine Precursor Pool Derived from the Late Endosomal/Lysosomal Degradation of Sphingomyelin. J. Biol. Chem. 276, 18722–18727 (2001). 173. Almeida, F. M. et al. Creatine supplementation attenuates pulmonary and systemic effects of lung ischemia and reperfusion injury. J. Hear. Lung Transplant. 35, 242–250 (2016).